University of Southern California Dissertations and Theses

The effects of prolonged fasting/ fasting mimicking diet (FMD) on CNS protection, regeneration, and treatment

(USC Thesis Other)

The effects of prolonged fasting/ fasting mimicking diet (FMD) on CNS protection, regeneration, and treatment

PDF

Download a page range

Download transcript

Copy asset link

Request this asset

Transcript (if available)

Content 1

The Effects of Prolonged Fasting/ Fasting Mimicking Diet (FMD) on CNS Protection,
Regeneration, and Treatment

By
In Young Choi

A Dissertation Presented to the
FACULTY OF GRADUATE SCHOOL
UNIVERSITY OF SOUTHERN CALIFORNIA
In Partial Fulfillment of the
Requirements of the Degree
DOCTOR OF PHILOSOPHY
(GENETIC, MOLECULAR, AND CELLUALR BIOLOGY)

Advisor: Valter D. Longo, Ph.D.

The Degree Conferral Date: May 2016
Copyright 2016
2

ACKNOWLEDGEMENTS
I want to thank my Ph.D. advisor, Dr. Valter Longo. I remember the first time I met him
for my first year lab rotation. When he talked about his passion for his research, I knew right
away that I want to be part of it. His passion for science is truly contagious and I wish I could
have that energy someday. I also remember the time he sent me a “non-science email” advising
me how I should properly present myself as a professional scientist, and I truly believe that it
was a turning point for my PhD life. It was not an easy journey, but his support and trust made it
much easier and endurable. It has been a great honor for me to be part of his research team.
I would like to thank my committee members: Dr. Sean Curran and Dr. Christian Pike.
Thank you for giving me an advice and encouragements when I was having a hard time during
my qualifying exam. I would also like to thank all of our collaborators: Dr. Laura Piccio and Dr.
Markus Bock, for their great helps and inputs.
I would like to thank all Longo lab members, past and present. For over five years, they
made fun of me for anything to everything, encouraged me when I was having some tough time,
scolded me when I was not up to my game, gave me many advices when I was lost, and made
this journey full of laughter. Especially, I would like to thank Dr. Min Wei. Without his
guidance, I am not sure how everything would have turned out. Thank you for all of your time
and advice.
Lastly, I would like to thank my family and friends. My parents are always my safety nets
and I cannot express how much I’m thankful for their love and endless encouragement. I would
have not made it without them. Also my great gratitude to my friends for brining lights, sparkles,
all the fun and stupid memories, and CLICs into my could-have-been-boring life. Without you
guys, I would have been just a sad and anti-social PhD student. Love you all!
3

TABLE OF CONTENTS

ACKNOWLEDGEMENTS 2
ABSTRACT 5

CHAPTER ONE: Dietary Intervention and Its Effects on Central Nervous System
1.1 Overview of Brain Aging and Dietary Restriction 7
1.2 The dietary restriction and CNS degenerative diseases 11
1.3 Immunopathology of multiple sclerosis and treatments 13
1.4 Hypothesis and Research Design 17

CHAPTER TWO: The effects of prolonged fasting on protection against chemotherapy-
induced neurotoxicity
2.1 Abstract 19
2.2 Introduction 20
2.3 Result 22
2.4 Discussion 32
2.5 Material and Methods 36

CHAPTER THREE: The effects of prolonged fasting on adult neurogenesis and its effects on
age-dependent decline of neurogenesis
3.1 Abstract 40
3.2 Introduction 41
3.3 Result 43
3.4 Discussion 52
3.5 Material and Methods 54

4

CHAPTER FOUR: Periodic fasting mimicking diet ameliorate the effects of multiple sclerosis
in mice
4.1 Abstract 59
4.2 Introduction 60
4.3 Result 62
4.4 Discussion 82
4.5 Material and Methods 84

CHAPTER FIVE: Conclusion
5.1 Summary of findings 90

References 92

5

ABSTRACT
Dietary restriction has been well established as a pro-longevity stimulant that increases
not only one’s chronological life span but also one’s health span. Prolonged fasting, a severe
form of dietary restriction lasting 48-120 hours, has many beneficial effects in multiple systems
by promoting metabolic and cellular changes that affect oxidative damage and inflammation,
optimize energy metabolism and enhance cellular protection. From our previous studies, we have
shown that prolonged fasting (or cycles of PF) results in a reduction of pro-growth or nutrient-
sensing signaling, including Insulin/IGF-1 for systematic nutrient sensing and TOR for
local/cellular nutrient sensing. It has also been shown to initiate atrophy in the existing
differentiated cell population followed by stimulation of stem-cell self-renewal upon re-feeding,
hence promoting efficient tissue regeneration.
We investigated the effects of dietary restrictions, in the form of prolonged fasting or
cycles of the fasting mimicking diet (FMD), in the chemotherapy induced neurotoxicity model,
the aging model and the neurodegenerative disease model. We found that PF protected mice
from chemo-induced cognitive impairments by reducing hippocampal inflammation and
promoting hippocampal cell proliferation. Furthermore, we report that the cycles of FMD
reversed the age-dependent decline in neurogenesis, the process of making new neurons, and
reversed the age-associated memory and cognitive deficits. We found that the fasting mimicking
diet can slow down and even reverse some key phenomena related to these degenerations, at
least in part, by lowering IGF-1 level and PKA activity and elevating NeuroD1. We also report
that FMD is an effective treatment for neurodegenerative diseases, in particular, multiple
sclerosis (MS). Cycles of FMD reduced central nervous system (CNS) autoimmune response by
inducing atrophy of existing autoreactive lymphocytes and by promoting regeneration of naive
6

lymphocytes. The FMD treatment also reduced autoreactive lymphocytes and increased
regulatory T cells. Moreover, FMD promoted oligodendrocyte progenitor and oligodendrocyte
regeneration, resulting in accelerated remyelination.
These findings reveal the anti-inflammatory and pro-regenerative effects of the prolonged
fasting and FMD in regulating CNS inflammation and neural cell regeneration, suggesting that
this dynamic metabolic program can be a cost-effective, simple yet potent intervention to treat
many neurodegenerative diseases.

7

CHAPTER ONE:
Dietary Intervention and Its Effects on Central Nervous System

1.1 Overview of Brain Aging and Dietary Restriction
Normal brain aging is often associated with changes in morphology and deterioration of
neuronal circuit function rather than large-scale loss of neurons
1
. Some of the common
phenotypes shared by many mammalian species in CNS aging include atrophy of pyramidal
neuronal and synapse, decrease in striatal dopamine receptor, fluorescent pigments
accumulation, cytoskeleton abnormalities and increase in reactive astrocytes and microglia
2-5
.
Specifically, the increase in reactive astrocytes and microglia, most prominently observed in
hippocampal molecular layers, is known to produce several pro-inflammatory mediators,
including interleukin (IL) - 1, IL-6, tumor necrosis factor-α (TNF-α), reactive oxygen species
(ROS), and nitric oxide (NO), that may further contribute to CNS aging
6
. Although exact
mechanisms of CNS aging are unclear, it is hypothesized that it includes instability of nuclear
and mitochondrial genomes that leads to neuroendocrine dysfunction, production of reactive
oxygen species, alterations in calcium metabolism and neuronal damage due to inflammation
7-11
.
Gene expression study done by Lee et al., analyzed the neocortex and cerebellum of young
(5-month old) and aged (30-month old) mice
12
and highlighted that only 67 out of 6,347 genes
(1%) showed more than a 1.7-fold increase in the expression level with aging in the neocortex,
whereas 63 genes (1%) showed more than a 2.1-fold increase in the expression level with aging in
the cerebellum. Among the increased genes, 20% and 27% was associated with immune or
inflammatory response in the neocortex and cerebellum. Some of them included genes that encode
microglial and macrophage migration factors, intracellular adhesion molecule 2 and CD40L
8

receptors, known to be involved in lymphocyte activation. Also, 24% and 13% of the increased
genes were associated with oxidative stress, including heat shock factors Hsp40, Hsp27, and
Hsp59. Taken together, these age-associated gene profiling data supported the concept that aging
in the brain is associated with hyper-activated immune response and oxidative stress.
Dietary restriction (DR), undernutrition without malnutrition, has been shown to extend
healthy life span in diverse organisms, from yeast to primates
13-15
(Table 1). In mammals, DR
reduces the development of age-related cancers
16
, cardiovascular disease
17
, deficits in immune
function
18
and neurodegenerative diseases
14
. The molecular mechanism responsible for the
effects of DR on health are not fully understood, but the reduction in growth hormone
(GH)/insulin-like factor (IGF-1) signaling that modulates many energy sensing pathways, such
as AMPK, AKT/mTOR and cyclic AMP response element binding protein (CREB), leads to
increases in cellular homeostasis and promotes cellular changes that affect oxidative damage and
inflammation, optimize energy metabolism, and enhance cellular protection
19-26
.

9

Table 1. The effects of dietary restriction on life span in different organisms.

Species DR regime Mean Increase Ref.
S. cerveisiae Glucose dilution
SDC vs. Water
75-300%
27,28

C. elegans Bacterial dilution in liquid
Reduction of bactopeptone in plates
Dietary deprivation
30-85%
29-32

D. melanogaster Reduction in yeast
Dilution of media
28-66%
33,34

Mice Every other day feeding
Methionine restriction
40% caloric restriction
10-65%
35-38

Rats 40% caloric restriction
Methionine restriction
Every other day feeding
42-83%
39-41

Monkey Restricted chow to maintain lean target weight of 10-11 kg 28%
42

-Adapted from Mair and Dillin (2008)
21
-
In mammals, severe DR results in a decrease in the size of most organs except the
brain
43
. During severe DR (in forms of prolonged fasting), the brain relies mainly on the ketone
bodies (β-hydroxybutyrate) for its main energy consumption
14
. After glycogen depletion from
the liver, ketone bodies, fat derived glycerols, and amino acids are the main source for generating
approximately 80 g/day of glucose, which is mostly utilized by the brain
14
.
Studies of rats and mice maintained on DR suggest that DR slows age-related molecular
changes in the brain, including increases in levels of glial fibrillary acidic protein and oxidative
damage to protein and DNA
1,10,11
. Although, DR does not induce atrophy in the brain, analyses of
relative expression levels in the brain of the old mice that had been fed either ad libitum or caloric
restricted (CR) diet, revealed significant changes in gene expression level between the two diet
groups. Among the largest age-related changes that were observed
12
, 30% (34 out of 114 genes
that were changed) were either completely or partially prevented by DR, mostly in gene classes
associated with induction of the stress response and in the inflammatory response (TABLE 2)
12
.
Interestingly, compared with age-matched controls, CR increased expression of 120 genes in the
neocortex (120 genes out of 6,300 genes that were observed), in which the largest classes of
10

transcripts induced by CR were growth and neurotrophic factors such as Hoxb9, Hoxb3, Hoxa6,
Tgfb3 and Bdnf, which have been associated with neural development and neurogenesis
12
. This
reversal in gene expression that was associated with aging and increase in gene expression that
was associated with induction of neurogenesis at the molecular level may underlie delay of brain
aging at the functional level.

Table 2. Caloric restriction-induced alterations in gene expression in neocortex
Δ CR (Fold) Encoded Protein Function Gene Category
↑2.0 Immunoglobulin alpha chain C region Immunoglobulin chain Inflammatory response
↑1.9 RelB Inhibitor of inflammation Inflammatory response
↑1.8 Inteferon-α 5 Modulator of inflammation Inflammatory response
↑1.8 Inteferon-α 2 Modulator of inflammation Inflammatory response
↑3.1 NAPH oxidoreductase Detoxification (& biosynthesis) Stress Response
↑2.0 PERK Attenuation of Protein Translation Stress Response
↑2.0 I-κB α chain NF-κB inhibitor Stress Response
↑1.7 I-TRAF NF-κB inhibitor Stress Response
↑1.9 Glucose-6-phosphate dehydrogenase Pentose phosphate pathway Energy metabolism
↑1.8 IF-2 homologue Mitochondrial protein synthesis inhibitor Energy metabolism
↑1.7 Ferredoxin-NADP reductase NADPH homeostasis Energy metabolism
↑1.7 Cytochrome c oxidase subunit Vlll-H Mitochondrial electron transport system Energy metabolism
↑3.0 BMP1 Developmental factor Growth/trophic factor
↑2.2 Gas6 Trophic factor Growth/trophic factor
↑1.9 Hox-B3 Homeobox gene Growth/trophic factor
↑1.9 Neuroserpin Neuronal plasticity Growth/trophic factor
↑1.8 BDNF Neurotrophic factor Growth/trophic factor

↓1.9 Multifunctional aminoacyl tRNA syn tRNA synthesis Protein Synthesis
↓1.9 Valyl tRNA synthetase homologue tRNA synthesis Protein Synthesis
↓1.8 EF-1-γ homologue Elongation Protein Synthesis
↓1.8 6S ribosomal protein L10 homologue Ribosomal component Protein Synthesis
↓2.2 MCP-5 Inflammatory cytokine Stress Response
↓2.1 Hsp27 Heat shot factor/chaperone Stress Response
↓2.1 NF-κ-B-p32 Oxidative stress response Stress Response
↓1.8 Stat6 IL-4 signaling Stress Response
↓1.8 Interferon-receptor beta chain homologue Th-1 cytokine receptor Stress Response
↓2.0 Phosphorylase-B-kinase γ subunit Glycogen breakdown Energy metabolism
↓1.8 Creatine transporter homologue Creatine transport Energy metabolism
↓1.8 Phosphoglycerate kinase 2 Glycolysis Energy metabolism
↓1.7 Insulin receptor substrate-3 Insulin signal transduction Energy metabolism
-Adapted from Lee et al.(2000)
12

11

1.2 The Dietary Restriction and CNS Degenerative Diseases
There have been great advances in the research of cancer and cardio vascular disease.
Consequently, many people who would have died in their 50s and 60s due to these diseases are
now in danger of facing many age-related neurodegenerative diseases such as amyotrophic
lateral sclerosis (ALS), Alzheimer’s disease (AD), Parkinson’s disease (PD) and stroke
14,44
. It
has been projected that, by the 2050s, the number of people with such neurodegenerative
diseases will triple.
Many neurodegenerative diseases include a variety of genetic or sporadic disease
progressions that lead to the progressive or chronic loss of structures and functions of the CNS.
One of the most studied neurodegenerative diseases is Alzheimer’s disease. General
pathology includes accumulation of amyloid plaques of insoluble β-amyloid (Aβ) and
degeneration and neuronal death in both cerebral cortex and hippocampus that are associated
with learning and memory
6
. In various AD mouse models, DRs (30% caloric restriction) have
increased resistance to excitotoxicity injury compared to its ad lib control
44
, reduced progression
of β-amyloid (Aβ) deposition in the hippocampus and cerebral cortex
45-47
, and reversed cognitive
deficits
48
. In presenilin-1 mutant mice and triple transgenic AD mouse models (3xTg-AD),
hippocampal CA1 and CA3 neurons of mice maintained on DR have increased resistance to
excitotoxic injury compared to mice fed ad lib
44
, which correlated with reduced levels of
oxidative stress
49-51
. Furthermore, 3xTg-AD mice that were on protein restriction cycles for four
months showed improved behavior performance and reduced phosphorylated Tau and these
improvements were associated with reduced IGF-1 signaling
52
.
12

Parkinson’s disease is characterized by loss of dopaminergic neurons in the substantia
nigra pars compacta, which leads to motor dysfunction
53
. The risk of PD increases with
advancing age and is associated with an increase in oxidative stress and impaired protein turn
over in dopamine neurons
54
. In neurotoxin 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine
(MPTP)-induced PD model, the DR-treated group reduced neuronal loss in the substantia nigra
pars compacta and improved motor coordination compared with the control diet group
55
. These
improvements upon DR treatment were associated with increased glia-derived neurotrophic
factor (GDNF) in the ipsilateral striatum
55
.
Some of the DR-mediated beneficial effects are due to reduced accumulation of oxidative
damaged molecules, improved cellular biogenetics, enhanced neurotrophic factor signaling and
reduced inflammation
14,56
. The neuro-protective mechanisms are supported by studies showing
that DR upregulates antioxidant defense mechanism, increase neurotrophic factors (BDNF and
FGF2) and protein chaperones (HSP-70 and GRP-78) and downregulates proinflammatory
cytokines (TNF-alpha, Il-1beta, and IL-6)
57
. DR may also promote restoration of the damaged
nerve cell circuits by stimulating synapse formation and the production of new neurons from
neural stem cells
58
.
Although many beneficial effects of DR on age-associated neurodegenerative diseases
are actively studied, the role of DR on other neurological disorders, such as multiple sclerosis
(MS), Huntington’s disease or epilepsy, still remains to be tested. Moreover, many studies rely
on DR as a preventive medicine that focuses on delaying the disease onset, which limits the DR
intervention to be more applicable to translational medicine.

13

1.3 Immunopathology of Multiple Sclerosis and Treatments
Multiple sclerosis (MS) is a chronic neuro-inflammatory disease of the central nervous
system (CNS), which results in serious physical disabilities including motor impairment, sensory
and visual disturbances, fatigue, pain and cognitive deficits
59
. MS has a heterogeneous disease
development, in which 85% of MS patients have relapse-remitting MS, characterized by an
episode of neurological dysfunction, followed by a remission, and then recurrence of release and
remission. Eventually, the majority of MS patients undergo secondary progressive MS,
characterized by reduction in brain volume and an increase in axonal loss
59-61
.
MS is caused by immune cell infiltration across the blood-brain barrier (BBB) that result
in inflammation, demyelination, gliosis and axonal degeneration in the white and gray matter of
the brain and spinal cord
62
. The initial attack is dominated by autoreactive lymphocytes that
respond abnormally to the CNS autoantigen, and, as MS progresses, diffusion of inflammatory T
and B cells, macrophages, microglia and activated astrocytes are apparent in the CNS lesions
62
;
however, the precise mechanism remains unsolved.
There are some hypotheses about how MS is triggered in the periphery. In the peripheral
model, autoreactive T-cells undergo negative selection (clonal deletion) during central tolerance
in the thymus
63
; however, this process is not perfect, and some autoreactive T cells escape to the
periphery. Unlike the healthy system in which these autoreactive T cells get targeted by
regulatory T cells (Treg), in MS patients, this tolerance is broken possibly due to Treg dysfunction,
and/or the increased resistance of effector T cells to suppressive mechanism
63,64
. Then, these
CNS-directed autoreactive T cells become active effector cells by recognition of sequestered
CNS antigen, molecular mimicry or novel autoantigen presentation
64-67
. Once activated,
14

differentiated CD4
+
T helper 1 (Th1) and Th17 cells, CD8
+
T cells, B cells and innate immune
cells can infiltrate the CNS, leading to inflammation, demyelination and axonal loss
64
.
Experimental autoimmune encephalomyelitis (EAE) is the most commonly used rodent
model for MS. EAE is induced in mice by immunizing them with myelin-specific antigens:
myelin binding protein (MBP), proteolipid protein (PLP) or myelin oligodendrocyte glycoprotein
(MOG), with adjuvant containing bacterial components that artificially activate the innate
immune system and autoreactive T cells
68,69
. Disease onset typically occurs between 8-14 days,
and mice develop observable phenotypes similar to MS motor/movement impairment. EAE
mimics many pathogeneses observed in MS. In EAE, infiltrating CD4
+
T cells in the CNS
undergo secondary activation by resident antigen-presenting cells (APCs), mainly dendritic cells
and macrophages
70
. This reactivation results in secondary monocyte recruitment and additional
activation of naïve CD4
+
T cells via epitope spreading resulting in enhanced inflammation.
The importance of Th1 and Th17 in EAE/MS pathogenesis has been well established.
When EAE was induced in IL-12p40-defective mice, mice were resistant to EAE
71
. Because
IL-12 is required for Th1 differentiation, it was postulated that Th1 plays an essential role in
disease development
71-73
. Furthermore, when patients were treated with IFN-γ, a main cytokine
secreted from Th1, it exacerbated the disease
74,75
. In addition to Th1, many studies have
highlighted the central role of Th17 in EAE and MS pathogenesis as well. A study by Langrish et
al., showed that when Th17 or Th1 cell lines were transferred into naïve mice, only mice that had
Th17 had EAE induction
76
. Furthermore, gene targeted mice lacking only IL-23, which is
essential for Th17 development, failed to induce EAE, while gene targeted mice lacking only IL-
12, which is essential for Th1 development, developed the disease
77
. Later, it was confirmed in a
T-cell transfer model of IL-23
-/-
mice that IL-23 was required for the induction phase of the
15

disease, but not for the effector or chronic phase of the disease
78
. Taken together, Th1 and Th17
play an important role in MS/EAE pathogenesis, and it may also be possible that they play
complementary roles.
Regulatory T cells (Treg) also play a crucial role in maintaining immune homeostasis
during EAE/MS pathogenesis. Initial observation that a healthy individual also has myelin-
specific autoreactive T cells suggested that these cells are constrained in some regulatory
mechanisms in a healthy individual, while it is insufficient and/or impaired in MS patients
79
. In
support of this hypothesis, Treg isolated from the MS patients showed impairment in in vitro
suppression assays compared to Treg from the healthy controls
80-82
. Furthermore, transfer of CD4
+

CD25
+
Treg into EAE induced mice resulted in a reduction in EAE disease severity
83
.
In addition to heightened immune activity in MS patients, spontaneous remyelination has
also been observed in the autopsy from MS patients during early stages of the disease
84-86
. These
remyelinated regions were also correlated with an increase in oligodendrocytes present at the
lesions
84-86
. Remyelination requires generation of new oligodendrocytes from oligodendrocyte
precursor cells (OPCs). OPCs are widespread throughout the CNS consist of 5-8% of total cell
population
87,88
. In response to the damage, astrocytes and microglia induce proliferation of
OPCs
89,90
. OPCs migrate to the lesion, and upregulate several genes that are associated with
oligodendrocyte development, such as OLIG2, NKX2.2, and MYT1
91,92
, which initiates
differentiation of OPC into oligodendrocytes
93
. However, most of the chronic lesions of MS are
not remyelinated, and severe axonal loss is observed
84,94
. Analysis of 48 chronic lesions obtained
at autopsy from MS patients showed that the lesions contained pre-myelinating oligodendrocytes
with multiple extended processes associated with demyelinated axons but failed to myelinate
95
.
16

Other studies also supported that remyelination failure is not due to failure of proliferation or
migration of OPCs, but rather inhibition of OPC differentiation at the lesion
85,95-97
.
Currently, several disease-modifying drugs are approved for MS treatmentss:
Alemtuzumab, an anti-CD52 antibody that depletes T-cell and monocytes
98
, Rituximab, an anti-
CD20 antibody that depletes B cells
99
and Natalizumab, an anti-α4β1 integrin antibody that
prevents CNS infiltration by immune cells
100
. These drugs are shown to reduce relapse rates by
modulating immune responses; however, their side effects from long-term treatment and
progression, its accrual of irreversible neurological disability, remains largely unclear,
underlining the need for novel therapeutic strategies
101
. Therefore, much advanced and effective
treatments for MS need to reduce immunity while promoting oligodendrocyte regeneration in
order to restore the myelin sheath.

