University of Southern California Dissertations and Theses

PTEN loss antagonizes aging through promoting regeneration and prevents oxidative stress induced cell death

(USC Thesis Other)

PTEN loss antagonizes aging through promoting regeneration and prevents oxidative stress induced cell death

PDF

Download a page range

Download transcript

Copy asset link

Request this asset

Transcript (if available)

Content

PTEN LOSS ANTAGONIZES AGING THROUGH PROMOTING
REGENERATION AND PREVENTS OXIDATIVE STRESS INDUCED
CELL DEATH

By

Ni Zeng

A Dissertation Presented to the
FACULTY OF THE USC GRADUATE SCHOOL
UNIVERSITY OF SOUTHERN CALIFORNIA
In Partial Fulfillment of the Requirements for the Degree
DOCTOR OF PHILOSOPHY
(MOLECULAR PHARMACOLOGY AND TOXICOLOGY)

December 2012

Copyright 2012 Ni Zeng

ii
Dedication

To my family

iii
Acknowledgements

First of all, I would like to thank my advisor, Dr. Bangyan Stiles, for her
constant support and guidance during my study at USC. She has set up an
outstanding example of scientist for me to follow. She always encourages me to
do my best and to pursue perfection. The confidence, the passion for science and
the dedication to work I learned from her will benefit my whole life.
My sincere thanks go to my dissertation committee members, Dr. Deborah
Johnson and Dr. Curtis Okamoto for their academic advise and support. They
have been offering me tremendous help in developing my research project and
editing this thesis. Their expertise and visions for science have greatly advanced
my research training. I also would like to thank Dr. Roger Duncan for the scientific
discussion and questions that have inspired me during my study.
Special thanks are conveyed to all of the past and current members in the
Stiles Lab, Dr. Lina He, Dr. Xiaogang Hou, Dr. Vivian Medina, Dr. Jennifer-Ann
Bayan, Yang Li, Kai-Ting Yang, Anketse Kassa, Zhechu Peng, and Richa
Aggarwal for their technical support and helpful discussion. They also made my
life at USC more enjoyable and memorable.
I would like to thank Dr. Beth Palian, Danny Abad and Dr. Ismail Al-Abdullah
for providing experimental materials. I also want to thank Trung Ky, Jamie

iv
Gubbins, Joseph Stiles and Rima Deshpande for their technical assistance.
My most heartfelt acknowledgement must go to my parents and my sister.
Without their unconditional love, support and encouragement, I would not have
made it this far.

v
Table of Contents

Dedication ………………………………………………………………………. ii
Acknowledgements ……………………………………………………………. iii
List of Tables …………………………………………………………………… viii
List of Figures ………………………………………………………………….. ix
Abstract …………………………………………………………………………. xi
Chapter I:
Overviews of aging, insulin-like signaling, PI3K/AKT and PTEN pathway

1
I-1 Theories of aging …………………………………………………..……….. 1
I-2 Lifespan and insulin like signaling ……………………………………..…. 5
I-3 PI3K/AKT pathway and PTEN ……………………………………..……… 6
I-4 Roles of IGF-1/PI3K/AKT and PTEN in diseases and regeneration ….. 9
I-5 Rationale of the study ……………..……………………………………….. 11
Chapter II:
PTEN controls beta cell regeneration and aging through regulating the
cell cycle inhibitor p16
Ink4a

14
II-1 Introduction and Rationale ………………………..………………………. 14
II-2 Results ……………………………..……………………………………….. 18
II-2-1 Pten deletion enhances proliferation and cell cycle progression …... 18

vi
II-2-1-1 Pten null mice exhibit increased islet mass and hypoglycemia
without detectable aberrance in the distribution of islet endocrine cells
18
II-2-1-2 Pten deletion increases beta cell proliferation in adult mice …. 20
II-2-1-3 Pten deletion leads to more cell cycle reentries and shortening
of the replication refractory period

22
II-2-2 PTEN loss rescues the aging phenotypes of beta cells ………..…… 28
II-2-2-1 Pten deletion overcomes aging-induced proliferation decline ... 28
II-2-2-2 PTEN loss rescues age-induced regeneration restriction …….. 35
II-2-3 PTEN regulates beta cell aging through modulating the cyclinD-
Ezh2-p16 axis
38
II-2-3-1 PTEN controls p16 regulated aging signals ……………………. 38
II-2-3-2 The downregulation of p16 in Pten null islets can be
recapitulated in vitro and is independent of the developmental effects

42
II-2-3-3 Downregulation of p16 in Pten null cells is mediated through
histone trimethylation of the Ink/Arf locus in an Ezh2 dependent
manner
48
II-2-3-4 Cyclin D1 regulates Ezh2 and thus p16 through E2Fs ……….. 52
II-3 Discussion ………………………..………………………………………… 58
Chapter III:
Pten deletion prevents oxidative stress induced cell death in
hepatocytes

64
III-1 Introduction and rationale ………………………………………..……… 64
III-2 Results ……………………………………..……………………………… 67

vii
III-2-1 Deletion of Pten in hepatocytes results in high oxidative stress …… 67
III-2-2 Resistance of Pten null hepatocytes to cellular stress ……………… 71
III-2-3 Enhanced basal eIF2α phosphorylation in Pten deficient cells ……. 78
III-2-4 PI3K/AKT signaling regulates the phosphorylation of eIF2α ………. 83
III-2-5 CReP downregulation mediates the hyper phosphorylation of eIF2α in
Pten null cells

87
III-3 Discussion …………………………………………………..…………….. 92
Chapter IV:
Overall discussion ……………………………………………………..…….. 97
Chapter V:
Materials and Methods …………………………………………………..…. 105
Bibliography ……………………………………………..…………………… 117

viii
List of Tables

Table 1. Primers used for qPCR analysis for mouse genes 112
Table 2. Primers used for qPCR analysis for human genes 112
Table 3. Primers used for ChIP assay 114

ix
List of Figures

Figure 1. Pten deletion increases islet mass and blood glucose levels.

19
Figure 2. PTEN controls beta cell mitotic activity in adults.

21
Figure 3. PTEN loss allows cells to escape cell cycle arrest after cell
division.

23
Figure 4. Deletion of Pten shortens the “replication refractory” period of
beta cells.

27
Figure 5. PTEN loss restores age-induced decline of beta cell
proliferation in aged mice.

30
Figure 6. Pten deletion increases islet mass.

32
Figure 7. Fasting plasma glucose levels are maintained at low levels in
both young (1.5 months) and old (9 months) Pten null mice.

34
Figure 8. PTEN loss restores the proliferation potential of aged beta cells.

36
Figure 9. Pten deletion leads to upregualtion of cyclin D1 and
downregulation of p16 as well as p27.

40
Figure 10. PTEN regulates expression of p16 in vitro.

44
Figure 11. Induced loss of PTEN in adult beta cells (9 months of age)
results in downregulation of p16.

47
Figure 12. PTEN regulates methylation of the Ink4/Arf locus through
modulating the expression levels of Ezh2.

50
Figure 13. E2Fs regulate Ezh2 promoter activity and inhibition of p16 in
Pten null cells.

53
Figure 14. PTEN regulates p16 through cyclin D1.

57

x
Figure 15. Working model.

63
Figure 16. High oxidative stress conditions in Pten null liver.

69
Figure 17. Characterization of Con and Pten null hepatocyte lines.

73
Figure 18. Improved survival and decreased cell death in Pten null
hepatocytes when exposed to oxidative stress.

76
Figure 19. Elevated phosphorylation of eIF2α in PTEN deficient
hepatocytes and livers.

79
Figure 20. PTEN regulates eIF2α phosphorylation independent of ER
stress.

82
Figure 21. PI3K/AKT signal regulates eIF2α phosphorylation.

85
Figure 22. CReP is down-regulated in Pten null hepatocytes. 90

xi
Abstract

PTEN is a dual lipid and protein phosphatase that antagonizes the PI3K/AKT
signaling cascade and controls multi cellular activities including proliferation,
survival and metabolism. Here, I studied its role in aging regulation through
investigating how it controls two aging-related processes: tissue regeneration and
oxidative stress in two types of cells: pancreatic beta cells and liver hepatocytes.
Beta cells undergo a significant aging process with declined proliferation and
restricted regeneration as the major phenotypes. I hypothesized that this aging
process is controlled by IGF-1, the level of which also declines dramatically with
advanced aging. To test that, I selectively deleted Pten in beta cells to activate the
IGF-1 signaling. Indeed, Pten deletion not only significantly increases islet
proliferation, but also restores the regenerative potential of aged beta cells,
confirming the critical role of PTEN in controlling aging. I further demonstrated
that such pro-proliferation and anti-aging effects of PTEN are mediated through
the cyclinD1/E2F/ Ezh2/p16
Ink4a
signaling axis.
In addition, I also studied how PTEN regulates oxidative stress response
using the liver deletion mouse model. PTEN loss in liver leads to fatty liver early
and liver cancer later in life. I found that Pten null hepatocytes are resistant to
oxidative stress induced by fatty liver development. Analysis of the molecular

xii
mechanism suggested that phosphorylation of the stress responder eIF2α and
downregulation of the eIF2α phosphatase CReP are the downstream events of
Pten deletion that contribute to the stress resistance.
Together, I showed that PTEN is an important regulator of both regeneration
and oxidative stress response during the aging process. Studies of the molecular
mechanisms and downstream pathways of PTEN in different tissue context might
provide critical insights into how to balance regeneration and oxidative stress to
achieve better life quality in the aged individuals.

1
Chapter I
Overviews of aging, insulin-like signaling, PI3K/AKT and PTEN pathway

I-1 Theories of aging
Aging is a complicated biological process that has attracted tremendous
attentions in scientific research. With the aim of extending the life span and
improving the quality of life, efforts have been focused on understanding how we
age and what mechanism controls aging. Studies in recent years have indicated
that aging is regulated by multidimensional factors at different biological levels
(Weinert and Timiras, 2003). Based on these studies, various theories have been
proposed to address the mechanism of aging, and they can be categorized as
systemic, cellular and molecular theories. The systemic theory suggests that
aging is associated with alterations in the regulatory systems that control and
coordinate the normal functions of all other systems (Finch, 1976). Neural and
endocrine systems, for instance, play a major role in maintaining the homeostasis
of the peripheral tissues. During the aging process, degeneration of the neural
system and declined production of circulating hormones result in dysregulated
activities of the targeted tissues and thus physiological changes in the aged
individuals. In human, levels of circulating growth hormone (GH) produced from
the pituitary decrease significantly with age. The declining function of GH has
2
been linked with many aging-related phenotypes such as wrinkle skin, decreased
muscle and bone mass, as well as increased risks of cardiovascular diseases,
and GH administration to older persons alleviates these syndromes (Corpas et al.,
1993), suggesting that GH is critical for the aging process. Another hormone
correlated with aging is insulin like growth factor-1 (IGF-1) (Bartke, 2011).
Levels of IGF-1 decline with age, and its production from the liver is regulated by
growth hormone (GH). Thus, GH produced by the pituitary gland may function as
the central neural system regulator that controls aging partly through regulation of
IGF-1 production from the liver, forming the neuronal-systemic regulatory circuitry.
At the cellular level, the aging theories concern a broad range of cellular
activities, including declined stem cell regeneration, cell senescence-telomere
shortening, and reactive oxygen species (ROS) accumulation. 1) Under normal
circumstances, tissue stem cells are needed for tissue homeostasis. Stem cells
undergo cell division and differentiation to replenish physiological loss of somatic
cells such as those occurring in the skin and hematopoietic tissues. They are also
needed to repair tissues when division of somatic cells is not sufficient in severe
injuries. During the aging process, however, stem cells gradually lose their
self-renew ability and thus can no longer compensate for the increased demand
of tissue replenishment, leading to the aging phenotypes (Geiger and Van Zant,
2002). 2) The cell senescence-telomere theory suggests that aging is caused by
3
the increased incidence of cell senescence following cell divisions. Senescence
refers to a status under which cells are prevented from entering further division
and was initially defined in primary cells cultured in vitro. After a limited number of
cell divisions on plastic dishes, normal primary cells undergo a series of changes
and exhibit distinct phenotypes such as flatten shape and resistance to either
mitogen-induced cell growth or apoptotic cell death, a process termed replicative
senescence (Blackburn, 2000). Recently it was suggested that senescence also
happens in the in vivo conditions, especially in aged cells (Campisi, 2005). In
cultured cells, a small piece of DNA termed telomere is lost at the chromatin end
after each cell division. In vivo, shortened telomere is observed in cells isolated
from old vs. young individuals. The gradual loss of telomere with age (and after
each cell division) leads to the inability of the DNA to duplicate. This shortening of
telomere is proposed to underlie replicative senescence observed with culturing
of primary cells. 3) In addition to stem cell restriction and senescence,
ROS-induced oxidative damage also plays a vital role in aging. Levels of
endogenous ROS are critical for modulating various cellular activities, including
cell growth, signaling transduction and gene expression (Finkel and Holbrook,
2000). However, high levels of ROS can damage intracellular macromolecules
like lipids, proteins, and DNAs through oxidative adducts (Harman, 1956). In
young individuals, levels of ROS in the tissues are kept at low levels by the
4
actions of antioxidant defense systems that include superoxide dismutase (SOD),
catalase and glutathione peroxidase. In aged individuals, the balance between
ROS production and depletion is disrupted, thus causing increased ROS in aged
individuals. The lack of normal anti-oxidant response to oxidative stress buildup
and the deficiency to repair DNA damage during chronic ROS exposure then
result in genomic instability, inability for cell renewal, and eventually cell death.
The molecular mechanism that controls aging has been under extensive study.
Using primarily the replicative senescence model, genes encoded by the Ink/Arf
locus have been proposed to play major roles in aging (Kim and Sharpless, 2006).
So far three genes have been identified on the Ink/Arf locus: p15
Ink4b
, p16
Ink4a
, and
p19
Arf
. p16
Ink4a
, and p19
Arf
are generated through alternative splicing and share
the second and third exons. p15
Ink4b
lies in the upstream of p16
Ink4a
, and its DNA
sequence is very similar to that of p16
Ink4a
. Both p15
Ink4b
and p16
Ink4a
are cell cycle
inhibitors that antagonize cell cycle progression through interacting with CDK4/6
and thus preventing their binding to cyclin Ds. During culturing of primary cells,
levels of p16
Ink4a
increase with cell passaging and become significantly higher
when cells undergo senescence. Downregulation of p16 extends the replicative
lifespan of the cultured normal cells, while overexpression of p16 results in cell
growth arrest with senescent phenotypes (Collins and Sedivy, 2003). Thus, the
accumulation of p16 expression, which leads to suppression of CDK4/6 activity, is
5
proposed to underlie the inability of cells to divide when they enter replication
senescence in vitro. Whether and how increased p16 may cause telomere
shortening, a process regulated by an enzyme called telomerase, is unknown. In
vivo, the expression of p16 is maintained at an extremely low level in growing
tissues in young individuals. Increased levels of p16 have been observed in
multiple tissues when individuals age (Krishnamurthy et al., 2004). In murine
models, deletion of p16 rescues the aging phenomenon of several cell types
including hematopoietic stem cells (HSCs), neural progenitors as well as
pancreatic beta cells (Janzen et al., 2006; Krishnamurthy et al., 2006; Molofsky et
al., 2006), suggesting that p16 indeed plays a vital role in regulating aging.

I-2 Lifespan and insulin like signaling
Lifespan is an important parameter for aging. Treatments or factors that alter
lifespan may also be critical in regulating the aging process. It should be noted,
however, that lifespan and aging are not interchangeable. Lifespan measures the
total length of time an organism lives for, while aging emphasizes on the
accumulating changes of an organism over time. Nevertheless, lifespan is closely
related to aging and lifespan studies have provided substantial cues for identifying
aging related factors and mechanisms.

6
One of the most exciting findings of lifespan studies is the identification of the
insulin/IGF-1 signaling as an important effector on longevity. C elegans harboring
mutations in daf-2 (Insulin/IGF-1 receptor) live significantly longer than their wild
type controls (Kenyon et al., 1993). Similarly, mutations in the Drosophila
homologues of insulin receptor also extend the fly lifespan dramatically (Kawano
et al., 2000). However, these mutant organisms display growth arrest phenotypes.
C. elegans undergo a define life cycle that include embryo, larva (L1-L4, or Dauer),
and adult. Mutation of Insulin/IGF-1 receptor in worms arrests their lifecycle at the
Dauer larva stage. Recently, studies using mouse models showed that genetic
manipulation of the IGF-1 receptor also affects the lifespan of the mouse as well
as their response to aging-induced stresses, confirming the potential role of
insulin/IGF-1 signaling in vertebrate aging (Bokov et al., 2011). These data
collected from C. elegans and Drosophila and more recently mouse models,
reinforced the idea that aging (and lifespan) is critically linked with the ability of
cells to growth and divide. However, cell growth and division also needs to be
balanced to prevent over-proliferative diseases such as cancer that also occurs
frequently in aged individuals.

I-3 PI3K/AKT pathway and PTEN
The signaling pathway downstream of IGF-1/insulin is conserved from C.
7
elegans and Drosophila. In mammalian cells, PI3K and AKT, which serve as the
major downstream targets of IGF-1, are characterized as master regulators that
control cell proliferation, survival and stress response.
PI3K is a heterodimer composed of a regulatory subunit and a catalytic
subunit. Various isoforms of the regulatory subunit (p55, p85α, and p85β) and
catalytic subunits (p110α, p110β, p110γ, and p110δ) have been identified. They
are expressed in multiple cell types and mediate a broad range of signal
transduction (Katso et al., 2001). Without stimulation, p85 binds to p110 and
inhibits the catalytic activity of p110. Upon addition of growth factors, growth
factor receptors are phosphorylated at the Tyr residues. The p85-p110 complex is
then recruited to the receptor through the interaction between the SH2 domain of
p85 and the phospho-Tyr on the receptor. Such interaction alleviates the inhibition
of p110 and thus leads to the activation of PI3K. The activated PI3K then
phosphorylates the phospholipid phosphatidylinositol 4,5-bisphosphate (PIP2) to
generate phosphatidylinositol 3,4,5-trisphosphate (PIP3), which provides the
docking site for AKT, a protein that contains a structure known as pleckstrin
homolog (PH) domain. Binding of PIP3 to AKT allows AKT to come to the
membrane, where it can interact with other proteins. AKT binding to PIP3 through
its PH domain undergoes conformational changes, exposing its two amino acid
residues Thr308 and Ser473. Phosphorylation of these two amino acid residues
8
by enzymes located at the membrane leads to full activation of AKT and allows it
to transmit the receptor-binding signal to its downstream molecules. AKT, being a
Ser/Thr kinase, has activities towards many Ser/Thr containing proteins. These
proteins, many of which are involved in the regulation of cell cycle progression
and apoptosis, are critical for IGF-1 to stimulate cell division. Two of the
substrates of AKT are cell cycle inhibitors p27 and p21 (Fujita et al., 2002).
Phosphorylation of p27 and p21 by AKT inhibits their ability to suppress cell cycle
progression. In addition, AKT also prevents the phosphorylation and degradation
of cyclin D1 through inhibiting the activity of GSK3β (Alt et al., 2000).
Phosphorylation and inhibition of several other targets, including BAD and
caspases 3 and 9, suppresses apoptosis activities and promotes cell survival
(Cardone et al., 1998; Datta et al., 1997). AKT is also essential for stress
response (through phosphorylation of FOXOs, a group of transcriptional factors),
and protein translation (through mTOR and eukaryotic translation initiation
factor 4E-binding protein, eIF4E-BP) (Stiles et al., 2004a).
In addition to PI3K and AKT, another key player in the IGF-1 signaling is
PTEN. PTEN was identified as a tumor suppressor in 1997 by three laboratories
independently (Li and Sun, 1997; Li et al., 1997; Liaw et al., 1997). Later studies
have demonstrated that it is a dual lipid and protein phosphatase that negatively
regulates the PI3K/AKT pathway (Maehama and Dixon, 1998; Myers et al., 1997).
9
By dephosphorylating the 3’ position of PIP3, PTEN antagonizes the activation of
AKT and its downstream pathways. Studies have shown that PTEN loss usually
shares molecular as well as phenotypic similarities to activation of PI3K and AKT.
In consistence with the aging-related roles of IGF-1, the PI3K/AKT signaling
cascade is an important pathway in regulating longevity and lifespan. Mutation of
age-1, the PI3K homologue in C. elegans, expands the lifespan by over 60% and
confers the worm resistance to UV and heat induced-stress (Larsen, 1993).
These phenotypes can be suppressed by mutating daf-16, homolog of the AKT
downstream factor FOXO1 (Martin et al., 1996). Both studies indicate that
PI3K/AKT as well as the downstream signaling effectors is essential for the
regulation of aging process.

