University of Southern California Dissertations and Theses

Structural and biochemical studies of two DNA transaction enzymes

(USC Thesis Other)

Structural and biochemical studies of two DNA transaction enzymes

PDF

Download a page range

Download transcript

Copy asset link

Request this asset

Transcript (if available)

Content

STRUCTURAL AND BIOCHEMICAL STUDIES OF TWO DNA
TRANSACTION ENZYMES

by

Yang Fu

A Dissertation Presented to the
FACULTY OF THE USC GRAUDATE SCHOOL
UNIVERSITY OF SOUTHERN CALIFORNIA
In Partial Fulfillment of the
Requirements for the Degree
DOCTOR OF PHILOSOPHY

(Molecular Biology)

May 2016

Copyright 2016 Yang Fu
ii

EPIGRAPH

“There is never just one thing that leads to success for anyone. I feel it always a combination of
passion, dedication, hard work, and being in the right place at the right time.”
-Lauren Conrad

iii

Dedication

To my family: past, present, and future

iv

Acknowledgement

First and foremost I want to thank my advisor Dr. Xiaojiang Chen for patiently
mentoring for my research projects and continuously supporting me along the way. I have
learned a lot from his unique perspective on research and his personal integrity. He always
cheered me up and encouraged me to overcome the difficulties in scientific research.
Without him, I would not be able to get my degree. I also would like to thank the other
members of my dissertation committee, Dr. Lin Chen and Dr. Peter Qin for the time and
suggestions.
I would like to express my thanks to all my former and present lab members: Ian
Slaymaker, Hanjing Yang, Damian Wang, Lyon Chen, Xiao Xiao, Aaron Wolf, Brett
Zirkle, Jiang Gu, Gewen Zhang, Junfeng Wang, Bo Zhou, Jessica Yu, Carolyn Truong,
Lauren Holden, Ganggang Wang, Aaron Brewster, Sophia Tsai, Maocai Yan, Kacie
Amacher, John Hershberger, Hasan Abbas, Meng Xu, Dahai Gai, Braulio Fernandez,
Ronda Bransteitter, and Courtney Prochnow. I am so happy to have you guys around in
XJ’s lab. Without their help, I could not manage to finish.
I would especially like to thank to my dear friends at USC: Quan Chen, Yuchi Che,
Qingjiao Li, Shuxing Li, Yongheng Chen, Meng Xia, Pei Zhang, Lei Xiao, Wangshu
Zhang, Shuli Kang, Min Xu, Chao Dai, Qiang Song, Ke Gong, Tianying Zhou, Che-yu
Lee, and many more I cannot enumerate here. Your company and support made this
journey truly wonderful.

v

Finally and forever, I would like to gratefully thank my family. Thank my parents for
their complete and unconditional love! They always try to provide the best and strongest
support for my life. Thank my cousins for growing together with me and giving me a happy
childhood! Thank my grandparents for supporting and caring!

vi

Table of Contents

EPIGRAPH II
DEDICATION III
ACKNOWLEDGEMENT IV
TABLE OF CONTENTS VI
LIST OF FIGURES VIII
LIST OF TABLES X
ABSTRACT XI
CHAPTER 1 : INTRODUCTION 1
1.1 MCM: THE REPLICATIVE DNA HELICASE 1
1.2 A3B: THE DNA MUTASE 5
CHAPTER 2 : THE 1.8 Å CRYSTAL STRUCTURE OF THE N-
TERMINAL DOMAIN OF AN ARCHAEAL MCM AS A RIGHT-
HANDED FILAMENT 8
2.1 RESULTS 8
2.2 DISCUSSION 17
2.3 METHODS 21
CHAPTER 3 . MINI-CHROMOSOME MAINTENANCE
COMPLEXES FORM A FILAMENT TO REMODEL DNA
STRUCTURE AND TOPOLOGY 23
3.1 RESULTS 23
3.2 DISCUSSION 44
3.3 METHODS 46
vii

CHAPTER 4 : DNA CYTOSINE AND METHYLCYTOSINE
DEAMINATION BY APOBEC3B: ENHANCING
METHYLCYTOSINE DEAMINATION BY ENGINEERING
APOBEC3B 55
4.1 RESULTS 55
4.2 DISCUSSION 80
4.3 METHODS 83
REFERENCE 89

viii

List of Figures
Figure 2.1 The overall structure of N-tapMCM. ...............................................................10
Figure 2.2 The detailed structure of N-tapMCM subunit ..................................................11
Figure 2.3 Structure of two subunits (colored by green and violet) of N-tapMCM from the
filament conformation. .................................................................................12
Figure 2.4 Electrostatics surface representation of the hexameric lockwasher ring
structure of the N-tapMCM and its modeled DNA binding. ........................13
Figure 2.5 Comparison with other known MCM structures. .............................................15
Figure 2.6 A model for origin remodeling by tapMCM complex. .....................................17
Figure 3.1 Overall features of the MCM filament structure. .............................................24
Figure 3.2 Samples of electron density map sections. .......................................................25
Figure 3.3 Electron tomography (ET) and TEM imaging of MCM-dsDNA filament. .......27
Figure 3.4 The helix α5 rotation and its interaction with the α-subdomain of a neighboring
subunit in the filament structure. ..................................................................29
Figure 3.5 The N-terminal domain structural alignment, and the DNA topology change
induced by MCM. .........................................................................................30
Figure 3.6 The strong electro-positive “strip” along the helical filament inner surface for
DNA binding. ................................................................................................31
Figure 3.7 The mutations of the positively charged residues on the electro-positive DNA
binding strip do not disrupt oligomerisation. ...............................................33
Figure 3.8 Comparison of filament formation and supercoiling of circular plasmid DNA
by WT MCM and the α5-linker mutant. .......................................................34
Figure 3.9 Comparison of DNA conformational changes induced by WT and mutant MCM
proteins. ........................................................................................................36
Figure 3.10 Conservation residues of MCM. ....................................................................38
Figure 3.11 Gel filtration (Superose-6) chromatography assay of MCM mutants, with
molecular marker elution profile shown in panel-c at the bottom. ..............39
Figure 3.12 Helicase activity of ssoMCM-F540A mutant at the interface between helix α5
and α-domain. ..............................................................................................40
ix

Figure 3.13 Phenotypes of mutants (mcm4-Y751A) and wild type mcm4 (mcm4+) .........43
Figure 4.1 Deamination on normal cytidine (C) by A3B and its mutants. ........................56
Figure 4.2 Substrates preference and DNA binding of MBP-tagged A3B proteins. .........58
Figure 4.3 Substrates preference of MBP-tagged A3B proteins on C and mC. ................59
Figure 4.4 Deamination on methylcytidine (mC) by A3B and its mutants. .......................61
Figure 4.5 An engineered A3BCD2 mutant with much higher mC deamination activity..63
Figure 4.6 Comparison of the C and mC deamination activities by A3BCD2 and A3A from
the dose-response deamination assay. .........................................................64
Figure 4.7 Superposition of the known APOBEC structures around the Zn active site. ...66
Figure 4.8 Sequence alignment of A3BCD2 and A3A, together with A3GCD2. ...............68
Figure 4.9 Comparison of the C and mC deamination activities of the A3BCD2 Mt0 mutant
from the dose-response deamination assay. .................................................68
Figure 4.10 Dissecting loop-1 residues important for increasing mC deamination. ........70
Figure 4.11 Comparison of C and mC deamination activities by A3BCD2 mutants from the
dose-response deamination assay. ...............................................................72
Figure 4.12 Substrates preference of His-tagged CD2 and Mt0. ......................................74
Figure 4.13 Substrates preference of His-tagged M3 and M4. .........................................75
Figure 4.14 ssDNA binding by the His-tagged A3BCD2, M0, M3, and M4 .....................76
Figure 4.15 The flexibility of loop-1 conformation in A3BCD2 Mt0 affects mC deamination
activity. .........................................................................................................77
Figure 4.16 A3BCD2 Y313 mutation enhances the substrate specificity on mC...............79
Figure 4.17 Y313F mutation of A3BCD2 enhances the substrate specificity on mC. .......79
Figure 4.18 SDS-PAGE of the purified proteins. ..............................................................85

x

List of Tables
Table 2.1 Crystallographic data collection and refinement statistics ................................9
Table 3.1 X-ray refinement statistics .................................................................................25
Table 3.2 Complementation data at permissive temperature 320C in S. pombe. ..............42
Table 3.3 Data collection and refinement statistics ...........................................................50
Table 4.1 The Comparison of the deaminase activity and mC selectivity factor of various
A3BCD2 mutants from the dose-response deamination assay. ....................65
Table 4.2 The Comparison of the mC/C deaminase activity (initial velocity) and mC
selectivity factor of A3BCD2 and its various mutants. ................................71
Table 4.3 ssDNA substrates used in deamination assay ....................................................86

xi

Abstract
DNA replication and mutation are two important DNA transactions for life. Mini-
Chromosome Maintenance (MCM) proteins are the replicative helicase necessary for DNA
replication in both eukarya and archaea. APOBEC ("apolipoprotein B mRNA editing
enzyme, catalytic polypeptide-like") is a family of enzymes that deaminates cytosine (C)
on nucleic acid introducing C to U mutations. One of the member, APOBEC3B (A3B),
may cause mutations in cancer. My thesis project focuses on structural and biochemical
studies of the archaea MCM and APOBEC3B.
In this study, the near full length MCM from the archaeon Sulfolobus solfataricus (sso)
forms wide left-handed filament structure for an archaeal MCM, as determined by X-ray
and electron microscopy. The crystal structure reveals that an α-helix bundle formed
between two neighboring subunits plays a critical role in filament formation. The filament
has a remarkably strong electro-positive surface spiraling along the inner filament channel
for DNA binding. MCM filament binding to DNA causes dramatic DNA topology change.
This newly identified function of MCM to change DNA topology may imply a wider
functional role for MCM in DNA metabolisms beyond helicase function.
The structure of N-terminal MCM from the archaeon thermoplasma acidophilum
(tapMCM) was determined as a right-handed filament that contains six subunits in each
turn, with a diameter of 25 Å of the central channel opening. The inner surface is highly
positively charged, indicating DNA binding. This filament structure with six subunits per
turn may also suggests a potential role for an open ring structure for hexameric MCM and
dynamic conformational changes in initiation and elongation stages of DNA replication.
xii

In the study of A3B, I show that both A3B and A3BCD2 have weak methylcytosine
(mC) deamination activity. Through structural and functional analysis, I successfully
engineered an A3BCD2 mutant that has gained over 2 orders of magnitude higher activity
for mC deamination. Important elements around the active site that contribute to the
activity and specificity for mC deamination have been identified, which reveals that
multiple determinants, rather than a single factor, contribute to the mC deamination activity
and specificity of A3BCD2

Chapter 1 : Introduction
DNA carries most of the genetic instructions used in the development, functioning and
reproduction of all known living organisms and many viruses. Replication of DNA occurs
in all living organisms and is the basis for biological inheritance. Mutation of DNA is not
only involved in life evolution but also plays important role in the development of disease
such as cancer. My focus of studies is DNA transaction enzymes in these two processes.
In particular, I am studying helicase enzyme that functions in replicating the genomic
DNA, and APOBEC deaminase A3B for mutating the foreign and cellular DNA.
1.1 MCM: The Replicative DNA Helicase
All organisms must duplicate their genome to provide each new cell with a full
complement of genetic information prior to mitotic division. When a cell enters S-phase,
double stranded genomic DNA is separated into single strands to be copied into sister
chromatids. This process is tightly regulated and highly coordinated to ensure the high
fidelity replication of the genome.
Eukaryotic and archaeal chromosomal DNA replication are initiated by the stepwise
assembly of pre-replicative complexes (pre-RCs), composed of the origin recognition
complex (ORC), Cdc6, and mini-chromosome maintenance (MCM) complexes(Aparicio
et al., 1997). These components cooperatively catalyze the initiation of replication at the
origin. In the G1 phase, the origin recognition complex (ORC) binds to the origin and
recruits the helicase loading factor CDC6.4 Cdt1 binds the free hexamer MCM complex
and facilitates its loading to an origin by binding to CDC6 (Bell, 2002). At this stage, MCM
2

is bound to the origin as a catalytically inactive double hexamer (Remus et al., 2009). After
additional factors are recruited to the origin, cells enter the S-phase. MCM is activated by
GINS and Cdc45, which together form a stable complex (Ilves et al., 2010; Moyer et al.,
2006). Upon activation, the MCM ring complex acts as an ATP dependent DNA helicase
to unwind the genome, opening double stranded DNA (dsDNA) into single stranded DNA
(ssDNA) templates (Labib et al., 2000). Evidence suggests that MCM is essential for both
initiation and elongation during replication (Aparicio et al., 1997) and that the malfunction
of MCM is linked to disease and cancer.
Eukaryotes express six essential homologous MCM proteins (MCM2-7) that form
hexamers and double hexamers in vitro (Gambus et al., 2011; Remus et al., 2009; Wyrick
et al., 2001). The six homologous MCM subunits belongs to the ATPase associated with
various cellular activities (AAA+) family (Erzberger and Berger, 2006). MCM contains
three domains: an N-terminal domain, an AAA+ domain, and a C-terminal domain
(Brewster et al., 2008). The N-terminal domain is known to play roles in protein
oligomerization, DNA binding, and the processivity of the helicase, while the C-terminal
AAA+ domain is responsible for ATPase function and DNA unwinding (Barry et al., 2007;
Fletcher et al., 2003). The small domain at the C-terminus is predicted to have a helix-turn-
helix motif that may play a role in double stranded DNA stimulated ATPase activity.
Archaeal genomes also encode MCM genes with sequence and structural homology to
eukaryotic MCM2-7 (Iyer et al., 2004). However, many archaea express only a single
MCM subunit, which forms homo-oligomeric complexes with the same function as the
eukaryotic MCM complexes (Brewster et al., 2008; Chen et al., 2005; Fletcher et al., 2003).
3

In G1 and leading up to S phase of the eukaryotic cell cycle, multiple MCM2-7 hetero-
hexamers are recruited to each pre-RC at the origin and spread to nearby chromatin
(Edwards et al., 2002; Randell et al., 2006). Mutations that limit pre-RC to only a single
iteration of MCM recruitment are not viable, which suggests that the recruitment of many
MCM proteins is a requirement for proper pre-RC function (Chen et al., 2007b; Hoang et
al., 2007; Randell et al., 2006). This is puzzling as only one or two MCM hexameric rings
are sufficient to unwind DNA.
How MCM functions when bound to chromatin prior to and during initiation has been
the subject of much interest, though results often raise more questions than answers. The
chromatin bound MCM complexes are categorized into two biochemically distinguishable
subgroups. One is the salt stable “loaded” complexes that are bound tightly to the origin,
likely locked onto DNA as hexamer or a double hexamer as the active helicase form in
vivo (Edwards et al., 2002; Remus et al., 2009). The other is the salt sensitive “associated”
complexes and not specifically located at origins, which accounts for the majority of the
MCM proteins. These MCM proteins distal from the origin may have different biological
function(s) (Edwards et al., 2002). MCM proteins have been detected associating with large
regions of unreplicated chromatin during G1 and early S phase (Kuipers et al., 2011).
Despite the large number of MCM proteins in the nucleus, reduction in MCM gene dosage
causes genome instability, demonstrating the importance of maintaining MCM protein
level for cell survival (Liang et al., 1999; Shima et al., 2007). These peculiarities are part
of what has been termed the “MCM paradox” (Klock and Lesley, 2009).
Current studies of archaeal MCM indicate that they can form double hexamers,
hexamers, heptamers, and filaments (Brewster et al., 2008; Evrin et al., 2009; Fletcher et
4

al., 2003; Fletcher et al., 2005; Gomez-Llorente et al., 2005; Pape et al., 2003; Remus et
al., 2009; Yu et al., 2002). Available evidence suggest that, after origin melting, the double
hexamer assembled at the origin can separate into two single hexamers, and each may
translocate on a single DNA strand to unwind DNA in a strand exclusive manner (Brewster
and Chen, 2010; Fletcher et al., 2005; Fu et al., 2011; Gambus et al., 2011; Graham et al.,
2011). However, the mechanism by which MCM loads to origin dsDNA, melts the origin,
transitions from a melted origin to two viable replication forks, and DNA unwinding during
replication remains unclear. It is a reasonable assumption that the conformation of MCM
has to be dynamic so that the hexamer ring can open and reclose to bind dsDNA or ssDNA
as required at different stages of replication.
In Chapter 2, we report a crystal structure of the near full length MCM from the
archaeon Sulfolobus solfataricus (sso) assembled as a wide helical filament with a large
channel along the filament axis. We also have verified the formation of the same filament
structure in solution using electron microscopy (EM). The crystal structure revealed a
structural element critical for filament formation, which has been confirmed by structure-
guided mutagenesis and EM studies. Furthermore, we used yeast genetics to show that this
structural element important for filament formation is critical for cell growth and survival.
In Chapter 3, we describe a 1.8 Å crystal structure of the N-terminal domain of MCM
from the archaeon thermoplasma acidophilum (tapMCM). This high-resolution structure
reveals that the tapMCM N-terminus forms a right-handed filament with six subunits per
turn. The inner channel of the filament is highly positively charged, with a diameter of 25
Å that can accommodate ssDNA or dsDNA. This structure suggests a possible role of an
5

open ring structure for the MCM and provides insights on the dynamic nature of MCM
conformation to perform its function.
1.2 A3B: The DNA mutase
In the human genome, there are 11 members in the family of APOBEC deaminases,
including activation-induced cytidine deaminase (AID), APOBEC1, APOBEC2,
APOBEC3A to H, and APOBEC4 (Conticello, 2008; Macduff and Harris, 2006). Among
them, APOBEC3 members and AID are well known for their roles in innate and acquired
immunity (Di Noia and Neuberger, 2007; Muramatsu et al., 2000). The major function of
the APOBEC3s is to inhibit replication of retroelements or infectious retroviruses such as
HIV-1 (Chiu and Greene, 2008).
APOBEC3B (A3B) is a member of the APOBEC3 group. It has two cytosine
deaminase domains (CD): CD1 at the N-terminus and CD2 at the C-terminus. A3B displays
anti-retroviral activity and inhibits retrotransposon replication (Bogerd et al., 2006; Doehle
et al., 2005a; Doehle et al., 2005b; Yu et al., 2004), and has been shown to impair infection
by the DNA virus Hepatitis B virus (HBV) (Bonvin et al., 2006). A3B expression is
upregulated in HBV and HPV infected patients (Vieira et al., 2014; Xu et al., 2007). A3B
is shown to deaminate HBV covalently closed circular DNA (cccDNA) to induce not only
mutations of the viral genome (Bonvin and Greeve, 2007; Xu et al., 2007) but also the
degradation of the viral cccDNA (Lucifora et al., 2014). However, uncontrolled
deamination activity by A3B on genomic DNA can have a detrimental effect, as A3B has
been reported to be an enzymatic source of mutation in multiple cancers including breast,
lung, and cervical cancers (Burns et al., 2013a; Burns et al., 2013b; Leonard et al., 2013).
Given this role in cancer mutagenesis, A3B has become a promising target for anti-cancer
6

drug development. Despite the importance of A3B function and its involvement in cancer,
there has been no comprehensive report yet on the in vitro biochemical characterization of
A3B.
Cytosine methylation is a common modification of genomic DNA in epigenetic
regulation of gene expression. So far, AID and APOBEC3A (A3A), both of which are
single-domain deaminases, are the only APOBECs reported to be capable of deaminating
mC, with A3A being much more active than other APOBECs in catalyzing this reaction in
vitro (Bransteitter et al., 2003; Carpenter et al., 2012; Larijani et al., 2005; Morgan et al.,
2004; Nabel et al., 2012; Wijesinghe and Bhagwat, 2012). The mC deamination activity
associated with AID has been proposed as an alternative way, in addition to the TET (Ten-
Eleven Translocation) pathway (Tahiliani et al., 2009), to contribute to DNA
demethylation for regulating the methylation pattern in mouse germ cells (Popp et al.,
2010), and for cell reprogramming in inducing pluripotent stem cells (Bhutani et al., 2010).
For A3A, its mC deamination is currently proposed to be involved in clearing foreign
infectious DNA or degraded self-DNA from apoptotic cells (Carpenter et al., 2012;
Stenglein et al., 2010).
The catalytic CD2 domain of A3G (A3GCD2) shares significant sequence homology
with A3A (65% identity). However, unlike A3A that has highly efficient mC deamination,
A3GCD2 is reported to be deficient in mC deamination (Carpenter et al., 2012; Wijesinghe
and Bhagwat, 2012). Even though, the high-resolution structures of A3A and A3GCD2, as
well as five other APOBEC domain structures, are available (Bohn et al., 2013; Byeon et
al., 2013; Holden et al., 2008; Kitamura et al., 2012; Prochnow et al., 2007; Siu et al.,
2013), the structural elements responsible for the efficient mC deamination activity
7

observed for A3A, or the lack of mC deamination for A3G have not been identified. Among
all APOBECs, A3BCD2 shares the highest sequence homology with A3A, with an 89%
sequence identity between them. Moreover, A3B is the only APOBEC that shows
constitutive nucleus localization (Pak et al., 2011), and its activity in editing nuclear DNA
is implicated in various cancers. However, whether A3B that shares high sequence
homology with A3A can also deaminate mC is unknown.
To address these questions, we characterized the in vitro deamination activity of A3B
using proteins purified from several A3B deletion/mutation constructs. Our results clarified
that only A3BCD2 is the catalytically active domain. We also showed that A3B and
A3BCD2 had detectible, weak deamination activity on mC at a level approximately three
orders of magnitude less than that of A3A. In order to reveal the factors(s) important for
determining mC deamination activity, we performed structure-guided mutagenesis studies;
these studies enabled us to successfully engineer A3BCD2 constructs with mutations
resulting in increased mC deamination activity by about two orders of magnitude. This
work has allowed us to identify the important elements that affect the activity and
specificity of mC deamination of A3BCD2.