17

1.4 Hypothesis and Research Design
Cycles of fasting mimicking diet (FMD) as an extreme dietary restriction have shown to
mimic many biomarkers associated with pro-longevity as that observed in the prolonged fasting
such as reduction in IGF-1 and glucose and increase in ketone bodies. Similar to that observed in
PF, the fFMD induces metabolic energy shift from glucose-based catabolism to a fat- and ketone
body based catabolism. It also induces atrophy in several organs. We hypothesize that the FMD
feeding regimen, in which available nutrients are scarce, leads to system-wide tissue atrophy,
followed by re-feeding, which stimulates and promotes multi-system regeneration in adult tissue.
In this study, we found that prolonged fasting or cycles of FMD 1) protects the CNS
against neurotoxicity 2) promotes adult neural stem cell regeneration and differentiation and
reverses age-dependent decline in memory and cognitions; 3) treats neurodegenerative diseases,
in particular, MS by modulating immune response and stimulating precursor-dependent
oligodendrocyte regeneration.
To investigate the role of a prolonged fasting intervention as a protection against
chemotherapy induced neurotoxicity, we treated mice with a high dose of cisplatin, a widely
used platinum-based chemotherapy drug that induces neurological side effects, with or without
72 hours of a prolonged fasting intervention. After three weeks of recovery time, the mice were
tested for spatial, associate learning and motor coordination tests. We observed that the
prolonged fasting cohort showed a higher survival rate, improved cognitive and motor
coordination compared to the control cohort, and was also associated with reduction in
hippocampal and cortex inflammation in the prolonged fasting cohort comparted to its control
cohort.
18

To study the effects of FMD cycles on age-related decreases in neurogenesis and decline
in memory and cognitive ability, 18-month old mice were subjected to either bi-monthly cycles
of FMD or regular control chow. We observed that FMD cycles extended longevity and
promoted hippocampal neurogenesis, lowered IGF-1 levels and PKA activity, elevated NeuroD1
in the hippocampus, and improved cognitive performance.
To investigate the efficacy of the FMD cycles for MS treatment, FMD cycles were tested
as a weekly cycle to a mouse model of MS called experimental autoimmune encephalomyelitis
(EAE). FMD cycles in EAE mice reduced disease severity and showed reduction in antigen
presenting cells (APCs) and T lymphocytes. Furthermore, FMD cycle stimulated
oligodendrocyte precursor dependent regeneration of functional oligodendrocytes. The results
from clinical trials of relapse remitting multiple sclerosis (RRMS) patients who received FMD
were further analyzed to evaluate the feasibility and safety of the diet and its efficacy in causing
similar changes.
Taken together, we demonstrated that cycles of very low protein and low carbohydrates,
FMD, provide similar beneficial effects as the ones that we observed in the prolonged fasting,
and provide a powerful means to modulate key regulators of CNS protection and regeneration.
This may also provide a cost-effective treatment for many neurodegenerative autoimmune
diseases in humans.

19

CHAPTER TWO:
The Effects of Prolonged Fasting on Protection Against Chemotherapy-induced
Neurotoxicity
2.1 Abstract
Chemotherapy related side effects can be ravaging for cancer patients and lead to
suspension of the pharmacological treatment. In particular, more focus has been placed on the
cognitive deficits and declining neuropsychological functioning described as “chemo-brain” or
“chemo-fog”. Chemo-brain encompasses impairments in memory, attention, concentration and
ability to perform various mental tasks as well as deficits in executive and motor function. We
examined the protective effects of prolonged fasting intervention in cisplatin (CDDP), a widely
used chemotherapy drug that known to induce neurotoxicity. Our previous studies have shown that
prolonged fasting in forms of short-term starvation (72 hours), resulting in reduction in insulin-
like growth factor I (IGF-I) signaling, can protect mammalian cells but not cancer cells against
oxidative stress and high doses of chemotherapy drug. We treated mice that have been subjected
to prolonged fasting for 72 hours (48 hours before the CDDP treatment followed by additional 24
hours after the treatment) with a high dose of cisplatin. After 3 weeks of recovery time, the mice
in the prolonged fasting cohort showed improved survival rate, and improved spatial learning
(Barnes maze) and motor coordination (Rotarod) tasks compared to its control cohort. These
improved behavior outcome was associated with a reduction in hippocampus and cortex
inflammation level and protection/enhancement of hippocampal proliferation in prolonged fasting
mice. These data indicate that prolonged fasting is a promising strategy to also protect cancer
patients against chemo-brain.

20

2.2 Introduction
The use of chemotherapy agents for the treatment of cancer is limited by severe side effects.
The chemotherapy related toxicity leads to both short- and long- term adverse effects that can limit
the dose of the drugs used and, in the worst scenario, cause the interruption of the treatment.
Among the different side effects encountered by cancer patients treated with anti-neoplastic drugs,
severe cognitive impairments are reported in 15-50% of cancer survivals and more patients are
now reported to experience more subtle cognitive impairments
102-104
. Chemobrain consists of
cognitive alterations which encompass deficits in executive and motor function, verbal memory,
concentration and multitasking. Although in the past cognitive dysfunction occurred in chemo-
treated cancer patients may have been attributed to stress or depression, common conditions
encountered by people subjected to cycles of chemotherapy, recent longitudinal studies have
provided substantial evidence that the cognitive decline is caused by chemotherapy itself
104-112
.
Several studies on cancer patients have shown that widely used chemotherapy drugs,
characterized by different mechanisms of action and used for the treatment of a wide range of
neoplasias, are linked to cognitive impairment episodes: doxorubicin
104,105
, 5-fluorouracil
104,105
,
methotrexate
104,105
, cyclophosphamide
104,105
, vincristine, etoposide, vinblastine
104
,
dexamethasone, prednisone, docetaxel
105
and cisplatin
113
. The specific mechanisms underlying
chemobrain remain largely unknown, although several processes could contribute to this
phenomenon including chronic increases in inflammation
103,114
, increase oxidative stress
114
, blood
vessel damage, chemotherapy-related anemia, disruption of hippocampal cell proliferations
102
.
Different studies also suggest a role of inflammation in chemotherapy related central
neurotoxicity. For example, it has been reported that the chemotherapy drug adriamycin induces
21

peripheral increase of tumor necrosis factor alpha (TNF-α) that in turn can cross the blood brain
barrier (BBB) and induce inflammatory responses in the brain
115-117
.
We have previously shown that prolonged fasting (PF), in forms of a short-term starvation
(STS), resulting in reduction of insulin-like growth factor I (IGF-I) signaling, can protect
mammalian cells but not cancer cells against oxidative stress and high doses of chemotherapy
drugs
118,119
. In the present study we tested the hypothesis that prolonged fasting is effective also
in providing protection in vivo against central neurotoxicity caused by a high dose of cisplatin, a
widely used chemotherapy agent characterized by neurologic side effects. Damage to progenitor
cells of CNS and inflammation are also investigated.

22

2.3 Results
Survival and weight changes after Cisplatin administration.
CD-1 mice, females, 8 weeks old, were divided into two groups: the first one fed ad libitum and
treated with Cisplatin (Cisplatin group; CDDP), the second subjected to a prolonged fasting: 48
hours before the cisplatin treatment followed by additional 24 hours post chemotherapy (PF
Cisplatin group; PF+CDDP). In order to study cisplatin-induced neurotoxicity, we injected both
groups with a single high dose of cisplatin (12 mg/kg, prepared in saline) (Fig. 1a). To better model
cisplatin side effects occurring in cancer patients, cisplatin was administered intravenously (i.v.),
a common way of administration of this molecule in oncologic therapy, and survival and weight
changes were monitored for 30 days. After 2 days from drug injection cisplatin acute toxicity,
PF+CDDP group had a 69% survival rate compared to a 50% of CDDP group by the end of D30
(Fig. 1b, survival curves comparison by Log-rank (Mantel-Cox) test, p = 0.0702). After a 72-hour
PF, mice lost approximately 20% of body weight but both groups recovered to their baseline body
weight by Day 17(Fig. 1c).

a
c
PF+ CDDP
CDDP
b
23

Prolonged fasting protects against spatial and associative learning deficits induced by
Cisplatin treatment.
After 3 weeks post CDDP treatment, CDDP and PF+CDDP cohorts were tested with Y-
maze to test working memory but there was no significant difference between the experimental
groups in SAB scores, a measure of working memory (Fig. 2a). Moreover, there was no difference
between the groups was found in the total number of arm entries (measure of activity level, Fig.
2b) nor in number of defecations (measure of anxiety, Fig. 2c), indicating that the survived mice
(after 3 weeks post CDDP treatment) from both cohort showed no signs of stress or altered
behavior caused by the drug delivery.

Figure 1. Representation of the experimental procedure, body weight and survival curve of Cisplatin
or STS+Cisplatin groups.
a. Schematic view of experimental procedure: CDDP was given 12mg/kg (i.v.) with or without
prolonged fasting (48 hours prior to CDDP and addition of 24 h; total 72 hours).
b. Body weight of CDDP (blue) and PF+CDDP (green) in % of initial body weight.
c. Survival rate of CDDP and PF+CDDP
Figure 2. Working memory seems unaffected both in CDDP and STS+CDDP cohorts.
a. SAB score (% of spontaneous alteration over total possible alteration) of control (no treatment),
CDDP, and PF+CDDP
b. Number of arm entry of control, CDDP, and PF+CDDP
c. Number of defecations of control, CDDP, and PF+CDDP
a. b. c.
Control
CDDP
PF+CDDP
24

Next we tested for a hippocampal-dependent spatial learning and memory task using the

Barnes maze. In this task rodents were trained to identify the

unique hole that leads to an escape
box (EB) among 20 holes

located around the perimeter of an open circular platform.

To find the
EB, mice must learn and memorize to orientate themselves on the platform using visual clues in
the testing room. The different experimental groups performed similarly on percentage of success
(Fig. 3a), latency (Fig. 3b), number of errors (Fig. 3c) and strategy used (Fig. 3e, 3f, 3g). The
three groups improved in the ability to locate the

EB over the acquisition phase day after day, as
indicated by increased percentage of success (Fig. 3a), reduced latency to find the correct escape
box (Fig. 3b) and improved search strategy (Fig. 3e, 3f, 3g). This was accompanied by a gradual
but steady shift from random strategy to the superior serial and spatial strategies. On the other
hand, when we analyzed the deviation between the first hole and the EB, we found that Cisplatin
treated mice did not improve their performance, whereas untreated mice and the PF+CDDP group
reduced deviation score over the time (Fig. 3d). In addition, when these parameters were re-
assessed 7- days after the last training session to test their retention of the memory, each group
maintained

its ability to locate the EB at a level similar to that on

the last day of the acquisition
phase (Fig. 3a–g, day

7 vs day 14), but CDDP treated group failed to retain long-term memory
measured by number of errors (Fig. 3c) and deviation from the escape box (Fig. 3d), suggesting
that memory retention is impaired in the cisplatin treatment group. Taken together, these results
indicate that, under our experimental conditions, cisplatin treatment causes a spatial memory
impairment compared to control and that PF+CDDP groups. Moreover, the finding that the
cisplatin treated mice carried out the task at a speed similar to that of untreated mice (Fig. 3b)
suggests that animals recovered from systemic Cisplatin toxicity.

25

Figure 3. Prolonged Fasting cohort showed improved hippocampal dependent contextual memory
performances.
a. Success rate (0% indicates failure in finding the EB, and 100% indicates success in
finding the EB) of control, CDDP, and PF+CDDP during 7 days of training period (Day1
– Day7) and retention day (Day 14).
b. Latency (maximum latency is 120 seconds) of control, CDDP, and PF+CDDP.
c. Number of errors took to identify the EB of control, CDDP and PF+CDDP.
d. Deviation from escape box (scored from 1 to 10; 10 being the farthest from the EB) of
control, CDDP and PF+CDDP.
e – f. Strategies (random, serials, and spatial) that used to locate the EB of control (e), CDDP
(f), and PF+CDDP (g).

C
C
S

PF+CDDP

Control
CDDP

0 1 2 3 4 5 6 7
0
25
50
75
14
Days
Latency (sec)

0 1 2 3 4 5 6 7
60
70
80
90
100
110
14
*
Days
Success Rate (%)

0 1 2 3 4 5 6 7
0
5
10
15
14
*
Days
# of Errors

0 1 2 3 4 5 6 7
0
2
4
6
8
14
Days
Deviation

*

a.
b.
c. d.
e.
f. g.
Control
PF+CDDP CDDP CDDP
26

Prolonged fasting reverted Rotarod performance impairment caused by cisplatin.
Cisplatin side effects include peripheral neurotoxicity characterized by severe neuropathy.
Peripheral neuropathy caused by cisplatin is associated with painful paresthesias and numbness
that can limit the dose of chemotherapy treatment
120
. Although the mice that survived to cisplatin
acute toxicity did not show any apparent locomotor problem after the recovery time, we wanted to
investigate further this particular side effects using Rotarod Performance test. Rotarod is used to
assess the effects of drugs on the motor coordination or fatigue resistance and it has been employed
also to study Cisplatin-induced neuropathy
121
. In this test rodents are placed on a rod rotating at
an increasing speed and the time they can stay on balance on it is recorded. Cisplatin treated mice
spent significantly less time on the rod compared to the untreated animals, suggesting a motor
function deficit; STS reverted the performance impairment (Fig. 4a, t-test: F = 1.869, p < 0.05
Control vs CDDP; F = 3.924, p = 0.725 Control vs PF+CDDP).

Figure 4. Prolonged Fasting protected mice from motor coordination impairment caused by cisplatin
a. Quantification of the maximum time spent (sec) on the rod by control, CDDP, and PF+CDDP (p <
0.05). Cisplatin treated mice spent significantly less time on the rod compared to the control and
PF+CDDP treated mice.

a.
Control
CDDP
PF+CDDP
27

Prolonged fasting protects CDDP induced insults by enhancing hippocampus proliferation
and neuronal protection.
Cisplatin, because of its hydrophilic nature, can hardly cross the blood-brain barrier (BBB),
but damage the BBB which allows infiltration and cause chemo-brain associated damages
122-124
.
Interestingly, recent studies indicated that CNS progenitor cells are targets of different
chemotherapy drugs including cisplatin
125
. In light of these findings, NPCs appear to be an
important target of anti-cancer drugs toxicitiy and damage to these cells could play an important
role in chemotherapy-induced cognitive impairment. In order to identify possible mechanism
behind PF-mediated protection against cisplatin neurotoxicity, BrdU was injected and the brain
were collected at various time points (Fig. 5a-c), and immunostained with antibody against BrdU,
as a proliferative marker, and doublecortin (DCX), as an immature neuronal marker (Fig. 6a).

Figure 5. Representation of the experimental procedure to investigate PF-mediated enhancement of
hippocampus proliferation and neural protection.
a. Time point A1; BrdU (10 mg/kg) was injected once a day for 4 days prior to PF regimen
and brains were collected right after PF.
b. Time poing A2: BrdU was injectd during 72 hours of PF regimen and brains were
collected right after PF.
c. Time point B: BrdU was injected after 2 week post PF regimen.
a
b
c
28

Dentate gyrus of hippocampus is a known niche for neural stem cell proliferation and
differentiation, and retain proliferation throughout adulthood. Newly generated neurons play a
critical role in hippocampal dependent learning and memory
126-128
. When BrdU was injected 3
days prior to PF regimen (TP A1; Fig. 5a) to measure proliferation of existing stem cell population,
PF+CDDP cohort shows a significant reduction in proliferating BrdU
+
cells (13.5 ± 3.9 CDDP vs.
7.9 ± 0.2 PF+CDDP), but an increase in number of DCX
+
immature neurons (31.7 ± 8.6 CDDP vs.
50.9 ± 5.9 PF+CDDP; Fig. 6b). To measure neuronal differentiation, we quantified the double
positive (BrdU
+
DCX
+
) cells over the total proliferative cells (BrdU
+
) indicative of proliferating
cells that are committed to become neuronal lineage. We observed that PF+CDDP cohort had a
significantly higher (p < 0.05) neuronal differentiation level (37.2 ± 4.1 CDDP vs. 45.3 ± 2.1
PF+CDDP; Fig. 6b). When BrdU was injected 3 days during PF regimen in parallel to CDDP
treatment (TP A2; Fig. 5b), both CDDP and PF+CDDP cohorts shows a significant reduction (p
< 0.01) in proliferating BrdU
+
cells compared to its non-treated control cohort, but an increase in
number of DCX
+
immature neurons (28.7 ± 9.4 CDDP vs. 44.3 ± 13.2 PF+CDDP; Fig. 6c). Similar
to TP1A, PF+CDDP cohort had a significantly higher (p < 0.05) in neuronal differentiating cells
(37.2 ± 4.1 CDDP vs. 45.3 ± 2.1 PF+CDDP; Fig. 6c). Since BrdU incorporation could also indicate
DNA repair, it could be possible that the initial increase in BrdU+ cells observed at TPA1 in CDDP
cohort could be due to an increase in CDDP induced damage response. Interestingly, when BrdU
was injected 3 weeks after the CDDP and PF regimen (TP B; Fig. 5c), we observed a significant
increase in BrdU+ cells in PF+CDDP cohort compared to the CDDP cohort (7.3 ± 5.1 CDDP vs.
14.7 ± 6.8 PF+CDDP). Furthermore, CDDP cohort showed near two-fold reduction in number of
BrdU
+
cells compared to its basal level at TP A1. Similarly, PF+CDDP cohort showed an increased
number of DCX+ cells and neuronal differentiation compared to that of CDDP cohort (Fig. 6d).
29

Figure 6. Prolonged fasting transiently reduces proliferation but promote neuronal differentiation.
a. Immunohistochemistry of BrdU and DCX of dentate gyrus to measure proliferation and
differentiation at different time points.
b. Quantification of BrdU+ cell counts (b), doublecortin+ cell counts (c) and percentage of
BrdU+ DCX+ of total BrdU+ cells (d) per section of control, PF, CDDP, and PF+CDDP
at TP A(1).
c. Quantification of BrdU+ cell counts (b), doublecortin+ cell counts (c) and percentage of
BrdU+ DCX+ of total BrdU+ cells (d) per section of control, PF, CDDP, and PF+CDDP
at TP A(2).
d. Quantification of BrdU+ cell counts (b), doublecortin+ cell counts (c) and percentage of
BrdU+ DCX+ of total BrdU+ cells (d) per section of control, PF, CDDP, and PF+CDDP
at TP B.
PF+CDDP
CDDP
CTRL
a.
b.
c.
d.
0
5
10
15
20
*
BrdU
+
Counts / Section
0
10
20
30
40
50
*
DCX
+
cells / section
0
5
10
15
20
25
Double Positive Cells/ DCX Ratio
*
0
5
10
15
20 *
BrdU
+
Counts / Section
0
20
40
60 *
DCX
+
cells / section
0
20
40
60 *
% Double Positive / BrdU - Section
0
5
10
15
**
BrdU
+
Counts / Section
0
20
40
60
*
DCX
+
cells / section
0
20
40
60
*
% Double Positive / BrdU - Section
30

Since the dendrites are the site of most synaptic contracts, the proper growth and
arborization of dendrites are crucial for functioning of the nervous system
129,130
. In order to assess
dendrites maturation, sections were also DAB-stained using DCX to visualize dendrite outgrowth
(Fig. 7a). PF+CDDP cohort showed more extensively arborized dendrites in the molecular layer
of dentate gyrus compared to the CDDP cohort (Fig. 7b).

Prolonged fasting decreases inflammation in the hippocampus and cortex
Next we investigated the effects of the treatments on different CNS inflammation. Proteins
were extracted from frontal cortex and hippocampus brain regions of the described mice and used
to quantify levels of GFAP (a marker of astrocytic activation), and found a dramatic decrease in

a.
b.
Control
0
1
2
3
Dendrite Covered Area (Pixcel)
CDDP STS CDDP
* **
Control
STS
CDDP
STS+CDDP

Figure 7. PF+CDDP mice shows extensively arborized dendrites in the molecular layer of dentate
gyrus.
a. Sections of control, CDDP, PF+CDDP mice DAB-stained with DCX to visualize dendrite
outgrowth
b. Quantification of dendrite covered area of control, CDDP, and PF+CDDP (p < 0.01) shows that
PF+CDDP cohort showed enhanced dendrite covered area compared to CDDP cohort.