I-4 Roles of IGF-1/PI3K/AKT and PTEN in diseases and regeneration
The insulin/IGF-1/PI3K signaling pathway has been a target for multiple
diseases including metabolic disease, injury repair, regeneration as well as
hyper-proliferative diseases such as cancer. Activation of the pathway, either by
direct delivery of insulin, activation of PI3K/AKT or downregulation of PTEN leads
to improved insulin activity. Expression of IGF-1 locally in skeletal muscles is
shown to rescue aging-induced muscle atrophy and retain their regenerative
potential in response to muscle injuries (Musaro et al., 2001). Similarly, activation
10
of the PI3K pathway through PTEN inhibition improves the regeneration ability of
mice fed with high-fed diet, as shown by cell growth and muscle repair (Hu et al.,
2010). In addition, deletion of Pten In cultured adult neurons from the corticospinal
tract also leads to axon regrowth and sprouting after injury (Liu et al., 2010).
Together, in post-mitotic cell types like muscle and neurons, activation of PI3K
signaling, either through insulin/IGF-1 administration, or PTEN downregulation
can potentiate their ability to regenerate even in adult tissues.
Due to the critical roles of PI3K/AKT in modulating cell growth and survival,
dysregulated activation of this pathway is frequently found in tumor tissues and
thus it has become a major target for cancer therapy. PTEN and PI3K are both
frequently mutated in cancers. Germline mutations of PTEN have been observed
in several inherited predispositions to cancer (Liaw et al., 1997; Nelen et al., 1997),
which include: Cowden disease, Lhermitte-Duclos disease, Bannayan-Riley-
Ruvalcaba syndrome and Proteus/Proteus-like syndromes. These disorders are
characterized by the development of non-cancerous harmartomas. PTEN loss is
also observed in a variety of cancers such as prostate cancer, endometrial cancer
and glioblastoma (Li et al., 1997). In addition, PI3K mutations that lead to PI3K
aberrant activation are another critical tumorigenic event that is frequently linked
with cancer development in breast, endometrium and colon (Liu et al., 2009).

11
I-5 Rationale of the study
My thesis work focuses on how the different observations/theories of aging
are integrated. Although it has been established that IGF-1 and its downstream
signaling cascades play a critical role in lifespan and aging, how this pathway
regulates the cellular events observed with aging and molecular mechanism
mediates the aging effect is largely unknown. To study these questions, I
genetically manipulated the activity of IGF/PI3K signaling pathway in two tissues:
beta cells where self-renewal ability is limited in adult and tissue maintenance
relies on self-replication, and hepatocytes where the self-renewal ability is high in
adult and tissue maintenance relies on both self-replication of hepatocytes and
progenitor cells. I chose the Pten deletion model given that the other major
players (e.g. IGF, PI3K and AKT) in this pathway have multiple isoforms. Thus, it
would be extremely difficult to effectively control the activity of the signaling
pathway by targeting one of them. In addition, our lab has utilized the Cre-loxP
system to develop the Pten conditional deletion models. By breeding the
Pten
loxp/loxp
mice with different promoter driving Cre lines, I was able to delete Pten
selectively in different tissues of interests. Using this system, my thesis addressed
the hypothesis that IGF-1 signaling regulates pathways that controls cellular
senescence and that governs oxidative stress responses.
12
In chapter II, I investigated how systemic changes in vivo alters the
mechanisms that control cellular aging to maintain tissue homeostasis in aged
individuals. Towards this end, I targeted the role of IGF-1/PI3K/PTEN signal using
the pancreatic beta cell as an in vivo model. Decline of IGF-1 levels is one of the
major systemic changes occurring with age. Inability of pancreas to maintain beta
cell mass also appears to contribute to diabetes pathology. In addition, previous
studies have demonstrated that adult beta cells replenish through self-renewal,
suggesting that they serve as their own stem cells for regeneration. Beta cells
also become quiescent with age, which is also very similar to tissue stem cells.
Thus, studying this cell type may shed light on how the population of tissue stem
cells are maintained, a critical question in aging. However, unlike other tissue
stem cells, beta cells are terminally differentiated. Thus, their identities are no
longer changing as they can only give rise to beta cells and not other types of
cells. This will allow me to understand how their growth is maintained with aging
without the complication of differentiation. Finally, unlike tissue stem cells, the
identity of beta-cells are well defined and can be readily identified in vivo with
staining of insulin. Therefore, this beta cell model allows me to focus on the
self-renewal effects without being interfered by differentiation.
In chapter III, I investigated the regulation of oxidative stress response by the
IGF-1/PI3K/PTEN signaling in hepatocytes. As the major organ of metabolism,
13
the liver produces a large amount of ROS and thus suffers from oxidative stress.
Recent studies of our lab indicated that Pten deletion in hepatocytes induces
oxidative stress. This Pten liver deletion system provided the ideal tool to
investigate how activation of IGF-1/PI3K signal may control oxidative stress.

14
Chapter II
PTEN controls beta cell regeneration and aging through regulating the cell
cycle inhibitor p16
Ink4a

II-1 Introduction and Rationale
Pancreatic beta cells, which produce insulin and thus play a major role in
maintaining glucose homeostasis, are the most important target of diabetes
treatments. Efforts have been made to understand how to generate more beta
cells so that beta cell transplantation in diabetic patients is possible. However,
under normal conditions, beta cells proliferate at a very low rate (Teta et al., 2005).
In addition, they undergo a dramatic aging process, thus rendering aged
individuals more vulnerable to diabetes. The aging phenotypes of beta cells
include reduced replication and failure to proliferate in response to growth
stimulation (Rankin and Kushner, 2009; Tschen et al., 2009). This inability to
proliferate significantly impedes the regeneration capability, making beta cells the
primary target for regenerative medicine. The goal of this study is to understand
how growth signaling, especially the IGF-1/PTEN/AKT pathway, controls the beta
cell growth and aging process.
For a very long time, beta cells have been considered as terminally
differentiated and irreversibly inactivated in proliferation. In recent years, however,
15
increasing evidence suggests that beta cells are able to replicate, and
self-renewal is actually the primary mechanism for beta cells replenishment (Dor
et al., 2004). Upon entering adulthood, beta cells replicate very slowly with a rate
less than 0.5% per day (Teta et al., 2005). Under certain circumstances, e.g.
pancreas injuries or pregnancy, beta cell proliferation is stimulated, suggesting
that beta cells possess the plasticity to regenerate and compensate for increased
insulin demand. Genetic studies have shown that beta cell replication is controlled
by cell cycle regulators such as cyclin Ds (Kushner et al., 2005) and p27 (Georgia
and Bhushan, 2006).
As individuals age, the basal levels of beta cell proliferation decline
dramatically. In addition to that, beta cells are no longer able to regenerate in
respond to external stimuli. Both decreased proliferation and blunted response to
regenerative stimulation are typical aging hallmarks in beta cells as well as many
other cell types. Mechanistic studies of aging have suggested that the
cyclin-dependent kinase inhibitor p16 is a key player in controlling this process
(Janzen et al., 2006; Krishnamurthy et al., 2006; Molofsky et al., 2006): The
expression level of p16 increases with age in a broad range of tissues; Genetic
studies using p16-deficient mice demonstrated that p16 deletion rescues the
aging phenotypes in various cell types including hematopoietic stem cells (HSCs),
neural progenitors, and pancreatic beta cells; Overexpression of p16, on the
16
contrary, leads to pre-mature aging which is depicted as declined proliferation in
the very young mice. Overall, these evidences demonstrated that p16 is a critical
player in mediating the aging-induced phenotypes, and manipulation of p16 can at
least partially rescue the aging process.
Although the correlation between p16 induction and aging onset has been
well established, how physiological changes in aging individuals alter p16

signals
to promote cellular aging is not fully understood. In vivo, aging is associated with a
decline of circulating growth hormone and insulin like growth factor-1 (IGF-1)
levels (Kamrava et al.), both of which have been shown to modulate a series of
cellular and metabolic activities that affect lifespan. Studies in lower organisms
have shown that mutations of the C. elegans and Drosophila homologues of
IGF-1/PI3K signaling molecules such as daf-2 (Insulin /IGF-1 receptor) and Age-1
(PI3K) significantly alters the lifespan of these organisms (Dorman et al., 1995).
Similar to the invertebrates, genetic manipulation of the IGF-1 receptor in mice
also affects their longevity as well as response to aging-induced stresses
(Holzenberger et al., 2003). Moreover, human patients with GH receptor mutation
and thus IGF-1 deficiency exhibit signs of early aging, including wrinkled skin,
obesity, insulin resistance and declined beta cell function (Laron, 2005), further
supporting that the GH and IGF-1 signaling pathways are essential in controlling
17
aging. As a result, treatment with growth hormone has been proposed to be a
possible anti-aging therapy in aged individuals.
In addition to modulating organism lifespan and global aging, the role of
IGF-1 has also been investigated in specific cell types. Beta cells, in particular,
have been shown to be one of the major target cell types that are affected by
manipulation of the IGF-1 pathway. Analysis of mice with IGF-1R and/or insulin
receptor knocked out revealed that perturbation of the IGF-1 signaling pathway
disrupts the normal function of beta cells and regular maintenance of islet mass
(Withers et al., 1999). Given the declining trend of IGF-1 with aging and its critical
role in beta cell maintenance, I hypothesized it is the IGF-1 signaling that controls
the aging process of beta cells. Activation of this pathway should be able to
improve the restricted regeneration potential that is induced by aging. To test this
hypothesis, I selectively deleted Pten, the inhibitor of the IGF-1/PI3K/AKT
signaling pathway, in beta cells using the transgenic mouse system. Detailed
characterization of Pten null mice showed that, indeed, Pten deletion not only
promotes the basal level of beta cell proliferation, but also enhances the
regenerative capability in aged mice challenged with a beta cell toxin. Further
molecular analysis suggested that such effects are mediated by the
cyclinD1/E2F/RB/p16 signaling axis.

18
II-2 Results

II-2-1 Pten deletion enhances proliferation and cell cycle progression
II-2-1-1 Pten null mice exhibit increased islet mass and hypoglycemia
without detectable aberrance in the distribution of islet endocrine cells
To study the role of PTEN in regulating beta cell proliferation and aging, we
selectively deleted PTEN in beta cells by using the RIP (rat insulin
promoter)-driving CRE transgenic system. As reported before (Stiles et al., 2006a)
and confirmed by immunostaining (figure 1A&E), PTEN was not detected in the
islet of Pten null mice (Pten
loxP/loxp
; Cre
+
; LacZ). Phenotypic characterization with
H&E staining showed that islet mass was increased dramatically by Pten deletion
(figure 1B&F, C&G). In consistence with that, the fasting blood glucose in Pten
null mice was decreased significantly compared to that of the control (Con,
Pten
loxP/loxp
; Cre
-
; LacZ) mice (figure 1I). In addition, staining of insulin as well as
other endocrine hormones revealed that the endocrine cells within the Pten null
islets were distributed in a similar pattern to that of the Con islets (figure 1D&H).
Both hypoglycemia and normal distribution of islet cells indicated that the
expanded islets were functioning normally. Taken together, these data raise an
interesting point that Pten deletion is able to expand the number of functional beta
cell in vivo, which may provide a potential beta cell source for diabetes treatment.
19
0
20
40
60
80
Fasting glucose (mg/dL)
Con Pten null
*
I
50 X
Con Pten null
PTEN DAPI 200 X
Insulin+ other endocrine
hormones
A B C
E F G
D
H
C
G

Figure 1. Pten deletion increases islet mass and blood glucose levels. A&E,
Immunostaining of PTEN in Con and Pten null pancreas sections from 3 months
old mice, nuclei were stained with DAPI. White dotted lines indicate the islet
boundary. Scale bar, 50 µm. B&F and C&G, hematoxylin and eosin (H&E)
staining of pancreas sections, scale bar in B and F, 50 µm, scale bar in C and G,
100 µm. D&H, Immunostaining of insulin (red) and other endocrine hormones
(including glucagon, somatostatin and pancreatic polypeptide, green). Scale bar,
50mm. I. Loss of PTEN also led to hyperglycemia. * p < 0.05. n=10-12.

20
II-2-1-2 Pten deletion increases beta cell proliferation in adult mice
Increased islet mass and beta cell number could be caused by two reasons:
1) increased cell proliferation; 2) decreased cell death. Since beta cell death is
very rare and thus is less likely to be the case, it should be cell proliferation that
contributes to islet expansion. To test that, 5-bromo-2-deoxyuridine (BrdU)
labeling was used to analyze beta cell proliferation. Three months old mice were
fed with BrdU containing drinking water for five days. Their pancreas sections
were then stained with BrdU and insulin. Quantification of BrdU positive cells
within the islets showed that indeed, beta cell proliferation doubled in Pten null
mice compared to the controls (figure 2), confirming that Pten deletion indeed
increases beta cell proliferation.

21
BrdU Insulin DAPI
Con
Pten
null
A B
β-Cells With BrdU
Incorporation %
0
1
2
3
4
5
6
*
Con Pten
null
C

Figure 2. PTEN controls beta cell mitotic activity in adults. A&B, Pancreas
sections immunostained with antibodies against BrdU (green), insulin (red) and
counterstained with DAPI (blue). Scale bar, 50 µm. C. Quantitative analysis of
BrdU positive beta cells in A&B. * p < 0.05. n=6.

22
II-2-1-3 Pten deletion leads to more cell cycle reentries and shortening of
the replication refractory period
Based on the proliferation results, we next tested whether PTEN deletion
promotes cell cycle entering. To answer this question, CldU and IdU, both of
which are BrdU analogs and can be distinguished by different antibodies, were
used to trace different rounds of cell cycle. The Con and Pten null mice were first
fed with CldU containing water for eight days. After two days of “washout” with
regular water, the same mice were labeled with IdU containing water for another
eight days. In this way, cells that enter one cell cycle in either labeling window are
labeled with one type of nucleotide, while those that progress into two or more cell
cycles in both labeling periods are double positive for both CldU and IdU. By
quantifying the number of double positive cells, I was able to examine whether the
cells are active in entering multi-cell cycles.
In the control mice, very few beta cells were double positive for CldU and IdU,
consistent with the very low mitotic activity seen in the proliferation assay. In
contrast to that, Pten null mice exhibited significantly more doubly labeled beta
cells (figure 3A&B). Comparison between Con and Pten null mice indicated that
the PTEN serves as the brake that blocks beta cells from cell cycling, and removal
of PTEN release the brake and activates cell cycle entering (figure 3C).
23
A.
CldU +IdU + Insulin
Pten
null
Con
B.
0
2
4
6
Con Pten
null
% CldU positive β-cells
0
1
2
3
4
Con Pten
null
% IdU positive β-cells
Percentage double
labeled cells (%)
0
1
2
3
4
*
Con Pten
null
C.
Cycle 1 Cycle 2
Cycle 1 Cycle 2
Cycle 1
Cycle 1 Cycle 2 Cycle 3
CON:
Pten null:
PTEN

24
Figure 3. PTEN loss allows cells to escape cell cycle arrest after cell
division. A. Cell cycle entry was determined using double nucleotide labeling with
CldU (red) and IdU (green) in 3 months old mice. Blue, insulin. Solid white arrows
point to nuclei with both CldU and IdU labels. Dashed arrows point to nuclei with
single CldU or IdU labels. Inset: higher magnification images of labeled cells
pointed by white arrows. Scale bar, 50 um. B. Quantitative analysis of CldU or IdU
incorporation ratio (left two panels). Right panel, percentage of double-positive
beta cells among all labeled (either CldU or IdU) beta cells. Con, control. n=10,
* different from that of control islets, p<0.05. C. Diagram representation for the
role of PTEN in beta cell maintenance. When PTEN is present (in control mice), it
blocks the cells from moving on to the next cell cycle and incorporate nucleotide.
Thus, most cells in control mice are labeled only once with nucleotides. In Pten
null mice, however, cells are allowed to enter the next cycle. Thus, more double
labeled cells in the Pten null islets were observed.

25
Previous studies have suggested that beta cells that have finished one cell
cycle are refractory to enter another until a long period later, which explains why
beta cells exhibit such a low mitotic rate under normal conditions (Teta et al.,
2007b). The short time double labeling experiment provided an excellent model to
study this “replication refractory phenomenon”: I assume that the proliferation rate
in the CldU labeling window is a% and that in IdU labeling window is b%. If all the
cells that have passed CldU labeling period are uniformly dividing and there is no
difference between CldU+ and CldU- cells in the potential to enter another cell
cycle during the later IdU labeling period, I could expect the ratio of double
positive cells (c%) to be equal to a% X b%, as a result, c%/(a%Xb%)=1. On the
other hand, if cells that have finished one round of division during the CldU
labeling period are refractory to enter another cell cycle, as in the case of
“replication refractory phenomenon”, the actual ratio of double positive cells (c%)
will be less than the expected value a% X b%, thus c%/(a%Xb%) < 1.
In the control mice, the value of c%/(a%Xb%) equaled to 0.6, which was
significantly lower than 1, confirming the presence of “replication refractory
period” that prevents beta cells from entering multi cell cycles. Interestingly, when
Pten was deleted, this value came back to 1, indicating that Pten null beta cells
were not restricted by the refractory period and were thus free to undergo multi
rounds of division (figure 4). Together, my results suggested that PTEN is the key
26
player that blocks beta cell cycling, and deletion of Pten not only increases beta
cell proliferation but also promotes cell cycle reentering.

27
Time
One
cell
cycle
Multi-cell
cycles
CldU IdU
Cycle
1
Cycle Cycle
Cycle
1
Cycle
2
Cycle
1
Cycle
2
Cycle
3
Cycle
1
A.
0
0.4
0.8
1.2
Con Pten
null
Ratio
*
B.

Figure 4. Deletion of Pten shortens the “replication refractory” period of
beta cells. A. Beta cells have long lag times between cell cycles. Using two
nucleotide analogues, I could distinguish cells that have undergone one or
multiple cell cycles. Cells undergoing one cell cycle within the experimental period
were labeled with CldU (red) or IdU (green). Only cells undergoing two or more
cell divisions were double labeled (both red and green). B. The Ratio of
“Experimental Value vs. Expected Value” in control (Con) and Pten null islets. In
control beta cells, this ratio was lower than 1, but in the Pten null beta cells, it
approached 1. * p < 0.05. n=8

28
II-2-2 PTEN loss rescues the aging phenotypes of beta cells
II-2-2-1 Pten deletion overcomes aging-induced proliferation decline
A typical aging phenotype of beta cells is the dramatic decline of proliferative
activity. Since Pten null beta cells proliferate at a higher rate in young animals (3
months old), I next tested whether this enhanced proliferation can be maintained
in aged mice. I used Ki67 as a marker to study beta cell proliferation in 1.5-, 3-, 6-
and 12-month old mice (figure 5). In the control mice, I observed a 1.2% beta cell
mitotic index (the ratio of Ki67 positive beta cells to total beta cells) in 1.5-month
old mouse. This ratio decreased dramatically to 0.2% in 3-month old mice and
further down to 0.05% when mice were around 1 year old. The declined
proliferation with age suggested that control beta cells undergo a significant aging
process and cannot maintain the high mitotic activity thorough the life. To study
the role of PTEN in regulating this process, I compared the mitotic rate of Pten null
beta cells with their age-matched controls.
Interestingly, in the very young animals (1.5-month), there was no difference
in proliferation between control and Pten null mice. During adulthood (3-month),
the proliferation rate of Pten null beta cells also dropped, but to a much less extent
compared to that of the Con beta cells. As the mice growing older, Pten null beta
cells maintain proliferating at a higher rate than that of control, and interestingly,
there was no significant difference between 3-month vs. 12-month old Pten null
29
mice in beta cell proliferation. These observations indicated that PTEN regulates
beta cell proliferation in an age-dependent manner. At the very young age, the
growth signaling is present to stimulate beta cell mitosis. In older animals,
however, as the growth stimulation decreases with age, beta cell proliferation
declines accordingly in control mice, while PTEN loss is able to compensate for
the absence of growth signaling and maintain the relatively high mitotic activity.
These observations suggest that PTEN is a critical component in the machinery
that controls beta cell aging.