8

Chapter 2 : The 1.8 Å Crystal Structure of the N-terminal
Domain of an Archaeal MCM as a Right-handed Filament

Reproduced with permission by Yang Fu, Ian M. Slaymaker,
Junfeng Wang, Ganggang Wang and Xiaojiang Chen. The 1.8 Å
Crystal Structure of the N-terminal Domain of an Archaeal MCM
as a Right-handed Filament. J Mol Biol. 2014 Apr 3;426(7):1512-
23.
Contributions: Y.F. refined the structure, analyzed the
structure/functional relationship, and wrote the manuscript, G.W.
purified and crystalized tapMCM, I.M.S solved the structure and
X.S.C supervised the project.
2.1 Results
Overall structure
The full-length tapMCM purified from E. coli was used for crystallization. However,
proteolysis occurred in the crystallization drops that yielded crystals containing only the
N-terminal half (residues 6-262) of the protein. Neither the full-length nor the degraded
C-terminal domains formed any crystals in the drop. We solved the crystal structure of
the N-terminal domain containing residues 6-262, which shows a right-handed filament
that has six subunits per turn (Figure 2.1a) (Table2.1). The six subunits in the filament
form a lockwasher-shaped open ring (Figure 2.1b, c). The inner channel wall is made up
9

Table 2.1 Crystallographic data collection and refinement statistics

10

Figure 2.1 The overall structure of N-tapMCM.
(a) The side view of the right-handed filament structure of N-tapMCM that contains six
subunits per helical turn. (b) Top view of the six subunits in one helical turn in a
lockwasher conformation, with each subunit colored differently. There is a gap between
the first molecule (violet) and the last molecule (green) in this spiral open ring structure.
(c) Side view of panel b rotated by 90˚.

of β-strands, with N-terminal hairpins (N-hp) pointing to the central channel. The outer
layer of the filament is made of α-helices. The width of the filament is 115 Å. Along the
filament axis, the subunits are organized like a 6-fold symmetric ring (Figure 2.1b). The
radius of the central channel of the ring is 25 Å, which is sufficient for encircling ssDNA
or dsDNA.

Subunit structure
The N-terminal fragment of tapMCM assembles into three sub-domains: A, B, and C
(Figure 2.2a, b). When compared with the hexameric ring structure of the previously
reported N-terminal regions of Methanobacterium thermoautotrophicum (mt)MCM and
sulfolobus solfataricus (sso) MCM (Brewster et al., 2008; Fletcher et al., 2003; Liu et al.,
2008) tapMCM has a unique 310-helix insertion at the zinc binding motif (Figure 2.2c),
which is not present in any of the known structures of MCM. Interestingly, this 310-helix
11

insertion is highly positively charged containing amino acid sequence -RGKDK- and
protrudes into the inner channel, which may help stabilize DNA interactions inside the
central channel. Subdomain C connects subdomain B (Figure 2.2a ,b). It has five β-
strands which are coiled to form an oligonucleotide/oligosaccharide binding (OB)

Figure 2.2 The detailed structure of N-tapMCM subunit
(a, b) Ribbon model of the N-tapMCM subunit structure, with the secondary structure
labeled. There are three subdomains (A, B, and C) colored in violet, yellow and green. (c)
Zinc motif in subdomain B. The Zinc atom is denoted by a yellow sphere. The four
cysteines are labeled and shown in sticks. The 310-helix insert is labeled.

fold and an N-hp that has been reported to play a role in DNA binding (Fletcher et al.,
2003; Fletcher et al., 2008; McGeoch et al., 2005).

Subunit interactions
The interaction between subunits in the filament is mainly through subdomains B
and C, with the helical domain A projecting away from the channel in a radial fashion
(Figure 2.1b) (Figure 2.3a, c). The N-hp of subdomain B in one subunit within the
filament interacts with a β-strand and a loop in the subdomain C of a neighboring subunit
(Figure 2.3a, b). This interaction is mainly through hydrogen bonds forming between the
main chain atoms of the involved residues. Additionally, a nearby 310-helix in the
12

subdomain C interacts with the β-strand 5 in a neighboring subunit (Figure 2.3b), and the
only residue involved in side chain interactions is Asp188 (Figure 2.3d), a well conserved
residue among MCM proteins. Mutating this conserved Asp to Arg in ssoMCM disrupts
hexamerization (Brewster et al., 2008) thus indicating its involvement in inter-subunit
interactions for oligomerization.

Figure 2.3 Structure of two subunits (colored by green and violet) of N-tapMCM
from the filament conformation.
(a,b) Showing the view of the dimer from inside the filament channel, and (c, d) showing
the dimer viewing from outside the filament channel. The interactions mediated through
the N-hp (N-terminal hairpin) are drawn and highlighted, with the residues involved in
the interactions shown by sticks. The hydrogen bonds are shown by red dash. The
interactions are mainly through main chain hydrogen bonds, except for D188 that is well
conserved among other MCM and also shown to play a role in hexamer
formation(Brewster et al., 2008).

Positively charged surface for DNA binding
Analysis of the electrostatics of this structure indicates that the inner channel is
highly positively charged (Figure 2.4a, b). The positive charge comes from the positive
13

residues located in two regions: N-hp and the 310-helix insert that is uniquely observed in
tapMCM (Figure 2.4c). The N-hp from each monomer points towards the channel. This
hairpin has been reported to be involved in DNA binding in the N-terminal MCM.20; 34;
36 In our structure, part of the hairpin is composed of basic residues (Figure 2.4c). In
addition, the unique 310-helix of tapMCM and a loop in the zinc finger domain also

Figure 2.4 Electrostatics surface representation of the hexameric lockwasher ring
structure of the N-tapMCM and its modeled DNA binding.
(a, b) Surface electrostatic pattern of the hexameric lockwasher ring structure that is
equivalent to one turn from the filament structure. The positive surface is colored as blue
and the negative as red. The strong and continuous electro-positive surface on the inner
channel surface suggests a role in DNA binding. (c) The basic residues responsible for the
positive charge surface inside the channel are shown by sticks in one subunit. Most of
these basic residues are located on the N-hp and the 310-helix insert in the zinc finger
domain. (d, e) Two views of the hexameric lockwasher structure with a B-form dsDNA
modeled into the central channel. Four of the six N-hp in the hexamer structure can fit
into the major groove of the dsDNA in its B-form. Better fitting of the entire six subunits
requires DNA deformation by stretching the dsDNA.

14

contribute to the positively charged region. Since the width of inner channel is about 25
Å, it can accommodate ssDNA or dsDNA. In addition, the right-handedness of this
structure is the same as that of the helical dsDNA. We made a model of six subunits
binding to a B-form dsDNA (Figure 2.4d, e), in which four of the six N-hps in one turn
could fit the helical path to bind to the major groove, with the remaining two subunits out
of phase with the helical turn of the B-form DNA, mainly because the helix pitch of the
MCM filament is longer than that of the standard B-form DNA. But with a slight stretch
of the B-form dsDNA, a better fitting of the six N-hp of the filament MCM into the DNA
major groove could be achieved.
Structural comparison
The monomer structure of the N-tapMCM folds into a similar manner as the
previously published N-terminal mtMCM (N-mtMCM) structure,20 with an RMSD of
1.411 Å2 for the superimposition of the two structures (Figure 2.5a). They share
approximately 30% sequence identity. Unlike our filament structure, the N-mtMCM
forms a double hexamer. Comparing the monomer structures of the two types of MCMs,
one of the two major differences is that subdomain A of N-tapMCM has a loop insertion
(Figure 2.5b), which allows tapMCM subdomain A to contact subdomain B directly
through this loop. Since the exact function of subdomain A is still unknown, the
functional role of this loop insertion is unclear. The second major difference is the 310-
helix insertion in the zinc finger domain (Figure 2.5c). This 310-helix insertion points
toward the central channel with positively charged residues that may help with DNA
binding.

15

The role of N-terminal hairpins in oligomerization
By aligning the dimer from the double hexamer of N-mtMCM with the dimer from the
filament of N-tapMCM reported here, we found that the position of the N-hp of tapMCM
in the filament is shifted up toward the N-terminus, which allows the N-hp of tapMCM to
make contacts with a loop in the zinc motif of the neighboring subunit (Figure 2.5d).

Figure 2.5 Comparison with other known MCM structures.
(a) Alignment of the monomer structure of the N-tapMCM from the filament and the N-
mtMCM from the hexamer, with an RMSD of 1.411 Å
2
. The detailed differences
discussed in the text are shown in panels b-e. (b) The difference in subdomain A. In N-
tapMCM structure, a long loop insertion in subdomain A makes direct contact with
subdomain B. (c) The unique 310-helix insertion in zinc finger domain in the N-tapMCM.
(d) The shifted N-hp in N-tapMCM. When a dimer from the right-handed filament of the
N-tapMCM are aligned to a dimer from the hexamer of N-mtMCM, the N-hp in the N-
tapMCM is shifted upward to contact its neighbor. This part of the N-hp in the hexamer
of mtMCM is in a more or less straight conformation and does not make direct contact
with a neighboring subunit. (e) Different directions of Nt-hp in different ssoMCM
oligomeric conformations. Here, the N-hp in the left-handed filament of ssoMCM is
shifted downward compared with the N-hp in a hexamer conformation to contact a
neighboring subunit.

16

This upward shift of the N-hp to establish the bonding contacts between subunits in this
right-handed filament suggests that this specific N-hp conformation may be important for
the spiral filament conformation. Consistent with this hypothesis is that, in contrast to the
upward shift of the N-hp of tapMCM in this right-handed filament, the N-hp of the
ssoMCM shifts downward in the left-handed filament structure27 when compared with a
N-terminal ssoMCM hexamer ring structure
(Figure 2.5e). These three different conformations of N-hp observed in the three types of
oligomeric crystal structures, i.e. the upward shift in the right-handed filament, the
middle position in the closed hexamer ring, and the downward shift shift in the left-
handed filament, suggest that the N-hp conformation may play a role in regulating
whether MCM oligomerizes to form a planar ring, or a spiral filament with different
handedness. It is worth pointing out that β8-strand in N-hp is directly connected with the
AAA+ motor domain,18 which allows the conformational changes of N-hp to be coupled
to ATP binding and hydrolysis, providing a structural means of regulating conformation.

Full-length tapMCM model
Full-length tapMCM has been shown to form hexamers in solution (Haugland et al.,
2006) and N-terminal tapMCM is involved in oligomerization38. In this N-tapMCM
filament structure, one turn consists of six subunits and forms a spiralopen ring that
resembles a lockwasher structure. We want to see if such a hexameric open ring of the N-
tapMCM can accommodate the missing AAA+ domain in the full-length tapMCM. Using
the AAA+ containing near full-length ssoMCM monomer structure18 to align into the N-
tapMCM open ring structure, we noticed that there are some minor clashes between
subunits in the AAA+ domain. However, the AAA+ domain connects to the N-tapMCM
17

by a flexible N-C linker that can easily allow the adjustment of the positions of the
AAA+ domain to avoid clashes. The conformation of the lockwasher structure model
with the docked full length MCM structure (Figure 2.6a,b) is similar to the previously
reported lockwasher structures for eukaryotic MCM that were determined using EM
(Costa et al., 2011; Lyubimov et al., 2012).

Figure 2.6 A model for origin remodeling by tapMCM complex.
(a, b) The side and top views of a lockwasher model containing the near full length
tapMCM. This model is made from six subunits of the N-tapMCM structure, but with the
AAA+ domain modeled into the N-tapMCM portion to make a near full length tapMCM
structure. There are some minor clashes at the AAA+ domain between subunits, which
can be avoided by some adjustment of the AAA+ positions around the long and flexible
linker connecting the N and C terminal domains. (c) A model that shows the role of an
open ring conformation of MCM for loading on to the origin dsDNA and then switch to
encircle the melted ssDNA during DNA replication. MCM is denoted by blue spheres.
During DNA replication, the conformation of MCM is dynamic, which can transition
between open and closed rings for function at different stages.

2.2 Discussion
Here we report the 1.8 Å resolution structure of the N- tapMCM, which forms a
right-handed filament. This is different from the previously published crystal structures in
the form of a double hexamer of N-terminal mtMCM (Fletcher et al., 2003), of a hexamer
of N-terminal ssoMCM,33 and of a thick left-handed filament of the near full length
ssoMCM.27 The inner channel of N-tapMCM is positively charged and wide enough to
18

bind ssDNA or dsDNA. The results reported here, in combination with the previously
reported lockwasher structure of eukaryotic MCM (Costa et al., 2011; Lyubimov et al.,
2012) suggests archaeal MCM may also be able to adopt a lockwasher conformation.
Both archaeal and eukaryotic MCM have been shown to form double-hexamers.
Interestingly, the eukaryotic MCM hexamer ring is closed when binding to Cdt1 before
loading on to the origin and once loaded, it becomes closed again (Remus et al., 2009).
Thus, MCM ring has to change conformation during loading. Studies of some eukaryotic
MCM complexes show that the closed hexamer conformation sometimes is cracked
between MCM2 and MCM5 subunits. MCM2-7 has been imaged as a lockwasher by EM.
Additionally, the RNA helicase Rho in E. coli adopts an open ring without RNA and
transitions to a closed ring conformation after binding to RNA (Skordalakes and Berger,
2003, 2006).44; 45; 46 Therefore, archaeal MCM may act similarly to switch between an
open ring and closed ring conformations to load on to the origin dsDNA, the process of
which is represented in the cartoon model in (Figure 2.6c). The open ring would adopt a
filament-like lockerwasher conformation. The diameter of the inner channel of the N-
tapMCM hexameric open ring in the lockwasher conformation is about 25 Å, which is
sufficiently wide to accommodate dsDNA as well as ssDNA.
MCM has been proposed to have dual roles for DNA replication: melting the origin
during initiation and unwinding DNA during elongation.1 In E. coli, the origin melting
for prokaryotic DNA replication is conducted by DnaA, which forms a filament around
DNA to open the origin DNA, followed by the loading of DnaB helicase onto the melted
single stranded DNA (Duderstadt et al., 2011). Interestingly, a previous EM study of the
archaeal MCM (mtMCM) by negative staining showed a thin right-handed filament for
19

the full length protein with 7.2 subunits per turn (Fletcher et al., 2005). While this EM
filament structure has similar dimensions as our high-resolution crystal structure of the
N-tapMCM reported here, the helix turn and pitch are different between the two forms. In
principle, such kind of thin filament conformation of MCM forming on dsDNA may
stretch DNA similarly to DnaA filament to melt origin DNA.
The basic active helicase form of Archaeal MCM is a hexamer (Shin et al., 2009). In
eukaryotic replication, the MCM double hexamer on the origin is shown to split into
single hexmers after origin melting and can function as an independent helicase to
unwind one replication fork. During MCM loading, origin melting, and replication fork
unwinding, the MCM may need to adopt different conformations, which may include
such changes from an open lockwasher/filament, to a closed circular hexamer/double
hexamer encircling dsDNA, to an open lockwasher/filament ring, and then finally to
hexamer encircling ssDNA (Figure 2.6c). The helical conformation of N-tapMCM
presented here may resemble the conformation that can encircle dsDNA with the gap in
the open-ring structure enabling the lagging strand to extrude out (Figure 2.6c). T
antigen, a viral replication initiator and a helicase, has been proposed to use an open ring
structure to bypass roadblocks that are covalently linked to DNA. For eukaryotic MCM,
the open ring of MCM2-7 is proposed to be closed by associating with GINS and Cdc45,
which may be responsible for enhancing the helicase activity. Like MCM2-7, TapMCM
also has low helicase activity by itself and binding to Cdc6 activates the helicase activity
(Haugland et al., 2008).
It is not clear if whether the crystal structure of this exact filament form can exist in
solution and or can bind DNA. However, based on current understanding of MCM
20

structures, the conformation of MCM oligomers is very dynamic and plastic, from
circular hexamer, double hexamer, heptamer, octamer, to open lockwasher, and filament.
Compared to the other published structures of archaeal MCM, we found that the N-hp
structure takes three different conformations in the three types of oligomeric complex:
right-handed filament, left-handed filament, and hexameric rings, to make different sets
of interactions. This suggests a potential structural role of the N-hp in helping regulating
the formation of the three types of oligomeric states. A yeast mcm5 mutant with N-hp
mutations is shown to be deficient in initiating DNA replication. Even though the most
direct explanation for this deficiency may be the defect for DNA binding, the mutation
could also affect the proper N-hp conformational changes, and thus the conformation
variations of MCM assembly. N-hp is connected with the AAA+ motor domain and ATP
hydrolysis changes the conformations of N-hp. This probably can explain how ATP
binding/hydrolysis can change the conformation of MCM from a lockwasher to a closed
ring.
While this study provides additional insights into the dynamic nature of MCM
structure in its origin loading/melting and DNA unwinding, the molecular details of this
process is still unclear. The polymorphism and dynamic nature of MCM conformations
demonstrated so far using various approaches is consistent with the multifaceted
functional roles of MCM in assembling a complex at the origin, melting the origin, and
unwinding the replication forks. If and how these different conformations of MCM are
switched between each others to perform a particular biological function at the origin and
replication fork, or even on the genomic DNA in general, are all important questions for
us to address in order to understand MCM function in DNA replication and genomic
21

stability. These questions would require further comprehensive investigation using
different approaches, one of which includes the determination of the complex structures
of MCM with DNA and other partners.
2.3 Methods
Cloning and purification of the TapMCM protein
The gene encoding full length TapMCM was cloned into a vector pGex-6p1. The
protein was expressed with an N-terminal His6 tag. The plasmid pGex-6p1-tapMCM was
transformed to E. coli and the cells were grown in 2XYT broth with 100 mg/ml ampicilin
at 37°C. After the OD600 reached 0.6, the cells was induced to overexpress MCM by a
final concentration of 0.5mM Isopropyl β-D-1-thiogalactopyranoside. TapMCM was
purified as the method used previously for SsoMCM.27 Cell pellets were resuspended
and lysed by French Press in buffer A (1 M NaCL, 50mM HEPES, pH7.5, 20 mM
Imidazole, 2 mM DTT). Cell lysis was centrifuged at 12000 rpm for 30 mins and the
supernatant was loaded to a nickel resin. The nickel resin was washed with 10 column
volumes of buffer A. Protein was eluted with Buffer A plus 250mM imidazole. Eluates
were diluted to 100 mM NaCl and and loaded to a Resource Q column. A gradient of
NaCl from 50 mM to 500 mM was applied to elute MCM. The fractions containing
MCM were combined and diluted to 100mM NaCl and then loaded to a Heparin column.
MCM was eluted by a linear gradient of 50 mM NaCl to 1000 mM NaCl. The fractions
containing MCM were pooled and concentrated to 2 ml and subjected to Superdex 200
column chromatography in buffer B (250mM NaCl, 20mM Hepes, pH 7.5, 2mM DTT).
The fractions containing MCM were concentrated to 30 mg/ml.