Control
CDDP
PF+CDDP
31

GFAP levels in the PF+CDDP mice when compared with the CDDP treated mice in both
hippocampus and frontal cortex (Fig. 8). This result supports that DR reduces inflammation and
may contribute to enhanced behavior and hippocampus proliferation observed in PF+CDDP cohort.

b.
Figure 8. Prolonged fasting reduces inflammation in the hippocampus and cortex.
a. Western blot of GFAP expression in control CDDP and PF+CDDP in hippocampus and
the quantification (a.u).
b. Western blot of GFAP expression in control, CDDP, and PF+CDDP in cortex and the
quantification (a.u.). PF+CDDP educed astrocytic activation level (p < 0.01) in cortex
compared to the CDDP.

a.
0.0
0.5
1.0
1.5
2.0
Hippocampal GFAP
Control
CDDP
PF+CDDP
Expression level (a.u.)
0.0
0.5
1.0
1.5
**
Cortex GFAP
Control
CDDP
PF+CDDP
Expression level (a.u.)
32

2.4 Discussion
The results presented here provide evidence for a neurotoxic effect caused by the peripheral
administration of a single high dose of the anticancer drug cisplatin. The cisplatin dose used on mice
in this study is higher of the equivalent cumulative dose of 300 mg/mm
2
at which the onset of
peripheral neurotoxicity is observed in cisplatin treated patients
131,132
. Thus, although the drug
dosage and regimen administration used here are different from the therapeutic protocol normally
used on cancer patients, the single injection of a high dose of cisplatin appears a feasible model of
chemotherapy induced neurotoxicity in rodents that has been employed to cause measurable
cognitive deficits
133-135
and neuropathies
136,137
.
Drug-induced cognitive deficits were observed on Barnes maze (deviation from EB in the
first set and number of errors in the second set). There were no differences between cisplatin and
control groups on Y-maze, whereas drug-treated mice performed even better then controls in other
two parameters scored with Barnes maze (% of success and latency in the first set of mice). The
data collected through behavioral tests allow us to exclude both physical and emotional
components as co-causes of the poor memory performances observed in the cisplatin group. After
the recovery period, the cisplatin treated mice did not show abnormal behaviors nor symptoms of
stress, anxiety and loss of motivation compared with not treated animals when tested with Y-maze
(number of arm entries and defecations), nor displayed apparent physical difficulties in targeting
the EB during the Barnes maze task (latency to find the EB). Therefore, we assume that the
observed cognitive deficits are due by specific damages induced by chemotherapy treatment.
Taken together, these results indicate that, besides the general toxicity, the drug caused a
significant and persistent cognitive impairment in the treatment survivors when compared with
control siblings. This study is the demonstration that cisplatin can impair cognitive function when

33

systematically administered to laboratory rodents. The detected cognitive impairment
encompassed deficits in spatial learning and memory (Barnes maze), in agreement with previous
studies that analyzed central neurotoxicity promoted by other chemotherapy drugs
133-135,138-141
.
Since the behavioral tests we used in this study rely mainly on hippocampus function
142,143
, our
results suggest that cisplatin can damage specifically the hippocampus region and are consistent
with previous findings obtained using other anticancer drugs
133,134,140,144
.
When tested on Rotarod, cisplatin treated mice performed worse than their control siblings,
suggesting locomotor impairment, diminished coordination or proprioceptive deficits. Although
the lack of specific nerve conduction studies or nerve morphometric analyses does not permit a
precise diagnosis of the nerves damage suffered by the cisplatin treated mice and does not allow
us to discriminate between central and peripheral toxicity, our results are compatible with
chemotherapy induced neuropathy reported by previous studies
145,146
. It is important to notice
that the poor performance of cisplatin treated mice on Rotarod is only apparently in contradiction
with the values of latency to enter the EB scored by the same group with Barnes maze. In the
Barnes maze the latency to enter the EB includes not only the walk speed, but also the time the
mouse needs to locate the box and enter in. Although this score can give general information about
rodent health status and gross locomotor issues, it is primarily a spatial and learning and memory
parameter. On the other hand, the Rotarod test design allows us to exclude the learning component
(after training all the mice learnt how to stay in balance on the rod) and gives specific information
about motor skills.
Prolonged fasting elicits a powerful protective effect against cisplatin toxicity on multiple
levels. After the injection of the high dose of cisplatin, approximately 50 % of the mice from the
first set and 40 % from the second set succumbed to the drug general toxicity. We did not find a
34

significant difference between the survival of cisplatin treated mice and their starved and then
treated siblings, as instead we reported for the chemotherapy drug, etoposide
119
. This result can be
due to the unusually high drug dose we used in this study. However we observed a trend for
protection in term of survival provided by PF (50% cisplatin vs 69% PF cisplatin in the first set of
mice, 40% cisplatin vs 50 % PF cisplatin in the second set). PF can efficiently protect against the
neurotoxicity induced by cisplatin. PF alleviated chemotherapy related deficits in spatial learning
memory detected on Barnes maze (EB deviation), spatial memory measured on NOR task (RI
value) and associative memory observed on fear conditioning test (both context and tone tests).
Moreover, our results raise the possibility the PF could be also efficacious in protecting against
drug induced peripheral toxicity. In fact, whereas cisplatin treated mice performed significantly
worse than control siblings on Rotarod test, starved and the chemotherapy treated mice did not.
Furthermore, PF could protect or promote hippocampus proliferation. In PF cohort, we
observed an increase in proliferative cells (BrdU
+
) that are committed to neuronal lineage
(BrdU
+
DCX
+
) compared to the CDDP treated group. Initially, CDDP cohort had an increase in
BrdU+ cells upon CDDP treatment; however, the BrdU uptake could reflect cells that are
undergoing DNA damage response. Therefore, the observed increase in BrdU
+
cells in the CDDP
treated group could indicate the cisplatin induced DNA damages, not proliferating cells. We also
observed a decrease in activated astrocyte in hippocampus and cortex. Hyper immune response in
hippocampus are suggested as one of the mechanisms that reduces hippocampal proliferation
147
.
Activated microglia can release pro-inflammatory or anti-inflammatory cytokines, modulating the
immune response in support of or suppression of neurogenesis
148,149
. Classically activated immune
cells secrete the pro-inflammatory cytokines, including tumor necrosis factor-alpha (TNF-alpha)
and interleukin-6 (IL-6), which can inhibit NSCs from differentiating into neurons in favor of
35

astrocyte
147,148
. Taken together, PF may enhance CNS protection by reducing cisplatin induced
inflammation and protecting hippocampus proliferation and differentiation.
It is also worth mentioning again that survival rate for cisplatin group was lower than the
one scored for PF cisplatin animals. We cannot exclude that the cisplatin treated mice that showed
a higher sensitivity to the drug and succumbed to its general toxicity could have presented also
severe neurological complications. Thus there is the possibility that we selected cisplatin treated
mice with milder neurological deficits. In light of these considerations, the protection provided by
PF appears even more remarkable.
Taken together, the data presented in our study suggest that PF is also effective in
protecting against central and peripheral neurotoxicity induced by cisplatin and, possibly, other
chemotherapy drugs. More efforts need to be made in understanding the connection between PF,
IGF-1 modulation and a variety of factors that have been proposed to underlie chemobrain, such
as inflammation and neurogenesis. Clinical trials on fasting and cancer treatment will be important
in understanding the clinical potential of PF and similar interventions for the increase of
chemotherapy efficacy and the protection against chemotherapy-related neurological side effects.

36

2.5 Materials and Methods
Mice and Experimental Design
CD-1 mice, females, 8 weeks old, weighing around 20 g, were purchased from Harlan. The animals
were divided into four experimental groups (n=20 / group): 1) untreated (Control group) 2) treated
i.v. with a high dose of cisplatin (12mg/Kg) (Cisplatin group; CDDP), 4) starved for 48 hours
before the cisplatin injection (12 mg/kg) followed by additional 24 hours of starvation after the
chemotherapy treatment (PF Cisplatin group; PF+CDDP).
Three weeks after the cisplatin treatment, when the surviving mice had gained back the initial
weight, the animals were tested with a battery of behavioral tests consisting in Rotarod, Y-maze,
Barnes Maze and rotarod. At the day 2, slightly after the Cisplatin injection, and at day 21, when
the survived mice gained back the initial weight, some mice were sacrificed and brains collected.
The remaining mice were sacrificed at day 42 at the end of the behavioral tests. Experiments were
done in accordance with the Institutional Animal Care and Use Committee (University of Southern
California, Los Angeles, CA) and NIH guidelines.
Behavioral Tests
Y-maze
14-20 mice per group were tested for working memory using a Y-maze. The test started placing
the rodent in one of the arms of the maze. The mouse was allowed to explore freely the
environment for 8 minutes and the total numbers of arm entries, number of defecations and arm
choices were recorded. An arm choice was defined as both forepaws and hind paws fully entering
the arm. Spontaneous alternation behavior (SAB) score was calculated as the proportion of
37

alternations (an arm choice differing from the previous two choices) to the total number of
alternation opportunities
150

Barnes Maze
14-20 mice per group were tested for spatial learning with Barnes Maze. The maze consisted of a
platform with 20 holes (San Diego Instruments). Beneath each hole were placed 20 boxes but only
one was big enough to allow the mouse to enter in (escape box-EB-). Each mouse was randomly
assigned a unique position for the EB that was always located underneath the same hole for a
particular animal. All mice were trained once daily from day 0 to 7 and tested twice daily from
day 1 to 7. During training sessions, the mouse was allowed to freely explore the maze until either
entering the EB or after 2 min elapsed. If the mouse did not enter the EB by itself, it was gently
guided to and allowed to stay in the EB for 30 s. After the training session, mice were tested twice
daily for 7 days. Testing was similar to training, but if after 2 min the mouse did not find the EB,
it was directly returned to its home cage. Success rate (100%, finding the EB within 2 minutes or
zero, not finding the EB within 2 minutes), latency (the time taken to enter the EB), number of
errors (defined as nose pokes and head deflections over any false target hole), deviation from EB
(how many holes away from the EB was the first error) and strategies used by the mouse to locate
the EB was recorded for each testingSearch strategies were classified as random (localized hole
searches separated by crossings through the maze center), serial (systematic hole searches in a
clockwise or counter-clockwise direction) or spatial (navigating directly to the EB with both error
and deviation scores of no more than 3). All measures were averaged from two tests to obtain each
mouse daily value. Retention was assessed by testing each mouse once on day 14
151
.

38

Rotarod Performance Test
10-17 mice per group were tested for motor coordination and balance using an accelerating rotarod
(LE8200, Letica), consisting of a 3 cm diameter drum (15 cm above the base).The mice were
placed on the rod, rotating at an initial speed of 4 rpm that was gradually increased to 40 rpm over
a 5 min session. The time the mouse stayed on the bar was recorded. The best performance of 2
days of training consisting in 3 trials each was plotted
152
.
Detecting Neurogenesis
BrdU injection and Immunohistochemistry
To label dividing cells in vivo, mice were injected i.p. with 5-bromodeoxyuridine (BrdU, 50 mg/kg
body weight, dissolved in 0.9% NaCl ) daily as indicated in experimental scheme. Brain sections
were treated with 0.6% H2O2 in TBS (0.9% NaCl and 0.1 M Tris-HCl pH 7.5) for 30 min to block
endogenous peroxidase. For DNA denaturation, sections were incubated for 2 h in 50%
formamide/2× SSC (0.3 M NaCl and 0.03 M sodium citrate) at 65°C, rinsed for 5 min in 2× SSC,
incubated for 30 min in 2 N HCl at 37°C, and rinsed for 10 min in 0.1 M boric acid pH 8.5. The
samples were rinsed with TBS and then incubated first with TBS/0.1% Triton X-100/3% donkey
serum (TBS
+
) for 30 min and then with rat anti-BrdU antibody (1:400) or anti-doublecortin
antibody (Santa Barbara, 1:200) in TBS
+
overnight at 4°C. For secondary antibody, sections were
either stained with AlexaFluor Anti-Rat 488 or AlexaFluor Anti-goat 586 (1:400) or sections were
rinsed in TBS
+
and incubated for 1 h with biotinylated donkey anti-rat antibody. Sections were
rinsed several times in TBS and avidin-biotin-peroxidase complex (ABC system, Vector
39

Laboratories, Burlingame, CA, USA) was applied for 1 h, followed by peroxidase detection for 5
min (0.25 mg/ml DAB, 0.01% H2O2, 0.04% NaCl)
125
.
Western blotting
Tissue were homogenized in 1x RIPA Buffer, protease and phosphatase inhibitor cocktails using
a dounce homogenizer. Equal amounts of supernatant protein were resolved on SDS-PAGE and
immunoblotted following standard procedures. Protein load was normalized using β-tubulin. Blots
were quantified with ImageJ software.
Statistical analysis
Raw data were analyzed by ANOVA followed by between-group comparisons using the Fisher's
least significant difference test (Barnes Maze) or by pairwise t-test (Rotarod, Fear Conditioning
and ABR). The significance of the difference between groups in survival curve was determined by
using Kaplan–Meier curves and Peto's log-rank test.

40

CHAPTER THREE:
The Effects of Prolonged Fasting on Adult Neurogenesis and its Effects on Age-dependent
Decline of Neurogenesis

3.1 Abstract
Neurogenesis, a process of generating new neurons, occur throughout the lifetime of an
organism, consistently observed in two regions of the brain: sub-granular zone (SGZ) of dentate
gyrus in the hippocampus and sub-ventricular zone (SVZ) of the lateral ventricle. New neurons in
SGZ differentiate and integrate into the local neural network as granule cells, and shown to
participate in forming new memory. However, the rate of neurogenesis declines dramatically with
age, where the older animals have significantly less neural progenitor cells proliferation, neuronal
differentiation, new born neurons, and decline in memory and cognition.
Here we show that bi-monthly cycles of fasting mimicking diet (FMD), administered at
mid-aged mice, extended longevity and caused an improvement in cognitive performance
associated with neural stem cell generation, reduced IGF-1 and PKA activity and elevated
NeuroD1 expression in the hippocampus. The FMD mediated increase in proliferation in dentate
gyrus in the hippocampus was reversed by MAM treatment, a chemical known to inhibit
neurogenesis. Our result suggest that cycles of fasting mimicking diet can reverse age-dependent
decline of neurogenesis and improve learning and memory, at least in part, by regenerating
neural stem cell.

41

3.2 Introduction
Neurogenesis, a process of making new neurons, has been repeatedly observed in two
regions of the brain: sub-ventricular zone (SVZ) of lateral ventricle which differentiate into
interneurons, and sub-granular zone (SGZ) in dentate gyrus of hippocampus, where newborn
granule cells are integrated into the local circuitry
153
.
In hippocampus, newly generated neurons gets added to the existing granular neuron layers
that makes new connections. These newly generated neurons from hippocampus have shown to
participate in formation of new memory hence increase in cognitions as well
127,154-156
.
Unfortunately, rate of hippocampal neurogenesis decline with age. The age-related decline in NPC
proliferation and neuronal differentiation in mice begins at 1-2 months of age and progressively
decreases, at which by 18 month of age, barely present
157
. Some hypothesis regarding age-
dependent decline in neurogenesis include: 1) skewing of differentiation where the newborn cells
in aged mice differentiate more into astrocyte compared to younger mice
158,159
, and 2) decreasing
in surviving NSC cells 3) entering quiescent state, where the number of NSCs (defined by
Nestin+Sox2+ cells) in the SGZ in aged rats did not decrease, but their ability to proliferate greatly
reduced compared to young adult rats
160
, 4) decreasing in NSC proliferation
157
.
The quiescent state regulation of NSCs and neurogenesis can occur at both intrinsic and
extrinsic levels. Intrinsically, it was shown that gene profiles of NSCs isolated from young and old
mice changed with age
161
. NSCs from young and old mice exhibited reduced expression of Nestin
and Musashi, stem cell markers, decreased in expression of Er81 and Dlx2, neural developmental
transcription factors, but increased level of Sox2 compared to embryonic NSC.
NSC from aged mice is known to have limited proliferation and differentiation in vivo;
however, when NSC were cultured in vitro these were reversed and continued to function
42

indicating that extrinsic factors also play an important role in regulating NSCs and neurogenesis
161
.
Inflammation and oxidative stress are two strong inhibitors of neurogenesis, and both are increased
in the hippocampus of aged mice compared to younger mice
12
. Activated microglia can release
pro-inflammatory or anti-inflammatory cytokines, modulating the immune response in support of
or suppression of neurogenesis
148,149
. Classically activated microglia secrete the cardinal pro-
inflammatory cytokines, including tumor necrosis factor-alpha (TNF-alpha) and interleukin-6 (IL-
6), which can inhibit NSCs from differentiating into neurons in favor of astrocyte
147
.
Here we show that bi-monthly cycles of fasting mimicking diet (FMD), administered at
mid-aged mice, extended longevity and caused an improvement in cognitive performance
associated with neural stem cell regeneration, reduced IGF-1 and PKA activity and elevated
NeuroD1 expression in the hippocampus. The FMD mediated increase in proliferation in dentate
gyrus of the hippocampus was reversed by MAM treatment, a chemical known to inhibit
neurogenesis. Our result suggest that cycles of fasting mimicking diet can reverse age-dependent
decline of neurogenesis and improve learning and memory, at least in part, by regenerating neural
stem cell.

43

3.3 Results
Effects of the FMD on lifespan
Control mice had a median lifespan of 25.5 months (Fig. 9a), which was extended to 28.3
months (11% extension) in the FMD group (p < 0.01). The FMD showed an 18% extension effect
at the 75% survival point, but only a 7.6% extension effect on the 25% survival point and no effect
on maximum lifespan (Fig. 9 a, b), indicating that at very advanced ages the 4-day FMD may be
beneficial for certain aspects and detrimental for others. The periodic FMD cycle increased the
median lifespan, but did not affect maximum lifespan.

a.
b.
Figure 9. Periodic FMD cycle increases median lifespan, but does not affect maximum
lifespan
a. Kaplan-Meier survival ocurve for control and FMD cohort (n=46 and 29)
b. Overview of onset of death, 75%, median, 25%, and maximum lifespan in months with
percent change
44

Effects of the FMD on motor coordination, memory and neurogenesis.
Aging is associated with the decline in locomotor and cognitive function
162
.
To test the effect of the diet on cognitive performance we carried out working memory tests
163
at
23 months (Fig. 10a). Mice in the FMD-RF cohort displayed enhanced spontaneous alternating
behavior compared to control mice with no difference in the total number of arm entries (a measure
of activity). Short-term cognitive performance and context-dependent memory were assessed with
the novel object recognition test (Fig. 10b,c)
164
. FMD-RF mice had a higher recognition index
(RI= 0.60) compared to controls (RI= 0.52; p< 0.01) (Fig. 10b). An increase in exploration time
was observed for the FMD-RF mice for the new object, while the total exploration time remained
the same (13.6 ± 0.9 CTRL vs. 13.4 ± 0.9 FM-RF), suggesting enhanced short-term cognitive
performance, not general activity (Fig. 10c).
As a measure of long-term\\o evaluate motor coordination and balance, we measured
spatial learning and memory using the Barnes Maze, a hippocampus-dependent cognitive task
requiring spatial reference memory to locate a unique escape box by learning and memorizing
visual clues (Fig. 10d-g)
165
. During the 7-day training period, FMD-RF mice performed better
with regard to errors, deviation, latency and success rate compared to controls (Fig. 10d-g). At the
retention test, the FMD-RF group displayed better memory indicated by reduced deviation (Fig.
10e). Deviation of control diet mice at day 14 was similar to that at day 1, indicating that these
mice did not remember the box location they had learned by day 7. In contrast, FMD mice
maintained their ability to minimize deviation from the escape box after 14 days (Fig. 10e).
Improvements in the search strategy including the shifting from a random and serial search strategy
to spatial strategies were also observed for the FMD but not the control diet group after day 3-4
45

(Fig. 10h, i). Together, the behavioral tests suggests that FMD cycles improve motor learning and
hippocampus-dependent short- and long-term memory in old animals.

Figure 10. Periodic FMD Cycle Improves Motor Coordination, Hippocampal-Dependent Learning,
and Short- and Long-Term Memory
a. Spontaneous alternation behavior (SAB) at 23 months. n = 11/group.

b. Recognition index at 23 months in the novel object recognition task.

c. Exploration time of the old versus novel object (New, dashed bar). n = 8/group. d.
d-g. Error number (d), deviation (e), latency (f), and success rate (g) in the Barnes maze at 23 months.
n = 7–12/group.
h-i. Control (h) and FMD-RF (i) strategies used to locate escape box.
All data are expressed as the mean ± SEM.

c b
2
a
d e
f g
h
i
46

Adult neurogenesis plays an important role in learning and memory
126,127,166
. To establish
changes in neurogenesis, we measured BrdU incorporation in the subgranular layer of control mice
at the age of 8 weeks, 12 weeks, 6 months and 24 months (Fig. 11b). Similarly to previously
reported data, we observed an age-dependent decline in BrdU incorporation in the dentate gyrus
128
(Fig. 11b). To assess whether the behavioral improvements in the FMD group is associated
with neural regeneration, we measured the proliferative index of DCX
+
immature neurons in the
sub-granular cell layer of the dentate gyrus. BrdU
+
or BrdU
+
DCX
+
double-labeling indicated an
increased proliferation of immature neurons in the FMD group compared to control (Fig. 11c-e).
To investigate mechanisms of FMD induced neurogenesis, we took 6 month-old mice, in which
cellular proliferation in the dentate gyrus is reduced by more than 50% compared to that in 8
weeks-old mice (Fig. 11b), and fed them with a single cycle of a FMD. After 72 hours on the FMD,
we observed a reduction in circulating and hippocampal IGF-1 (Fig. 11f) but increased IGF-1
receptor mRNA expression level in the dentate gyrus region of the hippocampal formation (Fig.
11g). In our previous study we identified a novel IGF-1-PKA pathway in hematopoietic stem cells
which negatively regulated stem cell self-renewal
167
. Micro-dissected dentate gyrus-enriched
samples from FMD mice displayed a major reduction in PKA activity (Fig. 11h), and 2-fold
induction in the expression of NeuroD1 (Fig. 11i), a transcription factor important for neuronal
protection and differentiation
168
.

47

a
b
c
d e
f g h
i
Figure 11. Periodic FMD Cycle Promotes Adult Neurogenesis
a. Hippocampal immunohistochemistry of control (top row) and FMD (bottom row)-fed 23-month-
old animals for BrdU (left, green), DCX (middle, red), and BrdU+DCX+ (right).

b. Age-dependent BrdU+ cell counts in sub-granular zone of the dentate gyrus (DG) (n = 4/group).

c. BrdU + cells in the DG at the end of the FMD (n = 4/group).

d. DCX+ staining in the DG in 23-month-old animals (n = 4/group).

e. Percentage of double-positive BrdU+ DCX+ cells in the DG (n = 4/group).

f. Hippocampal IGF-1 level after FMD (n =3/group).

g. IGF-1R mRNA level in the DG (n = 3/group).

h. PKA activity level in the DG (n = 5/group).

i. NeuroD1 mRNA level in the DG (n = 3/group). All data are expressed as the mean ± SEM

48

In the adult subgranular zone (SGZ), quiescent radial (Type I; Sox2
+
Nestin
+
GFAP
+
) and
non-radial precursors (Type II; Sox2
+
Nestin
+
) proliferate and generate rapidly proliferating
neuroblast (Nestin
-
Sox2
+
DCX
+
). Immature neurons migrate into the granular cell layer and
differentiate into granular neurons in the hippocampus. Neurogenesis, from proliferating non-
radial precursor cells to fully differentiated and functional neurons, takes average of 3-5 weeks
153,169
. In order to investigate if FMD stimulates regeneration of specific types of neuronal
precursor cells, mice were treated with a single cycle of the FMD (Fig. 12a). Although it was
insufficient to conclude that FMD mediated increase in any specific types of the precursor cells,
FMD increased radial glia-like cells (Type I) and nonradial precursor (Type II) neural stem cells
(Fig. 12 b-c, f), immature neurons (Fig. 12 d) and the dendrite covered area (Fig. 12 e) in CD-1
mice. These results in two genetic backgrounds indicate that the FMD promotes neurogenesis in
adult mice.
To investigate whether the FMD mediated increase in hippocampus neurogenesis is
sufficient to enhance hippocampal dependent cognitive function, mice were treated with
methylazoymethanol acetate (MAM), a chemical known to inhibit neurogenesis
170-172
(Fig. 13a).
Mice (female, 10 weeks old) were subjected to MAM treatment (5mg/kg) daily for 14 days and
grouped either into the control diet or the FMD cycles (Fig. 13a). We observed a significant
reduction in number of BrdU
+
proliferating cells in dentate gyrus of MAM treated mice
compared to non-treated mice regardless of whether they were on the control diet or FMD
regimen, indicating that MAM treatment successfully suppressed proliferating cells (Fig. 13c).
However, we did not observe any MAM mediated differences in the Barnes maze in all
parameters (Fig. 13 d-g).