30
C
1.5 month 11-13 month
Ki67 / Insulin / Nucleus
Pm
C Pm
Age (month)
50um
Ki67 ratio
0.0%
0.6%
1.2%
1.8%
1.5 3 6-7 11-13
Control
Pten null
0.0%
0.3%
0.6% **
*
*
*

Figure 5. PTEN loss restores age-induced decline of beta cell proliferation
in aged mice. Mitotic activity of control (C) and Pten null (Pm) mice was
measured with Ki67 staining. Upper panels, representative images of Ki67 (green)
and insulin (red) staining in pancreas sections from young (1.5 month) vs. old
(11-13 months) mice. Blue, DAPI for nuclei. Arrows indicate Ki67 positive cells
within islets. Lower panels, quantification of all stained sections showing the ratio
of Ki67 positive to total beta cells in control vs. Pten null mice at 1.5 (left panel), 3,
6-7 and 11-13 (right panel) months age. * different from the age matched controls,
p<0.05. ** Different from 3-month old controls, p<0.05. At least 5 animals were
used for each data point. n=4 for 11-13 months old Pten null mice. Scale bar,
50mM.
31
As the accumulation effect of beta cell proliferation, islet mass was also
analyzed at different time points. In contrast to the control mice, where the ratio of
islet area to total pancreas area was maintained at around 1% and increased very
slightly from 1.5-month old to 11-13 months old, the Pten null mice exhibited islet
mass that was expanding dramatically from young to old age (figure 6A&B). In
addition, the most significant increase of Con islet mass was observed between
1.5-3 months, in consistence with the relatively high mitotic rate during this time
window, while the islet mass of Pten null animals kept increasing throughout the
entire monitor period, supporting our previous observations that the high mitotic
activity of beta cells was maintained by Pten deletion even after the mice enter
adulthood.
32
A.
C.
1.5
Age:
(Month)
3
6
9
12
Con Pten null
150 um
Age (month)
Islet area / pancreas area(%)
2
4
6
8
10
0 3 6 9 12 15
**
**
**
*
*
Con
Pten null
B.
Islet area/nuclei
0
50
100
150
200
250
1.5&months 11-13&months
Con
Pten&null
C.
*
*

Figure 6. Pten deletion increases islet mass. A. Islet/pancreas ratio was
determined by measuring the size of the islet vs. the size of the pancreas from
H&E stained sections shown as representatives in B. At least 5 animals were
used for each data point. n=4 for 11-13 months old Pten null mice. * Different
from age matched controls, p<0.05. ** Different from age matched controls and
from 1.5 months old Pten null mice, p<0.05. B. Representative images of H&E
stained pancreas from control and Pten null mice of different age. Con, control. C.
Beta cell size analysis. * p<0.05, n=5.

33
As animals age, the peripheral tissues may develop insulin resistance that
requires the enhancement of insulin level and thus increased beta cell number.
Failure of the aged beta cells to proliferate will then results in hyperglycemia in old
animals compared to the young ones. Indeed, the fasting blood glucose was
increased in old vs. young control mice. Notably, Pten null mice maintained low
glucose levels in both young and old age (figure 7), indicating that PTEN loss
enables beta cells to proliferate in response to increased demand and thus
improves the glucose processing ability of the total body mass.

34
0
20
40
60
80
100
120
Fasting glucose ( mg/dL)
*
*
young old
*
Control
Pten null

Figure 7. Fasting plasma glucose levels are maintained at low levels in both
young (1.5 months) and old (9 months) Pten null mice. In control mice, this
level increases with age. At least 6 mice were used at every data point, * p<0.05.

35
II-2-2-2 PTEN loss rescues age-induced regeneration restriction
In addition to the basal level of proliferation, beta cell regeneration in response
to injury is also severely restricted in aged animals. I therefore studied whether
PTEN loss can also relieve the regeneration restriction induced by aging. I treated
the aged Pten mutant (Pten
loxP/wt
; Rip-Cre
+
, Pten
+/-
) mice with a beta cell toxin,
streptozotocin (STZ) to deplete beta cells and then examined the regeneration
potential following injury. Five days after STZ treatment, apoptotic cells were
easily detected in both Con and Pten mutant mice. Moreover, the islet
composition of both genotypes was disrupted as a large number of cells within the
islets were insulin negative (figure 8A). Although STZ induced injury in both Con
and Pten mutant mice, the regenerative responses differed in mice with different
genotypes: beta cell regeneration was rarely detected in the Con mice as
indicated by Ki67 staining but maintained at a much higher level in the mutant
animals (figure 8B). Two months after the treatment, islets in the control mice
shrink and collapsed due to the depletion of beta cells. To the contrary, Pten
mutant islets were able to fully recover from the injury and maintained their normal
morphology as well as insulin production, suggesting that deletion of Pten
restores the inability of aged beta cells to regenerate in response to injury.
Together with the age-dependent effect of Pten deletion on beta cell proliferation,
these results supported an essential role of PTEN in controlling beta cell aging.
36
Ki67/ Insulin/ Nucleus
Con Pten +/-
STZ STZ SHAM SHAM
B.
H&E
A.
Ki67 / Insulin / Nucleus
Pten +/- Con

37
Figure 8. PTEN loss restores the proliferation potential of aged beta cells. A.
Mitotic index (Ki67 staining, green) in pancreas of 13 months old Pten control and
mutant (Pten
+/-
, Pten
loxP/wt
; Rip-Cre
+
; Rosa-LacZ) mice 5 days after treatment with
streptozotocin. Red, insulin; Blue, DAPI. Arrows indicate Ki67 positive beta cells.
Representative image of pancreas sections from 3 animals. B. Two months after
STZ treatment in old (9 months) Pten
+/-
mice, control islets displayed collapsed
morphology (Compare top left two panels) and only very limited cells remained
insulin positive (Compare bottom left two panels, red). The Pten
+/-
islets (Right
panels) were able to maintain the normal morphology (Top) and insulin
expression (Bottom). Pten
+/-
islets also displayed mitotic activities (Ki67 staining,
green). Scale Bar, 50mM.

38
II-2-3 PTEN regulates beta cell aging through modulating the cyclinD-
Ezh2-p16 axis
II-2-3-1 PTEN controls p16 regulated aging signals
To study the molecular mechanism through which PTEN controls the mitotic
activity and aging process of beta cells, I examined protein expression profiles in
islets isolated from control and Pten null mice. The results revealed that when
Pten was deleted, AKT was hyper-phosphorylated while no significant difference
was observed in the ERK phosphorylation level (figure 9A), suggesting that the
pro-mitotic and anti-aging effects of PTEN loss was mediated through the
PI3K/AKT pathway and independent of the MAP kinase signaling axis. We also
screened a number of cell cycle regulators that have been shown to modulate the
proliferation of beta cells in vivo. Cyclin D1, but not cyclin D2 or cyclin D3, is
upregulated in Pten null islets. In addition, two cell cycle inhibitors, p16 and p27,
were downregulated by Pten deletion (figure 9A). These observations suggested
that cell cycle regulators serve as the downstream effectors of PTEN loss that
contribute to the increase of beta cell proliferation. To further investigate which of
the cell cycle regulators mediates the age-dependent effect of PTEN deletion, I
also analyzed their levels in islets from aged mice. Similar to that of the 6-month
old animals, islets of 9 months old Pten null mice expressed higher levels of cyclin
D1 and lower levels of p16 compared to the age-matched control mice, but the
level of p27 was comparable between the two genotypes (figure 9B), suggesting
39
that it is cyclinD1 and p16, but not p27, that modulate the aging process in Con
and Pten null islets.

40
Pten
null
A.
p27
CON Pten null
Cyclin D1
PTEN
GAPDH
p-ERK
p-AKT
AKT
p16
p27
Con
CynD1
CynD2
CynD3
Signaling
Cell cycle
accelerator
Cell cycle
Inhibitor
0
0.3
0.6
0.9
1.2
1.5
p16 protein level
Con
Pten null
*
Con
Pten null
CynD1
Con
Pten
null
PTEN
p16
p27
GAPDH
B.
9 MONTHS
50µM

41
Figure 9. Pten deletion leads to upregualtion of cyclin D1 and
downregulation of p16 as well as p27. A. Left panels, protein profiles in isolated
islets from 6 months old mice. Right panels, immunostaining cyclin D1 (brown)
and p27 (red) in 3 months old animals. Inset, higher magnificent images
showing nuclear localization of cyclin D1. B. Upper left panel, protein profiles in
isolated islets from 9-month old mice. Upper right panel, quantification of p16 in
9-month old isolated islets. n=3, *different from that of control islets, p<0.05.
Lower panels, p16 (green) and insulin (red) staining of pancreas sections from 9
months old mice. Representative image of 5 mice. Con, control.

42
II-2-3-2 The downregulation of p16 in Pten null islets can be recapitulated in
vitro and is independent of the developmental effects
The correlation between PTEN and p16 levels has never been reported
before. I therefore studied how PTEN regulates p16 expression in immortalized
mouse embryonic fibroblasts (mEFs) where the PTEN level can be manipulated in
culture. Comparisons between Con (Con, Pten
loxP/loxP
) and Pten null (Pm, Pten
null, Pten
d5/d5
) mEFs showed that phospho-AKT and cyclin D1 were upregulated
when Pten was deleted, suggesting that the PI3K/AKT signaling was intact in
these cell lines. In consistence with pancreatic islets, the levels of both p16
protein and mRNA were downregulated in Pten null mEFs compared to the
control cells (Fig 10A). The similar expression patterns of mEFs and beta cells
suggested that mEFs could be used as an in vitro model for me to investigate the
signaling between PTEN and p16. To exclude the possibility that the long-term
cell culturing affects gene expression, I transiently knocked down Pten using
small hairpin RNA (shRNA). Short-term Pten knockdown led to increased
phosphorylation of AKT, higher expression of cyclin D1, as well as downregulation
of p16 (figure 10B), mimicking the expression profiles of Pten null mEFs. In
addition to that, I also utilized an engineered cell line U87, in which PTEN
expression can be induced by addition of doxycycline, to explore the regulation of
p16. PTEN level was relatively low six hours after doxycycline treatment but
43
robustly induced 24 hours later. Similar to that, p16 level also went up significantly
at the 24- and 48- hour time points, accompanied by the induction of AKT
phosphorylation and cyclin D1 expression (figure 10C). Together, both PTEN
knocking down and induction experiments suggested that PTEN regulates p16
expression independently of either the genetic alteration or the long-term culturing
effects.

44
A. shRNA:
p16
β-actin
p-AKT
CynD1
PTEN
AKT
Pten null Con
PTEN
sc
PTEN
sc
PTEN
sc
PTEN
sc
p16 protein level
CON Pten
null
0
0.2
0.4
0.6
* CON Pten
null
* 0
0.4
0.8
1.2
p16 mRNA level
B. C.
PTEN
DOX(hr): 0 6 24 48
β-actin
PTEN
p16
CynD1
pAKT
Con Pten null
PTEN
p-AKT
AKT
p16
Tubulin
CynD1
CynD2
GAPDH
p53
Con+scRNA Pten null
Con+shPten
Relative mRNA level
0
0. 4
0. 8
p16
*
Pten
0
0.004
0.008
0.012
Relative mRNA level
*
*
MOUSE EMBRYONIC FIBROBLASTS
U87

45
Figure 10. PTEN regulates expression of p16 in vitro. A. Expression of cell
cycle proteins in mouse embryonic fibroblasts (mEFs) with or without PTEN.
Upper, western blot analysis of control (Con) and Pten null mouse embryonic
fibroblasts. Lower left, quantitative analysis of p16 protein levels. Lower right,
quantitative analysis of p16 mRNA levels. Tubulin and GAPDH are used as
loading control. n=3, * different from that of control mEF, p<0.05. B. Expression of
shPTEN in mEFs with intact PTEN (Con) led to the expected upregulation of
cyclin D1 and increased phosphorylation of AKT. This manipulation also resulted
in decrease of p16. Actin is used as loading control. Bottom two panels,
quantitative analysis of PTEN and p16 mRNA levels in mEFs treated with
scramble RNA (scRNA) or shPTEN. n=3, *different from that of scRNA
transfected control (Con) cells, p<0.05. C. Induced expression of PTEN
expression in a human glioma cell line lacking PTEN (U87) led to increases in p16
levels.

46
To study the transient effects of PTEN deletion in vivo, I also developed an
inducible Pten deletion mouse model (Pten
loxP/loxP
; Rip-CreER
+
), in which the
injection of tamoxifen led to nuclear localization of the Cre-ER fused protein and
thus deletion of Pten in beta cells. This model enabled me to manipulate PTEN in
vivo in a time-specific manner and thus excluded any interference that might be
induced during mouse development. Pten deletion induced at 9-month old by
tamoxifen injection led to p16 downregulation as shown by both immunostaining
and western-blotting (figure 11A). I also observed expanded islet and increased
beta cell proliferation in the tamoxifen treated group (figure 11B), confirming that
PTEN regulates p16 level and beta cell replication intrinsically and independently
of the developmental effects. (Figure 11)
47
A.
P16 / Insulin / DAPI
p16
-Tm +Tm
β-actin
ISLETS
-Tm +Tm
-Tm
B.
BrdU+ Insulin+DAPI
+Tm
50µM

Figure 11. Induced loss of PTEN in adult beta cells (9 months of age)
results in downregulation of p16. A. Left panels, Immunohistostaining of p16
and insulin in Pten
loxP/loxP
; RipCreER
+
mice (9 months old) treated with tamoxifen
(bottom) to induce PTEN loss showed reduced levels of p16 when compared with
vehicle (top) treated mice with intact PTEN. Representative image of 3 mice.
Scale bar, 10 µm. Right panel shows western blot analysis of p16 proteins in
isolated islets from Pten
loxP/loxP
; Rip-Cre
+
; Rosa-LacZ mice treated with (+Tm) or
without (-Tm) tamoxifen. Actin was detected as loading control. B. Proliferation
index of pancreas section of Pten
loxP/loxP
; Rip-Cre
+
; Rosa-LacZ mice treated with
or without tamoxifen. Inset, higher magnification images of the boxed area.
48
II-2-3-3 Downregulation of p16 in Pten null cells is mediated through
histone trimethylation of the Ink/Arf locus in an Ezh2 dependent manner
Previous studies have demonstrated that p16 is often regulated through
histone methylation (Little and Wainwright, 1995). Under ordinary conditions, e.g.
in young and healthy cells, histones on the Ink/Arf locus, which encodes p16
protein, is hyper-methylated, and thus p16 expression is under repression. When
aging or senescence signals are present, however, the histone will be
de-methylated to turn on p16 transcription. In order to investigate how PTEN
regulates p16, I analyzed the histone methylation pattern on the Ink/Arf locus in
Con and Pten null mEFs by using the chromatin immunoprecipitation (ChIP)
assay. DNA fragments were pulled down with antibodies that recognize the
tri-methylated lysine 27 residues on histone3 (H3K27M3) and quantified with
real-time PCR. The results were standardized to fragments precipitated by
anti-histone 3 antibodies to rule out the possibility that the abundance of total
histone 3 was not even. As shown in figure 12A, when Pten was absent, the
tri-methylation levels were elevated in all the five detected sites crossing the
Ink/Arf locus. These observations were consistent with the down-regulation of p16
levels in Pten null cells and suggested that such regulation is mediated through
histone modification.

49
A number of polycomb group proteins (PcGs) have been reported to modify
histone methylation and regulate p16 expression. We thus examined two of the
PcGs, namely Ezh2 and Bmi-1, both of which have been shown to regulate cell
aging and senescence (Chen et al., 2011; Chen et al., 2009; Dhawan et al., 2009).
Protein as well as mRNA analysis showed that both Ezh2 and Bmi-1 were
expressed in higher levels in Pten null mEFs (figure 12B&C) and thus may
contributed to the suppression of p16 levels. To further investigate whether they
do regulate p16 levels in mEFs, I knocked down Ezh2 and Bmi-1 in Pten null
mEFs with specific shRNAs. Manipulation of Ezh2, but not Bmi-1, restored the
level of p16 expression (figure 12D), indicating it is Ezh2 that mediates between
PTEN and p16.
50
B.
PTEN
Ezh2
GAPDH
C M C M C M
0
0.4
0.8
1.2
C M
Ezh2 protein
*
Bmi-1 protein
0
0.04
0.08
0.12
C M
*
Bmi-1

GAPDH
Con Pten null
PTEN
0
0.4
0.8
1.2
1.6
2.0
C M
*
wt
Bmi-1 mRNA
0
0.4
0.8
1.2
1.6
C M
*
wt
Ezh2 mRNA
C.
0
1
2
3
Ezh2 p16
mRNA expression
scramble
Ezh2 shRNA
*
*
0
0.4
0.8
1.2
Bmi-1 p16
mRNA expression
scramble
Bmi1 shRNA
*
D
A.
0
1
2
3
Arf prmt Ink4b
prmt
Ink4a
prmt
Ink4a
exon1
Ink4a
exon2-3
H3K27M3/H3 Ratio
Con
Pten null
*
*

51
Figure 12. PTEN regulates methylation of the Ink4/Arf locus through
modulating the expression levels of Ezh2. A. Pten deletion led to
hyper-methylation of the Arf/Ink locus. The tri-methylation status of the histone 3
lysine 27 was analyzed by ChIP assay. The promoter and coding region occupied
by methylated H3K27 standardized to total histone 3 is higher in Pten null mEFs
(solid bars) vs. controls (open bars). n=3 * Different from the controls at the same
site. p<0.05. B and C. Two polycomb group genes, Ezh2 and Bmi-1, were
upregulated in Pten null mEFs. Top panels, western-blotting images showing
increases in protein levels. Bottom panels, quantification of protein and mRNA
levels of Ezh2 and Bmi-1 in control (C) and Pten null (M) mEFs. n=3, *different
from that of the controls, p<0.05. D. Knocking down of Ezh2 (left), but not Bmi-1
(right), enhanced the expression of p16 in Pten null mEFs. Left panel, p16 and
Ezh2 mRNA expression after introduction of Ezh2 shRNA. Right panel, p16 and
Bmi-1 mRNA expression after introduction of Bmi-1 shRNA. n=3, *different from
that of scramble RNA transfected cells, p<0.05.