22

Crystallization
The full-length TapMCM protein was used for crystallization trials at 18°C by the
hanging drop vapor diffusion method. The P61 crystals of the TapMCM protein were
grown in solutions containing 0.1 M Hepes pH7.5, 0.2 M MgCl2, 15% PEG 400. The
sample from dissolved crystals was analyzed by mass spectrometer which revealed that
the P61 crystals was from the N-terminal domain of TapMCM that was the degraded
product of the full length protein.

Data Collection and Structure Determination
Data were collected from cryo-frozen crystals from synchrotron beamlines APS 23-
ID-D and ALS 8.2.1. Crystals diffracted to 1.8 Å and a complete data set was collected
from a single crystal. Phases were solved using autoMR within the Phenix suite (version
1.8.1, build 1168) with a single subunit of mtMCM (PDBID 1LTL) in the space group
P61 with one molecule per asymmetric unit of dimensions 93.5, 93.5. 56.2 Å (Table 2.1).
The structure was partially built with Autobuild then refined using phenix.refine.58
Rounds of refining and rebuilding in Coot were repeated to a final resolution range of
1.8-30 Å with a final R-free of 18.17 (Rwork = 21.5) (Table 2.1). Residues 101-102, 199-
206 and 240-243 in the final structure are unmodeled due to poor electron density.

23

Chapter 3 . Mini-chromosome maintenance complexes form a
filament to remodel DNA structure and topology

Reproduced with permission from Slaymaker IM, Fu Y, Toso DB, Ranatunga
N, Brewster A, Forsburg SL, Zhou ZH, Chen XS. Mini-chromosome
maintenance complexes form a filament to remodel DNA structure and
topology. Nucleic Acids Res. 2013 Mar 1;41(5):3446-56.
Contributions: Y.F created MCM mutant constructs, purified mutatants, did
helicase assays, DNA binding experiments, and gel filtration. Y.F and I.M.S
purified, crystallized ssoMCM, and collected diffraction data. I.M.S
processed data, calculated electrostatic, generated models, did topology
assays and carried out DNA melting experiments. I.M.S and D.B.T did
electron microscopy, A.B assisted with crystallography, N.R generated yeast
lines and did survival assays, S.L.F, Z.H.Z and X.S.C supervised project.

3.1 Results
MCM Filament Crystal Structure
Using a full-length MCM protein from the archeaon Sulfolobus solfataricus
(ssoMCM), crystals were obtained in the presence of 61 bp dsDNA, but not in the absence
of dsDNA, suggesting dsDNA is an integral part of the crystal, which is also confirmed
from agrose gel analysis of the solubilized crystals. The crystal structure is an unusually
wide left-handed filament (Fig 3.1a), with 10 subunits per helical turn. Each asymmetric
24

Figure 3.1 Overall features of the MCM filament structure.
(a) Surface representation of the crystal structure of the filament of full length ssoMCM.
The left-handed filament contains 10 subunits per turn. (b) Top down view through the
filament central channel, with dimensions indicated. (c) View of a MCM monomer
(ribbon in green) in the filament. Regions playing important roles in making contacts in
the filament are labeled. (d) Monomer structure, with a neighboring subunit in the
filament shown in grey. The division of the N-domain and C-domain, , and the
subdomains (A, B, C, N-C linkers, etc) are indicated. Notable structural features are
labeled: Nt-hp (N terminal hairpin); PS1 (pre-sensor 1), EXT (external hairpin), PH3-lp
(pre-helix 3 loop), P-hel (P-loop helix), P-lp (P-loop), H2I (helix-2 insert), ACL
(allosteric communication loop). The ATP binding pocket is marked with a red asterisk.

unit (asu) contains five MCM subunits. Despite the presence of DNA in the crystals, we
can only detect non-featured extra density along the filament channel which could be
accounted by the bound DNA with some freedom of rotation/sliding in each asu. Although
full length MCM protein was used in crystallization, density of a small wing helix like
domain at the C terminus was not visible, and thus the final model contains MCM protein
residues 7-598 and is missing residues 599-686.
Even though the resolution of the diffraction data goes to 4.1Å, the recently developed
refinement methods (DEN refinement (Schroder et al., 2010), also see Methods) worked
25

Figure 3.2 Samples of electron density map sections.
(a, b, c) Three sections of 2Fo-Fc map that show the electron density for the main-chain
and side-chain features. (d) Validation graphic of the final structure generated from
Polygon program using Phenix.

Table 3.1 X-ray refinement statistics

26

well to enable the confident placement of side chains in the electron density map (Figure
3. 2a,b,c), with excellent geometry and statistics (Table 3.1). The filament structure reveals
an outer diameter of approximately 175 Å and a large inner channel opening of 90 Å
(Figure 3.1a, b). The structure shows a narrow filament groove. Parallel to the narrow
groove is a furrow on the filament outer surface (Figure 3.1a), with side-channels formed
between neighboring subunits which connect to the interior of the filament central channel
(Figure. 3.1a).
To exclude the possibility that the filaments are a crystallographic artifact, we used
electron tomography (ET) to detect the oligomeric state of MCM bound to dsDNA in
solution. The same type of filaments were observed when MCM protein was pre-incubated
with naked dsDNA in solution, but not when incubated with ssDNA or in the absence of
DNA (Figure 3.3a). Three-dimensional (3D) ET reconstructions of filaments revealed that
the filament groove and pitch, dimensions and handedness, matches those of the crystal
structure well.
A prior EM study reported a very thin right-handed helical filament of a different
archaeal MCM (mtMCM). We were unable to detect any thin right-handed filament forms
by EM using either mtMCM or ssoMCM, in varying buffer conditions, with or without
DNA or added nucleotides. However, recently, a left-handed lock washer structure (with
filament arrangement) for MCM2-7 was published (Costa et al., 2011), providing an
example for a left-handed structure for an initiator protein, such as MCM.
27

Figure 3.3 Electron tomography (ET) and TEM imaging of MCM-dsDNA filament.
(a) Side by side comparison of the MCM filament crystal structure and ET reconstruction.
The crystal structure is filtered to 8Å (left) and a central slice from the ET reconstruction
is shown to the right. Note, the shadow in the EM image makes it to appear wider. The
superimposition of the crystal structure over the ET reconstruction image shows a well-
matched groove dimension and handedness (see S-Movie 1). (b) An ET reconstruction of
MCM filament showing DNA protruding from the ends (also see S-Movie 2 for views of
different sections). (c) Electron micrograph of WT MCM filament on 1,000 bp linear
dsDNA, forming a filament with 175 Å thickness, but a small fraction of it (bracket)
showing filament with similar thickness obtained from a mutant shown in panel d.
Approximately 1/100 of the wide filaments from WT MCM contains such a small portion
of thin filament end. (d) Electron micrograph of α5-linker mutant on 1,000 bp linear
dsDNA, exclusively forming a filament with 125Å thickness. Unlike the WT MCM, this
mutant cannot induce supercoiling of plasmid DNA (also compare S-Fig. 2a vs 2c, S-Fig.
4a vs 4b). Black scale bars are 500Å.

The structure of the MCM monomer in the filament is shown in Figure 3.1d, which
consists of two separable domains, an N-terminal domain (containing A, B, and C
subdomains) and the C-terminal domain (containing AAA+, α5 helix, and α-subdomains),
28

joined by a long linker (N-C linker). Despite a similar overall core fold to the previously
published monomeric structure of ssoMCM (3F9V (9)), the structure in the context of the
filament has some obvious conformational differences, as reflected by an r.m.s.d of 2.5 Å2
for the superimposition of the two structures. Compared to the previous structure, the C-
terminal domain is rotated ~17° about the N-C linker and swung away from the side facing
the central channel. Within the C-terminal domain, an alpha helix (α5 helix, Fig. 3a) rotates
dramatically (90° rotation) to take a different position and orientation, which has significant
consequences in filament assembly. At the N-terminus, the zinc bearing B subdomain also
has some positional shifts, revealing a structural flexibility about the β-sheet bridging the
B- and C-subdomains. Within the N-terminal half, another noteworthy difference from the
previous ssoMCM structure is that the long N-terminal hairpin (Nt-hp) from the filament
has a large shift to point at a different direction (Figure 3.5a), which alters the surface
charge features dramatically, generating a spiraling charged surface differing from that of
a hexamer with a horizontal changed surface within a ring (Figure 3.5b). The new
conformations of these structural elements appear to be important for forming contacts in
filament formation, as discussed below.

dsDNA Binds Within The MCM Filament Channel
As only broken and not featured extra density was seen within the filament channel,
which probably is due to the lack of fixed positioning of DNA, it was not possible to build
the model for the 61 bp dsDNA in the co-crystal. Using electron tomography to examine
the MCM protein incubated with 1000 bp dsDNA, however, the dsDNA was detected with

29

Figure 3.4 The helix α5 rotation and its interaction with the α-subdomain of a
neighboring subunit in the filament structure.
(a) C-domain structural alignment between the filament subunit (fila-ssoMCM, green)
and the previously determined monomer structure (3F9V, mon-ssoMCM, yellow). Fila-
MCM helix-5 (α5) is rotated 90˚ (red) relative to the mon-ssoMCM α5. (b) α5 (red) of
one subunit (mon2) docks on the α-subdomain (blue) of a neighboring subunit (mon1),
forming a 4-helix bundle between mon1 and mon2 in the filament structure. The EXT
hairpin (cyan) is just above the 4-helix bundle. (c) The side-chains (in stick model) of
some of the critical residues at the interface between α5 and α-subdomain, as well as on
the α5-linker for regulating filament formation.

the same form of MCM filament, with dsDNA clearly visible protruding from both ends
of the filament channel in EM tomographs (Figure 3.3b). The different Z-
sections of DNA bound filament are revealed in Supplemental Movie 2, which shows that
the filament features match those of the crystal structure.

30

Figure 3.5 The N-terminal domain structural alignment, and the DNA topology
change induced by MCM.
(a) Alignment of MCM N-terminal structures, showing the conformational change for the
N-terminal hairpin (Nt-hp) in the filament structure (green), with the Nt-hp pointing to a
different direction to make contact with a neighboring subunit. Monomeric mon-ssoMCM
in yellow (3F9V), N-ssoMCM in orange (2VL6), N-mtMCM in purple (1LTL). (b)
Electrostatic patterning of ssoMCM filament (5 subunits) compared to electrostatics of a
hexamers of the N-terminal ssoMCM. The Nt-hp conformation in the filament structure
reconstitutes an electro-positive surface (blue surface) to follow the spiral path in the
filament. The Orange objects represent the DNA with the expected DNA binding
orientation on the filament or the hexamer. (c) DNA topology footprint with MCM,
showing more negative supercoiling of DNA induced by increasing amount of MCM. Lane
1: Negatively supercoiled pBR233 plasmid; lane 2: Relaxed (nicked by topoisomerase)
plasmid DNA, and lanes 3-9: relaxed plasmid DNA incubated with increasing
concentrations (1-10 µM) of MCM. OC = open circle, (-) SC = negative supercoiling. Lk
= linker number.
31

Figure 3.6 The strong electro-positive “strip” along the helical filament inner
surface for DNA binding.
(a) Spiral positively charged electrostatic pattern (the blue strip) along the inner wall of the
helical MCM filament. (b) End view of the filament looking down the filament central
axis, showing the spiral electrostatic pattern (the blue strip) down the central channel. (c)
A half turn of the filament (5 subunits in one asymmetric unit or asu), showing the
electrostatic potential surface at -1 (red mesh) and 1 (blue surface) Kt/e. (d) Arrangement
of the six positively charge residues (or three pairs) on the electro-positive strip. (e)
Mutational effects of residues on the positively charged strip for dsDNA binding, (ND =
none detected). (f) Top down view along the filament channel, showing the periodicity (26
Å) of positively charged residues of each subunit and the length (153 Å) of the electro-
positive surface along the filament in one asu (five subunits), which matche the groove
periodicity (24.6 Å) and the length (150 Å) of a 61 bp DNA in A-form, as shown in panel-
g. (g) 61 bp A-form dsDNA modeled on to the electro-positive strip over a path of five
subunits of the filament, showing charged protein surface and matching periodicity of
groove spacing of the A-form DNA.

Electrostatic analysis of the crystal structure revealed a remarkably charged inner surface
that is highly electro-positive and forms a long, continuous “blue” (electro-positive) strip
32

along the filament inner channel surface (Figure 3.6 a-d), immediately suggesting a role in
DNA binding. Three pairs of residues, K246/R247 of one subunit, and
R379/ K381 and K408/R410 of an adjacent subunit, cluster on the filament channel
interface to form this electro-positive strip in the filament (Figure 3.6c, d). To confirm that
this electro-positive surface of the filament binds DNA, we mutated each residue pair to
Ala and assayed their DNA binding activity. As predicted, K408A/R410A mutant
completely abolished dsDNA binding (Figure 3.6e). R379A/K381A and K246A/R247A
mutants individually caused slight decrease in dsDNA affinity, and when combined
dsDNA binding was completely abolished (Figure 3.6e). These results confirm the DNA
binding role for this spiral electro-positive strip on the filament channel surface.
Examination of these mutants by EM revealed no filament formation, further illustrating
the need for binding DNA for the filament formation.

MCM Filament Induces Negative DNA Supercoils
Knowing that the left-handed MCM filament can bind linear dsDNA in packed crystal
and in solution, we subsequently used EM to examine MCM binding to closed circular
plasmid dsDNA. The result revealed that the plasmid DNA coated by WT MCM filaments
became heavily supercoiled (Figure 3.8a), indicating MCM can induce topological changes
to DNA.
To further confirm that MCM generates and stabilizes negative supercoils, we used a
topology footprinting assay to observe changes in DNA topology as described in methods.
In this assay, we added Topoisomerase I (TopoI) to plasmid DNA bound by various amount
33

of MCM to nick the circular DNA backbone and relieve topological stress of supercoils

Figure 3.7 The mutations of the positively charged residues on the electro-positive
DNA binding strip do not disrupt oligomerisation.
(a) Gel filtration profiles of MCM WT and mutants containing mutations on the electro-
positive DNA binding strip, showing these mutants behave similarly as WT in
oligomerisation. The buffer contains 250 mM NaCl. The molecular marker positions as
well as the expected hexamer and monomer peak positions are indicated by arrows. (b)
Elution profile of molecular markers on the same column.

introduced by MCM binding, allowing DNA to relax into the lowest energy topoisomer
that was then stabilized by ligation. Proteins were then degraded by proteinase K to isolate
the stabilized circular DNA with the altered linking number. The MCM generated the

34

Figure 3.8 Comparison of filament formation and supercoiling of circular plasmid
DNA by WT MCM and the α5-linker mutant.
(a) WT ssoMCM filament on circular plasmid dsDNA forms the large filament structure
(~175Å wide) and induces heavy supercoils. (b) WT ssoMCM forms a filament on a
1,000 bp linear dsDNA, which has a diameter of ~175 Å, and a length around ~120 nm,
much shorter than that of a 1,000 bp linear B-form dsDNA (340 nm). (c) α5-linker
mutant forms a narrower filament (~125 Å wide) on circular plasmid DNA, which shows
little supercoiling compared with WT. The result is consistent with what is shown in S-
Fig.4a-c. (d) α5-linker mutant forms a narrow filament (~125 Å wide) on a 1,000 bp
linear dsDNA. The length is ~331 nm, close to that of a 1,000 bp B-form DNA,
suggesting no significant shortening of the 1000 bp dsDNA, which is also consistent with
the lack of supercoiling on circular plasmid DNA for this mutant, as shown in panel-c
here. All scale bars (black) are 50 nm.

negatively supercoiled topoisomers of plasmid DNA in a dose-dependent manner (Figure
3.5c).
To confirm that the observed DNA topology change induced by MCM is indeed
negatively supercoiled, the same footprinting reactions were performed, but the reactions
35

were analyzed on agarose gels containing chloroquine, as chloroquine can bind dsDNA
and change the relative mobility of topoisomers depending on the negative or positive
supercoiling, allowing a differentiation between negative and positive supercoiling. The
result showed that presence of chloroquine on the agrose gel shifted the MCM-induced
supercoided DNA towards the sample wells relative to the chloroquine free gels (compare
Figure 3.9b,c), confirming that changes in DNA topology induced by MCM in the assay
were due to a negative change in linking number (-ΔLk).
A closer examination of the filament crystal structure revealed that the previously
mentioned positively charged residue pairs (such as K246/R247) critical for DNA binding
are spaced periodically ~26 Å apart along the left-handed electro-positive strip (Figure
3.6f), which is similar to the groove periodicity of A-form DNA (24.6 Å), but very different
from that of B-form DNA (35 Å). Although we cannot confirm that A-form DNA is indeed
present due to a lack of defined DNA electron density in the crystal structure, we used
molecular modeling to position dsDNA on the electo-positive strip of the left-handed
filament, which would require a transition from B-form to A-form to fit the periodicity of
the positively charged residues and the unit length of DNA (61 bs) per asu (Figure 3.6f, g).
The transition from B-form DNA to A-form requires untwisting (or net negative twist) of
the right-handed duplex DNA, loosening the double-helix. Such a local loosening of the
right-handed double-helix introduced through binding to the left-handed MCM filament
will generate supercoiling of a circular plasmid DNA in order to compensate for the local
untwisting of the duplex, thus providing a structural basis for the observed supercoiling of
DNA induced by MCM.
36

(a) DNA topology footprint of α5-linker
mutant of MCM (G485P/G501P), showing
little supercoiling of the circular plasmid
DNA was induced by the mutant MCM when
compared to the result using WT MCM in
panel-b. This result is consistent with the EM
result that shows the thinner filament formed
on DNA by this α5-linker mutant does not
induce supercoil on circular plasmid (see S-
Fig. 2c). (b) WT MCM topology footprint,
showing heavily supercoiled DNA
conformation induced by WT MCM,
consistent with the EM study shown in S-Fig.
2a. (c) WT MCM topology footprint assay as
in panel-b, except that chloroquine was added
to the agrose gel during electrophoresis
analysis to verify the extend of negative
supercoils induced by MCM, as chloroquine
is known to shift negatively coiled circular DNA towards the sample wells relative to
chloroquine free gels shown in panel-b. R: Relaxed plasmid generated from nicked
negatively supercoiled pBR233 plasmid by topoisomerase I treatment, and lanes 1-7 in
all panels: the relaxed plasmid was incubated with increasing concentrations of MCM (1-
10 µM of MCM proteins). OC = open circle, (-) SC = negative supercoiling. Lk = linker
number.