49

Figure 12. FMD increases Type I and Type II neural stem cells.
A) Experimental scheme to assess neural stem cell proliferation and differentiation based on the FMD schedule (see Methods for
details) and different BrdU injection time points in 6 months-old CD1 mice.
B) GFAP+Sox2+ (Type I neural stem cell) in the sub-granular zone (SGZ) in the control group and at the end of FMD (BrdU
schedule A).
C) BrdU+ Sox2+ (Type I and Type II neural stem cell) in SGZ in the control group and at the end of FMD (BrdU schedule B).
D) BrdU+ DCX+ in SGZ in the control group and at the end of FMD (BrdU schedule A).
E) Dendrites (DCX+, schedule C) covered molecular layer.
F) Quantification of GFAP+Sox2+in SGZ.
G) BrdU+Sox2+ in SGZ, increased BrdU incorporation in Sox2+ cells indicating self-renewal/proliferation of neural stem cell in
the FMD cohort (n = 4/group).
H) Quantification of dendritic covered area of the molecular layer 3 weeks after FMD.
I-Q) Quantification of BrdU+ (I- H), DCX + (L- N) and double positive for BrdU+DCX+ over BrdU+ cells (O- Q) at time points
A, B and C. All data are expressed as the mean ± SEM.

50

a
b
c
Error #
1 2 3 4 5 6 14
0
5
10
15
*
Number of errors
Deviation
1 2 3 4 5 6 14
0
2
4
6
8
# of holes from EB
Success Rate
1 2 3 4 5 6 14
0
20
40
60
80
100
Sucess Rate (%)
Latency
1 2 3 4 5 6 14
0
20
40
60
80
100
120
Ctrl
FMD
Ctrl+MAM
FMD+MAM
Latency (sec)
d
e
f
g
51

Figure 10. Periodic FMD Cycle Improves Motor Coordination, Hippocampal-Dependent Learning,
and Short- and Long-Term Memory
a. Experimental scheme to reverse FMD mediated neurogenesis by MAM treatment

b. BrdU+ DCX+ in SGZ in the control, FMD, control+MAM and FMD+MAM group.

c. Quantification of average BrdU+ cells in the dentate gyrus

d-g. Error number (d), deviation (e), latency (f), and success rate (g) in the Barnes maze.
n = 8/group.

All data are expressed as the mean ± SEM.

52

3.4 Discussion
These results in two genetic backgrounds indicate that the FMD promotes neurogenesis
in adult mice. The FMD treatment not only increased number of proliferating cells in the dentate
gyrus, but also increased neuronal differentiation. The FMD mediated increase in proliferation
was reversed upon additional treatment with MAM, a known inhibitor of neurogenesis.
However, the MAM treatment group failed to correlate increase in neurogenesis with enhanced
hippocampal dependent cognitive function, measured by the Barnes maze. Although we
observed a decrease in proliferation in the MAM treated control and FMD cohort, the behavior
result showed there is no MAM-mediated decrease in cognitive function, and the MAM treated
FMD cohort performed similar to that of the FMD alone group. Since MAM treatment was given
to 10 weeks-old mice, where there are still high basal neurogenesis level, it could be that the
MAM treatment did not sufficiently suppressed the neurogenesis to a degree where we could
observe behavior changes. Also, since DR is known to enhance neural plasticity
173,174
, it could be
that the observed phenomena is due to an enhanced plasticity in the FMD cohort regardless
successful inhibition of proliferating cells by MAM treatment.
Notably, the brain did not undergo a measurable weight reduction during the FMD,
indicating that regeneration can also occur independently of the organ size increase after
refeeding. Thus, we hypothesize that alterations in circulating factors, such as the reduction in
IGF-1 levels and PKA signaling, can induce pro-regenerative changes that are both dependent
and independent of the major cell proliferation that occurs during re-feeding, in agreement with
our previous finding in bone marrow and blood cells
175
. Most likely, the increase in IGF-1 and
PKA after refeeding also contributes to the proliferative and regenerative process, raising the
possibility that both low and high levels of these proteins can promote regeneration depending on
53

the timing of their expression. Alternatively, the FMD may increase survival of newly
differentiated neurons, as observed in the dentate gyrus of alternate day-fed rodents
58,176
. The
observed improvements in cognitive performance in the FMD cohort might be affected by a
PKA/CREB dependent regulation of NeuroD1
177
, which is known to increase neuronal survival
and differentiation of hippocampal progenitors
161,170
, enhance functional integration of new
neurons, and alleviate memory deficits in a mouse model of Alzheimer’s disease
178
.

54

3.5 Materials and Methods
Animals
All animal protocols were approved by the Institutional Animal Care and Use Committee
(IACUC) of the University of Southern California. 9-month-old female C57Bl/6 (Charles River)
retired breeders were maintained in a pathogen-free environment and housed in clear shoebox
cages in groups of three animals per cage with constant temperature and humidity and 12 hr./12
hr. light/dark cycle and unlimited access to water. At 16 months of age, animals were randomly
divided (by cage to avoid fighting) into the ad libitum-fed control (CTRL) group and the fasting
mimicking diet (FMD) group. Bodyweight of individual animals was measured routinely every 2
weeks, prior to starting a new FMD cycle. n = 9 mice were measured daily in the FMD and
control cohort for safety evaluation and to establish a weight profile during the FMD cycle. Food
intake was measured daily. To reduce subjective bias, mice were randomly assigned (using the
online Random Number Calculator from GraphPad) to any behavioral and physiological
assessments shortly before any experiment. Mice that appeared weak and/or showed signs of
illness were not included in any experiment. In addition, 6-month-old female CD-1 mice
(Charles River) were used in supplemental experiments to measure adult neurogenesis.
Rodent Diets
Mice were fed ad libitum with irradiated TD.7912 rodent chow (Harlan Teklad) containing 15.69
kJ/g of digestible energy (3.92 kJ/g animal-based protein, 9.1 kJ/g carbohydrate, 2.67 kJ/g fat).
The FMD is based on a nutritional screen that identified ingredients that allow nourishment
during periods of low calorie consumption (Brandhorst et al., 2013). The FMD consists of two
different components designated as day 1 diet and day 2–4 diet that were fed in this respective
55

order. The day 1 diet consists of a mix of various low-calorie broth powders, a vegetable medley
powder, extra virgin olive oil, and essential fatty acids; day 2–4 diet consist of low-calorie broth
powders and glycerol. Both formulations were then substituted with hydrogel (Clear H2O) to
achieve binding and to allow the supply of the food in the cage feeders. Day 1 diet contains 7.67
kJ/g (provided at 50% of normal daily intake; 0.46 kJ/g protein, 2.2 kJ/g carbohydrate,
5.00 kJ/g fat); the day 2–4 diet is identical on all feeding days and contains 1.48 kJ/g (provided at
10% of normal daily intake; 0.01 kJ/g protein/fat, 1.47 kJ/g carbohydrates). An alternative FMD
containing 0.26 kJ/g (0.01 kJ/g protein/fat, 0.25 kJ/g carbohydrates) was supplied for 3 days for
the evaluation of adult neurogenesis. Mice consumed all the supplied food on each day of the
FMD regimen and showed no signs of food aversion. At the end of either diet, we supplied
TD.7912 chow ad libitum for 10 days before starting another FMD cycle. Prior to the FMD,
animals were transferred into fresh cages to avoid feeding on residual chow and coprophagy.
Behavior Test
To prevent starvation-induced hyper-activity (e.g. foraging associated movement (personal
observation SB)), FMD animals were exposed to the behavior tests not earlier than 3 days after
re-feeding.
• Y‐ maze: Short‐ term spatial recognition memory was examined by a spatial novelty
preference task in the Y‐ maze. The Y‐ maze was made of black plexiglas and comprised
three identical arms (50 × 9 × 10 cm), radiating from a central triangle (8 cm on each
side) and spaced 120° apart from each other. The test started placing the rodent in one of
the arms of the maze. The mouse was allowed to freely explore the environment for 8
minutes and the total numbers of arm entries and arm choices were recorded. Arm
choices are defined as both fore-paws and hind-paws fully entering the arm. We used an
56

Accelerating rotarod consisting of a 3 cm diameter rotating rod (suspended 15 cm above
the base) and divided by flanges so that up to 5 mice could be tested simultaneously.
Mice were placed on the rotating rod and the speed gradually increased from 4 rpm to 40
rpm within a 5 min session. The exact speed at which the mice fell off and time that the
mice were able to stay on the bar were recorded. On two consecutive days, the mice were
given three successive trials, for a total of six trials.
• Novel Object Recognition: The novel object recognition test was introduced to assess the
ability of rodents to recognize a novel object in a familiar environment. The test includes
a habituation phase (5 min on day one) and trial phases (5 min each on the second day)
for each mouse. Briefly, in the habituation phase, the mouse was placed into a rectangular
cage (50 x 50 x 40 cm) made of black acryl plexiglas for 5 min on day one without any
object. The testing session comprised two trials with the duration of each trial being 5
min. Mice were always placed in the apparatus facing the wall at the middle of the front
segment. Exploration of the objects is defined as any physical contact with an object
(whisking, sniffing, rearing on or touching the object) as well as positioning its nose
toward the object at a distance of less than 2 cm; however, sitting or standing on top of
the object is not counted toward the exploration time. After the first exploration period,
the mice were placed back in their home cage. To control for odor cues, the open field
arena and the objects were thoroughly cleaned with water, dried, and ventilated for a few
minutes between mice. After a 1 hour delay interval, mice were placed back in the
apparatus for the second trial (T2), but now with two dissimilar objects, a familiar one
and a new one.
57

• Barnes Maze: The maze consists of a platform with 20 holes (San Diego Instruments) and
20 boxes underneath each hole; with only one hole big enough to allow the entire mouse
to enter/hide (escape box, ”EB”). A unique position for the EB was randomly assigned to
each mouse; this position was always located underneath the same hole for a specific
animal. In order to minimize the inter-maze cues, the platform was rotated after each
trial. All mice were trained once daily on days 0 to 7. During training sessions, mice were
allowed to freely explore the maze until either entering the EB or after 2 min time
elapsed. If the mouse did not enter the EB by itself, it was gently guided to and allowed
to stay in the EB for 30 seconds. After the training session, mice were tested twice daily
for 7 days. Testing was similar to training, but if after 2 min the mouse did not find the
EB, it was directly returned to its cage.
Immunohistochemistry
Adult mice were anesthetized with isoflurane and intracardially perfused with saline followed by
4% paraformaldehyde (PFA). The tissues were removed immediately and post-fixed in 4% PFA
for 24 hours and stored in 0.05% sodium azide. Brain was cut sagittally (40 μm), and stored in
0.05% sodium azide solution. Briefly, the sections were rinsed 3 times in phosphate buffered
saline (PBS) for 5 minutes and denatured in 2N HCl at 37°C for 20 minutes. Sections were
neutralized with 0.1M boric acid for 10 minutes and blocked with 2% Normal Donkey Serum
(NDS; Jackson ImmunoResearch) for 1 hour at room temperature. For the evaluation of adult
neurogenesis in the hippocampus, sections were incubated in BrdU (Serotec, 1:200),
doublecortin (Santa Cruz, 1:200), GFAP (Cell Signaling, 1:200), Sox2 (Millipore, 1:100), diluted
in 2% NDS in 0.3% triton overnight at 4°C. The sections were rinsed 3 times in PBS for 10 min,
incubated in anti-rat IgG tagged with Alexa Flour488 and anti-goat IgG tagged with Alexa
58

Flour598 (Invitrogen, 1:400) diluted in 2% NDS. Sections are mounted using Vectashield
(Vector). Free-floating hippocampal (one out of every 6th) were processed for fluorescent
immunohistochemistry. Co-expression was confirmed by fluorescent- and confocal-microscopy.
Digital images were collected on a Leica SL confocal microscope located at the Multiphoton
Imaging Core of the University of Southern California. For quantification, serological counting
methods were used.
Quantitative PCR
Relative transcript expression levels were measured using a SYBR Green-based method. IGF1R
F-CAAGCTGTGTGTCTCCGAAA/R-CTCCGTTGTTCCTGGTGTTT and NeuroD1 F-
ATTGCGTTGCCTTAGCACTT/R-TGCATTTCGGTTTTCATCCT. Average fold changes
were calculated by differences in threshold cycles (Ct) between pairs of samples.

59

CHAPTER FOUR:
Periodic Fasting Mimicking Diet Ameliorate the Effects of Multiple Sclerosis in Mice

4.1 Absract
Various dietary interventions, such as the Swank Diet and the Kousmine Diet - high
polyunsaturated fats and low in animal fats- , have been suggested to improve MS patients’
health status, but these dietary interventions have not been proven to have major effects in the
treatment of multiple sclerosis (MS). We show that weekly cycles of a very low calorie and low
protein fasting mimicking diet (FMD) are effective treatment for experimental autoimmune
encephalomyelitis (EAE), the main murine MS model. Mice treated with cycles of FMD upon
establishment of the disease improved in their disability measures, reversed clinical severity in
all mice, and caused complete recovery in 20% of the animals. These improvements were
associated with increased corticosterone levels, increased Treg cell number, reduced pro-
inflammatory cytokines, TNFα, IFNγ and IL-17, and activation and infiltration of TH1 and TH17
cells, and of antigen presenting cell (APCs). Furthermore, the FMD promoted oligodendrocyte
precursor cell regeneration and re-myelination in axons in both the EAE and cuprizone model, an
autoimmunity-independent MS model. FMD treated Cuprizone mice showed accelerated
remyelination compared to the control diet treated group. Evidence from the cuprizone-induced
model of demyelination, T-cell assays and EAE adoptive transfer experiments indicate that the
observed efficacy of the FMD results from both its in suppressing autoimmunity and in
promoting re-myelination by activation of precursor generated oligodendrocytes.

60

4.2 Introduction
Multiple sclerosis (MS) is an autoimmune disorder that affect central nervous system
(CNS), characterized by an auto-reactive T cell-mediated attack which leads to demyelination,
neurodegeneration, and partial to full paralysis
179-182
. Experimental autoimmune
encephalomyelitis (EAE) has been studied for several decades as an animal model for MS. In the
EAE model, mice are immunized with myelin components (MBP; myelin binding protein or
MOG; myelin oligodendrocyte glycoprotein) with an adjuvant, usually containing inactivated
bacteria that hyper-activate the innate immune system
69,183
, and it leads to activation of myelin-
specific TH1 and TH17 CD4
+
cells which initiate immune response,
182
similar to that of observed
in the MS patients. The activated TH1 and TH17 cells cross the blood brain barrier (BBB) and
migrate into the CNS, where they are re-activated by local antigen presenting cells (APCs) and
promote inflammation
183-186
. This inflammatory process leads to oligodendrocyte death,
demyelination and axonal damage, which eventually causes neurological damages
187,188
.
Although oligodendrocyte precursor cells (OPCs) migrate and repopulate in the sites of MS
lesions, they often fail to differentiate into functional oligodendrocytes
88,97
.
Several disease-modifying drugs are approved for MS treatments: Alemtuzumab, an anti-
CD52 antibody that depletes T-cell and monocytes
98
, Rituximab, anti-CD20 antibody that
depletes B cells
99
, and Natalizumab, anti-α4β1 integrin antibody that prevents CNS infiltration
by immune cells
100
. These drugs are shown to reduce relapse rates by modulating immune
responses; however, their side-effects from a long-term treatment and progression, its accrual of
irreversible neurological disability remains largely unclear, underlining the need for novel
therapeutic strategies
101
. Therefore, much advanced and effective treatments for MS need to
61

reduce immunity while promote oligodendrocyte regeneration in order to restore the myelin
sheath.
Dietary restrictions such as prolonged fasting (PF) or a fasting mimicking diet (FMD)
lasting 2 or more days are effective in increasing protection from chemotherapy drugs; moreover,
PF or FMD have shown to reverses the immunosuppression or immunosenescence effects of
either chemotherapy or aging by a hematopoietic stem cell-based regenerative process
14,15,26,175,189,190
. Other dietary interventions, such as chronic caloric restriction, a ketogenic diet
(KD), and intermittent fasting have been shown to prevent EAE by reducing inflammation and
enhancing neuroprotection when administered prior to disease induction or signs,
191-194
but, the
effects of dietary restriction in forms of FMD as a treatment for EAE or MS has not been
reported. Here we report on the effects of a very low calorie and low protein FMD cycles as a
treatment of MS mouse models, and investigate the mechanisms involved.

62

4.3 Results
FMD cycles reduce disease severity in MOG35-55-induced EAE model
EAE was induced in mice by immunizing with myelin oligodendrocyte glycoprotein 35-
55 (MOG35-55), and examined daily until initial EAE neurological sign (loss of tail tone) was
observed. Upon observation of EAE neurological signs, mice were randomly grouped into three
treatment groups: (1) mice treated with control diet (EAE CTRL), (2) mice treated with FMD
(EAE FMD T) or (3) ketogenic diet (KD) (Fig. 14). We examined the effect of periodic cycles of
FMD lasting 3 days every 7 days (3 cycles) or a ketogenic diet (KD) continued throughout the 30
days. FMD cohort was further divided into semi-therapeutically (EAE FMD(S); FMD treatment
started after 10% of the immunized population showed EAE signs) or therapeutically (EAE
FMD (T).

Figure 14. Representation of the experimental procedure.
Active MOG 35-55 EAE induction is carried out in 10-weeks old female C57BL/6 mice. The initial disease sign is
observed within 8-14 days post-immunization. Subsequently, mice were randomly divided into three groups: control
diet (CD-ad lib), fasting mimicking-diet (FMD- cycles of 3 days of FMD followed by 4 days of control diet) or
ketogenic diet (KD-ad lib.). BrdU (10mg/kg) was injected (i.p.) 7 days post initial EAE symptom.

63

FMD group lost ~15% weight during each FMD cycle but regained back the lost weight and
continued to grow upon re-feeding (Fig. 15a). Both FMD and KD group continuously gained
weight throughout the treatments (EAE FMD - 111.3±2.76%; EAE-KD – 109.6±3.10% of initial
body weight; Fig. 15a). FMD treated mice showed changes in markers associated with stress
resistance or longevity (IGF-1, ketone bodies and glucose; Fig. 15b-d) that are similar to those
observed in PF
26,175
.

Figure 15. FMD treated mice shows similar biological changes observed in previously reported prolonged
fasting biomarkers.
a. The body weight (% of initial body weight) of control diet, FMD or KD of EAE immunized mice for 30 days.
(n=20-25 / group)
b. Serum IGF-1 (ng/mL) of naïve, EAE-CTRL and EAE-FMD at Day 3 (D3 – end of the FMD diet) or Day 14
(D14-end of the re-feeding) (n=4-6 / group; Student t-test EAE-CTRL vs. EAE-FMD ; p < 0.05).
c. Serum Glucose (mg/dL) of naïve, EAE-CTRL and EAE-FMD at Day 3 (D3 – end of the FMD diet) or Day
14 (D14-end of the re-feeding) (n=4-6 / group; Student t-test EAE-CTRL vs. EAE-FMD ; p < 0.05).
d. Serum β-OH Butyrate (mM) of naïve, EAE-CTRL and EAE-FMD at Day 3 (D3 – end of the FMD diet) or
Day 14 (D14-end of the re-feeding) (n=4-6 / group; Student t-test EAE-CTRL vs. EAE-FMD ; p < 0.05).
a b
c d
Naive
0
200
400
600
EAE-CTRL
EAE-FMD
*
Naive
D3 D14
*
Serum IGF-1 (ng/mL)
Naive
0
100
200
300
D3 D14
*
Serum Glucose (mg/dL)
Naive
0.0
0.5
1.0
1.5
2.0
2.5 ***
*
D3 D14
Naive
EAE-CTRL
EAE-FMD
βOH Butyrate (mM)
0 5
70
80
90
100
110
120
10 15 20 25 30
EAE-CTRL
EAE-FMD
EAE-KD
Days after Initial Symptoms
BW (%)
64

Both dietary interventions decreased the disease severity score compared to the control (Fig.
16a). However, the FMD limited the mean EAE severity score in the early stage to below 2 and
reduced it to approximately 1 at later stages, whereas the KD group reached a score above 2
which persisted at the later stages (Fig. 16a). In the semi-therapeutic model, FMD treatment not
only delayed the onset of disease but also lowered the incidence rate (100% EAE CTRL vs.
45.6% EAE FMD(S); Fig. 16b). In the therapeutic model, FMD cycles completely reversed EAE
signs to a clinical score of 0 (no observable signs; Fig. 16c) in 21.7% of the FMD(T) cohort, and
reduced the mean clinical EAE score to below 0.5 in over 50% of the mice (12 out of 23 mice)
after 30 days. Furthermore, FMD cycles also showed beneficial effect on mice that had chronic
EAE, in which FMD treatment started on fully established disease (Fig. 16d). Prior to FMD
treatment, both EAE CTRL and EAE CTRL-FMD cohort had disease severity score (3.19±0.52
EAE CTRL vs. 3.30±0.27 EAE CTRL-FMD; Day 24); however, after 3 cycles of FMD
treatment, we observed a significant reduction in EAE clinical score in EAE CTRL-FMD cohort
compared to EAE CTRL (3.30±0.57 EAE CTRL vs. 2.10±0.89 EAE CTRL-FMD; Day 42; p <
0.05) (Fig. 16d).