52
II-2-3-4 Cyclin D1 regulates Ezh2 and thus p16 through E2Fs
I next studied how Ezh2 is regulated by the PTEN/PI3K pathway.
Upregulation of its mRNA level suggested that Ezh2 might be modulated in the
transcription level. I thus analyzed the promoter region of Ezh2 and screened it
with transcriptional factor binding consensus sequences that have been reported
before. Notably, within the 1kb promoter region of Ezh2, three potential sites that
possess the E2F-binding consensus (TTTSSCGC, S is a C or G) were identified,
indicating that the E2F transcription factors may bind to the Ezh2 promoter and
control its transcription. To test this hypothesis, I constructed the pGL2-Ezh2
promoter plasmid using luciferase as the reporter gene to study how the Ezh2
promoter is regulated. Transcription factors E2Fs1–4 were introduced into the
Con mEFs respectively, followed by evaluation of the Ezh2 promoter activity
through luciferase assay. Overexpression of E2F1 – E2F4 all led to increased
promoter activity of Ezh2 (figure 13). E2F1, E2F2 and E2F3, in particular,
up-regulated the luciferase levels by over ten folds, suggesting that Ezh2 is
indeed the downstream target of E2Fs.
53

*
*
0
5
10
15
20
Ezh2 promoter activity
vector
E2F1
E2F2
E2F3
E2F4
*
*

54
Figure 13. E2Fs regulate Ezh2 promoter activity and inhibition of p16 in
Pten null cells. Upper panel. Alignment of the human (upper sequence) and
mouse (lower sequence) Ezh2 promoter with E2F binding consensus
(TTTSSCGC, S is C or G) revealed three potential E2F binding sites (highlighted
in grey box) that are conserved from mouse to human. Arrows indicate the
transcriptional starting site. Lower panel. Control mEFs were co-transfected with
the Ezh2 promoter-driven luciferase construct and indicated transcription factors
(E2Fs1-4). Luciferase activity was measured as indication of the Ezh2 promoter
activity. Introduction of all E2Fs1-4 increases Ezh2 promoter activity with E2Fs1-3
having a higher activity. n=3, *different from vector transfected cells, * p<0.05.

55
E2Fs are a family of transcription factors that play a key role in the cell cycle
regulation. During G1-S transition, cyclin Ds form a complex with CDKs, which
subsequently phosphorylates Rb protein. The phosphorylated Rb then releases
E2Fs and thus allows them to transcribe downstream target genes to facilitate cell
cycle progression. Since I have consistently observed the increased levels of
cyclin D1 in Pten null cells, I next tested whether it is cyclin D1 that contribute to
the upregulation of Ezh2. Introduction of the shRNA targeting cyclin D1 into the
Pten null mEFs led to a 40% reduction in the mRNA level. Further knockdown
cannot be achieved because massive cell deaths were observed when cyclin D1
was depleted. Analysis of the expression profiled in the cyclin D1-low Pten null
mEFs showed that the Ezh2 level was only slightly altered, but a dramatically
increased expression of p16 was observed. Comparison between Con and Pten
null mEFs showed that Pten complete deletion leads to 5-fold increase of cyclin
D1, only 25% increase of Ezh2, and over 10-fold decrease of p16. As a result,
forty percent reduction of cyclin D1 in the Pten null mEFs may not be able to
sufficiently alter Ezh2 to a level that was detectable by our current measuring
system. However, p16, the downstream target of Ezh2, was more sensitive to the
changes of Ezh2 and thus exhibited significant difference in the expression level
when cyclin D1 was knocked down. In consistent with the hypothesis that cyclin
D1 regulates p16, analysis of the young and old mouse islets showed that as the
56
animal growing older, cyclin D1 level was downregulated, concurrently with the
upregulation of p16 (figure 14C).

57
A.
Pten null+scramble
0
2
4
6
Cyn D1 p16
mRNA Expression
Pten null+Sh CynD1
*
0.4
0.8
1.2
1.6
0
CynD1 p16
mRNA Expression
*
Con+ vector
Con+CynD1 T286A
B.
CynD1
1-2 M 14-15 M
tubulin
Age:
p16
CynD2
CynD3
GAPDH
PTEN
GAPDH
C.

Figure 14. PTEN regulates p16 through cyclin D1. A. Introduction of a cyclinD1
mutant (T286A) that cannot be degraded led to downregulation of p16. Here
shows mRNA levels of cyclin D1 and p16 in vector (white) or cyclin D1-T286A
(grey) transfected cells. B. Introducing shRNA for cyclin D1 to knock down cyclin
D1 resulted in robust induction of p16. White bars, mRNA levels of cyclin D1 and
p16 in scramble transfected cells. Grey bars, mRNA levels of cyclin D1 and p16 in
cyclin D1 shRNA transfected cells. * different from that of vector or scrambled
RNA transfected cells, p < 0.05. n=3. C. Levels of cyclin Ds, p16 and PTEN in
young (1-2 month) vs. old (14-15 months) mice. Top panel, cyclin D1 and p16.
Middle panel, D2 and D3. Bottom panel, PTEN. Tubulin and GAPDH were
detected as loading controls.
58
II-3 Discussion
In this study, I discovered an important aging-controlling regulatory axis that
involves PTEN, cyclinD1, E2F, Ezh2 and p16
Ink4a
(figure 15). This pathway links
the IGF-1 growth signaling with the p16-regulating aging process and provides a
possible molecular mechanism that induces aging. Decline of circulating growth
hormone and its target IGF-1 has been observed during the aging process, but
whether and how this reduced hormone levels affect aging have not been
completely understood. Precious studies have shown that perturbations of the
IGF-1 signaling pathways affect mitotic activity even in juvenile individuals, a
phenotype that mimics the aged process. Here, I further demonstrated that
activation of this pathway is able to maintain the cellular plasticity to recover after
injury even in aged animals, further substantiating the critical role of the IGF-1
pathway in controlling the aging process.
As the only in vivo source of insulin in adults, beta cells have to maintain a
normal mass throughout the life to control glucose homeostasis. Previous studies
have demonstrated that self-renewal is the dominant mechanism of beta cell
replenishment (Dor et al., 2004). As a result, beta cell replication constitutes the
major approach to compensate for both regular turnover and sudden loss of cells
due to injuries or diseases. Failure of beta cells to do so, which often happens in
aged individuals, will lead to the onset of diabetes. In this study, I demonstrated
59
that PTEN loss improves beta cells mitotic activity especially in the aged mice,
highlighting the anti-aging effects of PTEN deletion. My observations revealed
that PTEN regulates beta cell proliferation in a biphasic manner, possibly due to
the complication of factors other than aging that also affect proliferation. It is likely
that beta cell proliferation is controlled by both developmental and aging effects.
As the animal develops, matures and ages, the impact of developmental factors
declines, while the aging effect goes up. PTEN is involved in the regulation of
aging but not development. As a result, in 1.5-month old juvenile animals, when
development is the dominant factor, PTEN deletion has no effect on beta cell
proliferation. However, from 3-month to 1 year old, as the PTEN-dependent aging
effect takes over, proliferation rate in the control mice with intact PTEN declines
significantly, while Pten deletion is able to counteract the aging-effect and thus
maintain the mitotic activity of aged beta cells.
Although beta cell proliferation was not altered by Pten deletion at 1.5-month
old, islet mass was still increased in the Pten null animals with the same age. Our
study suggested that in addition to mitotic activity, Pten deletion also affects cell
size (figure 6C). Pten null beta cells were 1.5 folds larger than that of the controls
even in the very young mice (1.5 months old). These observations at least
partially explained why the islet mass was increased at this age while beta cell
proliferation was not affected. Comparison between the timelines of cell size
60
expanding and proliferation promoting effects of Pten deletion suggested that
these two phenotypes were regulated by distinct mechanisms downstream of
PTEN. Increase of cell size appeared at as early as 1.5 months old, and the ratio
between Con and Pten null islets was not altered even in aged animals,
suggesting that the effects of PTEN on controlling cell size is not age-related.
Restricted regeneration in response to injury is another aging phenotype of
beta cell aging. Notably, when STZ was used to induce type-I diabetes in aged
mice, PTEN loss stimulated the regeneration of beta cells and thus prevented the
diabetes onset, further emphasizing the critical roles of PTEN in maintaining
glucose homeostasis as well as controlling diabetes development. It has been
reported that even partial inactivation of PTEN can induce critical phenotypic
changes (Berger et al., 2011). Similarly, our study also observed haploinsufficient
effects of PTEN in controlling beta cell regeneration: deleting only one allele of
PTEN (in Pten
+/-
mice), which led to half reduction of its expression, significantly
improved the beta cell’s response to STZ treatment, suggesting that the
regeneration potential of beta cells is very sensitive to the levels of PTEN. Given
that partial inactivation is more technically achievable than complete knockout
during therapeutic development, our observations suggested that PTEN and its
down stream effectors might be excellent targets for regeneration medicine as
well as diabetes treatment.
61
The association of PTEN loss and tumor formation has been reported
previously by numerous studies, thus raising concerns of whether the improved
regeneration potential by PTEN deletion would be compromised by tumor
development. In my beta cell specific deletion model, however, no tumor has
been detected throughout the analysis period (1.5-13 months). The absence of
tumor formation in Pten null beta cells has also been reported by other groups
(Nguyen et al., 2006). Together, both studies support that in beta cells, the tumor
developing and regeneration enhancing effects of Pten deletion are un-coupled,
suggesting that beta cells are a unique model in the area of regeneration research.
It is also of great interest for future studies to understand why PTEN loss results in
tumor in certain types of cells but not in the others. A better understanding of this
question might provide fundamental insights into how to avoid undesired tumor
development while improving tissue regeneration.
Despite the well-established roles of p16 in controlling aging and senescence,
how p16 itself is regulated is not clear. My study for the first time demonstrated
that the IGF-1/PTEN regulating pathway controls p16 expression. Pten deletion in
beta cells resulted in downregulation of p16 in 6 months old mice, and a more
significant difference was observed in older islets that harbored Pten deletion
either from early development or later by the time of tamoxifen induction. The
age-dependent regulation of p16 could be caused by either accumulation of
62
mutations due to PTEN loss or direct mechanisms intrinsic of the cells. Analysis of
the ER mice revealed that acute deletion of Pten in 9 months old mice could still
lead to increased proliferation as well as downregulation of the p16-related aging
signaling, thus excluding the involvement of long-term mutation and confirming
that PTEN regulates p16 as well as aging intrinsically.
I also found that the PcG protein Ezh2 was involved in the regulation axis
between PTEN and p16. Previous studies have demonstrated that Ezh2 can be
regulated by cell cycle progression. My study confirmed this discovery and further
showed that it is also a downstream target of PTEN through cyclin D1 and E2F.
Given that Ezh2 is a critical epigenetic regulator that controls a variety of
physiological and pathological processes including senescence, proliferation,
aging as well as stem cell development, my findings not only linked PTEN to the
epigenetic regulation but also expand our knowledge about the functions of PTEN
into a much broader area. The involvement of cyclin D1 in the pathway is also of
great interests. So far three isoforms of cyclin D have been identified. Abundance
analysis showed that in pancreatic beta cells, cyclin D2 is expressed in a much
higher level than that of cyclin D1 and D3 (Kushner et al., 2005), thus raising the
question of which isoform is the key player in regulating p16. My analysis
indicates that neither cyclin D2 nor D3 expression was altered by PTEN deletion.
In addition, studies by our group and others also showed that the levels of cyclin
63
D2 and D3 remain unchanged in old vs. young islets, suggesting that they are
less likely to regulate beta cell aging. Cyclin D2 is expressed in a high level
possibly because it is required for the maintenance of islet mass in normal and
young animals. In aged mice, however, downregulation of cyclin D1 is more
profound and thus becomes the determinant that contributes to the aging
phenotype.
In summary, I have identified a novel regulatory pathway that links
IGF-1/PTEN to aging through cyclin D1-E2Fs-Ezh2-p16. I demonstrated that
PTEN loss in beta cells led to downregulation of p16, rescued aging phenotypes
as well as improved regeneration capability. Given that PTEN is ubiquitously
expressed and that IGF-1 is globally circulating, my study may also apply to other
cell types and provide critical insights into developing the pro-regeneration and
anti-aging therapy.
IGF-1
PI3K
cyclin D1
E2Fs
Ezh2
p16
Beta cell aging
PTEN
Beta cell size

Figure 15. Working model
64
Chapter III
Pten deletion prevents oxidative stress induced cell death in hepatocytes

III-1 Introduction and rationale
In addition to tissue regeneration, ROS production and oxidative stress is
another important theme of aging. I next studied the role of PTEN in regulating
cellular response to oxidative stress in hepatocytes (Zeng et al., 2011), which are
active in metabolism and thus may experience high levels of oxidative stress.
Unlike that of beta cells, however, Pten deletion in many other cell types is
tumorigenic. Genetic studies have shown that loss of PTEN functions results in
growth and survival phenotype and tumor development in multiple tissues and
organ systems (Stiles et al., 2004b). In the liver, nearly 80% of hepatocytes
carcinomas (HCC) are correlated with activation of the PI3K signaling pathway
including loss of PTEN (Whittaker et al.). Studies have showed that PTEN loss in
mouse models leads to lipid accumulation in the hepatocytes early and tumor
development later in life (Horie et al., 2004; Stiles et al., 2004c; Xu et al., 2006).
This two-stage progression of tumor development is similar to that observed with
human HCC where underlying liver disease especially fatty liver disease is a
common co-morbid factor. In human patients, the development of HCC is highly
correlated with oxidative stress (Jo et al.). In the mouse liver where PTEN is lost
65
and PI3K signaling is activated, accumulation of lipids is accompanied by high
levels of hydrogen peroxide, suggesting that the hepatocytes in the Pten null liver
are under conditions of chronic oxidative stress (Galicia et al., 2010). We used
the hepatocytes isolated from this model to investigate whether and how
PTEN/PI3K signal may provide the adaptation advantage for mutant cells to
survive stress induced cell death.
Cancer cells are often “addictive” to their oncogenic events such as loss of a
tumor suppressor or induction of an oncogene and resistant to stress-induced cell
death. We investigated the response of the Pten null hepatocytes to stress and
found that Pten null hepatocytes are resistant to various forms of stress including
oxidative glutamate and H
2
O
2
toxicity as well as ER stress. Phosphorylation of
eukaryotic Initiation Factor 2 (eIF2) family of translation regulators is known for
integrating various cellular stress responses including oxidative and ER stress
(Wek et al., 2006). This mechanism may underlie the conditioned protection
against more severe injury in cells growing in chronic low levels of stress
conditions like the stressed conditions the Pten null cells are in (Galicia et al.,
2010). Under acute stress response, phosphorylation of eIF2α leads to shutdown
of protein synthesis and mediation of global stress. We showed that PTEN,
through its regulation of PI3K/AKT signaling, controls the basal phosphorylation of
eIF2α. Chronic low level of eIF2α phosphorylation was reported to mediate an
66
adaptive response of cells to chronic stress (Lu et al., 2004). Such mechanism
may explain why tumor cells are more resistant to stress yet cannot survive when
the oncogenic signals are lost. We further established that downregulation of
CReP (constitutive repressor of eIF2α phosphorylation), a subunit of the PP1
phosphatase complex, is responsible for this basal phosphorylation of eIF2α.
Overexpression of CReP restores the sensitivity of the Pten null hepatocytes to
oxidative stress induced cytotoxicity. Together, our data suggested that basal
phosphorylation of eIF2α induced by activation of PI3K may act as an adaptive
response for the fast growing cells to cope with chronic stress.

67
III-2 Results

III-2-1 Deletion of Pten in hepatocytes results in high oxidative stress
Oxidative stress occurring with inflammation is often implicated in promoting
the development of tumors (Severi et al.). Free radicals produced with oxidative
stress can be both genotoxic and cytotoxic, causing some cells to acquire survival
advantages while other cells to undergo cell death. We studied a gene that is
commonly dysregulated in human liver cancers, PTEN and its role in oxidative
stress response in the liver. We have showed previously that mice lacking PTEN
in the liver (Pten
loxP/loxP
;Alb-Cre
+
; Pten null) develops liver steatosis (Figure 16A)
as well as liver cancer (Galicia et al., 2010; Stiles et al., 2004c). The steatosis in
the liver is accompanied by high H
2
O
2
contents, indicating that the hepatocytes
are experiencing high oxidative stress conditions (Figure 16B, left panel). We also
investigated enzymes responsible for reducing oxidative stress in the cells. The
expression of these enzymes often increases as a result of increased oxidative
stress. The mRNA expressions of two of such enzymes, hydrogen peroxide
scavenger glutathione peroxidase (GPx) and glutathione-s transferase (GST)
were also significantly higher in Pten null mice compared to controls (Figure 16B,
right two panels). Together, these data suggest that the hepatocytes in the Pten
null mice are under high oxidative stress conditions. In addition, we analyzed liver
68
tissues for trans-4-hydroxy-2-nonenal (4-HNE), a lipid peroxidation product
(Figure 16C). Immunostaining with 4-HNE antibody identified dramatically more
4-HNE aggregates in the Pten null livers vs. the controls (Figure 16C), further
supporting the presence of oxidative stress conditions in the Pten null livers.

69
B.
µM H
2
O
2
/µg protein

0
1
2
3
4
5
*
Con Pten
null
GPx
Fold Change mRNA
0
4
8
12
16
*
Con Pten
null
GST
Fold Change mRNA
0
4
*
2
6
Con Pten
null
C.
Con
Pten null
20µM
A.
CON Pten null
25µM

70
Figure 16. High oxidative stress conditions in Pten null liver. A. Deletion of
Pten leads to lipid accumulation in liver hepatocytes. Images are H&E stained
liver sections from Pten control (Con, Pten
loxP/loxP
;Alb-Cre
-
) and Pten null (Pten
null, Pten
loxP/loxP
;Alb-Cre
+
). Pten null liver sections show lipid vacuoles. B. High
oxidative stress in Pten null liver. Left, hydrogen peroxide (H
2
O
2
) levels are
significantly higher in Pten null livers vs. controls (Con). Expression of enzymes
responsible for scavenging free radicals, glutathione peroxidase (GPx) and
glutathione-S-transferase (GST) are both increased (Right two panels). n=5; *
p≤0.05. C. Immunohistostaining for lipid peroxidation indicated high oxidative
stress in Pten null liver. Staining for 4-HNE (Green) indicates higher lipid
peroxidation products in Pten null liver vs. controls. Blue indicates DAPI staining
for nuclei.

71
III-2-2 Resistance of Pten null hepatocytes to cellular stress
To investigate how Pten null cells cope with the high oxidative stress
conditions that they are exposed to in vivo, we established isogenic cell lines from
the livers of control (Pten
loxP/loxP
;Alb-Cre
-
) and Pten null (Pten
loxP/loxP
;Alb-Cre
+
)
mice using a standard 3T3. As expected, the Pten null (Mut) hepatocytes were
transformed and capable of forming colonies on soft agar and in nude mice
xenograft assays (figure 17). The control cell lines (Con) were also capable of
forming colonies and graft tumors (figure 17A). The tumor graft derived from the
control cell lines resembled the normal liver structure, suggesting that the control
cell lines at least partially retain the properties of the wild type hepatocytes in vivo.
The grafted tumors formed from the Pten null cell lines morphologically resembled
the tumors observed in vivo in the Pten
loxP/loxP
;Alb-Cre
+
mice. Significantly more
colonies were formed in the Pten null cells as compared to the control cells when
plated on soft agar (figure 17B). This data suggested that the Pten null cells may
have better survival potentials under the stressful condition of soft agar culturing
than the control cells.
On the molecular level, the isogenic hepatic cell lines recapitulated the
molecular signaling profiles observed in freshly isolated livers (figure 17C). Both
cell lines expressed albumin, indicating that the origin of the cells is liver
hepatocytes. The molecular signaling pathways such as mTOR were activated in
the Pten null cell line as predicted. AKT was robustly induced when Pten was
72
deleted. We also observed enhanced expression of fatty acid synthase (FAS) in
the Pten null cell line vs. the controls, similar to what we have seen previously in
mouse liver lysates (supplemental Figure 3C) (Stiles et al., 2004c).