MCM Helix α5 Regulates Oligomerization
Spatial alignment of the AAA+ subdomains with the previously solved ssoMCM
monomer structure (Brewster et al., 2008) revealed a 90° rotation of α-helix 5 (α5) (Figure
3.4a). This rotation brings α5 close to the three helices of the α-subdomain of a neighboring
subunit, allowing α5 to form an inter-subunit four helix bundle with the α-subdomain in
the filament structure (Figure 3.4b, c). Linkers flanking α5 (α5-linkers) contain Gly and
Pro, which can provide the flexibility as well as rigidity of the linkers to enable α5 to have
Figure 3.9 Comparison of DNA
conformational changes induced by
WT and mutant MCM proteins.
37

the large rotations necessary for interacting with the α-subdomain of another subunit in the
filament form. Additionally, some residues at the binding interface between α5 and α-
subdomain helices are highly conserved among archaeal and eukaryotic MCMs (Figure
3.10). Thus, we predicted that not only the Gly/Pro residues of the α5-linkers, but also the
conserved residues (such as F540, Figure 3.12a) at the interface between α5 and α-
subdomain are important for proper inter-subunit interactions for filament formation. To
test this we created mutants of the conserved residues on the interface between α5 and α-
subdomain (F540A mutant), and of the Gly and Pro residues on the α5-linker
(G485P/G501P mutant). By gel filtration chromatography, the G485P/G501P and F540A
mutant proteins eluted as smaller oligomers (with a molecular weight similar to a trimer)
than the WT oligomeric form (a hexamer form) in 250 mM NaCl buffer (Figure 3.11a),
clearly indicating compromised subunit association, even though not a complete
disruption.
We also examined whether these mutations would affect filament formation. By EM
examination, we found that F540A mutant could not form any filaments, but formed only
closed or open ring circular structures consisting of 6-8 subunits. Surprisingly, when tested
for helicase activity, F540A still showed significant amount of activity, with ~50-60% of
WT activity (Figure 3.12b, c). As for the G485P/G501P mutant on the α5-linker, EM study
revealed that this mutant exclusively formed a thinner filaments with diameters of only
~125 Å (Figure 3.3d), 50 Å narrower than the 175 Å filaments observed in WT MCM.
After surveying the WT filaments extensively, we occasionally found very small portion
38

The structure of two neighboring
ssoMCM subunits in the filament,
showing the conserved interface on
one subunit (drawn in surface
structure) for binding α5 from a
neighbor subunit (drawn in ribbon).
The degree of conservation on the
surface structure is obtained from
sequence alignment of ssoMCM with
S. pombe, H. sapiens, S. cerevisiae,
and X. laevis MCM proteins 2-7, and
shown by Consurf server coloring
scheme (at the bottom). Red is highly
conserved between MCMs and blue is
highly variable. Helix-5 (α5)
(indicated) docks to a highly
conserved region (colored in red) of
the three helices of the α-subdomain
that contains the highly conserved
residue F540.

of the large filaments of the WT (about once out of 100 filaments) to contain small portion
of the ~125Å narrow filament (bracketed portion in Figure 3.3c).
Unlike the wide filament that can spiral DNA along its helical electro-positive strip,
the narrow filament formed by G485P/G501P mutant would only have sufficient space in
the central channel to allow dsDNA to thread straight through the filament, generating little
or no untwisting of the bound double helix, which would predict little or no DNA
supercoiling to be induced by this mutant MCM protein. Indeed, EM observation of this
mutant bound to circular plasmid DNA revealed very little supercoiling (Figure 3.8c). This
result is also corroborated by the DNA topology footprint assay demonstrating that little
supercoiling was induced by the α5-linker mutant (G485P/G501P) (Figure 3.9a).

Figure 3.10 Conservation residues of MCM.
39

Figure 3.11 Gel filtration (Superose-6) chromatography assay of MCM mutants,
with molecular marker elution profile shown in panel-c at the bottom.
(a) Gel filtration profiles of ssoMCM WT and mutants containing G485P/G501P
mutations on the α5 linker and F540A at the interface between α5 and α-domain of two
neighboring subunits. The results reveal that the two mutants behave differently from WT
in oligomerization. WT profile (indicated by *) has a peak at the hexamer position with
molecular weight of approximately 480 kD. The mutants eluted at peak positions of
approximately 210 kD (around the molecular weight of a trimer), indicating weakened
inter-subunit interactions for the mutants at the assay condition. The gel filtration
chromatography was on Superose-6 analytical column in a buffer containing 20 mM
HEPES pH 7.5, 2 mM DTT, and 250 mM NaCl. The molecular marker positions as well
as the expected hexamer and monomer peak positions are indicated by arrows. (b)
Elution profile of molecular markers.

40

Figure 3.12 Helicase activity of ssoMCM-F540A mutant at the interface between
helix α5 and α-domain.
(a) Alignment of S. solfataricus MCM and S. pombe, H. sapiens, S. cerevisiae, X. laevis
and D. melanogaster MCM4 proteins around the F540 region one of the three α-domain
helices (α7) which is at the interface with helix α5. The residue aligning to ssoMCM
F540 is marked by (*). (b) F540A mutant that can no longer form filament still showed
helicase activity, which is ATP dependent. B: boiled fork DNA; UB: unboilded fork
DNA without protein, negative control for unwinding; WT: wild type protein; M: F540A
mutant protein. The positions of dsDNA and ssDNA are indicated. (c) Helicase activity
of ssoMCM-F540A at a range of tested protein concentrations, showing that F540A
mutant retained around 50-60% of the WT helicase over a range of protein
concentrations. Error bars were derived from 3 separate experiments.

Testing the Biological Relevance of α5-α subdomain Interactions in vivo
We employed yeast genetics to test the biological relevance of the α5-α subdomain
interactions important for filament formation using yeast S. pombe cells. As mentioned
previously, the α-subdomain residue F540 at the interface with α5 is highly conserved as
F/Y in MCM4 from several eukaryotic organisms (Figure 3.12a), suggesting a conserved
role for the equivalent F540 in other organisms in regulating α5 interactions for
41

oligomerization. Previously we showed that the F540A ssoMCM mutant could no longer
form filament structure, but still retained 50-60% WT helicase activity (Figure 3.12b, c).
Therefore, we made the F540A equivalent mutation in S. pombe, which is Y751A on
MCM4, to test the phenotype of this mutation in vivo (see Methods). We constructed
plasmids containing mcm4+ wild type gene or mcm4-Y751A mutant under control of a
weakened thiamine-regulated nmt1+ promoter, and transformed these into yeast strains
with either WT mcm4+ or a temperature sensitive allele mcm4ts which is not functional
at 36˚C.
Transformants were isolated in the presence of thiamine, which represses the
promoter. WT cells expressing mcm4-Y751A mutant were able to form colonies at all
temperatures and at all levels of expression. However, mcm4-Y751A was not able to
complement mcm4ts at 36°C, indicating that the mutant MCM4 is not functional (Table
3.2, Figure 3.13). Interestingly, mcm4-Y751A is toxic in mcm4ts even at permissive
temperatures when overproduced (minus-thiamine), as shown by very small colony size or
failure to form colonies, compared to wild type MCM4 or the vector control (S-Fig. 8).
The cells are elongated, indicating a cell cycle delay or arrest. This phenotype indicates
that an already attenuated protein (mcm4ts, in this case) is outcompeted by a dominant
lethal mutation (mcm4-Y751A) and suggests that the mutant may form non-functional
assemblies with cellular MCM. This in vivo result using the equivalent F540A mutant
suggests that the α5-α subdomain interactions is critical for cell survival.
In addition to the conserve residue (equivalent of F540) at the α5-α subdomain
interface discussed above, we also want to examine the role from the α5 side using yeast
genetics. As G458/G501 residues are poorly conserved in the α5 linker region among
42

archaeal and eukaryotic MCMs, we generated a mutant by deleting the α5 helix (res. 690-
704 of MCM4 from S. pombe). When the α5-deletion mutant was expressed from the
native mcm4 promoter in a plasmid, the mutant was not able to produce colonies following
the transformation with the temperature sensitive strain (mcm4 ts, F784Y strain) under
permissive temperature conditions, although the same α5 plasmid was able to successfully
produce colonies in the wild type strain (FY261 strain) at all three temperatures tested (data
not shown). This indicates that the deletion mutant exhibits a synthetic dosage lethality
phenotype.
When performing the same transformation experiments with the mutant derivatives
expressed by the weakest nmt1 (“81X”) promoter, we were able to successfully obtain
colonies following transformation from both mutation types with wild type and
temperature sensitive (mcm4 ts) strains under low expression conditions (+thiamine)

Table 3.2 Complementation data at permissive temperature 320C in S. pombe.

Plasmid
Wild Type
+ thiamine
Wild Type
- thiamine
mcm4ts
L238P
+ thiamine
mcm4ts
L238P
- thiamine
pNR29 (mcm4
+
) + + + +
pSLF372 (vector) + + + +
pNR30 mcm4-
Y751A-HA
+ + + +/-
pNR31mcm4-
Δ690-704 ( Δ 5)
+ + - -

43

Figure 3.13 Phenotypes of mutants (mcm4-Y751A) and wild type mcm4 (mcm4+)
plasmids transformed in the mcm4 temperature sensitive and in wild type strains.
Candidates were streaked on EMM-URA+ thiamine and - thiamine plates and incubated
at 25ºC, 32ºC and 36ºC for 7 days. The representation is following 5 days of incubation.
Presence of thiamine suppresses the expression WT or mutant MCM protein from the
transformed plasmid. The drawing on the bottom indicates the layout of the six plates
and the six experiments on each plate with particular clones and the cellular mcm4
genetic backgrounds.

although the α5-deletion mutant still showed relatively smaller colonies in the mcm4ts
host. Upon induction of the promoter (-thiamine), mcm4ts cells expressing either mutant
were no longer able to produce colonies, again indicating a toxic phenotype for α5-deletion
mutant (Figure 3.13).
These in vivo yeast genetics data obtained with the mutants designed to disrupting the
α5 and α-domain interactions for MCM4 of S. pombe, together with the in vitro structural
and biochemical data, suggest an important biological role for the interactions between the
α5 and α-domain observed in the filament structure.

44

3.2 Discussion
We described here an unusually wide filament structure of an archaeal MCM that
exists both in crystals and in solution. The formation of this large, left-handed filament
requires the presence of dsDNA. Remarkably, MCM filament formed on DNA is capable
of drastically changing DNA topology. This topology change is resulted from untwisting
the bound dsDNA, changing the local helical parameters of the duplex from B-form to a
looser isoform similar to A-form DNA. Furthermore we identified the structure elements
critical for filament formation through in vitro biochemical and EM studies, and showed
that mutation on these structural elements impacted MCM4 function and cell survival
through in vivo genetics study in S. pombe yeast.
One possible functional implication of the new structural and biochemical data
described here could be that MCM helical complexes bind and untwist DNA at origins to
facilitate strand separation. Similarly, bacterial replication factor DnaA has been reported
to “screw” dsDNA within a right-handed helical filament, in a comparable manner to
RecA, which is thought to catalyze origin DNA melting and replication initiation
(Duderstadt et al., 2011). AAA+ family enzymes, including MCM, share a core fold similar
to that of the RecA family of proteins and perform similar functions in DNA remodeling.
The pitch and angle of RecA filament subunits can adjust in response to ligands such that
a change in filament morphology occurs, and RecA and Rad51 (a eukaryotic RecA
homolog) form both right and left handed helical filaments around DNA to facilitate
disruption of the duplex (Chen et al., 2007a; Cox, 2007).
The role for MCM filaments in replication initiation would fit well with the current
understanding of pre-RC architecture. The central channel of this unusually wide filament
45

is large enough to support a replication bubble and allow an MCM ring to clamp down on
newly exposed single stranded DNA. This would also allow the filament to protect ssDNA
from prolonged exposure to the cellular environment. In this case, the ORC could act as a
nucleation point for filament growth. A modest conformational change via the α5 (and
possibly other structural elements) would allow a transition of MCM from the filament
form to the hexamer from that is the active helicase conformation. The in vitro reconstituted
MCM double hexamer on dsDNA shows no DNA melting (Remus et al., 2009). One of the
possible scenarios is that MCM initially loaded to the pre-RC as a double hexamer would
transition to a filament to initiate origin melting, excluding the lagging strand, and then
closing back into a ring. However, the process in this scenario seems inefficient.
Alternatively, the filament and double hexamer may exist together around origins,
partitioning the role of melting and unwinding between the two structural forms of MCM.
In any case, other replication factors are certainly involved in helicase activation. GINS
and Cdc45 are reported to promote a switch from an open “lock washer” of MCM2-7 to a
planar ring (Costa et al., 2011). Given our data, it is possible that GINS and Cdc45 could
also assume a role in switching MCM from a filament to a ring at melted origin DNA. It’s
noted that in addition the previous right-handed “lock washer” structure, a left-handed
“lock washer” form of MCM2-7 (with arrangement similar to a filament) was recently
reported (Costa et al., 2011).
Notably, the MCM proteins that associate with unreplicated chromatin regions away
from the origins (the MCM paradox) remain largely uncharacterized. So far, two chromatin
bound MCM populations have been described: an “associated” population that can be
removed by high salt, and a “loaded” population that was shown to be origin-DNA bound
46

hexamers/double hexamers. Because the MCM filaments described here could only be
formed in relatively low salt concentration, this salt-sensitive nature of the filament form
suggests that they may be categorized as the “associated” population. Most studies focus
on pre-RC assimilated MCM complexes at replication origins, however a larger portion of
MCM proteins is distributed over a wide ranges of unreplicated chromatin and distal to
replication origins. It is an intriguing question whether the filament form of MCM is
partially responsible for those MCMs associated with chromatin regions away from the
origins.
MCM’s capability of altering DNA topology suggests a possible mechanism for MCM
proteins to regulate the diverse array of biological processes in addition to replication, such
as chromatin remodeling and transcriptional regulation. Evidence suggests that MCM
proteins (likely the origin distal MCM population) are involved in additional functions
outside genome replication, such as transcription, chromatin remodeling and tumor
suppression. It is conceivable that the ability of MCM filament formation on DNA to cause
dramatic supercoiling of distal dsDNA would likely influence chromosome structure,
which should impact on the regulation of gene expression and other aspects of DNA
metabolism. A more detailed structure/function understanding paired with further in vivo
data will be required to resolve these exciting possibilities.

3.3 Methods
ssoMCM Cloning and MCM Purification
Wild type (WT) full length S. solfataricus MCM containing residues 1-686 cloned as
His-tagged fusion proteins in vectors pGEX-6P-1. Mutants of MCM were made using
either Quikchange or PIPE and expressed as previously described (Brewster et al., 2008).
47

Full length WT and mutant MCM proteins were purified from E. coli grown at 25°C for
18 hours. Cells were lysed by French-press and centrifuged at 10,000 rpm for 1 hour.
Supernatant was passed over nickel resin and washed with 10 column volumes of high salt
Buffer A (1M NaCl, 50 mM HEPES pH 7.5). MCM was eluted with 5 column volumes of
Buffer A supplemented with 250 mM imidazole. Eluted MCM fractions were diluted or
dialized to 100 mM NaCl and passed over a Resource Q column. MCM was eluted from
the Resource Q by a 10 column volume salt gradient from 50 mM to 500 mM NaCl.
Resource Q fractions were diluted to 100 mM NaCl and passed over a heparin column.
MCM was eluted from the column with a 50 mM to 1000 mM NaCl linear gradient.
Heparin fractions were collected, concentrated to 1 mL in 250 mM NaCl, 20 mM HEPES
pH 7.5, 2 mM DTT, and then further purified by Superdex 200 column chromatography.
Superdex 200 fractions were concentrated to 30-50 mg/mL and flash-frozen in liquid
nitrogen.

Crystallization and Structure Determination
To assemble a homogeneous complex, MCM (50 mg/mL) was initially incubated with
a 61 bp dsDNA with a 3` T overhangs on each strand and dialyzed from 2M NaCl to 50
mM overnight at 4 °C for crystallization trays. DNA strands for annealing into the 61 bp
dsDNA (strand1:tagctattagagcttggtttaattatacaaactcaatatttttcttttttccttcctttat,
strand2:tatcgataatctcgaaccaaattaatatgtttgagttataaaaagaaaaaagaaggaaat) were purified using
a MonoQ column (GE), annealed overnight, and further purified on an Superdex 200 gel
filtration column (GE). Hanging drop crystal trays were set up at 4 °C. Small but long
needle crystals grew to dimensions of ~30x40x200 microns at 4 °C in 2 µL drops with
48

ratios of 1 – 1.5 µL MCM to 1-0.5 µl of crystallization buffer (7.5% isopropanol, 420 mM
NaSO4, and 20 mM HEPES pH 6.75). Crystals were harvested, cryoprotected in 420 mM
LiSO4, 25% PEG 400, 25mM HEPES pH 6.75 and flash frozen in liquid nitrogen. Data
was collected at APS beamline GMCA/CAT 23-ID (and 19-ID) using the 5 micron
microbeam vectored over the length of the crystal needles.
Diffraction spots were detected up to 3.8 Å with 30 sec exposure at 23-ID. However a
30 second exposure time essentially kills the crystal diffraction. As a result, we used a
combination of 5 second exposure time, microbeam, translations every 3-5 exposures along
the needle crystals, and multiple crystals to collect data sufficient for obtaining the highest
resolution data set to 4.29Å. Later on, a different crystallization condition (0.1M Hepes
pH7.0, 18%MPD) yielded a crystal form that has the same space group and same filament
structure, but are more resistant to radiation damage up to 120 second exposure time in 23-
ID-D, and we are able to extend the resolution of the structure to 4.1Å (Table 3.3). The
crystal is in space group P21, with five subunits per asymmetric unit.
The structure was determined by molecular replacement using 3F9V with loops
trimmed off as a search model using the Phaser program in the Phenix suite (30). R-free
flags (5%) were set at this point and communicated between Phenix and CNS as needed.
The initial model was rebuilt as a polyalanine structure in Coot with reiterative rounds of
solvent flipping and solvent flattening using CNS, density modification and 5-fold NCS
averaging from the CCP4 suite or CNS. Once the main chain was properly placed, side
chains were added and refined using CNS 1.3 DEN low resolution refinement strategies
(31). The reference model for DEN restraints was a hybrid of the N-terminal ssoMCM and
homology model of mkaMCM threaded through the structure model from 3F9V. The DEN
49

refinement improved the phases at this resolution, as evident by the improved density and
correct side-chain positioning, which is the case for the refinement of another large
complex structure with 5.0 Å data. After DEN refinement, the model was further rebuilt
by reiterative rounds of density modification in CNS and model building in Coot using B-
factor sharpening and Density Modification in CNS. Further model improvements were
made using phenix.refine in Phenix version 1.7.2-863 (30). 5-fold NCS restraints were
imposed at all stages. Final refinements with geometry restraints were done using Refmac
and phenix.refine imposing secondary structure restraints, TLS restraints, Ramachandaran
restraints, and 5-fold NCS to a final model R-work/R-free 34.38/35.25 and Ramachandaran
statistics 85.3% in the most favored and 0.8% outliers. Identical set of reflections were
used for R-free at all stages of refinement (Table 3.3).
Once the model was refined satisfactorily, validation and final statistics were acquired
using Molprobity server (http://molprobity.biochem.duke.edu/ ) and phenix.validate. Our
structure fell into the 83rd percentile among structures from 3.25Å to 4.36Å resolution with
0 bad bonds, 0 bad angles, and excellent statistics among structures of similar resolution.
N-terminal residues 1-6 are not included in the structure as no density was seen. Density
for the flexible C-terminal 88 residue wing-helix domain of ssoMCM was also not visible
and thus the final model contains residues 7-598 for each of the five subunits in the
asymmetric unit or half of one helical turn. Although broken density was observed within
the central channel, we were unable to build a model for dsDNA into the filament.