65

Figure 16. EAE disease severity score of mice treated with control diet, fasting mimicking diet (either semi-
therapeutically or therapeutically) or ketogenic diet.
a. EAE severity scores (0 indicates no observable disease and 5 indicates moribund/dead) of Control Diet, KD
(Red), semi-therapeutic FMD cycles -FMD(S); Green- or therapeutic FMD cycles-(FMD(T); Blue- (n = 7-
23; mean± S.E.M., *** p<0.001, 2-way ANOVA; Bonferroni post-test).
b. Incidence rate of semi-therapeutically treated FMD and control diet (n=7; *** p<0.001, 2-way ANOVA).
c. EAE severity score of FMD(T) mice that completely reversed the EAE severity and scored 0, no
observable disease (n=5).
d. EAE severity score of EAE CTRL and EAE CTRL-FMD group where FMD treatment started on Day 21,
the chronic EAE disease phase.

a b
c
d
66

Some of the histopathological hallmarks of the EAE and MS is immune cell infiltration and
demyelination in the white and grey matters of spinal cord regions. To investigate whether FMD
treatment changes these phenotypes and thereby result in disease amelioration, we isolated spinal
cords from the control (EAE CTRL) mice and therapeutically FMD treated mice (EAE FMD) at
3 days (D3), 14 days (D14) and 30 days (D30) after initial EAE neurologic signs. Spinal cord
sections from thoracic and lumbar regions were stained with hematoxylin and eosin to visualize
immune cell infiltration (H&E; Fig. 17a) or solochrome cyanine to visualize demyelination (Fig.
17a). To assess demyelination and axonal damage, immunohistochemistry (Fig. 17a) was
performed using antibodies against myelin basic protein (MBP) or dephosphorylated
neurofilaments (SMI-32). At D3, the level of infiltrating immune cells and demyelination was
similar in the EAE CTRL and EAE FMD groups (Fig. 17b). 14 days after the initial signs, spinal
cord sections of EAE CTRL mice displayed severe immune cell infiltration corresponding with
demyelinated lesions, reduced MBP expression and increased SMI-32 expression (Fig. 17b-e).
By contrast, spinal cord sections of EAE FMD mice at D14 displayed significantly reduced
immune cell infiltration and demyelination (Fig. 17b-e). Although MBP staining showed no
difference between EAE CTRL and EAE FMD at D14 (Fig. 17c), neurofilament
dephosphorylation of EAE FMD was reduced compared to the control (Fig. 17e). Overall, these
results suggest that FMD cycles reduce MOG35-55 -induced EAE disease severity in part by
reducing inflammation, and preventing demyelination and axonal damage.

67

Figure 17. FMD treatment reduces infiltrating immune cells and protects from demyelination and axonal
damage (n = 8, mean ± S.E.M., * p < 0.05, *** p<0.01; Student t-test ; Scale bar represents 200 µm).
a. Spinal cord of EAE-CTRL and EAE-FMD mice stained for H&E, solochrome cyanine, MBP (Myelin Basic
Protein) and SMI32
b. Quantification of H&E staining for inflammatory infiltration at D3, D14 and D30.
c. Quantification of solochrome cyanine staining for degree of demyelination at D3, D14 and D30.
d. Quantification of MBP staining at D3, D14 and D30.
e. Quantification of SMI32 staining for axonal damage at D3, D14 and D30

0
1
2
3
4
D3 D14 D30
** **
Degree of Demyelination
(a.u.)
0.0
0.2
0.4
0.6
0.8
EAE-CTRL
EAE-FMD
D3 D14 D30
* *
SMI32
(# of Positive Pixels/mm
2
)
0
10
20
30
40
50
D3 D14 D30
*
MBP
(# of Positive Pixels/mm
2
)
0
1
2
3
4
D3 D14 D30
** **
Inflammatory Infiltration
(a.u.)
b
c d e
a.
68

FMD reduces infiltrating immune cells in the spinal cord by modulating circulating
immune cells
Next, we measured immune/inflammatory markers associated with EAE pathophysiology.
Monocytes, microglia, macrophages and granulocytes play a critical role in EAE disease
pathogenesis by producing pro-inflammatory cytokines/chemokines that promote leukocyte
recruitment and by acting as APC in the CNS
195-198
. D3 and D14 spinal cord sections of control
mice were extensively populated with CD11b
+
cells (Fig. 18a). However, at D14, the FMD mice
displayed a 75% reduction (p< 0.05) in spinal cord-associated CD11b
+
cells compared to the
control (11.7% CTRL vs. 2.8% FMD; Fig. 18a). Since myelin-specific effector T cells migrate
into the CNS and initiate demyelination, we investigated the accumulation of CD4
+
or CD8
+
T
cells in the spinal cord. A large number of CD4
+
T cells were detected in the spinal cord of
control mice throughout the white matter (Fig. 18b). FMD-treated mice had an over 4-fold
reduction (p< 0.01) in CD4
+
T cells at D3 (8.6% CTRL vs. 1.5% FMD; Fig. 18b), which
remained lower even at D14. FMD mice also had reduced CD8
+
T cells (D3: 1.3% CTRL vs.
0.4% FMD; p<0.01; Fig. 18c). To assess the observed reduction in infiltrating immune cells in
the spinal cord is due to FMD mediated system-wide reduction of the immune cell composition
and possibly autoimmune T-cells, we conducted complete blood cell profiling including
circulating white blood cells (WBCs), lymphocytes, monocytes and granulocytes of naive, EAE
CTRL, EAE FMD and EAE FMD:RF (measured 4 days after returning to a standard ad lib diet)
after 3 cycles of FMD regimen (Fig. 18d-g). The FMD treatment temporarily reduced total
WBCs by 40-50% of naïve and EAE CTRL level, and consistently showed reduced number of
lymphocytes, monocytes and granulocytes. Upon returning to the standard ad lib diet (FMD-RF),
all complete blood count profiles returned to either naive level or the EAE CTRL group level
69

with exception of granulocytes. These results suggest FMD mediated white blood cell death and
regeneration (Fig. 18d-g). To confirm that FMD also induces atrophy of circulating immune
cells as seen in prolonged fasting
175
, splenocytes were isolated from EAE CTRL and EAE FMD
and stained with annexinV to detect apoptotic cells. Splenocytes from the EAE FMD cohort had
a significant increase (p < 0.05) in AnnexinV+ splenocytes compared to the EAE CTRL cohort
(42.1 ± 3.0 % EAE CTRL vs. 49.5 ± 3.6 % EAE FMD; Fig. 18h), and this increase in the
apoptotic cells were also higher in CD4+ lymphocytes of the EAE FMD cohort compared to the
EAE CTRL cohort (Fig. 18i). In order to assess whether these apoptotic cells are replaced by
newly generated cells during refeeding period, we treated the EAE CTRL and EAE FMD mice
with BrdU during the re-feeding period (4 injections within 48 hours, 1 mg of BrdU / injection).
Splenocytes were isolated 4 days after the re-feeding of the regular diet, and stained for BrdU.
We observed no difference in levels of BrdU
+
lymphocytes (7.58 ± 2.03% EAE CTRL vs. 7.67 ±
2.65% EAE FMD; Fig. 18 j), but we observed a significantly reduced proliferation of TH1 TH17
CD4
+
T cells (Fig. 18 k). Taken together, these data indicate that the FMD cycles may promote
the death of autoimmune T cells by inducing apoptosis, and then replacing the autoimmune T
cells with the naïve T cells by interfering with proliferation and differentiation of TH1 and TH17
CD4
+
T cells. Although we did not observe a significant difference in BrdU+ lymphocytes, the
FMD mediated regeneration/proliferation of immune cells could have occurred before BrdU
treatment for BrdU injections were given after 12 hours post re-feeding. Another possibility is
that the EAE-dependent stimulation of autoreactive white blood cell proliferation may
comparable to that of the FMD-dependent stimulation albeit it may stimulate proliferations of
different immune-cell types.

70

g
f
e d
c
b
a
i
j
k
h
EAE CTRL
EAE FMD
0
10
20
30
*
Annexin V
(% of CD4+)
Figure 18. FMD reduces infiltrating immune cells in the spinal cord by modulating circulating immune
cells.
a - c. Spinal cord sections (D14) and quantification at D3 and D14 post first sign of EAE
from EAE-CTRL or EAE-FMD for CD11b+ (e) CD4+ (f) CD8+ (g) (at least 6 sections /
mouse; n=4, * p < 0.05, ** p < 0.01, t-test on Day3 or Day14; Scale bar represents 200
µm).

d - g Complete blood profiles of Niave, EAE CTRL, EAE FMD, and EAE FMD-RF of
white blood cell (a), lymphocyte (b), monocyte (c), and granulocyte (d).

h. FACS analysis of annexinV+ lymphocytes and the quantification of EAE CTRL and
EAE FMD on D3 (p < 0.05, student t test).

EAE CTRL
EAE FMD
0
5
10
15
20
BrdU
(% of live cells)
0
5
10
15
*
EAE CTRL
EAE FMD
CD4
+
BrdU
+
%
0
5
10
15
20
*
**
*
WBC Counts (10
9
/L)
0
5
10
15
**
*
Naive
EAE CTRL
EAE FMD
EAE FMD-RF
Lymphocyte Counts (10
9
/ L)
0.0
0.5
1.0
1.5
*
*
Moncotye Counts (10
9
/ L)
0
2
4
6
8 ***
**
**
**
Granulocyte Counts (10
9
/L)
EAE CTRL
EAE FMD
35
40
45
50
55
60
*
Annexin V
(% of gated cells)
71

To further determine how the FMD may prevent T cell infiltration in the spinal cord, we
evaluated its effect on T-cell activation. Splenocytes isolated from control or FMD mice were
characterized by flow cytometry. The numbers of CD4
+
T cells and CD8
+
T cells in EAE CTRL
and EAE FMD mice were similar (Fig. 19a-b), but the ratio of splenic naive (CD44
low
) to
activated (CD44
High
) CD4
+
T cells was increased (p< 0.05) in the FMD group (1.95 CTRL vs.
3.67 FMD; Fig. 19c-d). Moreover, the total number of effector (CD44
High
and CD62L
low
) T cells
was reduced in the FMD compared to the control group, but the ratio of effector (CD44
High
and
CD62L
low
) to memory T (CD44
High
and CD62L
High
) cells did not change in both EAE CTRL and
EAE FMD groups (Fig. 19e). To determine whether the reduced active T-cells and effector T
cells (Teff) numbers are due to an increase in anti-inflammatory regulatory T cells (Treg), we
isolated lymphocytes from draining lymph nodes and spleens of EAE CTRL or EAE FMD mice
and analyzed CD4
+
CD25
+
Treg cells. FMD treatment resulted in near two-fold increase (p<0.01)
in CD4
+
CD25
+
expressing Treg cells (13.6±4.2 EAE CTRL vs. 25.1±4.2 EAE FMD; Fig. 19f). To
determine whether the FMD cycles also reduces the MOG-specific antigen reactive cells, we
used a MHC Tetramer (MOG35-55 /IA
b
) to identify antigen-reactive cells in vivo after a FMD
cycle. CD4
+
MOG35-55 /IA
b +
cells were reduced in the EAE FMD cohort compared to the EAE
CTRL cohort (5.75 ± 0.51 % EAE CTRL vs. 3.83 ± 0.66 % EAE FMD of lymphocytes; * p <
i. FACS analysis of annexinV+ lymphocytes gated for CD4 and the quantification of EAE
CTRL and EAE FMD (p < 0.05, student t test).

j. FACS analysis of BrdU+ splenocytes and the quantification of EAE CTRL and EAE FMD
upon refeeding .

k. Quantification of BrdU+ CD4+ lymphocytes of EAE CTRL and EAE FMD upon
refeeding (p < 0.05, student t test).

72

0.05), indicating that the mice subjected to the FMD cycle showed reduction in the MOG-
reactive lymphocytes (Fig. 19g).

g
CD4
+
MOG
35-55
/IA
b+
EAE CTRL
EAE FMD
0
2
4
6
8
*
% of CD3
+
e f
EAE CTRL
EAE FMD
0
10
20
30
40
**
CD25
+
(%)
EAE CTRL EAE FMD
CD44
CD62L
EAE CTRL
EAE FMD
0
10
20
30
40
CD62L (L)
CD62L (H)
% of CD44
H
CD25
CD4
EAE CTRL EAE FMD
Figure 19. FMD reduces activated CD4
+
T cells and regulatory T cells.
a. Quantification of CD4
+
T cells in splenocytes of naïve, EAE-CTRL and EAE-FMD (n=4-6)
b. Quantification of CD8
+
T cells in splenocytes of naïve, EAE-CTRL and EAE-FMD (n=4-6)
c-d. CD4
+
(c) or CD8
+
(d) gated for CD44
L
or CD44
H
isolated from EAE-CTRL or EAE-FMD mice
and quantification of % splenocyte of CD4
+
CD44
L
(Inactive) or CD4
+
CD44
H
(Active) cells (n=4-7;
values are mean± S.E.M., * p < 0.05, t-test; EAE-CTRL vs. EAE-FMD).
e. CD4
+
gated for CD62L and CD44 isolated from EAE CTRL or EAE-FMD mice and quantification
of CD62L low or high expression of CD4
+
CD44
H
cells (n=4; values are mean± S.E.M.)
73

FMD reduces replaced autoimmune lymphocytes with naive cells
The FMD cohort resulted in a 27.8% reduction (p<0.05) in IFN-γ expressing TH1 cells
(2974.4±708.0 EAE CTRL vs. 2148.1±1396.1 EAE FMD; Fig. 20 a, b) and a 46.5% reduction
(p<0.05) in IL-17 expressing TH17 cells (2535.9±722.0 EAE CTRL vs. 1357.1±256.2 EAE
FMD; Fig. 20 c, d), both known to be the central mediators of EAE pathogenesis. Interestingly,
upon re-feeding of the control diet, the EAE FMD treatment group (EAE FMD:RF) showed a
72.9% reduction (p< 0.05) in IFN-γ expressing TH1 cells (2974.4±708.0 EAE CTRL vs.
805.8±251.5 EAE FMD:RF; Fig. 20 b) and 82.9% reduction (p< 0.05) in IL-17 expressing TH17
cells (2535.9±722.0 EAE CTRL vs. 432.4±117.4 EAE FMD:RF; Fig. 20 d).
To investigate whether the FMD effects on CNS infiltrating immune cells are linked to
suppression of TH1- and TH17-dependent cytokine production (IL-17, IFNγ, and TNF-α), we
analyzed serum from the naive, EAE CTRL and EAE FMD-treated mice (Fig. 20 e-g). We
observed a significant reductions in serum TNF-α (113.3±7.9 EAE CTRL vs. 79.3±10.5 pg/mL
EAE FMD; p<0.001; Fig. 20 e), IFNγ (558.43±124.5 EAE CTRL vs. 296.0±83.4 pg/mL EAE
FMD; p<0.001; Fig. 20 f), and IL-17 (36.8±9.67 EAE CTRL vs. 20.75±4.2 pg/mL EAE FMD;
p<0.01; Fig. 20 g), and serum IL-17, IFNγ, and TNF-α levels remained low until the end of the
experiments (day 25). To identify a potential mediator for the effects of FMD cycles on the
suppression of autoimmune responses, we measured serum corticosterone in mice.
Corticosterone are glucocorticoids secreted by the cortex of the adrenal gland that have broad
e. CD4
+
CD25
+
isolated from EAE CTRL and EAE FMD mice and quantification of CD4
+
CD25
+

cells (n=4; values are mean± S.E.M., ** p < 0.01, t-test; EAE-CTRL vs. EAE-FMD).
f. CD4
+
MOG 35-55/IA
b+
isolated from EAE CTRL and EAE FMD and quantification

74

anti-inflammatory and immunosuppressive actions affecting leukocyte distribution, trafficking,
and death
199-202
. Serum corticosterone levels were elevated in association with the first EAE
signs (EAE Day1; before the treatment). The FMD treatment caused a further increase in
corticosterone levels at D3 compared to those in controls (CTRL vs. FMD; 245.9±38.8 vs.
375.0±94.1 ng/mL; p < 0.01), which returned to EAE basal levels by D14 in both groups (Fig.
20h). These results indicate that the FMD cycles promote Treg differentiation while reducing TH1
and TH17 effector cells and the production of pro-inflammatory cytokines. TH1 and TH17 effector
cells remained low even after the end of the diet, indicating that the FMD cycles may promote
replacement of autoimmune T cells with naive T cells. These effects of the FMD cycles may be
regulated in part by the temporary elevation of corticosterone levels, dampening of T cell
activation, and reduced APCs and T cell infiltration in the spinal cord.

75

a
b
c d
e f
CD4
IFN γ IL17
EAE CTRL EAE FMD
0
50
100
150 ***
***
Serum TNF α (pg/mL)
0
200
400
600
800
***
***
Serum IFN γ (pg/mL)
0
20
40
60
***
**
NAIVE
EAE CTRL
EAE FMD
Serum IL-17 (pg/mL)
g
EAE FMD-RF
0
1000
2000
3000
4000 *
Naive
EAE CTRL
EAE FMD
FMD-RF
**
IFN-y (Cell Counts)
0
1000
2000
3000
4000
*
*
IL17 (Cell Counts)
0
100
200
300
400
500
EAE CTRL
EAE FMD
*
*
Naive
D3 D14
**
Corticosteroid (ng/mL)
h
Figure 20. FMD reduces Th1 and Th17 cells and its cytokine production
a-d. Intracellular staining for either IFNγ (a, b) or IL17(c, d) after gated for CD4
+
of the naïve,
EAE-CTRL, EAE-FMD, EAE-FMD:RF and quantification of cell counts (n=4-7; values are mean±
S.E.M., * p < 0.05; one-way ANOVA, Bonferroni post-test).
e-g. Serum TNFα (e) IFNγ (f), and IL-17 (g) level (pg/mL) in the Naïve, EAE CTRL and EAE
FMD mice on Day3 post first sign of EAE (** p < 0.01, *** p < 0.001; one-way ANOVA,
Bonferroni post-test).
h. . Serum corticosterone level (ng/mL) of before immunization, at the time of the symptom, 3 or
14 days after initial symptom of the control or FMD (n=6; values are mean± S.E.M., * p < 0.05,
**p < 0.01; one-way ANOVA, Bonferroni post-test).

76

Antigen activated splenocytes from mice of EAE-CTRL and EAE-FMD had similar
encephalitogenic effects.
To determine whether immune cells from both EAE CTRL and EAE FMD mice have
similar encephalitogenic effects, we induced EAE by adoptive transfer of splenocytes isolated
from either EAE CTRL or EAE FMD mice after ex vivo re-activation with MOG35-55 peptide and
IL-23. Re-activated splenocytes were then transplanted into naive recipients subsequently
subjected to either the control diet or FMD cycles (Fig. 21a). Injection of splenocytes from either
donor group (EAE CTRL or EAE FMD) into naive recipients -[A; EAE CTRL donor to control
diet recipient] and [C; EAE FMD donor to control diet recipient]- resulted in a similar disease
incidence rate (Fig. 21b), and an equally severe EAE disease severity by day 20 (2.38±0.48 A vs.
2.70±0.75 C; Fig. 21c), indicating that the FMD had no effect on the development and function
of anti-MOG T cells in vivo or ex vivo. However, FMD-treated recipient mice injected with
splenocytes from immunized donor mice [B; EAE CTRL donor to naïve mice with FMD
treatment] displayed delayed disease onset (Day 12 vs. Day 16 post-transfer; Fig. 21b) and a
major reduction in clinical severity scores compared to the controls (2.38±0.48 A vs. 0.75±0.87
B; Fig. 21c). Interestingly, upon in vitro reactivation, both EAE CTRL and EAE FMD had
similar Th1 and Th17 differentiated cells (Fig. 21d-e), which could explain the similar
encephalitogenic effects. Furthermore, the supernatant from ex-vivo splenocyte cultures derived
from EAE FMD- mice showed no difference in TNFα level (110.8±14.9 pg/mL EAE CTRL vs.
97.1±8.4 pg/mL EAE FMD Fig. 21f) but showed a major reduction (p< 0.01) in IFNγ
(342.0±29.8 pg/mL EAE CTRL vs. 46.6±16.6 pg/mL EAE FMD Fig. 21g) and IL-
17(850.5±442.0 pg/mL EAE CTRL vs. 257.4±36.4 pg/mL EAE FMD Fig. 21h).
77

Taken together, these results suggest that T-cell priming, development and function in
response to myelin antigen occurred normally in EAE CTRL and EAE FMD groups, and that the
FMD treatment reduces established autoimmunity.

0 5 10 15 20 25
0
25
50
75
100
*
Days
Incidence Rate (%)
0 5 10 15 20 25
0
1
2
3
4
DONOR RECIPIENT
EAE-CTRL CTRL [A]
EAE-CTRL FMD [B]
EAE-FMD CTRL [C]
Days
Mean clinical EAE score
0
50
100
150
MOG+IL23 + +
*** ***
Ex Vivo Supernatant
TNF α (pg/mL)
0
100
200
300
400
500
**
MOG+IL23 + +
*
Ex Vivo Supernatant
IFN γ (pg/mL)
0
500
1000
1500
EAE CTRL
EAE FMD **
MOG+IL23 + +
***
Ex Vivo Supernatant
IL17 (pg/mL)
a
b c
d e
f

g
h
78

FMD cycles stimulate remyelination by promoting oligodendrocyte regeneration
To assess the effect of the FMD on either OPC or mature oligodendrocytes, sections were stained
with TUNEL, an apoptotic marker, and GST- π
+
or NG2
+
(Fig. 22a). We observed a 5-fold
increase in apoptotic TUNEL
+
cells in the spinal cord from EAE CTRL mice compared to that
from EAE FMD mice (116.6±90.0 EAE CTRLvs. 22.2±6.2EAE FMD cells/section; p < 0.05),
and these TUNEL
+
cells were also positive for NG2
+
(11.2±12.2 EAE CTRL vs. 1.9±1.4
cells/section; p < 0.05; Fig. 22b) or GST- π
+
(18.8±15.2 EAE CTRL vs. 2.9±5.3 EAE FMD
cells/section; p < 0.05; Fig. 22c). To investigate whether the reduced demyelination in FMD
mice may also be related to enhanced oligodendrocyte regeneration, we first carried out a
quantitative image analysis of NG2
+
(oligodendrocyte progenitor cells marker; OPC)

and GST-
π
+
(mature oligodendrocyte marker) in spinal cord sections from control or FMD mice (Fig.
22d). We observed no difference in the number of NG2
+
OPC in the sections from EAE CTRL
and EAE FMD group (Fig. 22e). However, at D14, the number of GST- π
+
oligodendrocytes
Figure 21. Antigen activated splenocyte from mice of EAE-CTRL and EAE-FMD had similar
encephalitogenic effect, but clinical severity was reduced in FMD treated recipient mice.
a. Schematic for the adoptive transfer EAE model.

b. Incidence rate of adoptive transfer EAE (n=5-6 recipient mice / group; * p < 0.05 1-Way
ANOVA, Bonferroni Post-test on Day25).

c. Clinical EAE severity score of adoptive transfer EAE (n=5-6 recipient mice / group; mean±
S.E.M., *** p < 0.001; Two-way ANOVA).

d. Quantification of Th1 differentiation upon ex vivo re-activation with MOG 35-55 and IL23 of
EAE CTRL and EAE FMD

e. Quantification of Th17 differentiation upon ex vivo re-activation with MOG 35-55 and IL23 of
EAE CTRL and EAE FMD
f – h. Quantification of supernatant cytokine levels: TNF-α (f), IFN-γ (g), and IL-17 (h) of ex vivo
re-activation with MOG 35-55 and IL23 of EAE CTRL and EAE FMD

79

was reduced in spinal cord sections from the EAE CTRL but not from the EAE FMD group
compared to the naive controls (886.7±41.6 EAE CTRL vs. 1273±200.3 . EAE FMD cells/area;
p < 0.01; Fig. 22f). To assess whether the normal levels of mature oligodendrocytes in the EAE
FMD group were due to enhanced regeneration and/or differentiation, EAE CTRL or EAE FMD
mice were injected with BrdU at the time of re-feeding (Day10). We observed a major increase
(p< 0.01) in the percentage of cells double positive for BrdU
+
and GST- π
+
in the EAE FMD
group compared to the EAE CTRL (42.9±11.2% EAE CTRL vs. 83.0±13.2% EAE FMD; p <
0.01) suggesting that the FMD promotes oligodendrocyte differentiation from precursor cells
(Fig. 22g). Taken together, these results indicate that the FMD not only stimulates regeneration
of oligodendrocytes but also protects OPC and mature oligodendrocytes from apoptosis.