73
A.
B.
CON MUT
Cell Lines
Con Mut
p-mTOR
PTEN
p-AKT
Actin
p-S6
Albumin
FAS
Liver tissue
Con Mut
FAS
PTEN
p-AKT
Actin
p-mTOR
p-S6
Albumin
C.
M
C
M
C
Liver morphology in vivo Tumor graft morphology
50µM

Figure 17. Characterization of Con and Pten null hepatocyte lines. A.
Histological analysis of liver sections (right panels) and engrafted tumors (left
panels). C, control. M, Pten null. B. Colony formation assay showing more
colonies with the Pten null cells. C. Expression profiles of Control (Con) and Pten
null (Mut) cell lines (left panel) compared to livers (right panel).
74
The preliminary observations from the colony forming assay suggested that
the Pten null hepatocytes are more resistance to the stressful culture conditions
as more colonies were formed with the Pten null vs. Con cell lines. To determine
whether loss of PTEN protects the hepatocytes from cell death induced by high
oxidative stress condition, we treated the control and Pten null cells with three
oxidative stressors: hydrogen peroxide (H
2
O
2
), 3-morpholinosydnonimine (SIN-1),
and L-glutamic acid. Hydrogen peroxide is widely regarded as a cytotoxic agent
that induces cell death through oxidative stress. Twenty-four hour exposure to
H
2
O
2
induced cell death in control (Con) hepatocytes in a dose dependent
manner. The cell survival decreased from 88% to 12% as the doses increased
from 1.25 mM to 10 mM (Figure 18A). The Pten null hepatocytes (Pten null),
however, survived 1.25 mM H
2
O
2
for 24 hours without detectable cell death. At
high dose (10 mM), more than twice as much Pten null cells survived (29%) as
compared to Con cells (12%). The improved survival of Pten null cells was also
noted when cells were treated with SIN-1 (Figure 18B), a peroxinitrite donor used
to generate nitric oxide and superoxide radical (Gergel et al., 1995), as well as
L-glutamic acid (Figure 18C), which depletes intracellular cysteine and glutathione,
leading to oxidative stress (Diniz et al., 2005; Shih et al., 2006). Both treatments
resulted in a dose dependent cytotoxicity in the Con cell line but a significantly
diminished effect in the Pten null cell line.
75
We further evaluated H
2
O
2
induced cell death by staining the unpermeablized
cells with Propidium Iodide (PI). Dead cells with compromised membranes
incorporate PI and can be detected using flow cytometer. Treatment of Con
hepatocytes with 10mM H
2
O
2
for 24 hours resulted in the appearance of a distinct
cell population that were high for PI staining (Figure 18D). This cell population
was not present in the untreated Con cells, suggesting that this cell population
was the dead cells induced by H
2
O
2
. Under the indicated treatment conditions,
approximately 30% of Con hepatocytes became positive for PI labeling, indicating
that they were dead cells with compromised membranes. Under the same
conditions, only 1% of the Pten null hepatocytes incorporated PI. This
represented a 30 folds decrease in cell death when PTEN was lost. Together with
the cytotoxic analysis, this data suggested that PTEN loss protects hepatocytes
from oxidative stress induced cell death.
76
Vehicle 10mM H
2
O
2
D. A.
B.
C.
CON Pten null
*
*
*
*
0
40
80
120
0 1.2 2.5 5 10
H
2
O
2
(mM)
Cell Survival %
Con
Pten null
*
*
*
0
40
80
120
0 0.125 0.25 0.5 1
SIN-1 (mM)
Cell Survival %
Con
Pten null
*
*
*
*
0
40
80
120
0 1.2 2.5 5 10
L-glutamic acid (mM)
Cell Survival %
CON
Pten null
Unstained contol
1.0%
0.8%
0.3%
29.9%
30.8%
0.8%

77
Figure 18. Improved survival and decreased cell death in Pten null
hepatocytes when exposed to oxidative stress. Control (Con) and Pten null
hepatocytes were treated with H
2
O
2
(A), SIN-1 (B) and L-glutamic acid (C) at the
indicated concentrations. 100% survival was defined as the values in cells that
were treated with vehicles only. n=3, * p < 0.05. (D) Cell death analysis via PI
staining. Control (Con) and Pten null hepatocytes were treated with 10mM H
2
O
2

or vehicle for 24 hours, harvested, stained and analyzed on flow cytometry. The Y
axis is PI-area, the X axis is PI-width. Insets, PI-positive dead cells.

78
III-2-3 Enhanced basal eIF2α phosphorylation in Pten deficient cells
The ISR response mechanism may underlie the conditioned protection
against more severe injury in cells growing in chronic low levels of stress
conditions like the stressed conditions the Pten null cells are in (Galicia et al.,
2010). We analyzed phosphorylation of eIF2α, the central regulator of the ISR
response mechanism and found that p-eIF2α was induced in unstressed Pten null
hepatocytes comparing to the control cells with intact PTEN (Figure 19A, left
panel). Similarly, this basal level hyper-phosphorylation of eIF2α was also
observed in vivo in Pten null liver lysates vs. control lysate (Figure 19A, right
panel). We observed a consistent two-fold increase of eIF2α phosphorylation in
Pten null livers and hepatocytes vs. that of Controls. This difference in eIF2α
phosphorylation was correlated with an increase of p-AKT but not p-ERK (Figure
19A, left panel).

79
0
0.2
0.4
0.6
0.8
p-eIF / eIF
CON
MUT
A.
0
0.2
0.4
0.6
0.8
1
p-eIF / eIF
CON
MUT
eIF2α
Con Pten null
p-eIF2α
* *
Liver Lysates
p-eIF2α
eIF2α
Con Pten null
Immortalized Hepatocyte cell lines
p-ERK
p-AKT
actin
B.

Figure 19. Elevated phosphorylation of eIF2α in PTEN deficient hepatocytes
and livers. Immunobloting analysis of p-eIF2α and eIF2α in hepatocytes (A) and
mouse liver (B). Bottom panels, quantification of western blots. * p < 0.05.

80
To test whether the change in eIF2α phosphorylation also alters the cellular
response to other stress, we tested the response of the Pten null hepatocytes to
induced stress of the endoplasmic reticulum (ER) and compared this response to
the control cells. Thapsigargin (TG) is a chemical used to induce stress of the ER
and accumulation of GRP78 (Li et al., 1993). In both Con and Pten null cell lines,
TG treatment induced the expected increase of GRP78. No difference in GRP78
were observed between Con and Pten null cell lines at any time points after TG
treatment (Figure 20A). Similarly, no changes were observed with other ER
proteins such as GRP94 and PDI either, suggesting that the response of ER to
unfolded protein (UPR) accumulation is not altered by PTEN loss. Similar to the
response to H
2
O
2
induced stress, the Pten null hepatocytes survived ER stress
induced cell death much better as indicated by the attenuated CHOP induction in
response to TG treatment. This data suggested that PTEN regulated signals may
confer resistance to stress induced cell death regardless of the type of stress.
During TG induced ER stress response, the differences of p-eIF2α observed
between control and Pten null cells disappeared as acute stress response in
control cells led to enhanced phosphorylation of eIF2α (Figure 20A). Immediately
following treatment with TG at 1 hour, we observed that the phosphorylation of
eIF2α was induced to a similar level in Con and Pten null cell lines. This level of
phospho-eIF2α remained for 8 hours before returning to baseline levels. By 24
81
hours, the phospho-eIF2α levels in Con cells were reduced back to control levels
whereas phosphorylation of eIF2α was again higher in the Pten null cells vs.
control ones. Thus, phosphorylation of eIF2α appeared to response to PTEN
signal and ER stress independently. Basal phosphorylation of eIF2α is altered
with PTEN status where phosphorylation of eIF2α is also robustly increased
transiently (lasting 8 hours) when UPR is induced. The former event, basal
phosphorylation of eIF2α changes with PTEN status, but is independent of ER
stress signals. Consistent with this UPR independent role of PTEN regulated
eIF2α phosphorylation, eIF2α phosphorylation correlated with induction of AKT
but not GRP78 expression in vivo when PTEN was lost (Figure 20B). These data
were consistent with the notion that PTEN and PI3K signal regulates the
integrated stress response regardless of the source of the stress since eIF2α
integrates all stress responses.

82
Grp94
Grp78

P-eIF2a
eIF2a
0 1 2 8 16 24
C M C M C M C M C M C M
TG (Hr)
β-actin
PDI
CHOP
p-AKT
AKT
PTEN
β-actin
GRP78
Con Pten null B.
A.

Figure 20. PTEN regulates eIF2α phosphorylation independent of ER
stress. A. ER stress was induced by treatment with 20nM TG in control (C) and
Pten null (M) hepatocytes to assess the response of the cells to ER stress. In
response to TG treatment, ER chaperone protein expressions (GRP78, 94 and
PDI) increased. No consistent differences were detected between control (C) and
Pten null (M) hepatocytes. Apoptotic factor CHOP was induced as a result of TG
treatment. Loss of Pten significantly attenuated the induction of CHOP. At basal
level, phospho-eIF2a was higher in Pten null (M) hepatocytes vs. controls (C).
This difference diminished in TG treated cells (at 1, 2 and 8 hours) and returned
16 hours after TG treatment. B. p-eIF2a correlated with p-AKT but not GRP78 in
mouse liver. No UPR stress was detected in Pten null livers. GRP78 levels wer
the same in liver lysates from Pten control (Con) and null mice.

83
III-2-4 PI3K/AKT signaling regulates the phosphorylation of eIF2α
To explore the signaling events that lead to the accumulation of
phosphor-eIF2α, we introduced PTEN into the Pten null cells to evaluate whether
this introduction could diminish the phosphorylation of eIF2α observed with PTEN
loss. Compared to the GFP transfected cells, introduction of wtPTEN led to
reduction in phospho-eIF2α (Figure 21A). The phosphatase dead mutant of Pten
(csPTEN) did not induce phosphorylation of eIF2α, suggesting that this basal
eIF2α phosphorylation depends on the phosphatase activity of PTEN. The
enhanced phosphorylation of eIF2α was also observed in the isogenic mouse
embryonic fibroblasts (mEFs) where PTEN was lost as well as HepG2 cells where
PTEN expression was relatively lower as compared to Huh 7 cells (Figure 21B).
To further interrogate the downstream signaling of PTEN, we manipulated
the PI3K signaling pathway using chemical inhibitors. LY294002 is an inhibitor for
PI3K and blocks the pathways downstream of PI3K signaling. We treated the
Pten null cells with an activated PI3K signaling pathway with LY294002 (20mM).
This treatment led to a time dependent reduction in the phosphorylation of eIF2α
that followed the inhibition of p-AKT (Figure 21C). The phosphorylated AKT was
dramatically decreased 30 min after LY294002 treatment and started to recover at
1 hour post treatment. Phospho-eIF2α started to reduce at 30 min but reached the
lowest levels 2 hours after treatment with LY294002. This long delay suggested
84
that the effect of PI3K/AKT on eIF2α phosphorylation is likely indirect. The level of
phospho-eIF2α recovered 6 hours after treatment following the complete recovery
of phospho-AKT. These data suggested that phosphorylation of eIF2α may be
regulated by AKT signaling.
To substantiate the potential regulation of eIF2α by PI3K/AKT and determine
if AKT is indeed involved in this regulation, we introduced constitutively active
myristylated AKT (CA), dominant negative AKT (DN), wildtype (WT) AKT, and
vector to the Con and Pten null hepatocytes (Figure 21D). In the control cells,
introduction of caAKT moderately induced phospho-eIF2α. Inhibition of AKT
activity with dominant negative AKT significantly reduced phospho-eIF2α,
suggesting that this basal level of phospho-eIF2α is at least partially dependent
on AKT activity. In Pten null cells, a similar trend is observed though more
moderate, likely due to the already induced hyper-phosphorylation of AKT and the
inability of DN-AKT to significantly reduce the activity of this hyperactive AKT.
85
A.
B.
C.
C M
p-eIF2α
eIF2α
PTEN
β-actin
Huh-7
Hepatocyte mEFs
C M
HepG2
Pten null hepatocytes
P-eIF2a
wtPTEN csPTEN GFP
eIF2a
P-AKT
actin
β-actin
p-eIF2α
Pten null + LY294002 (hours)
eIF2α
p-AKT
AKT
CON 0 0.5 1 2 4 6 8
1 0.9 0.8 0.8 0.7 0.9 0.9 0.6
D.
1 1.3 0.5 0.9 1 0.7 1.6 1.8 p-eIF2a/actin
p-eIF2α
β-actin
AKT: CA WT DN Vec
p-AKT
Con Pten null
CA WT DN Vec

86
Figure 21. PI3K/AKT signal regulates eIF2α phosphorylation. A. Expression
of wtPTEN in Pten null hepatocytes results in downregulation of eIF2a
phosphorylation. GFP, wtPTEN and csPTEN containing plasmids were
transfected into Pten null hepatocytes to evaluate their effects on p-eIF2a.
wtPTEN induced downregulation of p-eIF2a as compared to GFP controls but not
csPTEN. B. Hyper-phosphorylation of eIF-2a was observed in several cell lines
lacking PTEN: hepatocyte cell lines isolated from control (C) and Pten null (M)
mice, mouse embryonic fibroblasts (mEF) established from the Pten null (M) and
control (C) mice and human hepatocytes cell lines with differential levels of PTEN
expression (Huh 7 and HepG2). C. Treatment of Pten null hepatocytes with 20mM
PI3K inhibitor LY294002 leads to downregulation of p-eIF2a. Phospho-AKT was
blotted to confirm the inhibition. Phospho-eIF2α and eIF2α were also analyzed on
the same membrane. D. AKT constructs (CA, constitutive active; WT, wild type;
and DN, dominant negative) were transfected into Control (Con) and Pten null
hepatocytes to assess the role of AKT in the regulation of p-eIF2a. The
transfection efficiency was tested by examining p-AKT level. In both Con and Pten
null cell lines, transfection of CA-AKT results in induction of p-eIF2a. DN-AKT
significantly downregulates p-AKT and leads to almost 2 fold decrease in p-eIF2a
in control cells compared to vector transfected cells. In Pten null cells, AKT activity
is moderately inhibited, leading to moderate attenuation of eIF2a phosphorylation.
87
III-2-5 CReP downregulation mediates the hyper phosphorylation of eIF2α
in Pten null cells
The delayed response of phospho-eIF2α to LY294002 treatment comparing
to phospho-AKT suggested that the regulation of eIF2α phosphorylation by
PI3K/AKT signaling is not direct. We found that the stress related kinases such as
the ER stress induced PERK (Wek et al., 2006) are unlikely the mediators for the
observed basal level increase of eIF2α since ER stress induced response on
phospho-eIF2α does not differ between the two cell lines (data not shown).
RNA-dependent protein kinase (PKR) was previously reported to regulate PTEN
mediated eIF2α independent of PI3K (Mounir et al., 2009). We determined
whether PKR regulates the basal eIF2α phosphorylation we observed with the
unstressed hepatocytes. We found that PKR was not detected in the
untransfected and unstressed hepatocytes cell lines (data not shown), suggesting
that this kinase is unlikely to be responsible for the enhanced basal
phosphorylation of eIF2α observed with PTEN loss. We also were unable to
observe an appreciated changed in the phosphatase GADD34 (Novoa et al., 2001)
between Con and Pten null cells in the unstressed conditions (data not shown).
GADD34 was induced under ER stress while not detectable in unstressed cells
(Jousse et al., 2003; Kojima et al., 2003; Novoa et al., 2001). The lack of response
in GADD34 is consistent with the observation that UPR response did not differ
88
between control and Pten null cells. A homologue of GADD34, CReP is thought to
regulate the phosphorylation of eIF2α at basal level (Jousse et al., 2003) whereas
GADD34 responds to stress induced recovery of phospho-eIF2α. CReP was also
found to have a growth regulatory role (Harding et al., 2009), thus a more likely
candidate to integrate the chronic stress with adaptive growth response. In the
Pten null cells, we observed a significant decrease of CReP transcript level (figure
22A). The mRNA levels of CReP were 40% less in the Pten null cells vs. the
controls. Treatment of Pten control hepatocytes cell line with IGF-1 to induce PI3K
activity led to a significant downregulation of mRNA expression of CReP (figure
22B). Conversely, blocking PI3K activity in Pten null cell lines resulted in a
significant induction of CReP expression (figure 22B). Together, these data
suggested that PI3K signals regulates basal phosphorylation of eIF2α by
downregulating the phosphatase CReP.
To evaluate the relationship between the upregulation of eIF2α and
downregulation of CReP in Pten null cells and their response to cellular stresses,
we sought to reduce p-eIF2α by overexpressing CReP in the Pten null cells. We
found that the introduction of CReP was able to reduce the phosphorylation of
eIF2α (figure 22C). Consistently, we observed that 7.7% of the Pten null cells
were stained for PI in vector transfected hepatocytes without H
2
O
2
treatment,
comparing to the 0.3% in the untransfected cells shown in Figure 18. When
89
treated with H
2
O
2
, approximately 19% of the vector transfected cells underwent
cell death. Reintroduction of CReP into Pten null hepatocytes partially restored
their sensitivity to H
2
O
2
(figure 22D). When CReP was overexpressed, the
amount of dead cells almost doubled (37%). Transfection alone also induced
acute phosphorylation of eIF2α and hepatocytes death when cells were not
treated with H
2
O
2
, likely due to activation of stress kinases. This data indicated
that CReP downregulation and chronic low level of p-eIF2α is at least partially
responsible for the stress resistance phenotype observed with the Pten null cells.

90
A.
0
0.2
0.4
0.6
0.8
1.0
1.2
Relative mRNA (CReP)
Con
Pten null
C.
Pten null+vector+H
2
O
2
Pten null+CReP+H
2
O
2
p-eIF2α
eIF2α
P-eIF2a/eIF2a 1.1 1.3 1.4 1
Con
Con
+
vector
Mut
+
Vector
Mut
+
CReP
7.7% 19% 37%
0
0.4
0.8
1.2
*
*
Con+Veh
Con+IGF-1
Mut+Veh
Mut+Ly294002
Relative mRNA (CReP)
B.
D.

91
Figure 22. CReP is down-regulated in Pten null hepatocytes. A. Total RNA
from Con and Pten null hepatocytes was extracted and then reverse transcribed
into cDNA. Quantitative PCR was performed to compare the mRNA levels of
CReP in Con and Pten null cells. Each sample was assayed in triplicate and
repeated three times. *, p ≤0.05. B. Control and Pten null (Mut) hepatocytes
were treated with IGF-1 and LY294002 respectively to induce or inhibit PI3K/AKT
signalling. Induction of PI3K/AKT with IGF-1 in control cells leads to attenuation of
CReP mRNA expression. Inhibition of PI3K/AKT with LY294002 resulted in
induction of CReP mRNA expression. C. Transfection of CReP to Pten null (Mut)
hepatocytes leads to downregulation of p-eIF2a. D. Hepatocytes were transfected
with CReP or vector as control and then treated with 5mM H
2
O
2
for 72 hrs. Cell
death was evaluated by using PI staining followed by FACS analysis. CReP
transfection restores the sensitivity of Pten null hepatocytes H
2
O
2
treatment
induced cell death.