50

Table 3.3 Data collection and refinement statistics

*Highest resolution shell is shown in parenthesis.

Transmission Electron Microscopy (TEM) and Electron Tomography
Negatively stained samples were prepared by placing a small drop (~4 μL) of sample
solution onto a glow-discharged carbon-coated copper grid. 200-mesh and 100/400 slotted
51

grids were used for TEM and electron tomography, respectively. After a period of one
minute at room temperature, the sample was blotted and a drop of 2.5% uranyl acetate
solution was immediately placed on the grid. After staining for one minute the drop was
blotted off, the grid was washed four times with the same stain solution, and then allowed
to air dry.
The stained samples were visualized with an FEI Tecnai F20 transmission electron
microscope with an accelerating voltage of 200 kV. The samples were imaged at 50,000x
to 100,000x with an underfocus value of 3 μm. Tomography tilt series were taken using
the FEI Batch Tomography software with a tilt range from -70o to +70o. The tilt series
were recorded on a 16 megapixel TVIPS CCD camera.
Alignment of the tilt series was performed using the etomo tomography processing
software from the Imod package. The steps included removing X-ray hot spots, rough
alignment by cross-correlation, and fine alignment by patch tracking. The aligned tilt series
were then used to make 3D reconstructions using GPU-based SIRT (Simultaneous Iterative
Reconstruction Technique) reconstruction implemented in Inspect3D (FEI). Slices from
the 3D tomography maps were displayed using the slicer tool within the 3dmod program
of the Imod package. Amira (Visage Imaging GmbH, http://www.amira.com/) was used to
segment and to create volume renderings of the 3D density maps of the filaments.

Consurf, Sequence Alignments, and Electrostatics Analysis
Conserved region alignments and coloring were done through the conserf server
(http://consurftest.tau.ac.il/). Multiple protein alignments were done with the ClustalW
52

server (http://www.ebi.ac.uk/Tools/msa/clustalw2/). Electrostatics of MCM filament
structure were calculated using the APBS plug-in as part of the Pymol 1.4.

Assays for DNA Binding, Helicase Activity, and Oligomerisation
A range of concentrations of purified MCM protein was incubated with 0.2 uM 61bp
dsDNA in binding buffer (10 mM Tris pH 8.0, 50 mM NaCl) at room temperature for 30
min. 10 µl reactions with 5% glycerol were electrophoresed (in 0.5% agarose, 0.5xTBE)
at 90 V for 40 min. After electrophoresis, gels were stained in ethidium bromide and
visualized under UV light. The DNA binding was quantified using a software Quantity
One. Helicase assays were performed as previously described (Brewster et al., 2010).
For oligomerisation assay, purified MCM and MCM mutants were dialyzed in a buffer
containing 10 mM HEPES pH 7.5, 50 mM NaCl, 2 mM DTT. 500 µg protein in 100 µL
was analyzed by gel filtration chromatography on an analytical Superose 6 column at 4 °C
in a buffer containing 10 mM HEPES pH 7.5, 250 mM, 2 mM DTT.

DNA Topology Footprints
MCM was dialyzed into buffer containing 50 mM NaCl and 10 mM Tris 8 and diluted
to 6 mg/mL. A 15 µL reaction solution containing 500 ng of plasmid DNA (pBR233, New
England Biolabs) and MCM was incubated at room temperature for 30 min. 5 units of E.
coli topoisomerase 1 were added to the reaction and incubated for 3 hours at 37˚C. 25 mM
EDTA and 5% SDS were added to stop the reaction which was then deproteinated by
addition of proteinase K. Samples were run on a 1% agarose gel either with or without 1.4
µg/mL of the intercalator chloroquine added.
53

Yeast Plasmid and Mutation Construction for Yeast Genetics:
Nucleotide changes to introduce the point mutation and the internal deletion were
created using the Phusion site directed mutagenesis kit (New England Biolabs) following
the manufacturer’s instructions. The constructs were sequenced (Laragen and Genewiz) to
confirm the presence of the mutation and to confirm that PCR mutagenesis did not
introduce additional mutations.

Yeast Strains and Manipulations:
Fission yeast strains used for the study were grown in yeast extract plus supplements
(YES) or in Edinburgh minimal medium (EMM) with appropriate supplements. In this
work wild type strain refers to FY 261 (h+ can1-1 leu1-32 ade6-M216 ura4-D18) and
mcm4 ts refers to FY 784 (h+ cdc21-M68 ura4-D18 leu1-32 ade6-M210 can1-1).
Yeast plasmids used for this work are derived from REP82X and contain a ura4+
marker, the weakest nmt promoter and a HA tag at the C terminus. pNR29 served as the
wild type ( positive control) whereas pSLF372 served as the vector only (negative control).
Transformations were carried out by electroporation and candidates were selected on EMM
media lacking uracil, which also contained 15µm thiamine for full repression of the nmt
promoter. Plates were allowed to grow at 25 ˚C for ~ 7 days following the transformation
or until colonies were visible.
Once colonies were present complementation analyses of wild type and mcm4
temperature sensitive strains were carried out by streaking six independent colonies from
each transformation on EMM media lacking uracil, supplemented with 15 µM thiamine,
and incubated at 25ºC, 32 ºC and 36 ºC for seven days. Plates were scanned on day 3, 5
54

and 7. The represented figures are following 5 days of incubation at the designated
temperatures.

55

Chapter 4 : DNA cytosine and methylcytosine deamination by
APOBEC3B: enhancing methylcytosine deamination by
engineering APOBEC3B

Reproduced with permission from Fu Y, Ito F, Zhang G, Fernandez B, Yang
H, Chen XS. DNA cytosine and methylcytosine deamination by APOBEC3B:
enhancing methylcytosine deamination by engineering APOBEC3B.
Biochem J. 2015 Oct 1;471(1):25-35.
Contributions: Y.F designed the experiments, performed the experiments,
and wrote manuscript; F.I, G.Z, B.F, and H.Y performed the experiments;
H.Y and X.S.C wrote the manuscript. X.S.C supervised project.
4.1 Results
Cytosine deamination by A3B
There are conflicting reports regarding whether both A3BCD1 and A3BCD2 domains
are catalytically active (Bogerd et al., 2007; Bonvin and Greeve, 2007; Shinohara et al.,
2012). To resolve this issue, we generated A3B mutants with inactivated mutations in the
CD1 and/or the CD2 catalytic center in the full-length A3B (FL-A3B) construct, or in the
separated CD1 and CD2 clones (Figure 4.1a). Specifically, either the putative catalytic
residue E68 of CD1 was mutated to generated E68A mutant, or the catalytic residue E255
of CD2 was mutated to generated E255A mutant, or both residues mutated to generate a
combined E68A/E255A mutant.
The C deaminase activities were examined by a gel-based fluorescence assay using a
single-stranded DNA (ssDNA) substrate containing a target C (Figure 4.1b). The sequence
56

Figure 4.1 Deamination on normal cytidine (C) by A3B and its mutants.
(A) Schematic of various A3B constructs, expressed as MBP-fusion. The putative catalytic
residue mutations E68A and E255A are marked red. (B) Flowchart of deamination assay
on 5' FAM (yellow asterisk) labeled ssDNA containing a single target C. The C is
deaminated to uridine (U) by A3B, and UDG releases uracil from ssDNA, and NaOH
treatment converts the ssDNA to two shorter ssDNA fragments. Only the ssDNA linked to
FAM is detected by fluorescent detector. (C) Gel image showing the C deamination
activity of the eight A3B constructs. 2 µM protein was incubated with 600 nM 50 nt ssDNA
substrate containing C for 2 h at 37°C. The reaction mixture was separated on a 20% TBE-
urea polyacrylamide gel. The control reaction contained no A3B but with UDG and NaOH
treatment. (D) Dose response of FL-A3B WT, FL-A3B E68A and A3BCD2 WT. Protein
at concentration 0.25 µM, 0.5 µM, 1 µM, 1.5 µM, and 2 µM was incubated with 600 nM
50 nt substrate for 2 h at 37°C. Error bars represent s.d. from the mean of three independent
experiments.

57

motif specificity of the ssDNA substrates for FL-A3B was examined using the ssDNA
substrates 5' NCA and 5' TCN, and the results show that 5'-TCA/G is the preferred DNA
sequence motif (Figure 4.2a, 2b). Then the C deaminase activity of the purified proteins of
these A3B constructs was compared using an ssDNA substrate containing the hotspot 5'-
TCA (Figure 4.1c). The results show that FL-A3B at a concentration of 2 µM was able to
deaminate approximately 90% of 600 nM substrate in 120 min. The FL-A3B mutant
E68A/E255A showed no detectable deamination activity. However, FL-A3B E68A (with
CD1 mutation) showed similar activity as FL-A3B, but FL-A3B E255A (with CD2
mutation) did not show any activity. These in vitro results clearly indicate that CD2 of
A3B is catalytically active, and CD1 inactive.
The individual WT CD2 domain (A3BCD2 WT) alone was also active in C
deamination (Figure 4.1c), even though with approximately 6-fold lower activity than that
of FL-A3B at a protein concentration of 2 µM (Figure 4.1d). These data suggest that even
though CD1 has no C deamination activity, it enhances the activity of the CD2 domain in
the context of FL-A3B. In further dose response studies, FL-A3B WT and FL-A3B E68A
mutant (CD1 mutation) showed similar activity within the tested protein concentration
range, whereas A3BCD2 WT alone showed much reduced activity in the tested
concentration range (Figure 4.1d). These results clearly indicate that the FL-A3B E68A
mutant in CD1 behaved similarly as WT CD1 in its role for enhancing the CD2
deamination activity in the context of the FL-A3B protein.
Given the fact that the overall charge of +4.5 for CD1 and -3.9 for CD2 at pH 6.5
(http://protcalc.sourceforge.net/), it is plausible that CD1 in FL-A3B may help bind ssDNA
substrate and orient it for efficient deamination of the target C by CD2. Using a steady-.
58

Figure 4.2 Substrates preference and DNA binding of MBP-tagged A3B proteins.
(A) and (B) Deamination product of MBP-tagged A3B wild type using single-stranded
DNA substrates with C that vary at the 5’ position and 3’ position relative to the target
cytosine was measured at different time. (C), (D), and (E) DNA binding to ssDNA by
MBP-tagged A3B wild type, A3B CD1, and A3B CD2 was measured by rotational
anisotropy. Values for each data point represent the mean ± S.E., determined from 3
independent measurements.
59

Figure 4.3 Substrates preference of MBP-tagged A3B proteins on C and mC.
(A), (B), (C), and (D) Deamination product of MBP-tagged A3B E68A and A3B CD2
using seven different ssDNA substrates with C was measured at different time. (E) and
(F) Deamination products of MBP-tagged A3B wild type using seven different ssDNA
substrates with mC were measured at different time. Values for each data point represent
the mean ± S.E., determined from 3 independent measurements.

60

state rotational anisotropy binding assay we measured the apparent dissociation constant
Kd of CD1, CD2, or FL-A3B with the ssDNA substrate containing the hotspot 5'-TCA.
The results show that while CD1 or CD2 alone has a relatively weak affinity to ssDNA
(Kd = 1 and 3 µM, respectively), FL-A3B has Kd = 67.9 nM showing a much enhanced
binding to ssDNA (Figure 4.2c-e). These results suggest that the combination of the CD1
and CD2 domain leads to a synergistically enhanced binding to ssDNA, which may directly
contribute to the enhanced deamination activity. This synergistic effects could be the result
of the three dimensional arrangement of CD1 and CD2 in the full-length structure which
allows the involvement of different parts of two domains coming together to enhance the
affinity and activity. The sequence specificity, on the other hand, is independent of the CD1
domain since both the E68A mutant and the CD1 deletion mutant display similar sequence
specificity as that of FL-A3B (Figure 4.3a-d).

Methylcytosine (mC) deamination by A3B
We examined mC deamination by A3B using an ssDNA containing 5'-TmCA motif
(Figure 4.4a). While the inactive mutant FL-A3B E68A/E255A did not show any mC
deamination activity, FL-A3B and FL-A3B E68A showed clearly detectable deaminase
activity on mC with both 50 nt and 30 nt substrates (Figure 4.4b). This mC deamination
activity by FL-A3B was much lower than the C deamination over a wide range of protein
concentration tested (Figure 4.4c). The A3BCD2 WT construct also showed detectable but
lower mC deamination than that of FL-A3B (Figure 4.4d, inset in Figure 4.4d). When
comparing the specific deamination activity in the linear range (Table 4.1), A3BCD2 had
61

about 50-fold lower mC deamination than C deamination. Despite much lower mC
deaminase activity the sequence specificity of the mC substrates of FL-A3B appears

Figure 4.4 Deamination on methylcytidine (mC) by A3B and its mutants.
(A) Flowchart of deamination assay on 5' FAM (yellow asterisk) labeled ssDNA containing
a single target mC. The mC was deaminated to thymine (T) by A3B. A 3-fold excess
complement strand (Comp-ssDNA) was added to form T:G mismatch. TDG releases T
from T:G mismatch and NaOH treatment converts the product to two shorter ssDNA
fragments. (B) Gel image showing the mC deamination activity of eight A3B constructs
on 50 nt (left) and 30 nt (right) ssDNA substrates. 2 µM protein was incubated with 600
nM ssDNA substrates containing mC for 2 h at 37°C. (C) Comparison of the dose response
deamination activity on C and mC by FL-A3B WT. (D) Comparison of the dose response
deamination activity on C and mC by A3BCD2 WT. The small inset is an amplified chart
that compares the mC deamination activity by FL-A3B WT and A3BCD2 WT. For both
panels-C and D, protein at various concentrations was incubated with 600 nM 50 nt ssDNA
substrate for 2 h at 37°C. Error bars represent s.d. from the mean of three independent
experiments.

62

similar to that of the C substrates, suggesting that the reduced deaminase activity with mC
is not due to the change of the sequence motif specificity (Figure 4.3e-f).

Engineering A3BCD2 to achieve increased mC deamination activity
We also have a highly purified A3BCD2 WT protein with a His-tag fused to its C-
terminus, and the dose response deamination assay showed that this construct had roughly
similar activity for mC (Figure 4.5a) and normal C deamination as the previous MBP fused
construct (Figure 3.9a, b). Additional controls in Supplementary Figure S4C confirmed the
deamination activity on C and mC substrates. This deamination activity levels for C and
mC are similar to that reported for AID (Nabel et al., 2012). However, when comparing
the deamination activity between A3BCD2 and A3A (expressed as nM product /µM
enzyme characterized in the linear protein concentration range), A3A has 525-fold higher
activity for C deamination, but a remarkable 3317-fold higher for mC deamination (Table
4.1, and Supplementary Figure 4.6d). Because of the large difference in specific activities
between A3BCD2 and A3A, to get a better sense of the relative activity for mC
deamination, we also compared the ratio of the mC/C activity x 100, which is defined as
the selectivity factor for mC deamination. In other words, this selectivity factor for mC
deamination can be can be thought of as the number of mC deaminations per every 100 C
deaminations under the same conditions. When using this standard to compare the factors
were calculated as [mC/C activity x 100]. Here the selectivity factor for A3A is 12.7, and
for A3BCD2 is 2.01 (Table 4.1).

63

Figure 4.5 An engineered A3BCD2 mutant with much higher mC deamination
activity.
(A) Gel image showing the mC deamination activity by A3BCD2 WT construct.
A3BCD2 at various concentrations was incubated with 600 nM 30 nt ssDNA substrate
containing mC at 37°C for 2 h. (B) Design of A3BCD2 Mt0 construct. Sequence
alignment of A3BCD2 and A3A shows the difference around loop-1 region (see Figure
S4 for a full alignment). The 15 amino acids sequence in the loop-1 region of A3A was
inserted to the corresponding region in A3BCD2 to make A3BCD2 Mt0. (C) Gel image
showing the mC deamination activity by A3BCD2 Mt0. A3BCD2 Mt0 at various
concentrations was incubated with 600 nM 30 nt ssDNA substrate at 37°C for 2 h. (D)
Quantification of the mC deamination by A3BCD2 WT and Mt0, showing significantly
increased activity on mC by Mt0 mutant.

64

Figure 4.6 Comparison of the C and mC deamination activities by A3BCD2 and
A3A from the dose-response deamination assay.
(A) The C and mC deamination activities by A3BCD2. Various concentrations of A3BCD2
were incubated with 600 nM 30 nt ssDNA substrates at 37°C for 2 h. Quantification of the
data on both C and mC substrates were plotted into one chart to compare the activity. (B)
Initial reaction rate of the A3BCD2 on C and mC substrates. The slope of the plotted line
indicated the initial reaction rate and the values were shown in Table 1. (C) A3BCD2 is
active on both C and mC (lane 2 and lane 7). A3BCD2 E255A shows no activity (lane 3
and lane 8). A3BCD2 is free of UDG and TDG contamination (lane 4 and lane 9). UDG
and TDG are not able to act on C and mC substrates (lane 5 and lane 11). UDG cannot
eliminate T from DNA (lane 10). 8 µM A3BCD2 and 600 nM substrates were used in these
experiments. 1800 nM complement ssDNA was added in the treatment of TDG. (D) Dose
response of A3A on C and mC ssDNA substrates. The small inset is an amplified chart that
shows initial reaction rate of the A3A on C and mC substrates. The slope of the plotted line
indicated the initial reaction rate and the values were shown in Table 1. (E) The selectivity
factors of mC deamination (defined in Table 1) for A3BCD2 and A3A. The mC selectivity
65

Table 4.1 The Comparison of the deaminase activity and mC selectivity factor of
various A3BCD2 mutants from the dose-response deamination assay.

Note:
a
Deaminase activity (nM product /µM enzyme) for the C and mC deamination
was calculated from the initial linear range of dose response assays for each protein
constructs (Supplementary Figure S3B and C, S6B, S7C and D, and S8A). SD was
estimated from data collected in three independent deamiase assay experiments that were
performed with 2 hr incubation time at 37
0
C.
b
The mC selectivity factor was calculated
[mC/C activity x 100], where the deaminase activity for the the C and mC was used in
this calculation.

two proteins, the selectivity factor for mC deamination is 2.01 for WT A3BCD2, which is
about 6-fold lower than the 12.69 for A3A (Table 4.1, Figure 4.6e). The selectivity factor
for mC deamination of A3A obtained in this study is similar to the value calculated from
the published data for A3A (Carpenter et al., 2012).
Currently, A3A and a zebra AID in the APOBEC family are the only two members
that have been reported to have relatively high activity on mC with over 10% of their
activity on regular C. Two previous studies on mutagenesis and domain-swapping of A3A
and fish AID tried to identify the domains contributing to efficient deamination activities
on mC, however, it is still not resolved. Here, given the high similarity of A3BCD2 to A3A
but its little mC deamination activity, we tried to understand why such a big difference in
mC deamination activity by analyzing the available structural data. The available structures
of A3A and four other APOBECs show no obvious features within the C or mC binding
pocket that could explain the observed difference in mC deamination activity of A3A,
A3BCD2 and other APOBECs. However, the superposition of the five structures reveals
many differences in the peripheral loops around the active site (Figure 4.7a). Among these
66

differences, two features caught our attention. One is that, although the loop-1
conformations of the four APOBECs (excluding A3A) are more or less similar to each
other, the A3A loop-1 conformation is noticeably different from the other APOBECs
(Figure 4.7a). The second feature is that, on loop-7, a highly conserved tyrosine residue
(the equivalent of Y130 in A3A) has a similar conformation for the four non-A3A
APOBECs, occupying a space near the active site as a half opened “lid” next to the active

Figure 4.7 Superposition of the known APOBEC structures around the Zn active
site.
A3A (Green, PDB: 2M65), A3C (Red, PDB: 3VOW), A3FCD2 (Purple, PDB: 4J4J,
4IOU), A3GCD2 (Yellow, PDB: 3IQS and 3IR2), A3BCD2 (Pink, modeled structure).
(a) A view of the superposition of loop-1, loop-3, and loop-7 around the Zn-active site.
The conserved Y130 in A3A can adopt a conformation different from its equivalent Tyr
residues in other APOBECs (in sticks), which likely is permitted by the different loop-1
conformation in A3A (green). The loop-1 conformations in other APOBECs should
prevent their Tyr residues to assume the conformation of the Y130 in A3A. (b) A closer
view of the active site for the non-A3A APOBECs, showing the conserved tyrosine as a
partial “lid” on the edge of the mC at the active site pocket. (c) A closer view of the
active site for A3A and the modeled A3BCD2, showing the different conformation for
loop-1, and for the conserved tyrosine (Y130 for A3A, Y313 for A3BCD2) next to the
mC at the active site. The Y313 of A3BCD2 is closer to the mC, causing some clashes
with the methyl group.