0
25
50
75
100 **
*
Naive
EAE CTRL
EAE FMD
BrdU
+
GST
+
/ BrdU
+
(%)
0
500
1000
1500 **
*
# GST π/mm
2
**
D3 D14

a b
0
5
10
15
*
# TUNEL
+
NG2
+
Cells
/ section
0
10
20
30
*
Naive
EAE CTRL
EAE FMD
# TUNEL
+
GST π
+
Cells
/ section

D14

D14

c
d
e
0
200
400
600 **
D3 D14
# NG2+ Cells / section
f g
80

To investigate whether the effects of the FMD on the stimulation of oligodendrocyte
regeneration and re-myelination can occur independent of effects on T-cell number and activity,
we used the cuprizone-induced T-cell independent demyelinating mouse model
203,204
. Addition
of 0.2% (w/w) cuprizone to the regular mouse diet for 5-6 weeks results in demyelination in the
corpus callosum followed by spontaneous re-myelination upon re-feeding of regular chow. After
5 weeks on the cuprizone diet, mice were switched to either the control diet or FMD cycles for 5
weeks and some mice were euthanized weekly to assess the degree of myelination by Luxol Fast
staining and GST- π
+
mature oligodendrocyte immunostaining (Fig. 23a, c). As expected, after 5
weeks of the cuprizone diet, a significant reduction in myelin staining was observed in the
corpus callosum compared to that of the naive controls (Fig. 23a, c). After 2 FMD cycles, the
FMD treated group had increases in myelin staining and in the number of GST- π
+
mature
oligodendrocytes compared to the control diet (Fig. 23b, d). However, at later time points, we
did not observe differences between spontaneous re-myelination of the control and FMD mice
(Fig. 23 c, d). These results indicate that the FMD promotes OPC-dependent regeneration and
Figure 22. . The FMD cycles protect the spinal cord from loss of oligodendrocyte precursor cells and
oligodendrocytes.
a. Spinal cord sections isolated at D14 stained with TUNEL(green – apoptotic marker) and GST-π (red
– matured oligodendrocyte marker )

b. Quantification of apoptotic oligodendrocyte precursor cells -TUNEL
+
NG2
+
(oligodendrocyte
precursor)-.

c. Quantification of apoptotic oligodendrocytes -TUNEL
+
GST-π
+
-.

d. Spinal cord section isolated at D14 and stained with BrdU and GST-π

e. Quantification of NG2
+
cells in the spinal cord collected at D3 and D14

f. Quantification of GST-π
+
cells in the spinal cord collected at D3 and D14

Quantification of BrdU and GST-π
+
double positive cells in the spinal cord collected at D14
81

accelerates OPC-differentiation into oligodendrocytes while enhancing re-myelination
independently of its modulation of the inflammatory response.

a

b
0
25
50
75
100
Weeks after Cuprizone Withdrawal
Week1 Week3 Week5
Naive
Cup. (5 weeks)
Cup + CTRL
Cup + FMD
Luxol Fast Staining
% Ctrl Pixel
*
**
c
0
25
50
75
100
Naive
Cup (5 weeks)
Cup + CTRL
Cup + FMD
Week 1 Week 3 Week 5
Weeks after Cuprizone Withdrawal
GST π
+
/ DAPI in CC
(%) of Naive
***
**
*
*
d
Figure 23. The FMD cycles accelerated remyelination level in the cuprizone demyelination model.
a. Section from the corpus callosum region of the cuprizone treated brains stained with luxol fast blue
of naïve, week0 (post cuprisone diet), week2 of control diet, and week2 of FMD cycles

b. Sections from corpurs callosum region of the cuprizone treated brains stained with GST-π

c. Quantification of myelination level (% of luxol fast staining) of cuprisone treated mice after week1,
week3, and week5 of either control diet or FMD cycles.

d. Quantification of oligodendrocyte number at the corpus callosum of cuprisone treated mice after
week1, week3, and week5 of either control diet or FMD cycles.

82

4.4 Discussion
We demonstrate a dual role for FMD cycles in the treatment of EAE in mice: (1) a
oligodendrocyte precursor-dependent regeneration/re-myelination, and 2) the reduction of
microglia/monocytes and of T cells contributing to the autoimmunity and encephalomyelitis.
Previous studies have investigated the effects of chronic caloric restriction (66% or 33%
reduction in Lewis rat or 40% in mouse) or alternate day feeding in the prevention of EAE but
therapeutic dietary interventions in MS have not been reported
191,192,194
. 3 days of a fasting
mimicking diet (FMD) administered every week were effective in ameliorating EAE symptoms
in all mice and completely reversing the clinical course for twenty percent of animals after the
onset of EAE signs. By contrast, the KD had more modest effects and did not reverse EAE
progression.
FMD treatment increased Treg cells, and caused a major reduction in the number of IFN-γ
producing TH1 and IL-17 producing TH17 cells, which are known to play a central role in EAE
pathogenesis
183
. These results support a FMD-mediated anti-inflammatory effect by shifting T-
cell polarity, possibly involving the up-regulation of AMPK or down-regulation of mTORC1,
key enzymes which sense nutrient availability and dictate cell fate
205
. It was shown that
mTORC1 couples immune signals and metabolic programming to establish Treg-cell function
206
.
In fact, treatment with rapamycin (inhibitor of mTORC1) or metformin (activator of AMPK)
attenuates EAE symptoms by modulating effector and regulatory T cells and restricting the
infiltrating mononuclear cells into the CNS
206-208
. FMD treatment could interfere with T-cell
proliferation, differentiation, and with recruitment of other immune cells, resulting in decreased
recruitment at lesion sites (Fig. 6). Some of the effects of FMD may be due to endogenous
glucocorticoid production. Glucocorticoids are used as the treatment in MS, but are generally
83

administered in short bursts and can be associated with dose related adverse effects including
osteoporosis, and metabolic syndrome
209-212
. The FMD may avoid these adverse effects by
promoting additional endogenous responses. Importantly, data from our animal studies indicate
that FMD cycles also caused beneficial effects in EAE that were related to activation of
oligodendrocyte precursor cells and myelin regeneration, as demonstrated by accelerated re-
myelination rate in the cuprizone model.
Finally, we found that administration of the FMD and KD in MS patients was safe, well
tolerated and resulted in high adherence rates. This pilot clinical feasibility trial revealed
potentially positive effects on HRQOL based on self-reports for both FMD and KD. It’s
interesting that the observed positive effects of the different diets occurred at different time
points. The time shift of the effect of the FMD and KD diets indicate a much more rapid effect of
the single FMD cycle in contrast to the KD. Thus, FMD cycles similar to those tested in mice, or
a combined FMD/KD intervention should be tested further for therapeutic efficacy.
In summary, periodic FMD cycles in multiple murine MS models were effective in
ameliorating disease signs, pathology and were associated with effects on autoimmunity,
inflammation and neuro-regeneration, all of which are likely to contribute to the attenuation and
in a percent of mice reversal of the autoimmune encephalomyelitis. The preliminary clinical data
from RRMS patients indicate that similar dietary interventions are feasible, can be safely
performed, and have potential to increase the HRQOL.
84

4.5 Materials and Methods
MS mouse model.
EAE Immunization
Active Immunization
C57Bl/6 (10-week-old female) mice were purchased from The Jackson Laboratory. Mice
were immunized subcutaneously with 200 µg myelin oligodendrocyte glycoprotein
peptide (MOG35-55; GenScript) mixed 1:1 with supplemented complete Freund’s
Adjuvant followed by 200 ng of mouse pertussis toxin (PTX; List Biological
Laboratories) i.p. at the time of immunization and at day 2.
Adoptive Immunization
Spleens from active immunized mice were isolated and RBC were lysed. Spleen cells are
cultured in presence of MOG35-55 (20 µg/mL) with rmIL-23 (20 ng/mL) for 48 hours.
Cells were collected and re-suspended in PBS and 15 million cells were injected intra
venous. Clinical EAE was graded on a scale of 1-5 by established standard criteria as
follows: score 0, no observable disease; score 1, complete loss of tail tone; score 2, loss
of righting; score 3, one hind limb paralysis; score 4, both hind limbs paralysis; score 5,
moribund/dead.
Cuprizone Demyelinating Model
C57BL/6 mice (5-weeks-old-female) were purchased from Charles River. Mice were fed
0.2% w/w cuprizone (bis-cyclohexanone oxaldihydrazone, Sigma-Aldrich) mixed into a
ground standard rodent chow (Harlan). Curprizone diet was maintained for 5 weeks;
thereafter mice were put on a normal chow or FMD cycles (3 days of FMD followed by 4
85

days of regular chow) for another 4 weeks. At different time points (0, 1, 2, 3 and 4 weeks
after cuprizone withdrawal), animals were euthanized. Brains were perfused with 4% PFA,
extracted, fixed in 4% PFA, paraffin-embedded, sectioned and stained as described in the
immunohistochemistry section.

Special Diet
Fasting Mimicking Diet.
Mice were fed ad lib with irradiated TD.7912 rodent chow (Harlan Teklad), containing 15.69 kJ/g
of digestible energy (animal-based protein 3.92 kJ/g, carbohydrate 9.1 kJ/g, fat 2.67 kJ/g). The
experimental FMD is based on a nutritional screen that identified ingredients which allow high
nourishment during periods of low calorie consumption
80
. The FMD diet consists of two different
components designated as day 1 diet and day 2-3 diet that were fed in this order respectively. Day
1 diet, mouse consume about 50% of their normal caloric intake containing 7.87 kJ/g. The day 2-
3 diet, mouse consume about 10% of their normal caloric intake containing 1.51 kJ/g. Day 1 and
day 2-3 diets were supplied to the FMD cohort with the average intake of the ad lib control group
(~4 g) every two weeks. On average, mice consumed 11.07 kJ (plant-based protein 0.75 kJ,
carbohydrate 5.32 kJ, fat 5 kJ) on each day of the FMD regimen. Mice consumed all the supplied
food on each day of the FMD regimen and showed no signs of food aversion. After the end of the
day 2-3 diet, we supplied TD.7912 chow ad lib for 4 days before starting another FMD cycle.
Mouse ketogenic diet was purchased from BioServ (F3666). Prior to supplying the FMD or KD,
animals were transferred into fresh cages to avoid feeding on residual chow and coprophagy.
Post-FMD Re-feeding
86

Mice were fed ad lib with irradiated TD.7912 rodent chow (Harlan Teklad) – same diet as used
for control chow.
BrdU Injection.
BrdU (Sigma) solution is prepared in PBS (10 mg/mL stock solution) and intra peritoneal
injected according to experiment schedule (50 mg/kg).
Immunohistochemistry and antibodies.
Spinal cords were isolated from mice using standard protocol. Briefly, spinal cords were fixed in
4% paraformaldehyde (PFA) overnight followed by incubation in 0.5% sodium azide at 4 °C
overnight. Spinal cords were isolated from mice and fresh frozen sections (5 µm) were obtained
from the USC Histology Core. Spinal cords were fixed in 4% PFA, dehydrated in sequential
concentrations of ethanol, cleared in xylene, and infiltrated and then embedded with paraffin.
Tissue was transversely cut at 9 µm sections. Sections were de-paraffinized with xylene, and
then hydrated with water. Antigen retrieval was performed by placing sections in 0.1M citric
acid pH 6, and boiled for 4 minutes in the microwave. Slides were allowed to cool, and then
sections were coated with blocking solution (5% horse serum and 0.1% triton-X in PBS) for 1
hour at RT. Blocking solution was removed, and sections were then coated with mouse anti-
SMI32 (abcam, ab28029, 1:1000), rabbit anti-MBP (zymed, 18-0038, 1:200), goat anti-GSTπ
(Abcam, ab53943, 1:200), rabbit anti-NG2 (Millipore, AB5320, 1:100) and rat anti-BrdU
(Serotec, MCA2060, 1:200) diluted in blocking solution, overnight at 4° C. Fresh frozen sections
were air-dried and fixed in 4% PFA for 15 min. and washed 3 times in wash buffer (PBS
containing 0.5% Tween-20). Sections were permeablized in 1% NP40 in PBS for 15 min and
washed in wash buffer and blocked in 5% normal donkey serum in 0.4% Triton for 1 hour and
incubated with either anti- CD4 (eBioscience, 14-0041-86, 1:100) CD8 (abcam, ab22378, 1:100),
87

CD11b (Serotec, MCA711G, 1:200) overnight in 4°C. The next day, sections were washed 3
times for 15 minutes in PBS, and then coated with donkey anti-mouse Alexafluor 647 (abcam,
ab150103, 1:500) and donkey anti-rabbit Alexafluor 488 (abcam, ab150069, 1:500) in PBS for
90 minutes at RT. Sections were again washed in PBS, and then covered with Fluorshield
Mounting Medium with DAPI (abcam, ab104139 or Vector Labs, H-1500). Apoptotic cells were
detected using In Situ Cell Death Kit (Roche, 11684795910) following the manufacturer’s
protocol.
Quantification and Analysis.
Stained tissues were imaged and each image from the same spinal cord sections were stitched
using ImageJ Fiji (SOURCE). At least 8 stitched spinal cord sections were quantified using
Image J (National Institute of Health) and cells were counted. Images were acquired and
analyzed using a Nikon Eclipse 90i fluorescent and bright field microscope, along with
Metamorph 7.7 software. SMI32 and MBP were analyzed using the Metamorph software. First,
raw images were digitally contrasted in the same way for each stain within each time point. The
digitally contrasted images were duplicated, and the region of interest was manually drawn on
the image. Next, each image was threshold equally for each stain, and the region statistics tool
was used to calculate the number of positive fluorescent pixels located within the region of
interest.
Demyelination Scoring.
Myelin was stained, using 9 μm sections, with solochrome cyanine as previously described
(Kiernan, 1984). Briefly, sections were stained for 90 minutes with Eriochrome Cyanine R
(Sigma; St. Louis, MO). Sections were washed in tap water, and then differentiated for 30 s in
88

10% iron (III) chloride (Sigma). Next, sections were counterstained with Van Gieson's stain for 2
min, washed, dehydrated in sequential concentrations of ethanol, cleared in xylene, and cover
slipped. Stained tissue was manually scored for the amount of demyelination on a scale from 0-5
(0=no demyelination, 1=one region of subpial white matter affected, 2=multiple regions of
subpial white matter affected, 3=multiple regions of white matter affected beyond subpial region,
4=parenchymal region affected, less than half of total white matter, 5=parenchymal region
affected, more than half of total white matter).
H&E Scoring.
Stained tissue was manually scored for the amount of inflammatory infiltration on a scale from
0-5 (0=no infiltration, 1=a few infiltrates in the leptomeninges, 2=organization of infiltrates
around blood vessels, 3=extensive perivascular cuffing with extension into the underlying
parenchyma, 4=infiltration in the parenchymal region, less than half of total white matter,
5=infiltration in the parenchymal region, more than half of total white matter).
In vivo T-cell assay.
C57B/6 (10-weeks-old female) mice were injected with MOG and pertussis toxin to induce EAE
as descried in the previous section. Mice usually developed symptoms of EAE by day 8-10, with
the peak symptom appearing around day 11-13. Mice were sacrificed on Day 13 and spleens
were removed. Blood was collected for sera. Spleens were teased apart to single cell
suspensions, red blood cells were lysed and splenocytes were isolated by centrifugation. Cells
were suspended in Dulbecco’s modified eagle medium (Gibco) supplemented with 10% fetal
bovine serum and counted. Cells were then plated at 2 x 10
5
cells per well on a 96-well plate and
treated with either 20 ug/ml MOG peptide or 10 ng/ml phorbol myristate acetate (PMA) and 300
89

ng/ml ionomycin for 48 h to stimulate cytokine production. Cytokine secretion was blocked
during the last 5 h by treatment with monensin. Supernatant was collected for ELISAs. Cells
were stained for flow cytometry using antibodies against CD4 (eBioscience, 140041896), CD8
(eBioscience, 100707), CD44 (eBioscience, 103029) and CD62L (eBioscience, 170621). Flow
cytometry analysis was done by the USC Immunology Core and data was analyzed using the
FlowJo software (Tree Star).
Serum physiological biomarkers and cytokines.
Prior to blood collection, mice were withheld food for up to 4 hours. Serum was stored at -80°C.
β-hydroxybutyrate was measured with a colorimetric assay kit following the manufacturer’s
protocol (#700190, Cayman Chemical). IGF-1 (R&D), TNF-α (R&D), IFN-γ (R&D), and IL-17
(R&D) was measured following the manufacturer’s protocol.
Statistical Analysis.
All data are expressed as the mean ± SEM. For mice, all statistical analyses were two-sided and P
values <0.05 were considered significant (* p<0.05, ** p<0.01, *** p<0.001). Differences among
groups were tested either by Student t-test comparison or one-way ANOVA followed by
Bonferroni post-test using GraphPad Prism v.5. Competing risk analysis was performed to assess
statistical differences in the rate of deaths.
Animal use statement.
All experiments were performed in accordance with approved Institutional Animal Care and Use
Committee (IACUC) protocols of University of Southern California

90

CHAPTER FIVE:
Conclusion
5.1 Summary of Findings
Dietary restriction affects a system wide changes that promote metabolic shift and
regeneration of the tissue specific stem cells. The beneficial effects of DR also extend to the
maintenance of brain including protection and rejuvenation.
In chapter 2, we demonstrated that DR in forms of PF can protect mice from cisplatin
induced neurotoxicity. PF+CDDP groups showed increase in survival rate compared to the
CDDP group. Moreover, PF+CDDP group were protected from CDDP induced cognitive and
motor coordination decline. We showed that the PF mediated CNS protection and enhanced
cognitive and motor coordination are, at least in part, mediated through reduced inflammation
and enhanced hippocampal proliferation.
In chapter 3, we demonstrated that the cycles of fasting mimicking diet protected mice
from age-associated decline in cognitive performances by promoting adult neurogenesis. FMD
treatment started at 18 months old showed enhanced proliferating cells in the dentate gyrus of the
hippocampus. The increase in proliferation was observed in both Type I and Type II neural stem
cells and FMD treatment enhanced neuronal differentiation. FMD treated mice had reduced IGF-
1 and PKA activity levels and an increase in NeuroD1 expression level in the hippocampus,
similar to that of observed in PF mediated HSC regeneration model. Furthermore, we confirmed
that the FMD mediated increase in proliferating cells in dentate gyrus was reversed in mice
treated with MAM, a neurogenesis inhibitor; however, the reduced neurogenesis was not in
accordance with the cognitive performance. We could not observe any MAM effects in the
cognitive tests, where FMD and MAM treated FMD group performed similarly in the Barnes
91

Maze. However, we also have to consider that DR mediated enhancement of neural plasticity.
FMD mediated reversal of age-dependent decline in cognitive performance may not solely due to
an increase in neurogenesis, but also an increase or enhanced neural plasticity and connectivity.
In chapter 4, we tested an efficacy of the FMD as a possible intervention to treat multiple
sclerosis, an autoimmune neurodegenerative disease. We showed that treatment with FMD
induce system wide atrophy in circulating lymphocytes, which correlated with reduced
infiltrating immune cells in the spinal cord in the FMD cohort compared to control cohorot. We
further confirmed that FMD-RF leads to increase in proliferation of naïve lymphocytes.
Moreover, the FMD treatment lead to reduced immune response by reducing CD4 T cell
subtypes and dendritic cells, while increasing the number of T regulatory cells compared to the
control. Using two different models, we showed that the FMD treatment lead to the protection of
oligodendrocytes and induced oligodendrocyte precursor dependent oligodendrocyte generation.
This increase in number of oligodendrocyte were correlated with an accelerated remyelination in
the FMD cohort compared to the control cohort.
We show that the FMD treatment is a remarkably potent intervention to enhance CNS
protection and to stimulate rejuvenation by increasing neural stem cell regeneration. Taken
together, the FMD intervention would provide very easy and cost-effective intervention to treat
neurodegenerative diseases.
92