92
III-3 Discussion
The integrated stress response (ISR) is a defensive mechanism that cells
developed to cope with the environmental insults they encounter (Wek et al.,
2006). Phosphorylation/dephosphorylation of a translation initiation factor eIF2α
lies at the center of this integrated response. Phosphorylation of eIF2α induced by
stress kinases coordinate a network of translation and transcription response, the
ISR mechanism to lower cellular stress. When such stress is prolonged, the
response switches from survival to apoptosis. In this paper, we found that
activation of the mitogenic signaling pathway PI3K/AKT through deletion of Pten
resulted in the upregulation of basal phosphorylation of eIF2α in unstressed
hepatocytes. Our results indicate that chronic induction of low level eIF2α
phosphorylation mediated by downregulation of the PP1 partner CReP protects
the Pten null hepatocytes against oxidative stress-induced cell death.
Oxidative stress is one of the most common forms of stress that the cells
need to cope with. Oxygen radicals accumulate as a by-product of normal cellular
processes such as metabolism. A sophisticated anti-oxidant and oxygen radical
scavenger systems are integrated with the ISR to reduce oxidative stress and
allow cells to survive (Kultz, 2005). Cancer cells with high growth and metabolic
rates are often under higher oxidative stress than normal cells. Yet, cancer cells
are able to survive the highly stressful conditions and develop into tumors. It is
93
well established that cancer cells evoke survival mechanisms to evade
growth/survival regulation (Trachootham et al., 2008). However, whether and how
these mechanisms may interact with stress response to adapt to the stressful
environment is not known. Our study here showed that the cell growth/survival
signaling, PI3K/AKT pathway activation promotes the adaptive survival of
hepatocytes to oxidative stress. In liver cancer model where PI3K signaling is
upregulated due to loss of its negative regulator PTEN, the development of
tumors requires the underlying fatty liver disease in the Pten null mice (Galicia et
al., 2010; He et al.). High levels of ROS accompany this fatty liver condition. Our
data here clearly demonstrated that the Pten null hepatocytes are more
advantage at being able to grow and survive in this high ROS (as well as other
stress) environment.
Our data also indicated that the interaction of PI3K signalling with the ISR
defense mechanism is at the level of eIF2α, the translation regulator that controls
all stress related ISR. The unphosphorylated form of eIF2a is available to form the
eIF2α -GTP-tRNA
met
complex and initiates translation (Wek et al., 2006). In
response to cellular stress, eIF2α can be transiently phosphorylated by various
stress-induced kinases (PERK, HRI, PKR, and GCN) responding to different
stimuli. The phosphorylated eIF2α cannot participate in translation initiation,
resulting in repression of global translation and activation of selective gene
94
expression to alleviate stress conditions. The activation of PI3K signalling by
chronic loss of PTEN resulted in hyper-phosphorylation of eIF2α at basal
conditions when cells are not under stress. This hyper-phosphorylation is similar
to conditions where phosphorylation of eIF2α is uncoupled from upstream stress
kinases (Lu et al., 2004). When uncoupled with the stress kinases, the
hyper-phosphorylation of eIF2α at basal unstressed conditions enhanced the
cytoprotection response to lethal stress. Consistent with this observation, eIF2α
phosphorylation was found previously to protect cells against oxidative H
2
O
2
and
glutamate toxicity (Horie et al., 2004). Thus, chronic phosphorylation of eIF2α
resulting from activation of PI3K signalling may represent an adaptive response of
fast growing cells to stress.
The major contradictory to this observation is the report that PTEN,
independently of PI3K upregulated eIF2α and control translation (Mounir et al.,
2009). Under doxycycline induction (likely high stress) conditions, PTEN was
found to enhance phosphorylation of eIF2α by inducing the stress kinase PKR
through its C2 domain. Through this phosphorylation, PTEN was thought to
control translation independent of PI3K. This action involves acute stress
response at the stress sensing and not ISR response since PKR is induced in
cells where PTEN levels are manipulated through transfection and doxycycline
induction. Our observation with vector, GFP, PTEN and AKT construct
95
transfected experiments supported this possibility. Regardless of the gene
introduced, introduction of plasmids resulted in hyper-phosphorylation of eIF2α in
all cases. Thus, eIF2α phosphorylation may be differentially regulated at stressed
and unstressed conditions.
Phosphorylation/dephosphorylation of eIF2α can be controlled by several
enzymes including kinases and phosphatases (Wek et al., 2006). The four
kinases responding to different stresses act as sensors to integrate stresses with
cellular response by phosphorylating eIF2α. The major phosphatase involved in
extinguishing this signal is GADD34 (Kojima et al., 2003), the phosphatase that is
induced by stress through selective translation by eIF2α. These kinases and
GADD34 respond transiently to acute stress conditions but cannot explain the
adaptation response under low chronic stress. CReP controls the basal levels of
eIF2α phosphorylation in unstressed cells and may be significant for the adaptive
response of cells under chronic low levels of stress (Harding et al., 2009). Our
study indicated that overexpression of CReP can reduce the basal
phosphorylation of eIF2α and restore the sensitivity of PTEN deficient cells to
hydrogen peroxide-induced cell death. Thus, CReP mediated phosphorylation of
eIF2α likely acts as an adaptive response for the Pten null hepatocytes to cope
with the high levels of cellular stress. Genetic studies targeting GADD34 and
CReP respectively also support a role of CReP and not GADD34 in integrating
96
growth signal with stress response (Harding et al., 2009). Loss of CReP led to
growth retardation (Harding et al., 2009) whereas mutants lacking GADD34 was
phenotypically indistinguishable from the wild type controls (Marciniak et al., 2004;
Silva et al., 2005).
Cellular adaptation to environmental stress is a major mechanism for tumor
cells to respond to its stressful environment. The molecular mechanism for such
response is not understood. Our study provided a novel molecular mechanism on
how activation of PI3K/AKT signaling may allow cells to deal with the stress
conditions and ultimately adapt to and survive the new environment. This adaptive
response of the Pten null hepatocytes to oxidative (and other) stress may allow
them to survive the stressful environment of fatty liver in vivo and play a role in the
development of tumors. Our study uncovered a novel role of PTEN in regulating
the adaptive response of cancer cells to chronic stress through modulating
CReP/eIF2α pathway.

97
Chapter IV
Overall discussion

Aging is a complicated process that involves regulatory and functional
changes in a broad range of cellular activities. Here I investigated how aging is
regulated by studying two representative events, tissue maintenance and ROS
response.
Decline of circulating IGF-1 levels is a major systemic change with aging
(Laron, 2005). This decline accompanies the increased inability of tissues repair
and restricted cell regeneration. In pancreas, the inability of beta cells to replenish
their own mass and compensate for the lost function is the major contributing
factor for the pathological stage. I used beta cells as the model to study
mechanisms that control the aging-induced decline in cell regeneration. My data
suggested that the IGF-1 pathway play a critical role in regulating this process.
Deletion of Pten, which leads to activation of the IGF-1 pathway, promotes beta
cell proliferation and regeneration in old but not young animals. My work also
demonstrated that the cell cycle inhibitor p16 is a downstream target of the
IGF-1/PTEN pathway, and such regulation is mediated by the cyclinD1/E2F/Ezh2
axis. Increased expression of p16 has been observed with aging, concurrent with
declined circulating IGF-1 levels. My studies for the first time proposed a
98
mechanistic link between these two aging events and suggested the critical role of
this regulatory pathway in cell regeneration during aging.
P16 is not only a cell cycle regulator, but also a key regulator in senescence
(Collins and Sedivy, 2003). Demonstrating that p16 is regulated by IGF-1 pathway,
my results suggested that the declined IGF-1 signaling might also contribute the
increased incidence of cell senescence under aging scenario. Activation of this
pathway by Pten deletion suppresses the induction of p16 and thus inhibits
senescence, which may explain why PTEN loss can maintain a relatively high
proliferation rate in beta cells without inducing cell senescence during aging.
In primary cell culture, rapid growth of cells eventually subsides and results in
replication senescence. Loss of p16 is necessary for these cells to become
sustainable cultures or “immortalized”. If experiencing aberrant mitogenic
signaling, e.g. Ras activation and thus undergoing uncontrolled proliferation, cells
are also induced to enter a senescent stage to avoid further undesired tissue
growth (Collado et al., 2007). This evidence suggests that p16 expression is
necessary for suppressing uncontrolled growth, possibly to prevent
hyper-proliferative diseases. In vivo, many aged tissues, especially the stem cell
compartment, express higher levels of p16. Studies have shown that p16
inhibition can at least partially restore the self-renewal and regenerative potential
of hematopoietic stem cells and forebrain progenitors, confirming the key role of
99
p16 in controlling stem cell aging (Janzen et al., 2006; Molofsky et al., 2006).
Tissue stem cells serve as the major reservoir of diverse somatic cells in
tissue maintenance. The inability of tissue stem cells to replenish lost cells in aged
individuals is the main cause for degenerative diseases such as Parkinson’s and
Alzheimer’s diseases. During development, tissue stem cells divide in order to
maintain its own population whilst at the same time, portions of stem cells
differentiate into other more functional cell types. At post development stage, this
process slows down to a level that is needed to maintain the organ and tissue
size/function. In older individuals, this process slows down even further, rendering
the inability to maintain proper organ size and eventually normal functions. Thus,
understanding how tissue stem cells maintain organ and tissue size in young and
adult tissues is a major question in aging research. Like tissue stem cells,
pancreatic beta cells undergo self-renewal to accomplish replenishment (Dor et
al., 2004). In addition, beta cells also exhibit a dramatic aging process with
decreased regenerative capability as the major phenotype (Rankin and Kushner,
2009; Tschen et al., 2009). These similarities between stem cells and beta cells
suggest that the regulatory mechanism for beta cells aging that is identified in this
study may also be applied to stem cells.
In addition to cell regeneration and senescence, ROS-induced damages are
another hallmark for aging. ROS produced in oxidation of energy storage
100
molecules and accumulated during aging are detrimental for macromolecules and
thus the major cause for oxidative stress. Cells at high metabolic status are more
likely to suffer from ROS-induced stress due to the higher levels of oxidation rate.
My study used hepatocytes, a cell type that is active in metabolism, as the cell
model and indicated that the IGF-1/PTEN pathway is critical for the cellular
response to ROS and oxidative stress. Pten deletion confers hepatocytes
resistance to oxidative stress induced cell death, suggesting that activation of
IGF-1 pathway is protective for cells against ROS, which acculturate during the
aging process.
Together, these two projects demonstrated that the IGF-1 pathway
modulates cell regeneration, senescence and ROS response, all of which are
closely related to aging. Given that IGF-1 levels goes down with growth hormone
during aging, my study defined novel regulatory mechanisms for aging that link
together the systemic changes (GH/IGF-1 decline) with cellular events (cell
regeneration restriction and ROS accumulation) and molecular factor regulation
(p16 upregulation, eIF2 phosphorylation and CReP downregulation).
The IGF-1/PI3K/PTEN pathway is also known to be involved in the
tumorigenic process. Indeed, PTEN loss in the liver as well as many other tissues
may result in susceptibility to tumor formation. However, the correlation between
Pten deletion and cancer development has not been observed in beta cells. The
101
discrepant phenotypes in beta cells and hepatocytes raise an interesting question:
why PTEN loss causes tumor formation in some tissues but not in the others?
Pancreatic beta cells serve as their own progenitors to replenish through
self-renewal but they are mono-lineage. When these “progenitors” are activated,
by Pten deletion for example, beta cells are the only cell types that are produced
and thus no cancer cells will develop. In contrast, liver is regenerated through liver
progenitors when the ability of hepatocytes to proliferate is defective or damage is
too severe. Liver progenitor cells can differentiate into multiple cell types.
Recently, our study demonstrating that Pten deletion in the liver activates tumor
initiating cells which eventually give rise to multi cancer types including
hepatocellular carcinoma and cholangiocarcinoma (Galicia et al., 2010). Thus,
unlike beta cells which is monolineage, inducing proliferation of multi-lineage
progenitors not only leads to production of differentiated liver cells, but may also
give rise to cancer stem cells that can further result in cancer formation. In
addition to the presence of progenitors, another significant difference between
beta cells and hepatocytes lies in metabolism. It has been noted for a long time
that organisms with higher metabolic rates usually exhibit shorter lifespans, a
phenomenon possibly due to the excessive production of ROS and thus
irreversible damages of macromolecules (Finkel and Holbrook, 2000).
Accumulation of ROS-induced DNA damages as well as structural disruption of
102
proteins over time results in the development of aged-related disorders with
cancer being one of those that are the most detrimental. Similarly, the liver is one
of the organs with the highest metabolic levels and thus is most likely to suffer
from ROS-induced damages, which is also the major cause of oxidative stress.
Under normal conditions, cells that fail to relief oxidative stress will be removed
through cell death. However, as indicated by our present study, PTEN loss
protects the damaged cells from cell death. As a result, the damages will keep
accumulating and eventually lead to mutations that cause cancers.
In this study, proliferation was used as the phenotypic readout of
regeneration, and oxidative stress is an important initiating factor for cancer
development. In the future, it would be interesting to study whether and how these
two cellular activities are interconnecting. Previous studies have reported that low
levels of oxidants activate mitogenic signaling, e.g. ERK, in a growth factor
dependent manner (Sachsenmaier et al., 1994; Wang et al., 2000). Meanwhile,
activation of growth signaling, like Ras, in primary cell culture will lead to
replicative senescence as well as increased oxidant levels (Lee et al., 1999;
Serrano et al., 1997), and this process is significantly slow down in cells grown in
low oxygen environment or treated with antioxidants (Finkel and Holbrook, 2000).
It is still not clear what mechanisms contribute to these observations, but clearly
cell growth and oxidative stress can crosstalk and interact with each other. Our
103
presented study of PTEN in proliferation and stress response suggest that PTEN
might be a critical player in coordinating these two processes. PTEN loss not only
stimulates the mitotic activity through activating the PI3K pathway, but may also
confer the proliferating cells resistance to oxidative stress that is induced by the
mitotic signaling. Interestingly, p16, the anti-aging effector of PI3K and PTEN
pathway, has been demonstrated to be a key regulator in senescence induced by
either aberrant growth or excessive stresses (Collado et al., 2007), further
supporting that PTEN signaling are critical in the interaction between growth and
stress.
Both regeneration and cancer are important aspects of the aging process. In
many tissues, aging is accompanied with declined regenerative capability in either
the cells of interest or their stem cells, which leads to deficiency in tissue repair
and thus age-related symptoms. In some other tissues, however, mutations
accumulated during aging leads to uncontrolled growth and thus cancer
phenotype. As a result, it is crucial to balance regeneration maintenance and
cancer formation during aging. To develop therapies for these aging-related
disorders, it is critical to keep in mind that treatments that are beneficial for certain
conditions might be detrimental under other circumstances. PTEN loss, for
instance, prevents the onset of diabetes when happens in beta cells but induces
cancer development in the liver. On the other hand, administrations of PI3K/AKT
104
inhibitors are potential anti-cancer therapy but at the same time may also affect
the glucose homeostasis in peripheral tissues and thus cause diabetes. One
solution for this problem is to develop organ-specific targeted therapy. PTEN
inactivation that is restricted in beta cells only will not increase the chance of
cancer development in the liver. Similarly, in vitro expansion of beta cell mass by
PTEN manipulation followed by transplantation into diabetic patients could also
be an ideal diabetes treatment without the risk of cancer formation.

105
Chapter V
Materials and methods

Animals - Targeted deletion of Pten in the beta cells was achieved by
crossing Pten
loxP/wt
; Rip-Cre
+
; Rosa-LacZ mice with Pten
loxP/loxP
; Rip-Cre
-
;
Rosa-LacZ mice to generate Pten
loxP/loxP
; Rip-Cre
+
; Rosa-LacZ mice (Pten null).
Pten
wt/wt
; Rip-Cre
+
; Rosa-LacZ and Pten
loxP/loxP
; Rip-Cre
-
; Rosa-LacZ mice were
used as controls (Con). Introduction of the Rosa-LacZ reporter gene does not
cause any detectable phenotypic change in metabolism and pancreas
morphology. Consistent with our previous observations in the Pten
loxP/loxP
;
Rip-Cre
+
mice (Stiles et al., 2006b), the Pten null (Pten
loxP/loxP
; Rip-Cre
+
;
Rosa-LacZ) mice displayed an increase in islet mass, lower fasting glucose levels,
and higher mitotic activity in the b-cells at 3 months of age compared with control
mice (Supplemental Fig 7). Animals of indicated age were used for experiments.
To induce beta cell injury, mice were injected i.p. with 50mg of streptozotozin
(Sigma) per kg of body weight daily for five consecutive days. Nine months old
Pten
loxP/loxP
; Rip-CreER
+
; Rosa-LacZ mice were used for inducing deletion of Pten
in adult mice. Induction is accomplished with 5 injections of tamoxifen (a total
dose of 30 mg) as previously reported (Dor et al., 2004).

106
Pten
loxP/loxP
; Alb-Cre
+
(Mut, Pten null) and Pten
loxP/loxP
; Alb-Cre
-
(Con) mice
were developed and characterized as previously described (Stiles et al., 2004c).
All animals were housed in a temperature-, humidity-, light-controlled room (12-h
light/dark cycle), allowing free access to food and water. All experiments were
conducted according to the Institutional Animal Care and Use Committee of the
University of Southern California research guidelines.

Cell culture - U87 cells were engineered to express PTEN under the control
of a doxycycline inducible promoter (Woiwode et al., 2008). Cells were grown in
DMEM supplemented with 10% Tet-free FBS, G418 at 1 mg/ml, and blasticidine
at 10 µg/ml. Cells were treated with 1 µg/ml doxycycline for 0, 6, 24, and 48 hours
in order to induce PTEN expression.
Immortalized hepatocyte cell lines were established from livers of CON and
Pten null (Mut) mice (Xu et al., 2006). Briefly, freshly isolated hepatocytes were
immortalized spontaneously with long term culturing using a 3T3 protocol and
maintained in Dulbecco's Modified Eagle Medium (DMEM, Mediatech, Manassas,
VA) supplemented with 10% fetal bovine serum (US Scientific, Ocala, FL), 5
ug/ml insulin (Sigma, St. Louis, MO), 10 ng/ml epidermal growth factor (EGF,
Invitrogen, Carlsbad, CA) (Xu et al., 2006). Control (Pten
+/+
) and Pten null (Pten
-/-
)
mouse embryonic fibroblasts (kindly provided by Dr. Hong Wu, University of
107
California at Los Angeles) (Chang et al., 2008), HepG2 (obtained from USC liver
core facility), Huh-7 (a generous gift from Dr. James Ou, University of Southern
California), and PLC.PRF/5 (provided by Dr. Aiwu Ruth He, Georgetown
University) were cultured in DMEM supplemented with 10% fetal bovine serum.
Hep3B cells were provided by Dr. Shelly Lu, University of Southern California and
cultured in DMEM with 10% FBS and 1×non-essential amino acids (Invitrogen,
Carlsbad, CA). SNU398, SNU449 and SNU475 (from Dr. Aiwu Ruth He,
Georgetown University) were cultured in RPMI1640 (Mediatech, Manassas, VA)
with 10% FBS.

Human Islets - Human islets were isolated from brain dead cadaveric donor
pancreata preserved in University of Wisconsin (UW) solution. Islet isolation was
carried out using the modification of the previously published work using standard
collagenase for pancreas digestion and Biocoll continuous density gradients was
used for islet purification (Ricordi et al., 1988). Briefly, pancreas was initially
perfused with collagenase for 10 min at 4ºC then digestion was completed at
37ºC. Dithizone was used to stain the islets and used for assessing purity,
integrity, and islet count. Islets were collected and processed immediately post
isolation for RNA and protein extraction. Islets with >80% purity and >90% viability
were used to carry out this study. All experiments were conducted with approval
108
of City of Hope Institutional Review Board (IRB).

Plasmids/shRNA and tranfection - pcDNA cyclinD1 T286A was obtained
from Addgene (Addgene plasmid 11182) (Newman et al., 2004). Cyclin D2 was
amplified from mouse cDNA library and ligated with pcDNA construct (Invitrogen).
Cyclin D2 T280A was generated by mutating Adenine at the +838 position into
Guanine. Ezh2 -1283 to +60bp promoter was cloned from mouse genomic DNA
and inserted into pGL2 luciferase reporter vector (Promega). Gene knockdown
was performed by introducing pSilencer-U6 neo or puro plasmids containing
sequence specific shRNA using the BioT transfection reagent (Bioland Scientific
LLC). Twenty-four hours after transfection, cells were selected with 0.5-1.0 mg/ml
G418 (Invitrogen) for 6 days or 1.0-1.5 µg/ml puromycin (Sigma) for 4 days.
Hepatocytes were transfected using the Lipofectamine2000 system
(Invitrogen, Carlsbad, CA) as described in the manufacturer’s instructions. Cells
were culture in 6-well plates (1-2 × 10
5
cells/well) overnight to allow attachment.
Four microgram DNA was delivered using 8 µg Lipofectamine 2000 in serum-free
medium. Cells were harvested 24 hrs after transfection.
pIRES CA-AKT and WT-AKT were constructed by inserting the coding
sequence of the genes into the multiple cloning site of pIRES-GFP vector. The
original constructs for PTEN, csPTEN, CA-AKT, DN-AKT and WT-AKT were
109
obtained from Dr. Hong Wu (Liliental et al., 2000). pIRE-GFP is used as control
vector for all experiments where pIRES constructs are used. pSG5-wtPTEN was
from Addgene (plasmid 10750) and provided by Dr. William Sellers (Ramaswamy
et al., 1999). pFLAG-CReP (amino acid 24-698) was from Dr. David Ron
(Jousse et al., 2003). We subcloned the coding sequence into the
p3xFLAG-myc-CMV™-26 vector from Sigma (St. Louis, MO).