67

site pocket (Figure 4.7b), which may present partial steric hindrance for the methyl group
on mC at the active site pocket. However, the side chain of this Y130 on A3A loop-7 is
oriented away from the active site pocket (Figure 4.7c), which could potentially reduce the
partial hindrance and allow the bulkier and more hydrophobic mC to get to the active site
pocket. At the sequence level, A3A and A3B-CD2 share the highest identity (89%) and
homology (92%) among all APOBECs, and the differences between the two proteins are
mostly concentrated around the loop-1, β2, and α5 regions (Figure 4.8), among which the
loop-1 is the only region located around the active site.
Guided by this structural and sequence analysis, we engineered novel A3BCD2
constructs in an attempt to identify the residues that can critically regulate the low or high
activity and specificity for mC deamination in A3BCD2 or in A3A. The first construct we
made was to graft a 15 amino acid segment around the loop-1 region of A3A (16-
HIFTSNFNNGIGRHK-30) to replace the corresponding region in A3BCD2, generating
mutant A3BCD2-Mt0 (Figure 4.5b). Interestingly, the A3BCD2-Mt0 construct gained 7-
fold increase of activity for C deamination, but a much more dramatic 56-fold increase for
mC deamination, when compared with A3BCD2 WT (Table 4.1, Figure 4.5 a, c, d).
Meanwhile, C deamination of A3BCD2 Mt0 was also significantly increased (Figure 4.9a,
b). From the dose response curves of both mC and C deamination for A3BCD2 Mt0 in
Supplementary Figure 4.9a and for A3BCD2 WT in Supplementary Figure 4.6b, it is clear
that A3BCD2 Mt0 showed a much higher activity on mC deamination relative to C
deamination than A3BCD2 WT. When the selectivity factor for mC deamination is
68

Figure 4.8 Sequence alignment of A3BCD2 and A3A, together with A3GCD2.
The sequences of A3BCD2 and A3A are aligned and the secondary structures are labeled.
The two proteins share 89% identity and 92% homology. Y313 of A3BCD2 and Y130 of
A3A are indicated.

Figure 4.9 Comparison of the C and mC deamination activities of the A3BCD2 Mt0
mutant from the dose-response deamination assay.
(A) Dose response of C and mC deamination by A3BCD2 Mt0. Various concentrations
of A3BCD2 Mt0 were incubated with 600 nM 30 nt ssDNA substrates at 37°C for 2 h.
(B) Initial reaction rate of the A3BCD2 Mt0 on C and mC substrates. The slope of the
plotted line indicated the relative reactivity shown in Table 4.1

69

compared, A3BCD2 Mt0 has a selectivity factor of 15.18 (Table 4.1), a 7-fold higher than
that of WT A3BCD2, which is even slightly higher than the 12.7 for WT A3A. These
results indicate that the short 15-residue loop-1 region of A3A and A3BCD2 can greatly
influence the deamination activity and the selectivity factor for mC deamination.

Specific residues on loop-1 region important for mC deamination
Seven out of the fifteen residues from the grafted loop-1 region in the A3BCD2 Mt0
mutant are actually conserved between A3BCD2 and A3A (Figure 4.10a). The remaining
non-conserved 8 residues may therefore contribute to the increased activity and specificity
for mC deamination observed in the A3BCD2 Mt0 construct. In order to evaluate the
contributions of these non-conserved residues to the increased activity and specificity for
mC, we divided the eight non-conserved residues into four groups and generated mutants
(M1-4) on the A3BCD2 WT construct, mutating the residues in each group to the
corresponding A3A residues (Figure 5A). The results of the mC deamination assay showed
that, with the exception of M2 mutant (F8S), mutants M1 (-DT- to -HI-), M3 (-DPLVLR-
to -GIG-), and M4 (-RQ- to -HK-) all displayed greatly increased activity on mC (Figure
4.10b, c), with M4 showing the highest mC deamination activity. These results indicate
that the mutated residues in M1, M3, and M4 can influence mC deamination activity.
We next examined the mC deamination activity of the combined mutants M3M1,
M3M2, and M3M4, in order to evaluate the potential additive effects of the mutated
residues (Figure 4.10a right panel). Each of these combined mutants showed slightly higher
mC deamination activity than the corresponding individual mutants (Figure 4.10b, c),

70

Figure 4.10 Dissecting loop-1 residues important for increasing mC deamination.
(A) Design of the mutants on A3BCD2 WT. Sequence alignment of A3BCD2 and A3A
showed four groups (M1-M4) around loop-1 that are not conserved (left). A3BCD2 was
mutated to contain the corresponding residues of A3A individually to generated mutant
M1-M4. A3BCD2 M3 was combined with others to generate three additional combined
mutants. (B) Gel image showing the different mC deamination activities by the mutants.
0.5 µM and 2 µM of each protein were incubated with 600 nM 30 nt ssDNA substrates at
37°C for 2 h. (C) Quantification of the activity on mC. The activity of the mutants at the
concentration of 2 µM was quantified. (D) Dose response of mC deamination activity by
A3BCD2 WT, M3, M4, M3M4, and Mt0 constructs. (E) Dose response of C deamination
activity by A3BCD2 WT, M3, M4, M3M4, and Mt0 constructs. Error bars represent s.d.
from the mean of three independent experiments.

with M3M4 showing the highest activity (Figure 4.10c), even slightly higher than Mt0 that
has the combined M1-M4 mutations. Despite that M2 alone did not show increased mC
deamination activity, the combined M3M2 mutant had higher activity than M3 alone
(Figure 4.10c). A similar trend of activity changes for the various mutants is also observed
when the initial velocity for the deamination assay was performed (Table 4.2).
71

Table 4.2 The Comparison of the mC/C deaminase activity (initial velocity) and mC
selectivity factor of A3BCD2 and its various mutants.

A3BCD2
constructs
& A3A
C deamination
initial velocity
(nM/min)
a

mC deamination
initial velocity
(nM/min)
b

mC selectivity
factor
c

CD2 WT 11.27 ± 0.76 0.18 ± 0.01 1.62
A3A 5,500 ± 338 832 ± 42.26 15.13
Mt0 169.66 ± 23.75 45.25 ± 4.55 26.67
M1 24.47 ± 0.89 1.56 ± 0.10 6.39
M2 1.46 ± 0.34 ND
d
ND
M3 28.18 ± 1.09 2.01 ± 0.18 7.13
M4 243.96 ± 25.40 16.67 ± 0.83 6.83
M5 137.4 ± 6.43 ND
d
ND
M6 561.35 ± 84.08 68.56 ± 4.10 12.21
M7 126.89 ± 9.81 ND
d
ND
M8 469.35 ± 46.83 26.31 ± 2.43 5.61
M1M3 52.18 ± 2.88 2.819 ± 0.16 5.4
M2M3 92.375 ± 7.60 3.99 ± 0.13 4.32
M4M3 1527.38 ± 96.88 97 ± 4.50 6.35
Y313F 1.3533 ± 0.10 0.075 ± 0.001 5.56

Note:
a, b
The initial velocity for C and mC deamination was calculated from the initial
linear range of time course deamination assay using substrate ssDNA containing target C
or mC. Proteins at fixed concentrations were incubated with substrate at 37
0
C for various
time points starting from 0, 1, 2, 3, 10 min. The data were fit into linear regression and
the slope divided by protein concentration represents the initial velocity of 1 μM protein.
SD was estimated from data collected in three independent deaminase assay experiments.
c
The mC selectivity factor was calculated as [mC/C initial velocity x 100], which
reflects the number of mC deamination per every 100 C deamination under the same
conditions.
d
The activity is too low to be accurately determined.

In order to evaluate the relative increase of mC deamination vs. C deamination activity
(or the selectivity factor for mC), we carried out a dose response assay on both mC and C
deamination activities for the four mutants (M3, M4, M3M4, Mt0) that showed
significantly increased mC deamination activity. The results clearly indicated that a
significant increase for mC deamination is also linked to the significant increase for C
deamination as well (Figure 4.10d, e; Figure 4.11a, b) . However, the fold of
72

Figure 4.11 Comparison of C and mC deamination activities by A3BCD2 mutants
from the dose-response deamination assay.
(A) Gel image showing the different activities of the A3BCD2 mutants on C. 0.5 µM and
2 µM of each protein were incubated with 600 nM 30 nt ssDNA substrates at 37°C for 2
h. (B) Quantification of the activity on C. The activity of the mutants at the concentration
of 2 µM was quantified. (C) Initial reaction rate of C deamination for the A3BCD2
mutants M3, M4, and M3M4. The slope of the plotted line indicated the initial reaction
rate and the value was shown in Table 1. (D) Initial reaction rate of the mC deamination
for the mutants M3, M4, and M3M4. The slope of the plotted line indicated the initial
reaction rate and the value was shown in Table 1.

increase for mC deamination is much higher than that for C deamination, indicating a
biased increase toward mC deamination. This phenomenon becomes more obvious when
the selectivity factor for mC deamination are calculated for the four mutants, which shows
have 4-9 times higher mC selectivity factor than WT A3BCD2 (Table 4.1, Figure 4.11c,
d). Among them, the two combined mutants Mt0 and M3M4 have the highest specificity
factor for mC deamination, with an increase of over 7 and 9 times higher than that of WT
A3BCD2 (Table 4.1). These results indicate that the mutated residues of M3M4 from the
73

loop-1 region of A3A (i.e. -G25I26G27- in M3, and -H29K30- in M4, Figure 4.10a)
collectively play a critical role in the activity and specificity for mC deamination.
We also examined the preferred tri-nucleotide sequence motif for deamination and the
substrate ssDNA binding affinity of A3BCD2, and M3, M4, and Mt0 mutants. Our results
show that A3BCD2 and the three mutants have unchanged sequence motif specificity for
deamination (Figure 4.12-13) and had similar binding affinity to substrate ssDNA (Figure
4.14), indicating that the increased deamination activity and selectivity factor for mC
deamination of these engineered mutants is not resulted from altered DNA sequence motif
specificity or the altered overall binding affinity for the substrate ssDNA.

Flexibility of loop-1 important for mC specificity
The available A3A NMR structure shows that the conformation of loop-1 differs from
that of other known APOBECs and is very flexible in adopting several conformations
(Byeon et al., 2013). The two glycine residues -GIG- on loop 1 of A3A and of the A3BCD2
M3M4 mutant may be important for the flexible conformation of the loop (Figure 15a, b),
which may contribute to the higher mC activity and specificity. To test this hypothesis, we
used A3BCD2 Mt0 that contains the -GIG- sequence in the loop 1 region to perform further
mutational studies, in which the two highly flexible glycine residues (G25, G27) in the -
G25I26G27- of loop-1 were mutated to proline residue, and also the isoleucine residue
(I26) to alanine (Figure 15a, b, mutants M5-8), and then examined their effects on mC and
C deamination activity. The activity assay results showed that, at a protein concentration
of 2 µM, mutants M5 and M7 containing the G25P mutation had essentially

74

Figure 4.12 Substrates preference of His-tagged CD2 and Mt0.
Deamination products of CD2 and Mt0 using seven different ssDNA substrates with C or
mC were measured at different time.
75

Figure 4.13 Substrates preference of His-tagged M3 and M4.
Deamination products of M3 and M4 using seven different ssDNA substrates with C or
mC were measured at different time.

76

Figure 4.14 ssDNA binding by the His-tagged A3BCD2, M0, M3, and M4
ssDNA binding by the His-tagged A3BCD2, M0, M3, and M4 was measured by
rotational anisotropy. To ensure the binding affinity measured reflects the substrate
ssDNA binding instead of deaminated product ssDNA binding, the E255A mutant known
to inactive the enzyme was used for each mutant so that the ssDNA substrate will not be
converted to the deaminated product DNA. Values for each data point represent the mean
± S.E., determined from 3 independent measurements.

lost mC deamination activity, while mutant M6 and M8 displayed similar mC deamination
as A3BCD2 Mt0 (Figure 15c, d). Interestingly, the C deamination of M5 and M7 is only
partially affected by this G25P mutation, retaining about 50% of the activity level of the
A3BCD2 Mt0 construct (Figure 15e, f). These results indicate that G25 in the -G25I26G27-
motif is indeed critical for the activity and specificity for mC deamination, possibly
because this G25 could allow the loop-1 to adopt the conformation necessary for
positioning mC for more optimal deamination reaction at the active site pocket.

The conserved loop-7 tyrosine for mC specificity
A highly conserved loop-7 tyrosine (Tyr) residue among all APOBECs corresponds
to Y313 in A3BCD2 and Y130 in A3A. As mentioned above, the structure alignment
77

Figure 4.15 The flexibility of loop-1 conformation in A3BCD2 Mt0 affects mC
deamination activity.
(A) Structure of A3A loop-1 and Y130 on loop-7 around the Zn-active site. Residues -
G25I26G27- and -H29K30- on loop-1 are drawn in sticks. The mC modeled into the active
site is shown in dots. In the NMR structure of A3A (PDBID 2M65), Y130 is close to -
GIG-. (B) Design of four mutants on the loop-1 of A3BCD2 Mt0. (C) Gel image showing
the mC deamination activity of the mutants. 0.5 µM and 2 µM of each protein were
incubated with 600 nM 30 nt ssDNA substrates at 37°C for 2 h. (D) Quantification of the
mC deamination activity at the protein concentration 2 µM. (E) Gel image showing the C
deamination activity of the mutants. 0.5 µM and 2 µM of each protein were incubated
with 600 nM 30 nt ssDNA substrates at 37°C for 2 h. (F) Quantification of the C
deamination activity at the protein concentration 2 µM. Error bars represent s.d. from the
mean of three independent experiments.
reveals that the loop-7 Y130 in A3A adopts a different conformation from all the
equivalent Tyr residues in other APOBECs (Figure 4.7a-c), possibly resulting in a more
accessible active site for accommodating the bulkier mC residue in A3A than in other
APOBECs (such as A3B, A3G), and as such accounting for the high activity and
78

selectivity for mC deamination. In other words, the less accessible active site due to the
conformations of the conserved Y313 in A3BCD2 (Figure 4.7c) may contribute to the
observed low activity and specificity for mC deamination.
To test this hypothesis, we mutated the Y313 in the A3BCD2 WT template to different
hydrophobic residues, including a larger Trp residue mutation (Y313W), or a slightly
smaller Phe residue (Y313F), or the much smaller Val and Ala residues (Y313V, Y313A),
and then evaluated their deamination activity and specificity for mC. The results indicated
that A3BCD2 constructs with mutations Y313W, Y313V and Y313A had no detectible
deamination activity for C or mC substrates (Figure 4.16a, b), suggesting that too large a
side chain like Trp may completely block the access to the active site in A3BCD2, and too
small a side chain may not be sufficient to stably hold the C or mC in the active site for
deamination reaction. However, Y313F retained essentially the same level of mC
deamination, but caused a significant decrease of C deamination activity (Figure 4.16c). If
the selectivity factor for mC deamination is calculated, the Y313F mutant is 13.69, which
is similar to that of A3A and gained an increase of over 6-fold compared with the 2.01 of
WT A3BCD2 (Table 4.1), (Figure 4.16d; Figure 4.17). We postulate that the loss of a –OH
group in Y313 mutant may result in a slightly more open “gate” to the active site of
A3BCD2 (Figure 4.7c), possibly allowing a better access for the bulkier and more
hydrophobic mC to the active site yet with only a small penalty of C stability and
deamination, which might be the reason for the observed 6-fold increase of selectivity
factor for mC deamination of the Y313F mutant.
79

Figure 4.16 A3BCD2 Y313 mutation enhances the substrate specificity on mC.
(A) Gel image showing the C deamination activity of A3BCD2 mutants. 0.5 µM and 2
µM of each protein were incubated with 600 nM 30 nt ssDNA substrates at 37°C for 2 h.
(B) Gel image showing the mC deamination activity of A3BCD2 mutants. 0.5 µM and 2
µM of each protein were incubated with 600 nM 30 nt ssDNA substrates at 37°C for 2 h.
(C) Dose response of A3BCD2 WT and Y313F for C and mC deamination. (D)
Comparison of the mC selectivity factor for A3BCD2 WT and Y313F. The data was
calculated from Table 4.1. Error bars represent s.d. from the mean of three independent
experiments.

Figure 4.17 Y313F mutation of A3BCD2 enhances the substrate specificity on mC.
Initial reaction rate of of C and mC deamination for A3BCD2 Y313F. The slope of the
plotted line indicated the initial reaction rate and the value was shown in Table 1.