References

1 Morrison, J. H. & Hof, P. R. Life and death of neurons in the aging brain. Science 278, 412-419
(1997).
2 Stone, D. J. et al. Astrocytes and microglia respond to estrogen with increased apoE mRNA in
vivo and in vitro. Experimental neurology 143, 313-318, doi:10.1006/exnr.1996.6360 (1997).
3 Seigel, D. Age-related macular degeneration. The New England journal of medicine 359, 1735;
author reply 1736, doi:10.1056/NEJMc081470 (2008).
4 Moorthi, P., Premkumar, P., Priyanka, R., Jayachandran, K. S. & Anusuyadevi, M. Pathological
changes in hippocampal neuronal circuits underlie age-associated neurodegeneration and
memory loss: positive clue toward SAD. Neuroscience 301, 90-105,
doi:10.1016/j.neuroscience.2015.05.062 (2015).
5 Liu, J. et al. Microglial activation and age-related dopaminergic neurodegeneration in MPTP-
treated SAMP8 mice. Brain research 1345, 213-220, doi:10.1016/j.brainres.2010.05.043 (2010).
6 Akiyama, H. et al. Inflammation and Alzheimer's disease. Neurobiology of aging 21, 383-421
(2000).
7 Blumenthal, H. T. Fidelity assurance mechanisms of the brain with special reference to its
immunogenic CNS compartment: their role in aging and aging-associated neurological disease.
The journals of gerontology. Series A, Biological sciences and medical sciences 52, B1-9 (1997).
8 Biessels, G. & Gispen, W. H. The calcium hypothesis of brain aging and neurodegenerative
disorders: significance in diabetic neuropathy. Life sciences 59, 379-387 (1996).
9 Sohal, R. S. & Weindruch, R. Oxidative stress, caloric restriction, and aging. Science 273, 59-63
(1996).
10 McEwen, B. S. Stress and the aging hippocampus. Frontiers in neuroendocrinology 20, 49-70,
doi:10.1006/frne.1998.0173 (1999).
11 Stanta, G. [The molecular basis of cellular aging]. Pathologica 89, 566-567 (1997).
12 Lee, C. K., Weindruch, R. & Prolla, T. A. Gene-expression profile of the ageing brain in mice.
Nature genetics 25, 294-297, doi:10.1038/77046 (2000).
13 Weindruch, R., Walford, R. L., Fligiel, S. & Guthrie, D. The retardation of aging in mice by dietary
restriction: longevity, cancer, immunity and lifetime energy intake. The Journal of nutrition 116,
641-654 (1986).
14 Longo, V. D. & Mattson, M. P. Fasting: molecular mechanisms and clinical applications. Cell
metabolism 19, 181-192, doi:10.1016/j.cmet.2013.12.008 (2014).
15 Fontana, L., Partridge, L. & Longo, V. D. Extending healthy life span--from yeast to humans.
Science 328, 321-326, doi:10.1126/science.1172539 (2010).
16 Raffoul, J. J., Guo, Z., Soofi, A. & Heydari, A. R. Caloric restriction and genomic stability. The
journal of nutrition, health & aging 3, 102-110 (1999).
17 Maeda, H. et al. Nutritional influences on aging of Fischer 344 rats: II. Pathology. Journal of
gerontology 40, 671-688 (1985).
18 Spaulding, C. C., Walford, R. L. & Effros, R. B. Calorie restriction inhibits the age-related
dysregulation of the cytokines TNF-alpha and IL-6 in C3B10RF1 mice. Mechanisms of ageing and
development 93, 87-94 (1997).
19 Longo, V. D. & Finch, C. E. Evolutionary medicine: from dwarf model systems to healthy
centenarians? Science 299, 1342-1346, doi:10.1126/science.1077991
299/5611/1342 [pii] (2003).
20 Lee, C., Raffaghello, L. & Longo, V. D. Starvation, detoxification, and multidrug resistance in
cancer therapy. Drug Resist Updat 15, 114-122, doi:S1368-7646(12)00005-2 [pii]
93

10.1016/j.drup.2012.01.004 (2012).
21 Mair, W. & Dillin, A. Aging and survival: the genetics of life span extension by dietary restriction.
Annual review of biochemistry 77, 727-754, doi:10.1146/annurev.biochem.77.061206.171059
(2008).
22 Johnson, T. E. et al. Gerontogenes mediate health and longevity in nematodes through
increasing resistance to environmental toxins and stressors. Exp Gerontol 35, 687-694,
doi:S0531-5565(00)00138-8 [pii] (2000).
23 Haigis, M. C. & Yankner, B. A. The aging stress response. Mol Cell 40, 333-344, doi:S1097-
2765(10)00778-1 [pii]
10.1016/j.molcel.2010.10.002 (2010).
24 Smith, E. D. et al. Age- and calorie-independent life span extension from dietary restriction by
bacterial deprivation in Caenorhabditis elegans. BMC developmental biology 8, 49, doi:1471-
213X-8-49 [pii]
10.1186/1471-213X-8-49 (2008).
25 Narasimhan, S. D., Yen, K. & Tissenbaum, H. A. Converging pathways in lifespan regulation.
Current biology : CB 19, R657-666, doi:10.1016/j.cub.2009.06.013 (2009).
26 Brandhorst, S. et al. A Periodic Diet that Mimics Fasting Promotes Multi-System Regeneration,
Enhanced Cognitive Performance, and Healthspan. Cell metabolism 22, 86-99,
doi:10.1016/j.cmet.2015.05.012 (2015).
27 Fabrizio, P. & Longo, V. D. The chronological life span of Saccharomyces cerevisiae. Aging cell 2,
73-81 (2003).
28 Jiang, J. C., Jaruga, E., Repnevskaya, M. V. & Jazwinski, S. M. An intervention resembling caloric
restriction prolongs life span and retards aging in yeast. FASEB journal : official publication of the
Federation of American Societies for Experimental Biology 14, 2135-2137, doi:10.1096/fj.00-
0242fje (2000).
29 Klass, M. R. Aging in the nematode Caenorhabditis elegans: major biological and environmental
factors influencing life span. Mechanisms of ageing and development 6, 413-429 (1977).
30 Kaeberlein, T. L. et al. Lifespan extension in Caenorhabditis elegans by complete removal of
food. Aging cell 5, 487-494, doi:10.1111/j.1474-9726.2006.00238.x (2006).
31 Lee, G. D. et al. Dietary deprivation extends lifespan in Caenorhabditis elegans. Aging cell 5, 515-
524, doi:10.1111/j.1474-9726.2006.00241.x (2006).
32 Hosono, R., Nishimoto, S. & Kuno, S. Alterations of life span in the nematode Caenorhabditis
elegans under monoxenic culture conditions. Experimental gerontology 24, 251-264 (1989).
33 Chapman, T. & Partridge, L. Female fitness in Drosophila melanogaster: an interaction between
the effect of nutrition and of encounter rate with males. Proceedings. Biological sciences / The
Royal Society 263, 755-759, doi:10.1098/rspb.1996.0113 (1996).
34 Wyllie, J. P., Chippindale, A. J. & Cant, A. J. Miliary tuberculosis and symptomatic hypercalcemia.
The Pediatric infectious disease journal 12, 780-782 (1993).
35 Goodrick, C. L., Ingram, D. K., Reynolds, M. A., Freeman, J. R. & Cider, N. Effects of intermittent
feeding upon body weight and lifespan in inbred mice: interaction of genotype and age.
Mechanisms of ageing and development 55, 69-87 (1990).
36 Miller, R. A. et al. Methionine-deficient diet extends mouse lifespan, slows immune and lens
aging, alters glucose, T4, IGF-I and insulin levels, and increases hepatocyte MIF levels and stress
resistance. Aging cell 4, 119-125, doi:10.1111/j.1474-9726.2005.00152.x (2005).
37 Weindruch, R. & Walford, R. L. Dietary restriction in mice beginning at 1 year of age: effect on
life-span and spontaneous cancer incidence. Science 215, 1415-1418 (1982).
94

38 Holehan, A. M. & Merry, B. J. Lifetime breeding studies in fully fed and dietary restricted female
CFY Sprague-Dawley rats. 1. Effect of age, housing conditions and diet on fecundity. Mechanisms
of ageing and development 33, 19-28 (1985).
39 Zimmerman, J. A., Malloy, V., Krajcik, R. & Orentreich, N. Nutritional control of aging.
Experimental gerontology 38, 47-52 (2003).
40 Goodrick, C. L., Ingram, D. K., Reynolds, M. A., Freeman, J. R. & Cider, N. L. Effects of intermittent
feeding upon growth and life span in rats. Gerontology 28, 233-241 (1982).
41 Yu, B. P., Masoro, E. J., Murata, I., Bertrand, H. A. & Lynd, F. T. Life span study of SPF Fischer 344
male rats fed ad libitum or restricted diets: longevity, growth, lean body mass and disease.
Journal of gerontology 37, 130-141 (1982).
42 Bodkin, N. L., Alexander, T. M., Ortmeyer, H. K., Johnson, E. & Hansen, B. C. Mortality and
morbidity in laboratory-maintained Rhesus monkeys and effects of long-term dietary restriction.
The journals of gerontology. Series A, Biological sciences and medical sciences 58, 212-219
(2003).
43 Weindruch, R. & Sohal, R. S. Seminars in medicine of the Beth Israel Deaconess Medical Center.
Caloric intake and aging. The New England journal of medicine 337, 986-994,
doi:10.1056/NEJM199710023371407 (1997).
44 Zhu, H., Guo, Q. & Mattson, M. P. Dietary restriction protects hippocampal neurons against the
death-promoting action of a presenilin-1 mutation. Brain research 842, 224-229 (1999).
45 Mouton, P. R., Chachich, M. E., Quigley, C., Spangler, E. & Ingram, D. K. Caloric restriction
attenuates amyloid deposition in middle-aged dtg APP/PS1 mice. Neuroscience letters 464, 184-
187, doi:10.1016/j.neulet.2009.08.038 (2009).
46 Wang, D. S. et al. Decreased neprilysin immunoreactivity in Alzheimer disease, but not in
pathological aging. Journal of neuropathology and experimental neurology 64, 378-385 (2005).
47 Patel, N. V. et al. Caloric restriction attenuates Abeta-deposition in Alzheimer transgenic models.
Neurobiology of aging 26, 995-1000, doi:10.1016/j.neurobiolaging.2004.09.014 (2005).
48 Halagappa, V. K. et al. Intermittent fasting and caloric restriction ameliorate age-related
behavioral deficits in the triple-transgenic mouse model of Alzheimer's disease. Neurobiology of
disease 26, 212-220, doi:10.1016/j.nbd.2006.12.019 (2007).
49 Nunomura, A. et al. Neuronal death and survival under oxidative stress in Alzheimer and
Parkinson diseases. CNS & neurological disorders drug targets 6, 411-423 (2007).
50 Nunomura, A. et al. Involvement of oxidative stress in Alzheimer disease. Journal of
neuropathology and experimental neurology 65, 631-641,
doi:10.1097/01.jnen.0000228136.58062.bf (2006).
51 Finch, C. E. & Cohen, D. M. Aging, metabolism, and Alzheimer disease: review and hypotheses.
Experimental neurology 143, 82-102, doi:10.1006/exnr.1996.6339 (1997).
52 Parrella, E. et al. Protein restriction cycles reduce IGF-1 and phosphorylated Tau, and improve
behavioral performance in an Alzheimer's disease mouse model. Aging cell 12, 257-268,
doi:10.1111/acel.12049 (2013).
53 Ben-David, E. & Tu, R. Genetics of Parkinson disease. AJNR. American journal of neuroradiology
36, 445-447, doi:10.3174/ajnr.A4092 (2015).
54 Brighina, L. et al. Lymphomonocyte alpha-synuclein levels in aging and in Parkinson disease.
Neurobiology of aging 31, 884-885, doi:10.1016/j.neurobiolaging.2008.06.010 (2010).
55 Duan, W. & Mattson, M. P. Dietary restriction and 2-deoxyglucose administration improve
behavioral outcome and reduce degeneration of dopaminergic neurons in models of Parkinson's
disease. Journal of neuroscience research 57, 195-206 (1999).
95

56 Qiu, G. et al. Neuroprotection provided by dietary restriction in rats is further enhanced by
reducing glucocortocoids. Neurobiology of aging 33, 2398-2410,
doi:10.1016/j.neurobiolaging.2011.11.025 (2012).
57 Mattson, M. P. The impact of dietary energy intake on cognitive aging. Frontiers in aging
neuroscience 2, 5, doi:10.3389/neuro.24.005.2010 (2010).
58 Lee, J., Seroogy, K. B. & Mattson, M. P. Dietary restriction enhances neurotrophin expression
and neurogenesis in the hippocampus of adult mice. Journal of neurochemistry 80, 539-547
(2002).
59 Compston, A. & Coles, A. Multiple sclerosis. Lancet 372, 1502-1517, doi:10.1016/S0140-
6736(08)61620-7 (2008).
60 Weissert, R. The immune pathogenesis of multiple sclerosis. Journal of neuroimmune
pharmacology : the official journal of the Society on NeuroImmune Pharmacology 8, 857-866,
doi:10.1007/s11481-013-9467-3 (2013).
61 Ciccarelli, O. et al. Pathogenesis of multiple sclerosis: insights from molecular and metabolic
imaging. The Lancet. Neurology 13, 807-822, doi:10.1016/S1474-4422(14)70101-2 (2014).
62 Frischer, J. M. et al. The relation between inflammation and neurodegeneration in multiple
sclerosis brains. Brain : a journal of neurology 132, 1175-1189, doi:10.1093/brain/awp070
(2009).
63 Xing, Y. & Hogquist, K. A. T-cell tolerance: central and peripheral. Cold Spring Harbor
perspectives in biology 4, doi:10.1101/cshperspect.a006957 (2012).
64 Dendrou, C. A., Fugger, L. & Friese, M. A. Immunopathology of multiple sclerosis. Nature
reviews. Immunology 15, 545-558, doi:10.1038/nri3871 (2015).
65 Olson, J. K., Croxford, J. L., Calenoff, M. A., Dal Canto, M. C. & Miller, S. D. A virus-induced
molecular mimicry model of multiple sclerosis. The Journal of clinical investigation 108, 311-318,
doi:10.1172/JCI13032 (2001).
66 Munz, C., Lunemann, J. D., Getts, M. T. & Miller, S. D. Antiviral immune responses: triggers of or
triggered by autoimmunity? Nature reviews. Immunology 9, 246-258, doi:10.1038/nri2527
(2009).
67 Harkiolaki, M. et al. T cell-mediated autoimmune disease due to low-affinity crossreactivity to
common microbial peptides. Immunity 30, 348-357, doi:10.1016/j.immuni.2009.01.009 (2009).
68 Libbey, J. E. & Fujinami, R. S. Experimental autoimmune encephalomyelitis as a testing paradigm
for adjuvants and vaccines. Vaccine 29, 3356-3362, doi:10.1016/j.vaccine.2010.08.103 (2011).
69 Libbey, J. E., Tsunoda, I. & Fujinami, R. S. Studies in the modulation of experimental autoimmune
encephalomyelitis. Journal of neuroimmune pharmacology : the official journal of the Society on
NeuroImmune Pharmacology 5, 168-175, doi:10.1007/s11481-010-9215-x (2010).
70 Libbey, J. E. & Fujinami, R. S. Potential triggers of MS. Results and problems in cell differentiation
51, 21-42, doi:10.1007/400_2008_12 (2010).
71 Gran, B. et al. IL-12p35-deficient mice are susceptible to experimental autoimmune
encephalomyelitis: evidence for redundancy in the IL-12 system in the induction of central
nervous system autoimmune demyelination. Journal of immunology 169, 7104-7110 (2002).
72 Hsieh, C. S. et al. Development of TH1 CD4+ T cells through IL-12 produced by Listeria-induced
macrophages. Science 260, 547-549 (1993).
73 Athie-Morales, V., Smits, H. H., Cantrell, D. A. & Hilkens, C. M. Sustained IL-12 signaling is
required for Th1 development. Journal of immunology 172, 61-69 (2004).
74 Panitch, H. S., Hirsch, R. L., Schindler, J. & Johnson, K. P. Treatment of multiple sclerosis with
gamma interferon: exacerbations associated with activation of the immune system. Neurology
37, 1097-1102 (1987).
96

75 Panitch, H. S., Hirsch, R. L., Haley, A. S. & Johnson, K. P. Exacerbations of multiple sclerosis in
patients treated with gamma interferon. Lancet 1, 893-895 (1987).
76 Langrish, C. L. et al. IL-23 drives a pathogenic T cell population that induces autoimmune
inflammation. The Journal of experimental medicine 201, 233-240, doi:10.1084/jem.20041257
(2005).
77 Cua, D. J. et al. Interleukin-23 rather than interleukin-12 is the critical cytokine for autoimmune
inflammation of the brain. Nature 421, 744-748, doi:10.1038/nature01355 (2003).
78 Gyulveszi, G., Haak, S. & Becher, B. IL-23-driven encephalo-tropism and Th17 polarization during
CNS-inflammation in vivo. European journal of immunology 39, 1864-1869,
doi:10.1002/eji.200939305 (2009).
79 Danke, N. A., Koelle, D. M., Yee, C., Beheray, S. & Kwok, W. W. Autoreactive T cells in healthy
individuals. Journal of immunology 172, 5967-5972 (2004).
80 Haas, J. et al. Reduced suppressive effect of CD4+CD25high regulatory T cells on the T cell
immune response against myelin oligodendrocyte glycoprotein in patients with multiple
sclerosis. European journal of immunology 35, 3343-3352, doi:10.1002/eji.200526065 (2005).
81 Feger, U. et al. Increased frequency of CD4+ CD25+ regulatory T cells in the cerebrospinal fluid
but not in the blood of multiple sclerosis patients. Clinical and experimental immunology 147,
412-418, doi:10.1111/j.1365-2249.2006.03271.x (2007).
82 Venken, K. et al. Compromised CD4+ CD25(high) regulatory T-cell function in patients with
relapsing-remitting multiple sclerosis is correlated with a reduced frequency of FOXP3-positive
cells and reduced FOXP3 expression at the single-cell level. Immunology 123, 79-89,
doi:10.1111/j.1365-2567.2007.02690.x (2008).
83 Kohm, A. P., Carpentier, P. A., Anger, H. A. & Miller, S. D. Cutting edge: CD4+CD25+ regulatory T
cells suppress antigen-specific autoreactive immune responses and central nervous system
inflammation during active experimental autoimmune encephalomyelitis. Journal of
immunology 169, 4712-4716 (2002).
84 Wolswijk, G. Oligodendrocyte regeneration in the adult rodent CNS and the failure of this
process in multiple sclerosis. Progress in brain research 117, 233-247 (1998).
85 Scolding, N. et al. Oligodendrocyte progenitors are present in the normal adult human CNS and
in the lesions of multiple sclerosis. Brain : a journal of neurology 121 ( Pt 12), 2221-2228 (1998).
86 Ji, Q., Perchellet, A. & Goverman, J. M. Viral infection triggers central nervous system
autoimmunity via activation of CD8+ T cells expressing dual TCRs. Nature immunology 11, 628-
634, doi:10.1038/ni.1888 (2010).
87 Prayoonwiwat, N. & Rodriguez, M. The potential for oligodendrocyte proliferation during
demyelinating disease. Journal of neuropathology and experimental neurology 52, 55-63 (1993).
88 Wolswijk, G. Chronic stage multiple sclerosis lesions contain a relatively quiescent population of
oligodendrocyte precursor cells. The Journal of neuroscience : the official journal of the Society
for Neuroscience 18, 601-609 (1998).
89 Franklin, R. J. Why does remyelination fail in multiple sclerosis? Nature reviews. Neuroscience 3,
705-714, doi:10.1038/nrn917 (2002).
90 Franklin, R. J. & Kotter, M. R. The biology of CNS remyelination: the key to therapeutic advances.
Journal of neurology 255 Suppl 1, 19-25, doi:10.1007/s00415-008-1004-6 (2008).
91 Horner, P. J. et al. Proliferation and differentiation of progenitor cells throughout the intact
adult rat spinal cord. The Journal of neuroscience : the official journal of the Society for
Neuroscience 20, 2218-2228 (2000).
92 Levine, J. M., Reynolds, R. & Fawcett, J. W. The oligodendrocyte precursor cell in health and
disease. Trends in neurosciences 24, 39-47 (2001).
97

93 Sim, F. J., Zhao, C., Penderis, J. & Franklin, R. J. The age-related decrease in CNS remyelination
efficiency is attributable to an impairment of both oligodendrocyte progenitor recruitment and
differentiation. The Journal of neuroscience : the official journal of the Society for Neuroscience
22, 2451-2459, doi:20026217 (2002).
94 Ffrench-Constant, C. & Raff, M. C. Proliferating bipotential glial progenitor cells in adult rat optic
nerve. Nature 319, 499-502, doi:10.1038/319499a0 (1986).
95 Blakemore, W. F. & Franklin, R. J. Remyelination in experimental models of toxin-induced
demyelination. Current topics in microbiology and immunology 318, 193-212 (2008).
96 Patel, J. R. & Klein, R. S. Mediators of oligodendrocyte differentiation during remyelination. FEBS
letters 585, 3730-3737, doi:10.1016/j.febslet.2011.04.037 (2011).
97 Chang, A., Tourtellotte, W. W., Rudick, R. & Trapp, B. D. Premyelinating oligodendrocytes in
chronic lesions of multiple sclerosis. The New England journal of medicine 346, 165-173,
doi:10.1056/NEJMoa010994 (2002).
98 Investigators, C. T. et al. Alemtuzumab vs. interferon beta-1a in early multiple sclerosis. The New
England journal of medicine 359, 1786-1801, doi:10.1056/NEJMoa0802670 (2008).
99 Hauser, S. L. et al. B-cell depletion with rituximab in relapsing-remitting multiple sclerosis. The
New England journal of medicine 358, 676-688, doi:10.1056/NEJMoa0706383 (2008).
100 Miller, D. H. et al. A controlled trial of natalizumab for relapsing multiple sclerosis. The New
England journal of medicine 348, 15-23, doi:10.1056/NEJMoa020696 (2003).
101 Wingerchuk, D. M. & Carter, J. L. Multiple sclerosis: current and emerging disease-modifying
therapies and treatment strategies. Mayo Clinic proceedings 89, 225-240,
doi:10.1016/j.mayocp.2013.11.002 (2014).
102 Monje, M. & Dietrich, J. Cognitive side effects of cancer therapy demonstrate a functional role
for adult neurogenesis. Behavioural brain research 227, 376-379, doi:10.1016/j.bbr.2011.05.012
(2012).
103 Myers, J. S. The possible role of cytokines in chemotherapy-induced cognitive deficits. Advances
in experimental medicine and biology 678, 119-123 (2010).
104 Wefel, J. S., Lenzi, R., Theriault, R. L., Davis, R. N. & Meyers, C. A. The cognitive sequelae of
standard-dose adjuvant chemotherapy in women with breast carcinoma: results of a
prospective, randomized, longitudinal trial. Cancer 100, 2292-2299, doi:10.1002/cncr.20272
(2004).
105 Bender, C. M. et al. Cognitive impairment associated with adjuvant therapy in breast cancer.
Psychooncology 15, 422-430, doi:10.1002/pon.964 (2006).
106 Hurria, A. et al. Cognitive function of older patients receiving adjuvant chemotherapy for breast
cancer: a pilot prospective longitudinal study. J Am Geriatr Soc 54, 925-931, doi:JGS732 [pii]
10.1111/j.1532-5415.2006.00732.x (2006).
107 Fan, H. G. et al. Fatigue, menopausal symptoms, and cognitive function in women after adjuvant
chemotherapy for breast cancer: 1- and 2-year follow-up of a prospective controlled study. J Clin
Oncol 23, 8025-8032, doi:23/31/8025 [pii]
10.1200/JCO.2005.01.6550 (2005).
108 Schagen, S. B., Muller, M. J., Boogerd, W., Mellenbergh, G. J. & van Dam, F. S. Change in
cognitive function after chemotherapy: a prospective longitudinal study in breast cancer
patients. J Natl Cancer Inst 98, 1742-1745, doi:98/23/1742 [pii]
10.1093/jnci/djj470 (2006).
98