SA-β-gal assay - Freshly isolated pancreases were fixed in 4%
paraformaldehyde for 3 hours at 4ºC, balanced in 30% sucrose solution overnight
at 4 ºC , and then embedded in OCT. Five µm sections were stained for
senescence associated β-gal using SA- β-gal assay kit according to manufacture
instructions (Biovision, Inc.) and counter stained with fast nuclear red (Sigma, St.
Louis, MO).

Mouse islet isolation - Pancreases were perfused with collagenase P
solution (0.5-0.8 mg/ml) and digested at 37 ºC for 13-17 min. Islets were then
purified by using Ficoll gradients with densities of 1.108, 1.096, 1.069 and 1.037
(Cellgro) as previously reported (Stiles et al., 2006b). Dithizone was used to verify
the purity of the islets.

110
Immunohistochemistry - Zn-formalin fixed and paraffin embedded sections
were stained as previously reported(Stiles et al., 2006b). Antibodies used are:
PTEN (Cell Signaling Tech. #9559), cyclin D1(Santa Cruz, sc-8396), p16
ink4a

(Santa Cruz, sc-1661), p27 (Santa Cruz, sc-1641), insulin (Invitrogen).
Antibodies for other pancreatic hormones were provided by Zymed.

CldU and IdU labeling - Ten weeks old mice were fed with drinking water
containing 1 mg/ml CldU for 8 days, followed by 2 days of regular drinking water
with no label, followed by another 8 days of 1mg/ml IdU containing water. CldU
and IdU staining was performed as previously reported (Teta et al., 2007a).

Western blot - Cell lysate preparation and immunoblot analysis were
performed as described (Rountree et al., 2009). Briefly, cells or tissues were lysed
in cell lysis buffer. Supernatants of the lysates were subjected to SDS-PAGE and
then transferred to PVDF membranes. Antibodies used: p16
ink4a
(Santa Cruz,
F-12 or M-156), PTEN (Cell Signaling Tech., #9552), pAKT (Cell Signaling Tech.,
#4060), AKT (Santa Cruz, sc-8312), p27 (Santa Cruz, sc-1641), cyclinD1 (Santa
Cruz, sc-8396), Cyclin D2 (Cell Signaling Tech.), p53 (Cell Signaling Tech.),
p-ERK (Cell Signaling Tech.), GAPDH (Santa Cruz), β-actin (Sigma), tubulin
(Abcam). Antibodies against phospho-eIF2α, eIF2α, phosphor-ERK,
111
phospho-AKT, PTEN, PKR, caspase-8 and-9 were from Cell Signaling
Technology (Danvers, MA); anti-AKT, anti-KDEL, anti-CHOP and anti-GRP78
antibodies were from Santa Cruz Biotechnology (Santa Cruz, CA); anti-actin
antibody was from Sigma (St. Louis, MO). Anti-fatty acid syntheses (FAS)
antibody was obtained from Millipore (Billerica, MA). Anti phospho-PKR antibody
was from Abcam (Cambridge, MA). Anti caspase-3 antibody was from BD
Biosciences (San Diego, CA).

RNA isolation and quantitative RT-PCR analysis - Total RNA was
isolated using TRIzol (Invitrogen, Carlsbad, CA) following the manufacturer’s
instructions. Reverse transcription and quantitative PCR were performed using
M-MLV reverse transcriptase system (Promega, Madison, WI) and Maxima™
SYBR Green qPCR Master Mix (Fermentas, Glen Burnie, MD) following the
manufacturer’s instructions. For mEFs, Real-time PCR reactions were performed
on the ABI 7900HT Fast Real-Time PCR System. Primers used for real-time PCR
are listed in Table 1 & 2.

112
Table 1. Primers used for qPCR analysis for mouse genes

Gene Forward primer Reverse primer
Pten TGAAGACCATAACCCACCACA TCATTACACCAGTCCGTCCCT
p16
Ink4a
CGGTCGTACCCCGATTCAG GCAGTTCGAATCTGCACCGTAG
CyclinD1 TCCGCAAGCATGCACAGA GGTGGGTTGGAAATGAACTTCA
Ezh2 TCAAAACCGCTTTCCTGG TGTCCCAATGGTCAGCA
Bmi-1 AATTAGTCCCAGGGCTTTTCAA TCTTCTCCTCATCTGCAACTTCT
C
Gapdh TGCACCACCAACTGCTTA GGATGCAGGGATGATGTTC

Table 2. Primers used for qPCR analysis for human genes

Gene Forward primer Reverse primer
Pten ACCAGTGGCACTGTTGTTTCA
C
TTCCTCTGGTCCTGGTATGAAG
p16
Ink4a
GCTGCCCAACGCACCGAATA ACCACCAGCGTGTCCAGGAA
p27 AAGGAAGCGACCTGCAACC TCTGAGGCCAGGCTTCTTG
p53 TGCGTGTGGAGTATTTGGATG TGGTACAGTCAGAGCCAACCTC
p21 CCATGTGGACCTGTCACTGT TGGTAGAAATCTGTCATGCTGGTC
Gapdh GAAGGTGAAGGTCGGAGTC GAAGATGGTGATGGGATTTC

113
For hepatocytes, Gene-specific primers for CReP: forward 5’-AGTCTC
TGAGTTCACTGCGGC-3’, reverse 5’-GGCGCTGCAGAGTCTAAAGC-3’.
GAPDH: forward 5'-GCACAGTCAAGGCCGAGAAT-3', reverse 5'-GCCTT
CTCCATGGTGGTGAA-3'. The cycling condition was 95°C for 5 min followed by
amplification for 40 cycles at 95°C for 30 sec, 60°C for 30 sec and 72°C for 30 sec
in the Bio-Rad iCycler. Relative expression of mRNA levels was determined
(using GAPDH as a standard) using the delta-delta Ct method (Pfaffl, 2001; Wu et
al., 2009).

Chromatin Immunoprecipitation assay - ChIP assay was performed as
previously reported (Wu and Shih). Briefly, MEFs cultured in 20-cm dishes were
treated with 1% formaldehyde upon confluence to cross-linked proteins with
DNAs, followed by sonication with the Branson 450 sonifier to shear genomic
DNA. The supernatant was then immunoprecipitated with anti-H3K27m3 or
anti-H3 antibodies (Santa Cruz) as well as Protein G-agarose at 4°C overnight.
After wash, elution and reverse crosslink, the precipitated DNA fragments were
purified using QIAquick PCR Purification Kit (Qiagen) and then used as the
templates for PCR analysis. Primers used for qPCR are listed in Table 3.

114
Table 3. Primers used for ChIP assay

Location Forward primer Reverse primer
Arf promoter GAGTACAGCAGCGGGAGCAT GAACTTCACCAAGAAAACCCTCT
CT
Ink4b promoter CGACGGGAGGCAGGTTTT CAATCTAGTGCCGAGGGATGTT
Ink4a promoter GTCCGATCCTTTAGCGCTGTT AGCCCGGACTACAGAAGAGATG
Ink4a exon 1
CCGGAGCCACCCATTAAACTA CAAGACTTCTCAAAAATAAGACA
CTGAAA
Ink4a between
exon 2 and 3
CCCAACACCCACTTGAGGAA CAGAGGTCACAGGCATCGAA

115
Luciferase assay - Ezh2 promoter luciferase reporter construct was
co-transfected into mEFs with pRL-TK, which serves as internal control
(Promega). Transfections were performed with the BioT transfection reagent
(Bioland Scientific LLC) using 12-well plates. Forty-eight hours after transfection,
cells were lysed, and luciferase activity was assayed using the Dual-Luciferase
Reporter Assay System (Promega) (Wu et al., 2009).

Xenograft - Nude mice 3-4 month of age were obtained from Jackson’s
laboratory (Ann Harbor, Vt). Single cell suspensions of Con and Mut
hepatocytes were obtained and prepared at four different concentrations (5×10
5
,
1×10
6
, 5×10
6
, and 1×10
7
). Each mouse was injected subcutaneously with 0.1 ml
cell suspension. Tumor growth was observed and experiments were terminated
3 months later when the volume of the largest tumor reached 1.5 cm
2
.

Reagents - L-glutamic acid and SIN-1 were obtained from Sigma (St. Louis,
MO); H
2
O
2
was provided by Fisher Scientifics (Pittsburgh, PA); LY294002 was
purchased from Cell Signaling Technology (Danvers, MA). Caspase-12 Inhibitor
Z-ATAD-FMK was from BioVision (Mountain View, CA).

116
Cell survival assay - Cells were seeded at a density of 3 × 10
3
cells/96-well
plate, and then treated with H
2
O
2
, L-glutamic acid or SIN-1 at 37°C, 5% CO
2
with
indicated doses. After 24 hours of treatment, 3-(4,5-Dimethylthiazol-2-yl)2,5-
diphenyl tetrazolium bromide (MTT, 50 µg/ml) was added into the culture and
mixed by tapping gently on the side of the tray. After incubating at 37°C for 4 h,
the formazan crystals were dissolved by adding DMSO and then incubating at
37°C for 30 min, and the absorbance at 570 nm was measured on a microplate
reader. Each sample was assayed in pentad.

Propidium iodide (PI) staining and flow cytometry - Hepatocytes were
plated in 12-well plates at the density of 0.5-1 X 10
5
cells/well. After treating with
10mM H
2
O
2
for 24 hrs, cells were trypsinized and then collected by centrifuge. As
described previously (Stiles et al., 2002), cells re-suspended in PBS were stained
with 1 ug/ml propidium iodide (PI) for 15 min at room temperature. Samples were
then analyzed immediately using the BD LSR II flow cytometry system.

Statistical Analysis - The data are presented as means ± the standard error
of the mean (SEM). Differences between individual groups were analyzed by
Student’s t test, with two-tailed p values less than 0.05 considered statistically
significant.
117
Bibliography

Alt, J.R., Cleveland, J.L., Hannink, M., and Diehl, J.A. (2000). Phosphorylation-dependent
regulation of cyclin D1 nuclear export and cyclin D1-dependent cellular transformation.
Genes Dev 14, 3102-3114.

Bartke, A. (2011). Growth hormone, insulin and aging: the benefits of endocrine defects.
Exp Gerontol 46, 108-111.

Berger, A.H., Knudson, A.G., and Pandolfi, P.P. (2011). A continuum model for tumour
suppression. Nature 476, 163-169.

Blackburn, E.H. (2000). Telomere states and cell fates. Nature 408, 53-56.

Bokov, A.F., Garg, N., Ikeno, Y., Thakur, S., Musi, N., DeFronzo, R.A., Zhang, N., Erickson,
R.C., Gelfond, J., Hubbard, G.B., et al. (2011). Does reduced IGF-1R signaling in Igf1r+/-
mice alter aging? PLoS One 6, e26891.

Campisi, J. (2005). Senescent cells, tumor suppression, and organismal aging: good
citizens, bad neighbors. Cell 120, 513-522.

Cardone, M.H., Roy, N., Stennicke, H.R., Salvesen, G.S., Franke, T.F., Stanbridge, E., Frisch,
S., and Reed, J.C. (1998). Regulation of cell death protease caspase-9 by phosphorylation.
Science 282, 1318-1321.

Chang, C.J., Mulholland, D.J., Valamehr, B., Mosessian, S., Sellers, W.R., and Wu, H. (2008).
PTEN nuclear localization is regulated by oxidative stress and mediates p53-dependent
tumor suppression. Mol Cell Biol 28, 3281-3289.

Chen, H., Gu, X., Liu, Y., Wang, J., Wirt, S.E., Bottino, R., Schorle, H., Sage, J., and Kim, S.K.
(2011). PDGF signalling controls age-dependent proliferation in pancreatic beta-cells.
Nature 478, 349-355.

Chen, H., Gu, X., Su, I.H., Bottino, R., Contreras, J.L., Tarakhovsky, A., and Kim, S.K. (2009).
Polycomb protein Ezh2 regulates pancreatic beta-cell Ink4a/Arf expression and
regeneration in diabetes mellitus. Genes Dev 23, 975-985.

Collado, M., Blasco, M.A., and Serrano, M. (2007). Cellular senescence in cancer and aging.
118
Cell 130, 223-233.

Collins, C.J., and Sedivy, J.M. (2003). Involvement of the INK4a/Arf gene locus in
senescence. Aging Cell 2, 145-150.

Corpas, E., Harman, S.M., and Blackman, M.R. (1993). Human growth hormone and human
aging. Endocr Rev 14, 20-39.

Datta, S.R., Dudek, H., Tao, X., Masters, S., Fu, H., Gotoh, Y., and Greenberg, M.E. (1997).
Akt phosphorylation of BAD couples survival signals to the cell-intrinsic death machinery.
Cell 91, 231-241.

Dhawan, S., Tschen, S.I., and Bhushan, A. (2009). Bmi-1 regulates the Ink4a/Arf locus to
control pancreatic beta-cell proliferation. Genes Dev 23, 906-911.

Diniz, Y.S., Faine, L.A., Galhardi, C.M., Rodrigues, H.G., Ebaid, G.X., Burneiko, R.C.,
Cicogna, A.C., and Novelli, E.L. (2005). Monosodium glutamate in standard and high-fiber
diets: metabolic syndrome and oxidative stress in rats. Nutrition 21, 749-755.

Dor, Y., Brown, J., Martinez, O.I., and Melton, D.A. (2004). Adult pancreatic beta-cells are
formed by self-duplication rather than stem-cell differentiation. Nature 429, 41-46.

Dorman, J.B., Albinder, B., Shroyer, T., and Kenyon, C. (1995). The age-1 and daf-2 genes
function in a common pathway to control the lifespan of Caenorhabditis elegans. Genetics
141, 1399-1406.

Finch, C.E. (1976). The regulation of physiological changes during mammalian aging. Q
Rev Biol 51, 49-83.

Finkel, T., and Holbrook, N.J. (2000). Oxidants, oxidative stress and the biology of ageing.
Nature 408, 239-247.

Fujita, N., Sato, S., Katayama, K., and Tsuruo, T. (2002). Akt-dependent phosphorylation of
p27Kip1 promotes binding to 14-3-3 and cytoplasmic localization. J Biol Chem 277,
28706-28713.

Galicia, V.A., He, L., Dang, H., Kanel, G., Vendryes, C., French, B.A., Zeng, N., Bayan, J.A.,
Ding, W., Wang, K.S., et al. (2010). Expansion of hepatic tumor progenitor cells in Pten-null
mice requires liver injury and is reversed by loss of AKT2. Gastroenterology 139,
2170-2182.
119

Geiger, H., and Van Zant, G. (2002). The aging of lympho-hematopoietic stem cells. Nat
Immunol 3, 329-333.

Georgia, S., and Bhushan, A. (2006). p27 Regulates the transition of beta-cells from
quiescence to proliferation. Diabetes 55, 2950-2956.

Gergel, D., Misik, V., Ondrias, K., and Cederbaum, A.I. (1995). Increased cytotoxicity of
3-morpholinosydnonimine to HepG2 cells in the presence of superoxide dismutase. Role
of hydrogen peroxide and iron. J Biol Chem 270, 20922-20929.

Harding, H.P., Zhang, Y., Scheuner, D., Chen, J.J., Kaufman, R.J., and Ron, D. (2009).
Ppp1r15 gene knockout reveals an essential role for translation initiation factor 2 alpha
(eIF2alpha) dephosphorylation in mammalian development. Proceedings of the National
Academy of Sciences of the United States of America 106, 1832-1837.

Harman, D. (1956). Aging: a theory based on free radical and radiation chemistry. J
Gerontol 11, 298-300.

He, L., Hou, X., Kanel, G., Zeng, N., Galicia, V., Wang, Y., Yang, J., Wu, H., Birnbaum, M.J.,
and Stiles, B.L. The critical role of AKT2 in hepatic steatosis induced by PTEN loss. Am J
Pathol 176, 2302-2308.

Holzenberger, M., Dupont, J., Ducos, B., Leneuve, P., Geloen, A., Even, P.C., Cervera, P.,
and Le Bouc, Y. (2003). IGF-1 receptor regulates lifespan and resistance to oxidative stress
in mice. Nature 421, 182-187.

Horie, Y., Suzuki, A., Kataoka, E., Sasaki, T., Hamada, K., Sasaki, J., Mizuno, K., Hasegawa,
G., Kishimoto, H., Iizuka, M., et al. (2004). Hepatocyte-specific Pten deficiency results in
steatohepatitis and hepatocellular carcinomas. J Clin Invest 113, 1774-1783.

Hu, Z., Wang, H., Lee, I.H., Modi, S., Wang, X., Du, J., and Mitch, W.E. (2010). PTEN
inhibition improves muscle regeneration in mice fed a high-fat diet. Diabetes 59,
1312-1320.

Janzen, V., Forkert, R., Fleming, H.E., Saito, Y., Waring, M.T., Dombkowski, D.M., Cheng, T.,
DePinho, R.A., Sharpless, N.E., and Scadden, D.T. (2006). Stem-cell ageing modified by the
cyclin-dependent kinase inhibitor p16INK4a. Nature 443, 421-426.

Jo, M., Nishikawa, T., Nakajima, T., Okada, Y., Yamaguchi, K., Mitsuyoshi, H., Yasui, K.,
120
Minami, M., Iwai, M., Kagawa, K., et al. Oxidative stress is closely associated with tumor
angiogenesis of hepatocellular carcinoma. Journal of gastroenterology 46, 809-821.

Jousse, C., Oyadomari, S., Novoa, I., Lu, P., Zhang, Y., Harding, H.P., and Ron, D. (2003).
Inhibition of a constitutive translation initiation factor 2alpha phosphatase, CReP,
promotes survival of stressed cells. J Cell Biol 163, 767-775.

Kamrava, M., Gius, D., Casagrande, G., and Kohn, E. Will targeting insulin growth factor
help us or hurt us?: An oncologist's perspective. Ageing research reviews 10, 62-70.

Katso, R., Okkenhaug, K., Ahmadi, K., White, S., Timms, J., and Waterfield, M.D. (2001).
Cellular function of phosphoinositide 3-kinases: implications for development,
homeostasis, and cancer. Annu Rev Cell Dev Biol 17, 615-675.

Kawano, T., Ito, Y., Ishiguro, M., Takuwa, K., Nakajima, T., and Kimura, Y. (2000). Molecular
cloning and characterization of a new insulin/IGF-like peptide of the nematode
Caenorhabditis elegans. Biochem Biophys Res Commun 273, 431-436.

Kenyon, C., Chang, J., Gensch, E., Rudner, A., and Tabtiang, R. (1993). A C. elegans mutant
that lives twice as long as wild type. Nature 366, 461-464.

Kim, W.Y., and Sharpless, N.E. (2006). The regulation of INK4/ARF in cancer and aging. Cell
127, 265-275.

Kojima, E., Takeuchi, A., Haneda, M., Yagi, A., Hasegawa, T., Yamaki, K., Takeda, K., Akira,
S., Shimokata, K., and Isobe, K. (2003). The function of GADD34 is a recovery from a
shutoff of protein synthesis induced by ER stress: elucidation by GADD34-deficient mice.
Faseb J 17, 1573-1575.

Krishnamurthy, J., Ramsey, M.R., Ligon, K.L., Torrice, C., Koh, A., Bonner-Weir, S., and
Sharpless, N.E. (2006). p16INK4a induces an age-dependent decline in islet regenerative
potential. Nature 443, 453-457.