80

4.2 Discussion
Previous literature on A3B reported conflicting results regarding whether both CD1
and CD2 are enzymatically active (Bogerd et al., 2007; Bonvin and Greeve, 2007;
Shinohara et al., 2012). In addition, there is precedent for an active CD1 domain in the
mouse APOBEC3 protein (Hakata and Landau, 2006). In this report, we performed in
vitro biochemistry study using purified proteins of various mutants of A3B and showed
that CD2 is the enzymatically active domain, and CD1 is inactive. However, the presence
of CD1 can greatly enhance the deamination activity of CD2 in the context of the FL-
A3B protein, which is likely in part due to the three dimensional arrangement of CD1 and
CD2 in the native full-length structure which allow the synergistic binding of the two
domains to ssDNA substrate to achieve higher deamination activity. We also show here
that FL-A3B and A3BCD2 can deaminate mC, even though this mC deamination activity
is very weak which is about 50-fold lower than C deamination.
A3B’s overall activities of C and mC deamination reported here appear to be quite
similar to those reported for human AID, both with much lower mC deamination relative
to C deamination. A3A, on the other hand, is the only human APOBEC protein that has
been reported to have clearly much higher deamination activity for both C and mC based
on in vitro assay (Carpenter et al., 2012). Another extreme is A3G that is reported to have
no detectible mC deamination (Carpenter et al., 2012). What is the structural basis for
these closely related APOBEC deaminases to discriminate the subtle differences between
C and mC for deamination? To date, no amino acid sequences or/and structural elements
of an APOBEC deaminase have been shown to be responsible for the observed
81

discrimination for mC discrimination. In this study we report that the loop 1 of A3BCD2
plays a major role in the activity and selectivity of mC deamination.
In particular, by substituting a few residues on the loop 1 of A3BCD2 to that of A3A
(i.e. -G25I26G27-, and -H29K30-) the resulting A3BCD2 mutants gained over two orders of
magnitude higher mC deamination activity than WT A3BCD2 (Table 4.1). Moreover, our
point mutagenesis studies indicated that a flexible Gly25 residue on loop-1, likely
important to allow loop-1 to adopt certain conformations, plays an important role in mC
deamination. Previously extensive studies with loop switches and mutations are limited to
investigating sequence motif specificity surrounding the target C. These studies show
that loops 1 and 7, especially loop 7 (previously names as the “specificity” loop), affect
the sequence motif specificity (Carpenter et al., 2010; Kohli et al., 2009; Kohli et al.,
2010; Langlois et al., 2005; Logue et al., 2014; Mitra et al., 2014; Narvaiza et al., 2009;
Rathore et al., 2013; Wang et al., 2010). For example, the sequence motif for A3G is -
CC-, a graft of its loop-7 to that of A3A can change its sequence motif specificity of -TC-
(Rathore et al., 2013). Depending on the specific pair of the loop 7-donor and receiver,
the outcome can range between loss of activity, less stringent specificity, or near
complete conversion to the donor sequence motif specificity. Loop 1 graft mutants, on
the other hand, can result in less stringent sequence specificity (Carpenter et al., 2010;
Logue et al., 2014) or enhanced/reduced activity (Carpenter et al., 2010; Rathore et al.,
2013). The -HK- equivalent residues have not been reported in the loop grafting studies.
However, our results showed that they have no effect on the sequence motif specificity,
rather they have a significant impact on increasing the mC deamination activity and
82

selectivity. Our study adds another layer of complexity as to how individual loops assist
the recognition and reactivity of the target mC vs C.
Even though the exact mechanism remains to be elucidated, two possibilities could
explain the important role of the loop-1 for mC deamination of A3BCD2. The first
possibility is that the loop-1 sequence/conformation may influence the conformation of
the highly conserved Y313 on loop-7 of A3BCD2, which may determine how well the
target mC residue can get to and bind at the active site. Previous reports suggest Y114 of
AID and Y315 of A3G, which are equivalent to Y313 of A3B, may also participate in
positioning the target C (Gajula et al., 2014; Holden et al., 2008). Therefore, Y313 of
A3B may bear dual functions - stabilize target C and discriminate mC at the active
pocket. For the loop-1 of A3A, it may allow its corresponding Y130 to adopt a
conformation that is more accessible to the active pocket for a bulkier mC than the
equivalent Tyr residue of other APOBECs (Figure 4.7a). The second possibility is that
loop-1 needs to have a certain flexibility that allows it to change conformations in order
to bind ssDNA in certain way to present the target mC in a better position for
deamination reaction. The two substituted loop-1 residues -H29K30- that impact
significantly on mC deamination are actually located outside the active site pocket. Such
positioning of the -H29K30- residues suggests they are unlikely to interact directly with
the target mC or C bound inside the active site pocket. They may interact with the base at
the 3’- or 5’-side of the target C/mC to allow better presentation the target mC/C to the
active Zn for efficient deamination (Bulliard et al., 2011; Mitra et al., 2014). The
evidence that K30 is involved in DNA binding is consistent with this hypothesis (Mitra et
83

al., 2014). It’s also likely that both possibilities described above work together to regulate
mC/C deamination.
In summary, our study on A3B indicates that only CD2 is catalytically active in
vitro, and that A3B has a very weak but clearly detectable activity on mC deamination.
This mC deamination activity of A3B is much lower (roughly by three order of
magnitude) than that of A3A, the only APOBEC reported to have a robust mC
deamination to date. Through structural and systematic mutational analysis, we have
successfully engineered a mutant version of A3BCD2 that has gained over 2 orders of
magnitude higher activity for mC deamination and has achieved an mC selectivity factor
comparable to that of A3A. Important elements around the active site that contribute to
the activity and specificity for mC deamination have been identified for the first time. It
is clear from this study that multiple determinants, rather than a single factor, contribute
to the mC deamination activity and specificity by APOBEC deaminases. A thorough
understanding of the detailed mechanism of the mC substrate selectivity as well as the
nucleotide sequence motif specificity will require critical information from high-
resolution complex structure(s) containing the enzyme bound to a series of ssDNA
substrates.

4.3 Methods
Cloning, expression, and protein purification
The full-length A3B, A3BCD1, A3BCD2 and their corresponding mutants were
constructed in pMAL-c5X vector (New England Biolabs) and expressed as an N-terminal
84

MBP fusion in E. coli cells. A3BCD2 and its various mutant constructs were also cloned
into pET-28a (+) vector (Novagen) with a C-terminal His•Tag. All clones were sequenced
to confirm the correct sequences before proceeding with protein expression, purification
and activity assays.
Protein expression for MBP-A3B constructs was induced with 0.3 mM isopropyl β-
D-1-thiogalactopyranoside (IPTG) at 16 °C for 18 h in a shaker incubator. Cell pellets were
resuspended with lysis buffer A (20 mM Tris-HCl, pH 8.0, 250 mM NaCl, and 2 mM DTT)
and lysed by French press. The crude cell lysate was then centrifuged at 12,000 rpm for 1
h. The MBP-fusion proteins in the supernatant were purified by passing through a column
with Amylose resin (New England Biolabs), followed with extensive wash using 10
column volumes of wash buffer (20 mM Tris-HCl, pH 8.0, 1 M NaCl, and 2 mM DTT).
The A3B proteins eluted with elution buffer (20 mM Tris-HCl, pH 8.0, 250 mM NaCl, 2
mM DTT, and 20 mM maltose) were concentrated and further purified using Superose 6
gel filtration chromatography (GE Healthcare). The fractions containing
chromatographically homogeneous A3B proteins were pooled, concentrated, aliquoted into
multiple small tubes (20 µl/tube), flash-frozen in liquid nitrogen, and stored at -80°C for
activity assay.
For the His-tagged A3BCD2 mutant constructs and the wild type (WT) A3A, the
fusion proteins were initially purified by nickel resin column (Qiagen) from the supernatant
fraction, followed by extensive wash with 10 column volumes of buffer B (20 mM Tris-
HCl, pH 8.0, and 300 mM NaCl) plus 50 mM Imidazole. The fusion proteins were then
eluted from the nickel column with buffer B plus 500 mM imidazole. Elutions were
85

combined and switched to protein buffer (20 mM Tris-HCl, pH 8.0, 250 mM NaCl, 1 mM
DTT, and 1 mM EDTA) by buffer exchange. Concentrated protein was divided into

Figure 4.18 SDS-PAGE of the purified proteins.
(A) MBP-tagged A3B wild type and mutants purified by two steps purification: MBP-
resin affinity column and S75 gel filtration. (B) and (C) His-tagged A3BCD2 wild type
and mutants purified by one step Ni-resin affinity column. (D) Comparison of the
proteins purified using one step (Ni-resin only) or three step methods (Ni-resin followed
by additional Resource Q ion exchange and then by S75 gel filtration, Ni-RQ-S75). (E)
Comparison of activity assay results for the different protein preparations, showing no
detectible differences in the deaminase activity for the same protein that are purified
using one step (Ni-resin) or three step (Ni-RQ-S75) methods.

small aliquots, flash-frozen in liquid nitrogen, and stored at -80 °C for activity assay. All
purified proteins used in this study were quantified by UV absorption, and the final
concentrations were calibrated by SDS-PAGE as shown in Figure 12.18.

86

Deamination Assay
A3B and A3A proteins were reacted with 600 nM 5' 6FAM-labeled ssDNA substrates
(synthesized by Integrated DNA Technologies, Supplementary Table S1) in deamination
buffer (25 mM HEPES, pH 6.5, 100 mM NaCl, 0.1% Triton X-100, 1 mM DTT, and 0.1
µg/ml RNase). Reactions were incubated at 37°C for the designated time lengths and
terminated by heating to 90°C for 5 min. Deamination products were detected using
protocols described previously. Briefly, reactions with normal C deamination were treated
with 2 units of UDG (NEB) for 1 h at 37°C; reactions with mC deamination were treated
with 2 units of TDG (Trevigen) in the presence of 3X complementary ssDNA for 12 h at
42°C. Samples were incubated at 90°C for 10 min in the presence of 0.1 M NaOH.
Table 4.3 ssDNA substrates used in deamination assay

Deamination products were separated on 20% denaturing PAGE gel, visualized with
Molecular Imager FX (Bio-Rad), and quantified with Quantity One® 1-D analysis
87

software (Bio-Rad). For calculation of the initial velocity, fixed concentrations of A3BCD2
and mutant proteins were incubated with ssDNA substrates for a series of incubation time
points (with intervals of one minute starting from 0 min) at 37°C. The deamination products
were quantified and the data were fitted with linear regression using GraphPad Prism 6
software. The slope divided by protein concentration represents the initial velocity at
concentration of 1 μM and was determined from three independent experiments.

Steady-State Rotational Anisotropy DNA Binding Assay
5' 6FAM-labeled 30 nt ssDNA containing TCA was used as a substrate for A3B
binding assay monitored by change in steady-state fluorescence depolarization (rotational
anisotropy). Increasing concentrations of A3B were incubated with 50 nM ssDNA in 65 µl
reaction volume containing 10 mM HEPES pH 6.5, and 100 mM NaCl for 1 min at room
temperature. The rotational anisotropy was measured using a QuantaMaster QM-1
fluorometer (Photon Technology International) with a single emission channel. Samples
were excited with vertically polarized light at 495 nm, and both vertical and horizontal
emissions were monitored at 520 nm (8-nm bandwidth). The apparent dissociation constant
Kd was calculated by fitting the data to a one site—specific binding curve using GraphPad
Prism 6 software and was determined from three independent experiments.

Structural Modeling
The homology modeling program SWISS-MODEL was used to generate the A3BCD2
model using the structures of A3A (PDB: 2M65) and A3GCD2 (PDB: 3IQS and 3IR2) as
templates. The C and mC docking on to A3A and the modeled A3BCD2 structures was
88

performed using the program Glide [54]. We also performed the structural superposition
of A3A and A3BCD2 with the complex structure of mouse free cytosine deaminase bound
to cytidine (PDB: 2FR6), and used the resulting orientation/position of the C in the
superposition to guide the selection of the docked C/mC poses resulted from Glide.

89

Reference

Aparicio, O.M., Weinstein, D.M., and Bell, S.P. (1997). Components and dynamics of
DNA replication complexes in S-cerevisiae: Redistribution of MCM proteins and Cdc45p
during S phase. Cell 91, 59-69.
Barry, E.R., McGeoch, A.T., Kelman, Z., and Bell, S.D. (2007). Archaeal MCM has
separable processivity, substrate choice and helicase domains. Nucleic Acids Res 35, 988-
998.
Bell, S.P. (2002). The origin recognition complex: from simple origins to complex
functions. Genes Dev 16, 659-672.
Bhutani, N., Brady, J.J., Damian, M., Sacco, A., Corbel, S.Y., and Blau, H.M. (2010).
Reprogramming towards pluripotency requires AID-dependent DNA demethylation.
Nature 463, 1042-1047.
Bogerd, H.P., Wiegand, H.L., Doehle, B.P., and Cullen, B.R. (2007). The intrinsic
antiretroviral factor APOBEC3B contains two enzymatically active cytidine deaminase
domains. Virology 364, 486-493.
Bogerd, H.P., Wiegand, H.L., Hulme, A.E., Garcia-Perez, J.L., O'Shea, K.S., Moran,
J.V., and Cullen, B.R. (2006). Cellular inhibitors of long interspersed element 1 and Alu
retrotransposition. Proc Natl Acad Sci U S A 103, 8780-8785.
Bohn, M.F., Shandilya, S.M., Albin, J.S., Kouno, T., Anderson, B.D., McDougle,
R.M., Carpenter, M.A., Rathore, A., Evans, L., Davis, A.N., et al. (2013). Crystal structure
of the DNA cytosine deaminase APOBEC3F: the catalytically active and HIV-1 Vif-
binding domain. Structure 21, 1042-1050.
90

Bonvin, M., Achermann, F., Greeve, I., Stroka, D., Keogh, A., Inderbitzin, D.,
Candinas, D., Sommer, P., Wain-Hobson, S., Vartanian, J.P., et al. (2006). Interferon-
inducible expression of APOBEC3 editing enzymes in human hepatocytes and inhibition
of hepatitis B virus replication. Hepatology 43, 1364-1374.
Bonvin, M., and Greeve, J. (2007). Effects of point mutations in the cytidine
deaminase domains of APOBEC3B on replication and hypermutation of hepatitis B virus
in vitro. J Gen Virol 88, 3270-3274.
Bransteitter, R., Pham, P., Scharff, M.D., and Goodman, M.F. (2003). Activation-
induced cytidine deaminase deaminates deoxycytidine on single-stranded DNA but
requires the action of RNase. Proc Natl Acad Sci U S A 100, 4102-4107.
Brewster, A.S., and Chen, X.S. (2010). Insights into the MCM functional mechanism:
lessons learned from the archaeal MCM complex. Crit Rev Biochem Mol Biol 45, 243-
256.
Brewster, A.S., Slaymaker, I.M., Afif, S.A., and Chen, X.S. (2010). Mutational
analysis of an archaeal minichromosome maintenance protein exterior hairpin reveals
critical residues for helicase activity and DNA binding. BMC Mol Biol 11, 62.
Brewster, A.S., Wang, G., Yu, X., Greenleaf, W.B., Carazo, J.M., Tjajadi, M., Klein,
M.G., and Chen, X.S. (2008). Crystal structure of a near-full-length archaeal MCM:
functional insights for an AAA+ hexameric helicase. Proc Natl Acad Sci U S A 105, 20191-
20196.
Bulliard, Y., Narvaiza, I., Bertero, A., Peddi, S., Rohrig, U.F., Ortiz, M., Zoete, V.,
Castro-Diaz, N., Turelli, P., Telenti, A., et al. (2011). Structure-function analyses point to
91

a polynucleotide-accommodating groove essential for APOBEC3A restriction activities. J
Virol 85, 1765-1776.
Burns, M.B., Lackey, L., Carpenter, M.A., Rathore, A., Land, A.M., Leonard, B.,
Refsland, E.W., Kotandeniya, D., Tretyakova, N., Nikas, J.B., et al. (2013a). APOBEC3B
is an enzymatic source of mutation in breast cancer. Nature 494, 366-370.
Burns, M.B., Temiz, N.A., and Harris, R.S. (2013b). Evidence for APOBEC3B
mutagenesis in multiple human cancers. Nat Genet 45, 977-983.
Byeon, I.J., Ahn, J., Mitra, M., Byeon, C.H., Hercik, K., Hritz, J., Charlton, L.M.,
Levin, J.G., and Gronenborn, A.M. (2013). NMR structure of human restriction factor
APOBEC3A reveals substrate binding and enzyme specificity. Nat Commun 4, 1890.
Carpenter, M.A., Li, M., Rathore, A., Lackey, L., Law, E.K., Land, A.M., Leonard,
B., Shandilya, S.M., Bohn, M.F., Schiffer, C.A., et al. (2012). Methylcytosine and normal
cytosine deamination by the foreign DNA restriction enzyme APOBEC3A. J Biol Chem
287, 34801-34808.
Carpenter, M.A., Rajagurubandara, E., Wijesinghe, P., and Bhagwat, A.S. (2010).
Determinants of sequence-specificity within human AID and APOBEC3G. DNA Repair
(Amst) 9, 579-587.
Chen, L.T., Ko, T.P., Chang, Y.C., Lin, K.A., Chang, C.S., Wang, A.H., and Wang,
T.F. (2007a). Crystal structure of the left-handed archaeal RadA helical filament:
identification of a functional motif for controlling quaternary structures and enzymatic
functions of RecA family proteins. Nucleic Acids Res 35, 1787-1801.
Chen, S., de Vries, M.A., and Bell, S.P. (2007b). Orc6 is required for dynamic
recruitment of Cdt1 during repeated Mcm2-7 loading. Genes Dev 21, 2897-2907.
92

Chen, Y.J., Yu, X., Kasiviswanathan, R., Shin, J.H., Kelman, Z., and Egelman, E.H.
(2005). Structural polymorphism of Methanothermobacter thermautotrophicus MCM. J
Mol Biol 346, 389-394.
Chiu, Y.L., and Greene, W.C. (2008). The APOBEC3 cytidine deaminases: an innate
defensive network opposing exogenous retroviruses and endogenous retroelements. Annu
Rev Immunol 26, 317-353.
Conticello, S.G. (2008). The AID/APOBEC family of nucleic acid mutators. Genome
Biol 9, 229.
Costa, A., Ilves, I., Tamberg, N., Petojevic, T., Nogales, E., Botchan, M.R., and
Berger, J.M. (2011). The structural basis for MCM2-7 helicase activation by GINS and
Cdc45. Nat Struct Mol Biol 18, 471-477.
Cox, M.M. (2007). Motoring along with the bacterial RecA protein. Nat Rev Mol Cell
Biol 8, 127-138.
Di Noia, J.M., and Neuberger, M.S. (2007). Molecular mechanisms of antibody
somatic hypermutation. Annu Rev Biochem 76, 1-22.
Doehle, B.P., Schafer, A., and Cullen, B.R. (2005a). Human APOBEC3B is a potent
inhibitor of HIV-1 infectivity and is resistant to HIV-1 Vif. Virology 339, 281-288.
Doehle, B.P., Schafer, A., Wiegand, H.L., Bogerd, H.P., and Cullen, B.R. (2005b).
Differential sensitivity of murine leukemia virus to APOBEC3-mediated inhibition is
governed by virion exclusion. J Virol 79, 8201-8207.
Duderstadt, K.E., Chuang, K., and Berger, J.M. (2011). DNA stretching by bacterial
initiators promotes replication origin opening. Nature 478, 209-213.
93

Edwards, M.C., Tutter, A.V., Cvetic, C., Gilbert, C.H., Prokhorova, T.A., and Walter,
J.C. (2002). MCM2-7 complexes bind chromatin in a distributed pattern surrounding the
origin recognition complex in Xenopus egg extracts. J Biol Chem 277, 33049-33057.
Erzberger, J.P., and Berger, J.M. (2006). Evolutionary relationships and structural
mechanisms of AAA+ proteins. Annu Rev Biophys Biomol Struct 35, 93-114.
Evrin, C., Clarke, P., Zech, J., Lurz, R., Sun, J., Uhle, S., Li, H., Stillman, B., and
Speck, C. (2009). A double-hexameric MCM2-7 complex is loaded onto origin DNA
during licensing of eukaryotic DNA replication. Proc Natl Acad Sci U S A 106, 20240-
20245.
Fletcher, R.J., Bishop, B.E., Leon, R.P., Sclafani, R.A., Ogata, C.M., and Chen, X.S.
(2003). The structure and function of MCM from archaeal M. Thermoautotrophicum. Nat
Struct Biol 10, 160-167.
Fletcher, R.J., Shen, J., Gomez-Llorente, Y., Martin, C.S., Carazo, J.M., and Chen,
X.S. (2005). Double hexamer disruption and biochemical activities of Methanobacterium
thermoautotrophicum MCM. J Biol Chem 280, 42405-42410.
Fletcher, R.J., Shen, J., Holden, L.G., and Chen, X.S. (2008). Identification of amino
acids important for the biochemical activity of Methanothermobacter thermautotrophicus
MCM. Biochemistry 47, 9981-9986.
Fu, Y.V., Yardimci, H., Long, D.T., Ho, T.V., Guainazzi, A., Bermudez, V.P.,
Hurwitz, J., van Oijen, A., Scharer, O.D., and Walter, J.C. (2011). Selective bypass of a
lagging strand roadblock by the eukaryotic replicative DNA helicase. Cell 146, 931-941.
94