Krishnamurthy, J., Torrice, C., Ramsey, M.R., Kovalev, G.I., Al-Regaiey, K., Su, L., and
Sharpless, N.E. (2004). Ink4a/Arf expression is a biomarker of aging. J Clin Invest 114,
1299-1307.

Kultz, D. (2005). Molecular and evolutionary basis of the cellular stress response. Annu
Rev Physiol 67, 225-257.

121
Kushner, J.A., Ciemerych, M.A., Sicinska, E., Wartschow, L.M., Teta, M., Long, S.Y.,
Sicinski, P., and White, M.F. (2005). Cyclins D2 and D1 are essential for postnatal
pancreatic beta-cell growth. Mol Cell Biol 25, 3752-3762.

Laron, Z. (2005). Do deficiencies in growth hormone and insulin-like growth factor-1 (IGF-1)
shorten or prolong longevity? Mech Ageing Dev 126, 305-307.

Larsen, P.L. (1993). Aging and resistance to oxidative damage in Caenorhabditis elegans.
Proc Natl Acad Sci U S A 90, 8905-8909.

Lee, A.C., Fenster, B.E., Ito, H., Takeda, K., Bae, N.S., Hirai, T., Yu, Z.X., Ferrans, V.J.,
Howard, B.H., and Finkel, T. (1999). Ras proteins induce senescence by altering the
intracellular levels of reactive oxygen species. J Biol Chem 274, 7936-7940.

Li, D.M., and Sun, H. (1997). TEP1, encoded by a candidate tumor suppressor locus, is a
novel protein tyrosine phosphatase regulated by transforming growth factor beta. Cancer
Res 57, 2124-2129.

Li, J., Yen, C., Liaw, D., Podsypanina, K., Bose, S., Wang, S.I., Puc, J., Miliaresis, C.,
Rodgers, L., McCombie, R., et al. (1997). PTEN, a putative protein tyrosine phosphatase
gene mutated in human brain, breast, and prostate cancer. Science 275, 1943-1947.

Li, W.W., Alexandre, S., Cao, X., and Lee, A.S. (1993). Transactivation of the grp78
promoter by Ca2+ depletion. A comparative analysis with A23187 and the endoplasmic
reticulum Ca(2+)-ATPase inhibitor thapsigargin. J Biol Chem 268, 12003-12009.

Liaw, D., Marsh, D.J., Li, J., Dahia, P.L., Wang, S.I., Zheng, Z., Bose, S., Call, K.M., Tsou,
H.C., Peacocke, M., et al. (1997). Germline mutations of the PTEN gene in Cowden disease,
an inherited breast and thyroid cancer syndrome. Nat Genet 16, 64-67.

Liliental, J., Moon, S.Y., Lesche, R., Mamillapalli, R., Li, D., Zheng, Y., Sun, H., and Wu, H.
(2000). Genetic deletion of the Pten tumor suppressor gene promotes cell motility by
activation of Rac1 and Cdc42 GTPases. Curr Biol 10, 401-404.

Little, M., and Wainwright, B. (1995). Methylation and p16: suppressing the suppressor. Nat
Med 1, 633-634.

Liu, K., Lu, Y., Lee, J.K., Samara, R., Willenberg, R., Sears-Kraxberger, I., Tedeschi, A., Park,
K.K., Jin, D., Cai, B., et al. (2010). PTEN deletion enhances the regenerative ability of adult
corticospinal neurons. Nat Neurosci 13, 1075-1081.
122

Liu, P., Cheng, H., Roberts, T.M., and Zhao, J.J. (2009). Targeting the phosphoinositide
3-kinase pathway in cancer. Nat Rev Drug Discov 8, 627-644.

Lu, P.D., Jousse, C., Marciniak, S.J., Zhang, Y., Novoa, I., Scheuner, D., Kaufman, R.J., Ron,
D., and Harding, H.P. (2004). Cytoprotection by pre-emptive conditional phosphorylation of
translation initiation factor 2. Embo J 23, 169-179.

Maehama, T., and Dixon, J.E. (1998). The tumor suppressor, PTEN/MMAC1,
dephosphorylates the lipid second messenger, phosphatidylinositol 3,4,5-trisphosphate. J
Biol Chem 273, 13375-13378.

Marciniak, S.J., Yun, C.Y., Oyadomari, S., Novoa, I., Zhang, Y., Jungreis, R., Nagata, K.,
Harding, H.P., and Ron, D. (2004). CHOP induces death by promoting protein synthesis and
oxidation in the stressed endoplasmic reticulum. Genes Dev 18, 3066-3077.

Martin, G.M., Austad, S.N., and Johnson, T.E. (1996). Genetic analysis of ageing: role of
oxidative damage and environmental stresses. Nat Genet 13, 25-34.

Molofsky, A.V., Slutsky, S.G., Joseph, N.M., He, S., Pardal, R., Krishnamurthy, J., Sharpless,
N.E., and Morrison, S.J. (2006). Increasing p16INK4a expression decreases forebrain
progenitors and neurogenesis during ageing. Nature 443, 448-452.

Mounir, Z., Krishnamoorthy, J.L., Robertson, G.P., Scheuner, D., Kaufman, R.J., Georgescu,
M.M., and Koromilas, A.E. (2009). Tumor suppression by PTEN requires the activation of
the PKR-eIF2alpha phosphorylation pathway. Sci Signal 2, ra85.

Musaro, A., McCullagh, K., Paul, A., Houghton, L., Dobrowolny, G., Molinaro, M., Barton,
E.R., Sweeney, H.L., and Rosenthal, N. (2001). Localized Igf-1 transgene expression
sustains hypertrophy and regeneration in senescent skeletal muscle. Nat Genet 27,
195-200.

Myers, M.P., Stolarov, J.P., Eng, C., Li, J., Wang, S.I., Wigler, M.H., Parsons, R., and Tonks,
N.K. (1997). P-TEN, the tumor suppressor from human chromosome 10q23, is a
dual-specificity phosphatase. Proc Natl Acad Sci U S A 94, 9052-9057.

Nelen, M.R., van Staveren, W.C., Peeters, E.A., Hassel, M.B., Gorlin, R.J., Hamm, H.,
Lindboe, C.F., Fryns, J.P., Sijmons, R.H., Woods, D.G., et al. (1997). Germline mutations in
the PTEN/MMAC1 gene in patients with Cowden disease. Hum Mol Genet 6, 1383-1387.

123
Newman, R.M., Mobascher, A., Mangold, U., Koike, C., Diah, S., Schmidt, M., Finley, D., and
Zetter, B.R. (2004). Antizyme targets cyclin D1 for degradation. A novel mechanism for cell
growth repression. J Biol Chem 279, 41504-41511.

Nguyen, K.T., Tajmir, P., Lin, C.H., Liadis, N., Zhu, X.D., Eweida, M., Tolasa-Karaman, G.,
Cai, F., Wang, R., Kitamura, T., et al. (2006). Essential role of Pten in body size
determination and pancreatic beta-cell homeostasis in vivo. Mol Cell Biol 26, 4511-4518.

Novoa, I., Zeng, H., Harding, H.P., and Ron, D. (2001). Feedback inhibition of the unfolded
protein response by GADD34-mediated dephosphorylation of eIF2alpha. J Cell Biol 153,
1011-1022.

Pfaffl, M.W. (2001). A new mathematical model for relative quantification in real-time
RT-PCR. Nucleic Acids Res 29, e45.

Ramaswamy, S., Nakamura, N., Vazquez, F., Batt, D.B., Perera, S., Roberts, T.M., and
Sellers, W.R. (1999). Regulation of G1 progression by the PTEN tumor suppressor protein
is linked to inhibition of the phosphatidylinositol 3-kinase/Akt pathway. Proceedings of the
National Academy of Sciences of the United States of America 96, 2110-2115.

Rankin, M.M., and Kushner, J.A. (2009). Adaptive beta-cell proliferation is severely
restricted with advanced age. Diabetes 58, 1365-1372.

Ricordi, C., Lacy, P.E., Finke, E.H., Olack, B.J., and Scharp, D.W. (1988). Automated method
for isolation of human pancreatic islets. Diabetes 37, 413-420.

Rountree, C.B., Ding, W., He, L., and Stiles, B. (2009). Expansion of CD133-expressing liver
cancer stem cells in liver-specific phosphatase and tensin homolog deleted on
chromosome 10-deleted mice. Stem Cells 27, 290-299.

Sachsenmaier, C., Radler-Pohl, A., Zinck, R., Nordheim, A., Herrlich, P., and Rahmsdorf,
H.J. (1994). Involvement of growth factor receptors in the mammalian UVC response. Cell
78, 963-972.

Serrano, M., Lin, A.W., McCurrach, M.E., Beach, D., and Lowe, S.W. (1997). Oncogenic ras
provokes premature cell senescence associated with accumulation of p53 and p16INK4a.
Cell 88, 593-602.

Severi, T., van Malenstein, H., Verslype, C., and van Pelt, J.F. (2010). Tumor initiation and
progression in hepatocellular carcinoma: risk factors, classification, and therapeutic
124
targets. Acta Pharmacol Sin 31, 1409-1420.

Shih, A.Y., Erb, H., Sun, X., Toda, S., Kalivas, P.W., and Murphy, T.H. (2006).
Cystine/glutamate exchange modulates glutathione supply for neuroprotection from
oxidative stress and cell proliferation. J Neurosci 26, 10514-10523.

Silva, R.M., Ries, V., Oo, T.F., Yarygina, O., Jackson-Lewis, V., Ryu, E.J., Lu, P.D., Marciniak,
S.J., Ron, D., Przedborski, S., et al. (2005). CHOP/GADD153 is a mediator of apoptotic
death in substantia nigra dopamine neurons in an in vivo neurotoxin model of
parkinsonism. J Neurochem 95, 974-986.

Stiles, B., Gilman, V., Khanzenzon, N., Lesche, R., Li, A., Qiao, R., Liu, X., and Wu, H. (2002).
Essential role of AKT-1/protein kinase B alpha in PTEN-controlled tumorigenesis. Mol Cell
Biol 22, 3842-3851.

Stiles, B., Groszer, M., Wang, S., Jiao, J., and Wu, H. (2004a). PTENless means more. Dev
Biol 273, 175-184.

Stiles, B., Groszer, M., Wang, S., Jiao, J., and Wu, H. (2004b). PTENless means more. Dev
Biol 273, 175-184.

Stiles, B., Wang, Y., Stahl, A., Bassilian, S., Lee, W.P., Kim, Y.J., Sherwin, R., Devaskar, S.,
Lesche, R., Magnuson, M.A., et al. (2004c). Liver-specific deletion of negative regulator
Pten results in fatty liver and insulin hypersensitivity [corrected]. Proceedings of the
National Academy of Sciences of the United States of America 101, 2082-2087.

Stiles, B.L., Kuralwalla-Martinez, C., Guo, W., Gregorian, C., Wang, Y., Tian, J., Magnuson,
M.A., and Wu, H. (2006a). Selective deletion of Pten in pancreatic beta cells leads to
increased islet mass and resistance to STZ-induced diabetes. Mol Cell Biol 26, 2772-2781.

Stiles, B.L., Kuralwalla-Martinez, C., Guo, W., Gregorian, C., Wang, Y., Tian, J., Magnuson,
M.A., and Wu, H. (2006b). Selective deletion of Pten in pancreatic beta cells leads to
increased islet mass and resistance to STZ-induced diabetes. Molecular and cellular
biology 26, 2772-2781.

Teta, M., Long, S.Y., Wartschow, L.M., Rankin, M.M., and Kushner, J.A. (2005). Very slow
turnover of beta-cells in aged adult mice. Diabetes 54, 2557-2567.

Teta, M., Rankin, M.M., Long, S.Y., Stein, G.M., and Kushner, J.A. (2007a). Growth and
regeneration of adult beta cells does not involve specialized progenitors. Developmental
125
cell 12, 817-826.

Teta, M., Rankin, M.M., Long, S.Y., Stein, G.M., and Kushner, J.A. (2007b). Growth and
regeneration of adult beta cells does not involve specialized progenitors. Dev Cell 12,
817-826.

Trachootham, D., Lu, W., Ogasawara, M.A., Nilsa, R.D., and Huang, P. (2008). Redox
regulation of cell survival. Antioxid Redox Signal 10, 1343-1374.

Tschen, S.I., Dhawan, S., Gurlo, T., and Bhushan, A. (2009). Age-dependent decline in
beta-cell proliferation restricts the capacity of beta-cell regeneration in mice. Diabetes 58,
1312-1320.

Wang, X., McCullough, K.D., Franke, T.F., and Holbrook, N.J. (2000). Epidermal growth
factor receptor-dependent Akt activation by oxidative stress enhances cell survival. J Biol
Chem 275, 14624-14631.

Weinert, B.T., and Timiras, P.S. (2003). Invited review: Theories of aging. J Appl Physiol 95,
1706-1716.

Wek, R.C., Jiang, H.Y., and Anthony, T.G. (2006). Coping with stress: eIF2 kinases and
translational control. Biochem Soc Trans 34, 7-11.

Whittaker, S., Marais, R., and Zhu, A.X. The role of signaling pathways in the development
and treatment of hepatocellular carcinoma. Oncogene 29, 4989-5005.

Withers, D.J., Burks, D.J., Towery, H.H., Altamuro, S.L., Flint, C.L., and White, M.F. (1999).
Irs-2 coordinates Igf-1 receptor-mediated beta-cell development and peripheral insulin
signalling. Nat Genet 23, 32-40.

Woiwode, A., Johnson, S.A., Zhong, S., Zhang, C., Roeder, R.G., Teichmann, M., and
Johnson, D.L. (2008). PTEN represses RNA polymerase III-dependent transcription by
targeting the TFIIIB complex. Molecular and cellular biology 28, 4204-4214.

Wu, J.B., Chen, K., Ou, X.M., and Shih, J.C. (2009). Retinoic acid activates monoamine
oxidase B promoter in human neuronal cells. J Biol Chem 284, 16723-16735.

Wu, J.B., and Shih, J.C. Valproic acid induces monoamine oxidase A via Akt/forkhead box
O1 activation. Mol Pharmacol 80, 714-723.

126
Xu, X., Kobayashi, S., Qiao, W., Li, C., Xiao, C., Radaeva, S., Stiles, B., Wang, R.H., Ohara,
N., Yoshino, T., et al. (2006). Induction of intrahepatic cholangiocellular carcinoma by
liver-specific disruption of Smad4 and Pten in mice. J Clin Invest 116, 1843-1852.

Zeng, N., Li, Y., He, L., Xu, X., Galicia, V., Deng, C., and Stiles, B.L. (2011). Adaptive basal
phosphorylation of eIF2alpha is responsible for resistance to cellular stress-induced cell
death in Pten-null hepatocytes. Mol Cancer Res 9, 1708-1717.

Abstract (if available)

Abstract PTEN is a dual lipid and protein phosphatase that antagonizes the PI3K/AKT signaling cascade and controls multi cellular activities including proliferation, survival and metabolism. Here, I studied its role in aging regulation through investigating how it controls two aging-related processes: tissue regeneration and oxidative stress in two types of cells: pancreatic beta cells and liver hepatocytes. Beta cells undergo a significant aging process with declined proliferation and restricted regeneration as the major phenotypes. I hypothesized that this aging process is controlled by IGF-1, the level of which also declines dramatically with advanced aging. To test that, I selectively deleted Pten in beta cells to activate the IGF-1 signaling. Indeed, Pten deletion not only significantly increases islet proliferation, but also restores the regenerative potential of aged beta cells, confirming the critical role of PTEN in controlling aging. I further demonstrated that such pro-proliferation and anti-aging effects of PTEN are mediated through the cyclinD1/E2F/ Ezh2/p16Ink4a signaling axis. ❧ In addition, I also studied how PTEN regulates oxidative stress response using the liver deletion mouse model. PTEN loss in liver leads to fatty liver early and liver cancer later in life. I found that Pten null hepatocytes are resistant to oxidative stress induced by fatty liver development. Analysis of the molecular mechanism suggested that phosphorylation of the stress responder eIF2α and downregulation of the eIF2α phosphatase CReP are the downstream events of Pten deletion that contribute to the stress resistance. ❧ Together, I showed that PTEN is an important regulator of both regeneration and oxidative stress response during the aging process. Studies of the molecular mechanisms and downstream pathways of PTEN in different tissue context might provide critical insights into how to balance regeneration and oxidative stress to achieve better life quality in the aged individuals.

Linked assets

University of Southern California Dissertations and Theses

Conceptually similar

PDF

Pten regulates beta-cell regeneration intrinsically and independently of development

PDF

Phosphatase and tensin homolog deleted on chromosome 10 (PTEN) signaling regulates fatty acid beta-oxidation

PDF

Neuronal and glial metabolic alterations in the liver-specific PTEN knockout mouse model

PDF

Akt1 deletion decrease proliferation in aged pancreatic beta-cells by arresting cell cycle in S phase

PDF

Steatosis induces Wnt/β-catenin pathway to stimulate proliferation of hepatic tumor initiating cells and promote liver cancer development

PDF

Regulation of mitochondrial bioenergetics via PTEN (phosphatase and tensin homolog deleted on chromosome 10)/estrogen-related receptor alpha (ERRα) signaling

PDF

Pten deletion in adult pancreatic beta-cells induces cell proliferation and G1/S cell cycle progression

PDF

Protein kinase Bα (AKT1) but not protein kinase Bβ (AKT2) controls pancreatic β cell growth and survival

PDF

PI3K/AKT signaling and the regulation of the mitochondrial energy-redox axis

PDF

Short term high fat diet (HFD) stimulates β cell proliferation through mTOR while the prolonged treatment induces β cell senescence via p27

PDF

The regulation of fatty acid oxidation by estrogen related receptor alpha

PDF

Inhibition of NR3B1 attenuates the progression of NAFLD and NASH in liver-specific Pten knockout mice

PDF

PTEN deletion induced tumor initiating cells: Strategies to accelerate the disease progression of liver cancer

PDF

Nuclear respiratory factor-1 regulation by PTEN signaling

PDF

Maf1 is a novel target of the tumor suppressor PTEN and a negative regulator of lipid metabolism

PDF

Insulin sensitivity in cognition, Alzheimer's disease and brain aging

PDF

MAO a deficient mice exhibit an altered immune system in the brain and prostate

PDF

Calorie restriction reduces liver steatosis in liver specific Pten deleted mouse model

PDF

Design of novel anticancer agents targeting cellular stress response pathways

PDF

Repression of RNA polymerase III-dependent transcription by the tumor suppressors p53 and PTEN

Asset Metadata

Creator Zeng, Ni (author)

Core Title PTEN loss antagonizes aging through promoting regeneration and prevents oxidative stress induced cell death

School School of Pharmacy

Degree Doctor of Philosophy

Degree Program Molecular Pharmacology and Toxicology

Publication Date 11/23/2012

Defense Date 05/01/2012

Publisher University of Southern California (original), University of Southern California. Libraries (digital)

Tag aging,AKT,beta cell,IGF-1,OAI-PMH Harvest,PTEN,Regeneration

Language English

Contributor Electronically uploaded by the author (provenance)

Advisor Stiles, Bangyan L. (committee chair), Johnson, Deborah L. (committee member), Okamoto, Curtis Toshio (committee member)

Creator Email nzeng@usc.edu,zengni02@gmail.com

Permanent Link (DOI) https://doi.org/10.25549/usctheses-c3-118946

Unique identifier UC11291414

Identifier usctheses-c3-118946 (legacy record id)

Legacy Identifier etd-ZengNi-1339.pdf

Dmrecord 118946

Document Type Dissertation

Rights Zeng, Ni

Type texts

Source University of Southern California (contributing entity), University of Southern California Dissertations and Theses (collection)

Access Conditions The author retains rights to his/her dissertation, thesis or other graduate work according to U.S. copyright law. Electronic access is being provided by the USC Libraries in agreement with the a...

Repository Name University of Southern California Digital Library

Repository Location USC Digital Library, University of Southern California, University Park Campus MC 2810, 3434 South Grand Avenue, 2nd Floor, Los Angeles, California 90089-2810, USA