Gajula, K.S., Huwe, P.J., Mo, C.Y., Crawford, D.J., Stivers, J.T., Radhakrishnan, R.,
and Kohli, R.M. (2014). High-throughput mutagenesis reveals functional determinants for
DNA targeting by activation-induced deaminase. Nucleic Acids Res 42, 9964-9975.
Gambus, A., Khoudoli, G.A., Jones, R.C., and Blow, J.J. (2011). MCM2-7 form
double hexamers at licensed origins in Xenopus egg extract. J Biol Chem 286, 11855-
11864.
Gomez-Llorente, Y., Fletcher, R.J., Chen, X.S., Carazo, J.M., and San Martin, C.
(2005). Polymorphism and double hexamer structure in the archaeal minichromosome
maintenance (MCM) helicase from Methanobacterium thermoautotrophicum. J Biol Chem
280, 40909-40915.
Graham, B.W., Schauer, G.D., Leuba, S.H., and Trakselis, M.A. (2011). Steric
exclusion and wrapping of the excluded DNA strand occurs along discrete external binding
paths during MCM helicase unwinding. Nucleic Acids Res 39, 6585-6595.
Hakata, Y., and Landau, N.R. (2006). Reversed functional organization of mouse and
human APOBEC3 cytidine deaminase domains. J Biol Chem 281, 36624-36631.
Haugland, G.T., Sakakibara, N., Pey, A.L., Rollor, C.R., Birkeland, N.K., and Kelman,
Z. (2008). Thermoplasma acidophilum Cdc6 protein stimulates MCM helicase activity by
regulating its ATPase activity. Nucleic Acids Res 36, 5602-5609.
Haugland, G.T., Shin, J.H., Birkeland, N.K., and Kelman, Z. (2006). Stimulation of
MCM helicase activity by a Cdc6 protein in the archaeon Thermoplasma acidophilum.
Nucleic Acids Res 34, 6337-6344.
Hoang, M.L., Leon, R.P., Pessoa-Brandao, L., Hunt, S., Raghuraman, M.K., Fangman,
W.L., Brewer, B.J., and Sclafani, R.A. (2007). Structural changes in Mcm5 protein bypass
95

Cdc7-Dbf4 function and reduce replication origin efficiency in Saccharomyces cerevisiae.
Mol Cell Biol 27, 7594-7602.
Holden, L.G., Prochnow, C., Chang, Y.P., Bransteitter, R., Chelico, L., Sen, U.,
Stevens, R.C., Goodman, M.F., and Chen, X.S. (2008). Crystal structure of the anti-viral
APOBEC3G catalytic domain and functional implications. Nature 456, 121-124.
Ilves, I., Petojevic, T., Pesavento, J.J., and Botchan, M.R. (2010). Activation of the
MCM2-7 helicase by association with Cdc45 and GINS proteins. Mol Cell 37, 247-258.
Iyer, L.M., Leipe, D.D., Koonin, E.V., and Aravind, L. (2004). Evolutionary history
and higher order classification of AAA+ ATPases. J Struct Biol 146, 11-31.
Kitamura, S., Ode, H., Nakashima, M., Imahashi, M., Naganawa, Y., Kurosawa, T.,
Yokomaku, Y., Yamane, T., Watanabe, N., Suzuki, A., et al. (2012). The APOBEC3C
crystal structure and the interface for HIV-1 Vif binding. Nat Struct Mol Biol 19, 1005-
1010.
Klock, H.E., and Lesley, S.A. (2009). The Polymerase Incomplete Primer Extension
(PIPE) method applied to high-throughput cloning and site-directed mutagenesis. Methods
Mol Biol 498, 91-103.
Kohli, R.M., Abrams, S.R., Gajula, K.S., Maul, R.W., Gearhart, P.J., and Stivers, J.T.
(2009). A portable hot spot recognition loop transfers sequence preferences from APOBEC
family members to activation-induced cytidine deaminase. J Biol Chem 284, 22898-22904.
Kohli, R.M., Maul, R.W., Guminski, A.F., McClure, R.L., Gajula, K.S., Saribasak, H.,
McMahon, M.A., Siliciano, R.F., Gearhart, P.J., and Stivers, J.T. (2010). Local sequence
targeting in the AID/APOBEC family differentially impacts retroviral restriction and
antibody diversification. J Biol Chem 285, 40956-40964.
96

Kuipers, M.A., Stasevich, T.J., Sasaki, T., Wilson, K.A., Hazelwood, K.L., McNally,
J.G., Davidson, M.W., and Gilbert, D.M. (2011). Highly stable loading of Mcm proteins
onto chromatin in living cells requires replication to unload. J Cell Biol 192, 29-41.
Labib, K., Tercero, J.A., and Diffley, J.F. (2000). Uninterrupted MCM2-7 function
required for DNA replication fork progression. Science 288, 1643-1647.
Langlois, M.A., Beale, R.C., Conticello, S.G., and Neuberger, M.S. (2005).
Mutational comparison of the single-domained APOBEC3C and double-domained
APOBEC3F/G anti-retroviral cytidine deaminases provides insight into their DNA target
site specificities. Nucleic Acids Res 33, 1913-1923.
Larijani, M., Frieder, D., Sonbuchner, T.M., Bransteitter, R., Goodman, M.F.,
Bouhassira, E.E., Scharff, M.D., and Martin, A. (2005). Methylation protects cytidines
from AID-mediated deamination. Mol Immunol 42, 599-604.
Leonard, B., Hart, S.N., Burns, M.B., Carpenter, M.A., Temiz, N.A., Rathore, A.,
Vogel, R.I., Nikas, J.B., Law, E.K., Brown, W.L., et al. (2013). APOBEC3B upregulation
and genomic mutation patterns in serous ovarian carcinoma. Cancer Res 73, 7222-7231.
Liang, D.T., Hodson, J.A., and Forsburg, S.L. (1999). Reduced dosage of a single
fission yeast MCM protein causes genetic instability and S phase delay. J Cell Sci 112 ( Pt
4), 559-567.
Liu, W., Pucci, B., Rossi, M., Pisani, F.M., and Ladenstein, R. (2008). Structural
analysis of the Sulfolobus solfataricus MCM protein N-terminal domain. Nucleic Acids
Res 36, 3235-3243.
97

Logue, E.C., Bloch, N., Dhuey, E., Zhang, R., Cao, P., Herate, C., Chauveau, L.,
Hubbard, S.R., and Landau, N.R. (2014). A DNA sequence recognition loop on
APOBEC3A controls substrate specificity. PLoS One 9, e97062.
Lucifora, J., Xia, Y., Reisinger, F., Zhang, K., Stadler, D., Cheng, X., Sprinzl, M.F.,
Koppensteiner, H., Makowska, Z., Volz, T., et al. (2014). Specific and nonhepatotoxic
degradation of nuclear hepatitis B virus cccDNA. Science 343, 1221-1228.
Lyubimov, A.Y., Costa, A., Bleichert, F., Botchan, M.R., and Berger, J.M. (2012).
ATP-dependent conformational dynamics underlie the functional asymmetry of the
replicative helicase from a minimalist eukaryote. Proc Natl Acad Sci U S A 109, 11999-
12004.
Macduff, D.A., and Harris, R.S. (2006). Directed DNA deamination by
AID/APOBEC3 in immunity. Curr Biol 16, R186-189.
McGeoch, A.T., Trakselis, M.A., Laskey, R.A., and Bell, S.D. (2005). Organization
of the archaeal MCM complex on DNA and implications for the helicase mechanism. Nat
Struct Mol Biol 12, 756-762.
Mitra, M., Hercik, K., Byeon, I.J., Ahn, J., Hill, S., Hinchee-Rodriguez, K., Singer,
D., Byeon, C.H., Charlton, L.M., Nam, G., et al. (2014). Structural determinants of human
APOBEC3A enzymatic and nucleic acid binding properties. Nucleic Acids Res 42, 1095-
1110.
Morgan, H.D., Dean, W., Coker, H.A., Reik, W., and Petersen-Mahrt, S.K. (2004).
Activation-induced cytidine deaminase deaminates 5-methylcytosine in DNA and is
expressed in pluripotent tissues: implications for epigenetic reprogramming. J Biol Chem
279, 52353-52360.
98

Moyer, S.E., Lewis, P.W., and Botchan, M.R. (2006). Isolation of the Cdc45/Mcm2-
7/GINS (CMG) complex, a candidate for the eukaryotic DNA replication fork helicase.
Proc Natl Acad Sci U S A 103, 10236-10241.
Muramatsu, M., Kinoshita, K., Fagarasan, S., Yamada, S., Shinkai, Y., and Honjo, T.
(2000). Class switch recombination and hypermutation require activation-induced cytidine
deaminase (AID), a potential RNA editing enzyme. Cell 102, 553-563.
Nabel, C.S., Jia, H., Ye, Y., Shen, L., Goldschmidt, H.L., Stivers, J.T., Zhang, Y., and
Kohli, R.M. (2012). AID/APOBEC deaminases disfavor modified cytosines implicated in
DNA demethylation. Nat Chem Biol 8, 751-758.
Narvaiza, I., Linfesty, D.C., Greener, B.N., Hakata, Y., Pintel, D.J., Logue, E., Landau,
N.R., and Weitzman, M.D. (2009). Deaminase-independent inhibition of parvoviruses by
the APOBEC3A cytidine deaminase. PLoS Pathog 5, e1000439.
Pak, V., Heidecker, G., Pathak, V.K., and Derse, D. (2011). The role of amino-terminal
sequences in cellular localization and antiviral activity of APOBEC3B. J Virol 85, 8538-
8547.
Pape, T., Meka, H., Chen, S., Vicentini, G., van Heel, M., and Onesti, S. (2003).
Hexameric ring structure of the full-length archaeal MCM protein complex. EMBO Rep 4,
1079-1083.
Popp, C., Dean, W., Feng, S., Cokus, S.J., Andrews, S., Pellegrini, M., Jacobsen, S.E.,
and Reik, W. (2010). Genome-wide erasure of DNA methylation in mouse primordial germ
cells is affected by AID deficiency. Nature 463, 1101-1105.
99

Prochnow, C., Bransteitter, R., Klein, M.G., Goodman, M.F., and Chen, X.S. (2007).
The APOBEC-2 crystal structure and functional implications for the deaminase AID.
Nature 445, 447-451.
Randell, J.C., Bowers, J.L., Rodriguez, H.K., and Bell, S.P. (2006). Sequential ATP
hydrolysis by Cdc6 and ORC directs loading of the Mcm2-7 helicase. Mol Cell 21, 29-39.
Rathore, A., Carpenter, M.A., Demir, O., Ikeda, T., Li, M., Shaban, N.M., Law, E.K.,
Anokhin, D., Brown, W.L., Amaro, R.E., et al. (2013). The local dinucleotide preference
of APOBEC3G can be altered from 5'-CC to 5'-TC by a single amino acid substitution. J
Mol Biol 425, 4442-4454.
Remus, D., Beuron, F., Tolun, G., Griffith, J.D., Morris, E.P., and Diffley, J.F. (2009).
Concerted loading of Mcm2-7 double hexamers around DNA during DNA replication
origin licensing. Cell 139, 719-730.
Schroder, G.F., Levitt, M., and Brunger, A.T. (2010). Super-resolution biomolecular
crystallography with low-resolution data. Nature 464, 1218-1222.
Shima, N., Alcaraz, A., Liachko, I., Buske, T.R., Andrews, C.A., Munroe, R.J.,
Hartford, S.A., Tye, B.K., and Schimenti, J.C. (2007). A viable allele of Mcm4 causes
chromosome instability and mammary adenocarcinomas in mice. Nat Genet 39, 93-98.
Shin, J.H., Heo, G.Y., and Kelman, Z. (2009). The Methanothermobacter
thermautotrophicus MCM helicase is active as a hexameric ring. J Biol Chem 284, 540-
546.
Shinohara, M., Io, K., Shindo, K., Matsui, M., Sakamoto, T., Tada, K., Kobayashi, M.,
Kadowaki, N., and Takaori-Kondo, A. (2012). APOBEC3B can impair genomic stability
by inducing base substitutions in genomic DNA in human cells. Sci Rep 2, 806.
100

Siu, K.K., Sultana, A., Azimi, F.C., and Lee, J.E. (2013). Structural determinants of
HIV-1 Vif susceptibility and DNA binding in APOBEC3F. Nat Commun 4, 2593.
Skordalakes, E., and Berger, J.M. (2003). Structure of the Rho transcription
terminator: mechanism of mRNA recognition and helicase loading. Cell 114, 135-146.
Skordalakes, E., and Berger, J.M. (2006). Structural insights into RNA-dependent ring
closure and ATPase activation by the Rho termination factor. Cell 127, 553-564.
Stenglein, M.D., Burns, M.B., Li, M., Lengyel, J., and Harris, R.S. (2010). APOBEC3
proteins mediate the clearance of foreign DNA from human cells. Nat Struct Mol Biol 17,
222-229.
Tahiliani, M., Koh, K.P., Shen, Y., Pastor, W.A., Bandukwala, H., Brudno, Y.,
Agarwal, S., Iyer, L.M., Liu, D.R., Aravind, L., et al. (2009). Conversion of 5-
methylcytosine to 5-hydroxymethylcytosine in mammalian DNA by MLL partner TET1.
Science 324, 930-935.
Vieira, V.C., Leonard, B., White, E.A., Starrett, G.J., Temiz, N.A., Lorenz, L.D., Lee,
D., Soares, M.A., Lambert, P.F., Howley, P.M., et al. (2014). Human papillomavirus E6
triggers upregulation of the antiviral and cancer genomic DNA deaminase APOBEC3B.
MBio 5.
Wang, M., Rada, C., and Neuberger, M.S. (2010). Altering the spectrum of
immunoglobulin V gene somatic hypermutation by modifying the active site of AID. J Exp
Med 207, 141-153.
Wijesinghe, P., and Bhagwat, A.S. (2012). Efficient deamination of 5-methylcytosines
in DNA by human APOBEC3A, but not by AID or APOBEC3G. Nucleic Acids Res 40,
9206-9217.
101

Wyrick, J.J., Aparicio, J.G., Chen, T., Barnett, J.D., Jennings, E.G., Young, R.A., Bell,
S.P., and Aparicio, O.M. (2001). Genome-wide distribution of ORC and MCM proteins in
S. cerevisiae: high-resolution mapping of replication origins. Science 294, 2357-2360.
Xu, R., Zhang, X., Zhang, W., Fang, Y., Zheng, S., and Yu, X.F. (2007). Association
of human APOBEC3 cytidine deaminases with the generation of hepatitis virus B x antigen
mutants and hepatocellular carcinoma. Hepatology 46, 1810-1820.
Yu, Q., Chen, D., Konig, R., Mariani, R., Unutmaz, D., and Landau, N.R. (2004).
APOBEC3B and APOBEC3C are potent inhibitors of simian immunodeficiency virus
replication. J Biol Chem 279, 53379-53386.
Yu, X., VanLoock, M.S., Poplawski, A., Kelman, Z., Xiang, T., Tye, B.K., and
Egelman, E.H. (2002). The Methanobacterium thermoautotrophicum MCM protein can
form heptameric rings. EMBO Rep 3, 792-797.

Abstract (if available)

Abstract DNA replication and mutation are two important DNA transactions for life. MiniChromosome Maintenance (MCM) proteins are the replicative helicase necessary for DNA replication in both eukarya and archaea. APOBEC (""apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like"") is a family of enzymes that deaminates cytosine (C) on nucleic acid introducing C to U mutations. One of the member, APOBEC3B (A3B), may cause mutations in cancer. My thesis project focuses on structural and biochemical studies of the archaea MCM and APOBEC3B. ❧ In this study, the near full length MCM from the archaeon Sulfolobus solfataricus (sso) forms wide left-handed filament structure for an archaeal MCM, as determined by X-ray and electron microscopy. The crystal structure reveals that an α-helix bundle formed between two neighboring subunits plays a critical role in filament formation. The filament has a remarkably strong electro-positive surface spiraling along the inner filament channel for DNA binding. MCM filament binding to DNA causes dramatic DNA topology change. This newly identified function of MCM to change DNA topology may imply a wider functional role for MCM in DNA metabolisms beyond helicase function. ❧ The structure of N-terminal MCM from the archaeon thermoplasma acidophilum (tapMCM) was determined as a right-handed filament that contains six subunits in each turn, with a diameter of 25 Å of the central channel opening. The inner surface is highly positively charged, indicating DNA binding. This filament structure with six subunits per turn may also suggests a potential role for an open ring structure for hexameric MCM and dynamic conformational changes in initiation and elongation stages of DNA replication. ❧ In the study of A3B, I show that both A3B and A3BCD2 have weak methylcytosine (mC) deamination activity. Through structural and functional analysis, I successfully engineered an A3BCD2 mutant that has gained over 2 orders of magnitude higher activity for mC deamination. Important elements around the active site that contribute to the activity and specificity for mC deamination have been identified, which reveals that multiple determinants, rather than a single factor, contribute to the mC deamination activity and specificity of A3BCD2.

Linked assets

University of Southern California Dissertations and Theses

Conceptually similar

PDF

Structure and function of archaeal McM helicase

PDF

Biochemical studies of APOBEC protein family

PDF

The crystal structure of APOBEC-2 and implications for APOBEC enzymes

PDF

Structural and biochemical studies of large T antigen: the SV40 replicative helicase

PDF

Biochemical characterization and structural analysis of two hexameric helicases for eukaryotic DNA replication

PDF

Structural and biochemical determinants of APOBEC1 substrate recognition and enzymatic function

PDF

Mechanism study of SV40 large tumor antigen atpase and helicase functions in viral DNA replication

PDF

Structural and biochemical analyses on substrate specificity and HIV-1 Vif mediated inhibition of human APOBEC3 cytidine deaminases

PDF

A structure based study of the HIV restriction factor APOBEC3G

PDF

Structural and biochemical studies of DNA helicase complexes: conformational diversity of archaeal MCM

PDF

Simulating the helicase motor of SV40 large tumor antigen

PDF

Essential and non-essential helicases maintain genome stability in Schizosaccharomyces pombe

PDF

Structural and biochemical studies of a MEF2 cancer mutant

PDF

Different alleles of fission yeast mcm4 uncover different roles in replication

PDF

Exploring roles of human APOBEC-mediated RNA editing activity

PDF

Structural studies of two key factors for DNA replication in eukaryotic cells

PDF

The role of Cdc7 in replication fork progression in response to DNA damage

PDF

Data-driven approaches to studying protein-DNA interactions from a structural point of view

PDF

X-ray structural studies on DNA-dependent protein kinase catalytic subunit:DNA co-crystals

PDF

Structure and regulation of lymphoid tyrosine phosphatase (LYP) in autoimmune response

Asset Metadata

Creator Fu, Yang (author)

Core Title Structural and biochemical studies of two DNA transaction enzymes

School College of Letters, Arts and Sciences

Degree Doctor of Philosophy

Degree Program Molecular Biology

Publication Date 03/16/2016

Defense Date 10/13/2015

Publisher University of Southern California (original), University of Southern California. Libraries (digital)

Tag APOBEC,deaminase,helicase,MCM,OAI-PMH Harvest

Format application/pdf (imt)

Language English

Contributor Electronically uploaded by the author (provenance)

Advisor Chen, Xiaojiang (committee chair), Chen, Lin (committee member), Qin, Peter (committee member)

Creator Email yangfu@usc.edu

Permanent Link (DOI) https://doi.org/10.25549/usctheses-c40-221769

Unique identifier UC11279222

Identifier etd-FuYang-4207.pdf (filename),usctheses-c40-221769 (legacy record id)

Legacy Identifier etd-FuYang-4207-0.pdf

Dmrecord 221769

Document Type Dissertation

Format application/pdf (imt)

Rights Fu, Yang

Type texts

Source University of Southern California (contributing entity), University of Southern California Dissertations and Theses (collection)

Access Conditions The author retains rights to his/her dissertation, thesis or other graduate work according to U.S. copyright law. Electronic access is being provided by the USC Libraries in agreement with the a...

Repository Name University of Southern California Digital Library

Repository Location USC Digital Library, University of Southern California, University Park Campus MC 2810, 3434 South Grand Avenue, 2nd Floor, Los Angeles, California 90089-2810, USA