109 Quesnel, C., Savard, J. & Ivers, H. Cognitive impairments associated with breast cancer
treatments: results from a longitudinal study. Breast Cancer Res Treat 116, 113-123,
doi:10.1007/s10549-008-0114-2 (2009).
110 Jansen, C. E., Dodd, M. J., Miaskowski, C. A., Dowling, G. A. & Kramer, J. Preliminary results of a
longitudinal study of changes in cognitive function in breast cancer patients undergoing
chemotherapy with doxorubicin and cyclophosphamide. Psychooncology 17, 1189-1195,
doi:10.1002/pon.1342 (2008).
111 Stewart, A. et al. The cognitive effects of adjuvant chemotherapy in early stage breast cancer: a
prospective study. Psychooncology 17, 122-130, doi:10.1002/pon.1210 (2008).
112 Ahles, T. A. et al. Neuropsychologic impact of standard-dose systemic chemotherapy in long-
term survivors of breast cancer and lymphoma. J Clin Oncol 20, 485-493 (2002).
113 Ferguson, R. J. & Ahles, T. A. Low neuropsychologic performance among adult cancer survivors
treated with chemotherapy. Curr Neurol Neurosci Rep 3, 215-222 (2003).
114 Aluise, C. D. et al. 2-Mercaptoethane sulfonate prevents doxorubicin-induced plasma protein
oxidation and TNF-alpha release: implications for the reactive oxygen species-mediated
mechanisms of chemobrain. Free radical biology & medicine 50, 1630-1638,
doi:10.1016/j.freeradbiomed.2011.03.009 (2011).
115 Tangpong, J. et al. Adriamycin-induced, TNF-alpha-mediated central nervous system toxicity.
Neurobiol Dis 23, 127-139, doi:S0969-9961(06)00040-4 [pii]
10.1016/j.nbd.2006.02.013 (2006).
116 Tangpong, J. et al. Adriamycin-mediated nitration of manganese superoxide dismutase in the
central nervous system: insight into the mechanism of chemobrain. J Neurochem 100, 191-201,
doi:JNC4179 [pii]
10.1111/j.1471-4159.2006.04179.x (2007).
117 Tangpong, J. et al. Tumor necrosis factor alpha-mediated nitric oxide production enhances
manganese superoxide dismutase nitration and mitochondrial dysfunction in primary neurons:
an insight into the role of glial cells. Neuroscience 151, 622-629, doi:S0306-4522(07)01336-X [pii]
10.1016/j.neuroscience.2007.10.046 (2008).
118 Lee, C. et al. Reduced levels of IGF-I mediate differential protection of normal and cancer cells in
response to fasting and improve chemotherapeutic index. Cancer Res 70, 1564-1572, doi:0008-
5472.CAN-09-3228 [pii]
10.1158/0008-5472.CAN-09-3228.
119 Raffaghello, L. et al. Starvation-dependent differential stress resistance protects normal but not
cancer cells against high-dose chemotherapy. Proc Natl Acad Sci U S A 105, 8215-8220,
doi:0708100105 [pii]
10.1073/pnas.0708100105 (2008).
120 McWhinney, S. R., Goldberg, R. M. & McLeod, H. L. Platinum neurotoxicity pharmacogenetics.
Mol Cancer Ther 8, 10-16, doi:8/1/10 [pii]
10.1158/1535-7163.MCT-08-0840 (2009).
121 Verdu, E. et al. Physiological and immunohistochemical characterization of cisplatin-induced
neuropathy in mice. Muscle Nerve 22, 329-340, doi:10.1002/(SICI)1097-
4598(199903)22:3<329::AID-MUS5>3.0.CO;2-8 [pii] (1999).
99

122 Jacobs, S. et al. Extracellular fluid concentrations of cisplatin, carboplatin, and oxaliplatin in
brain, muscle, and blood measured using microdialysis in nonhuman primates. Cancer
chemotherapy and pharmacology 65, 817-824, doi:10.1007/s00280-009-1085-7 (2010).
123 Gidda, J. S. et al. Antagonism of serotonin3 (5-HT3) receptors within the blood-brain barrier
prevents cisplatin-induced emesis in dogs. The Journal of pharmacology and experimental
therapeutics 273, 695-701 (1995).
124 Dhami, N. K., Pandey, R. S., Jain, U. K., Chandra, R. & Madan, J. Non-aggregated protamine-
coated poly(lactide-co-glycolide) nanoparticles of cisplatin crossed blood-brain barrier,
enhanced drug delivery and improved therapeutic index in glioblastoma cells: in vitro studies.
Journal of microencapsulation 31, 685-693, doi:10.3109/02652048.2014.913725 (2014).
125 Dietrich, J., Han, R., Yang, Y., Mayer-Proschel, M. & Noble, M. CNS progenitor cells and
oligodendrocytes are targets of chemotherapeutic agents in vitro and in vivo. J Biol 5, 22,
doi:jbiol50 [pii]
10.1186/jbiol50 (2006).
126 Clelland, C. D. et al. A functional role for adult hippocampal neurogenesis in spatial pattern
separation. Science 325, 210-213, doi:10.1126/science.1173215 (2009).
127 Deng, W., Aimone, J. B. & Gage, F. H. New neurons and new memories: how does adult
hippocampal neurogenesis affect learning and memory? Nature reviews. Neuroscience 11, 339-
350, doi:10.1038/nrn2822 (2010).
128 Lee, S. W., Clemenson, G. D. & Gage, F. H. New neurons in an aged brain. Behavioural brain
research 227, 497-507, doi:10.1016/j.bbr.2011.10.009 (2012).
129 Mainen, Z. F. & Sejnowski, T. J. Influence of dendritic structure on firing pattern in model
neocortical neurons. Nature 382, 363-366, doi:10.1038/382363a0 (1996).
130 Jan, Y. N. & Jan, L. Y. Branching out: mechanisms of dendritic arborization. Nature reviews.
Neuroscience 11, 316-328, doi:10.1038/nrn2836 (2010).
131 Reagan-Shaw, S., Nihal, M. & Ahmad, N. Dose translation from animal to human studies
revisited. FASEB J 22, 659-661, doi:fj.07-9574LSF [pii]
10.1096/fj.07-9574LSF (2008).
132 Sharpe, M. J., Fardell, J. E., Vardy, J. & Johnston, I. N. The chemotherapy agent oxaliplatin
impairs the renewal of fear to an extinguished conditioned stimulus in rats. Behav Brain Res 227,
295-299, doi:S0166-4328(11)00790-X [pii]
10.1016/j.bbr.2011.11.005.
133 Fardell, J. E., Vardy, J., Shah, J. D. & Johnston, I. N. Cognitive impairments caused by oxaliplatin
and 5-fluorouracil chemotherapy are ameliorated by physical activity. Psychopharmacology
(Berl) 220, 183-193, doi:10.1007/s00213-011-2466-2.
134 Seigers, R. et al. Long-lasting suppression of hippocampal cell proliferation and impaired
cognitive performance by methotrexate in the rat. Behav Brain Res 186, 168-175, doi:S0166-
4328(07)00403-2 [pii]
10.1016/j.bbr.2007.08.004 (2008).
135 Reiriz, A. B. et al. Cancer chemotherapy and cognitive function in rodent models: memory
impairment induced by cyclophosphamide in mice. Clin Cancer Res 12, 5000; author reply 5000-
5001, doi:12/16/5000 [pii]
10.1158/1078-0432.CCR-06-0138 (2006).
100

136 Authier, N., Gillet, J. P., Fialip, J., Eschalier, A. & Coudore, F. Description of a short-term Taxol-
induced nociceptive neuropathy in rats. Brain Res 887, 239-249, doi:S0006899300029103 [pii]
(2000).
137 Ling, B. et al. Behavioral and immunohistological assessment of painful neuropathy induced by a
single oxaliplatin injection in the rat. Toxicology 234, 176-184, doi:S0300-483X(07)00105-9 [pii]
10.1016/j.tox.2007.02.013 (2007).
138 Winocur, G., Vardy, J., Binns, M. A., Kerr, L. & Tannock, I. The effects of the anti-cancer drugs,
methotrexate and 5-fluorouracil, on cognitive function in mice. Pharmacol Biochem Behav 85,
66-75, doi:S0091-3057(06)00220-6 [pii]
10.1016/j.pbb.2006.07.010 (2006).
139 Mustafa, S., Walker, A., Bennett, G. & Wigmore, P. M. 5-Fluorouracil chemotherapy affects
spatial working memory and newborn neurons in the adult rat hippocampus. Eur J Neurosci 28,
323-330, doi:EJN6325 [pii]
10.1111/j.1460-9568.2008.06325.x (2008).
140 Christie, L. A. et al. Impaired cognitive function and hippocampal neurogenesis following cancer
chemotherapy. Clin Cancer Res 18, 1954-1965, doi:1078-0432.CCR-11-2000 [pii]
10.1158/1078-0432.CCR-11-2000.
141 Macleod, J. E. et al. Cancer chemotherapy impairs contextual but not cue-specific fear memory.
Behav Brain Res 181, 168-172, doi:S0166-4328(07)00200-8 [pii]
10.1016/j.bbr.2007.04.003 (2007).
142 Harrison, F. E., Hosseini, A. H. & McDonald, M. P. Endogenous anxiety and stress responses in
water maze and Barnes maze spatial memory tasks. Behav Brain Res 198, 247-251, doi:S0166-
4328(08)00574-3 [pii]
10.1016/j.bbr.2008.10.015 (2009).
143 Phillips, R. G. & LeDoux, J. E. Differential contribution of amygdala and hippocampus to cued and
contextual fear conditioning. Behav Neurosci 106, 274-285 (1992).
144 Yang, M. et al. Cyclophosphamide impairs hippocampus-dependent learning and memory in
adult mice: Possible involvement of hippocampal neurogenesis in chemotherapy-induced
memory deficits. Neurobiol Learn Mem 93, 487-494, doi:S1074-7427(10)00023-7 [pii]
10.1016/j.nlm.2010.01.006.
145 Apfel, S. C., Arezzo, J. C., Lipson, L. & Kessler, J. A. Nerve growth factor prevents experimental
cisplatin neuropathy. Ann Neurol 31, 76-80, doi:10.1002/ana.410310114 (1992).
146 Boyle, F. M., Wheeler, H. R. & Shenfield, G. M. Amelioration of experimental cisplatin and
paclitaxel neuropathy with glutamate. J Neurooncol 41, 107-116 (1999).
147 Carpentier, P. A. & Palmer, T. D. Immune influence on adult neural stem cell regulation and
function. Neuron 64, 79-92, doi:10.1016/j.neuron.2009.08.038 (2009).
148 Monje, M. L., Toda, H. & Palmer, T. D. Inflammatory blockade restores adult hippocampal
neurogenesis. Science 302, 1760-1765, doi:10.1126/science.1088417 (2003).
149 Butovsky, O. et al. Microglia activated by IL-4 or IFN-gamma differentially induce neurogenesis
and oligodendrogenesis from adult stem/progenitor cells. Molecular and cellular neurosciences
31, 149-160, doi:10.1016/j.mcn.2005.10.006 (2006).
150 Rosario, E. R., Carroll, J. C., Oddo, S., LaFerla, F. M. & Pike, C. J. Androgens regulate the
development of neuropathology in a triple transgenic mouse model of Alzheimer's disease. J
Neurosci 26, 13384-13389, doi:26/51/13384 [pii]
101

10.1523/JNEUROSCI.2514-06.2006 (2006).
151 Michan, S. et al. SIRT1 is essential for normal cognitive function and synaptic plasticity. J
Neurosci 30, 9695-9707, doi:30/29/9695 [pii]
10.1523/JNEUROSCI.0027-10.2010.
152 Serradj, N. & Jamon, M. Age-related changes in the motricity of the inbred mice strains 129/sv
and C57BL/6j. Behav Brain Res 177, 80-89, doi:S0166-4328(06)00595-X [pii]
10.1016/j.bbr.2006.11.001 (2007).
153 Ming, G. L. & Song, H. Adult neurogenesis in the mammalian brain: significant answers and
significant questions. Neuron 70, 687-702, doi:10.1016/j.neuron.2011.05.001 (2011).
154 Johnston, S. T., Shtrahman, M., Parylak, S., Goncalves, J. T. & Gage, F. H. Paradox of pattern
separation and adult neurogenesis: A dual role for new neurons balancing memory resolution
and robustness. Neurobiology of learning and memory, doi:10.1016/j.nlm.2015.10.013 (2015).
155 Jessberger, S. et al. Dentate gyrus-specific knockdown of adult neurogenesis impairs spatial and
object recognition memory in adult rats. Learning & memory 16, 147-154,
doi:10.1101/lm.1172609 (2009).
156 Aimone, J. B., Wiles, J. & Gage, F. H. Computational influence of adult neurogenesis on memory
encoding. Neuron 61, 187-202, doi:10.1016/j.neuron.2008.11.026 (2009).
157 Ben Abdallah, N. M., Slomianka, L., Vyssotski, A. L. & Lipp, H. P. Early age-related changes in
adult hippocampal neurogenesis in C57 mice. Neurobiology of aging 31, 151-161,
doi:10.1016/j.neurobiolaging.2008.03.002 (2010).
158 Kempermann, G., Kuhn, H. G. & Gage, F. H. Experience-induced neurogenesis in the senescent
dentate gyrus. The Journal of neuroscience : the official journal of the Society for Neuroscience
18, 3206-3212 (1998).
159 Bondolfi, L., Ermini, F., Long, J. M., Ingram, D. K. & Jucker, M. Impact of age and caloric
restriction on neurogenesis in the dentate gyrus of C57BL/6 mice. Neurobiology of aging 25,
333-340, doi:10.1016/S0197-4580(03)00083-6 (2004).
160 Hattiangady, B. & Shetty, A. K. Aging does not alter the number or phenotype of putative
stem/progenitor cells in the neurogenic region of the hippocampus. Neurobiology of aging 29,
129-147, doi:10.1016/j.neurobiolaging.2006.09.015 (2008).
161 Ahlenius, H., Visan, V., Kokaia, M., Lindvall, O. & Kokaia, Z. Neural stem and progenitor cells
retain their potential for proliferation and differentiation into functional neurons despite lower
number in aged brain. The Journal of neuroscience : the official journal of the Society for
Neuroscience 29, 4408-4419, doi:10.1523/JNEUROSCI.6003-08.2009 (2009).
162 Lynch, M. A. Long-term potentiation and memory. Physiol Rev 84, 87-136,
doi:10.1152/physrev.00014.2003
84/1/87 [pii] (2004).
163 Beninger, R. J., Jhamandas, K., Boegman, R. J. & el-Defrawy, S. R. Effects of scopolamine and
unilateral lesions of the basal forebrain on T-maze spatial discrimination and alternation in rats.
Pharmacol Biochem Behav 24, 1353-1360, doi:0091-3057(86)90195-4 [pii] (1986).
164 Bernabeu, R., de Stein, M. L., Fin, C., Izquierdo, I. & Medina, J. H. Role of hippocampal NO in the
acquisition and consolidation of inhibitory avoidance learning. Neuroreport 6, 1498-1500 (1995).
165 Barnes, C. A. Spatial learning and memory processes: the search for their neurobiological
mechanisms in the rat. Trends Neurosci 11, 163-169, doi:0166-2236(88)90143-9 [pii] (1988).
166 Mattson, M. P. Energy intake and exercise as determinants of brain health and vulnerability to
injury and disease. Cell metabolism 16, 706-722, doi:S1550-4131(12)00402-0 [pii]
102

10.1016/j.cmet.2012.08.012 (2012).
167 Cheng, C.-W. et al. Prolonged Fasting Reduces IGF-1/PKA to Promote Hematopoietic-Stem-Cell-
Based Regeneration and Reverse Immunosuppression. Cell Stem Cell 14, 810-823,
doi:http://dx.doi.org/10.1016/j.stem.2014.04.014 (2014).
168 Gao, Z. et al. Neurod1 is essential for the survival and maturation of adult-born neurons. Nature
neuroscience 12, 1090-1092, doi:10.1038/nn.2385 (2009).
169 Bond, A. M., Ming, G. L. & Song, H. Adult Mammalian Neural Stem Cells and Neurogenesis: Five
Decades Later. Cell stem cell 17, 385-395, doi:10.1016/j.stem.2015.09.003 (2015).
170 Deng, B., Glanzman, D. & Tidball, J. G. Nitric oxide generated by muscle corrects defects in
hippocampal neurogenesis and neural differentiation caused by muscular dystrophy. The
Journal of physiology 587, 1769-1778, doi:10.1113/jphysiol.2008.166256 (2009).
171 Snyder, J. S., Hong, N. S., McDonald, R. J. & Wojtowicz, J. M. A role for adult neurogenesis in
spatial long-term memory. Neuroscience 130, 843-852, doi:10.1016/j.neuroscience.2004.10.009
(2005).
172 Shors, T. J. et al. Neurogenesis in the adult is involved in the formation of trace memories.
Nature 410, 372-376, doi:10.1038/35066584 (2001).
173 Mattson, M. P., Duan, W. & Guo, Z. Meal size and frequency affect neuronal plasticity and
vulnerability to disease: cellular and molecular mechanisms. Journal of neurochemistry 84, 417-
431 (2003).
174 Stranahan, A. M. et al. Diet-induced insulin resistance impairs hippocampal synaptic plasticity
and cognition in middle-aged rats. Hippocampus 18, 1085-1088, doi:10.1002/hipo.20470 (2008).
175 Cheng, C. W. et al. Prolonged fasting reduces IGF-1/PKA to promote hematopoietic-stem-cell-
based regeneration and reverse immunosuppression. Cell stem cell 14, 810-823,
doi:10.1016/j.stem.2014.04.014 (2014).
176 Lee, J., Duan, W. & Mattson, M. P. Evidence that brain-derived neurotrophic factor is required
for basal neurogenesis and mediates, in part, the enhancement of neurogenesis by dietary
restriction in the hippocampus of adult mice. Journal of neurochemistry 82, 1367-1375 (2002).
177 Choi, J. H. et al. Comparison of neurogenesis in the dentate gyrus between the adult and aged
gerbil following transient global cerebral ischemia. Neurochemical research 37, 802-810,
doi:10.1007/s11064-011-0675-z (2012).
178 Richetin, K. et al. Genetic manipulation of adult-born hippocampal neurons rescues memory in a
mouse model of Alzheimer's disease. Brain : a journal of neurology 138, 440-455,
doi:10.1093/brain/awu354 (2015).
179 Friese, M. A. & Fugger, L. Autoreactive CD8+ T cells in multiple sclerosis: a new target for
therapy? Brain : a journal of neurology 128, 1747-1763, doi:10.1093/brain/awh578 (2005).
180 Pender, M. P. & Greer, J. M. Immunology of multiple sclerosis. Current allergy and asthma
reports 7, 285-292 (2007).
181 Rasmussen, S. et al. Persistent activation of microglia is associated with neuronal dysfunction of
callosal projecting pathways and multiple sclerosis-like lesions in relapsing--remitting
experimental autoimmune encephalomyelitis. Brain : a journal of neurology 130, 2816-2829,
doi:10.1093/brain/awm219 (2007).
182 Sospedra, M. & Martin, R. Immunology of multiple sclerosis. Annual review of immunology 23,
683-747, doi:10.1146/annurev.immunol.23.021704.115707 (2005).
183 Goverman, J. Autoimmune T cell responses in the central nervous system. Nature reviews.
Immunology 9, 393-407, doi:10.1038/nri2550 (2009).
184 Dhib-Jalbut, S. Pathogenesis of myelin/oligodendrocyte damage in multiple sclerosis. Neurology
68, S13-21; discussion S43-54, doi:10.1212/01.wnl.0000275228.13012.7b (2007).
103

185 Fletcher, J. M., Lalor, S. J., Sweeney, C. M., Tubridy, N. & Mills, K. H. T cells in multiple sclerosis
and experimental autoimmune encephalomyelitis. Clinical and experimental immunology 162, 1-
11, doi:10.1111/j.1365-2249.2010.04143.x (2010).
186 Hemmer, B., Archelos, J. J. & Hartung, H. P. New concepts in the immunopathogenesis of
multiple sclerosis. Nature reviews. Neuroscience 3, 291-301, doi:10.1038/nrn784 (2002).
187 Lucchinetti, C. et al. A quantitative analysis of oligodendrocytes in multiple sclerosis lesions - A
study of 113 cases. Brain : a journal of neurology 122, 2279-2295, doi:DOI
10.1093/brain/122.12.2279 (1999).
188 Raine, C. S. & Wu, E. Multiple-Sclerosis - Remyelination in Acute Lesions. J Neuropath Exp Neur
52, 199-204 (1993).
189 Guevara-Aguirre, J. et al. Growth hormone receptor deficiency is associated with a major
reduction in pro-aging signaling, cancer, and diabetes in humans. Science translational medicine
3, 70ra13, doi:10.1126/scitranslmed.3001845 (2011).
190 Lee, C. et al. Reduced levels of IGF-I mediate differential protection of normal and cancer cells in
response to fasting and improve chemotherapeutic index. Cancer research 70, 1564-1572,
doi:10.1158/0008-5472.CAN-09-3228 (2010).
191 Esquifino, A. I., Cano, P., Jimenez-Ortega, V., Fernandez-Mateos, M. P. & Cardinali, D. P. Immune
response after experimental allergic encephalomyelitis in rats subjected to calorie restriction.
Journal of neuroinflammation 4, 6, doi:10.1186/1742-2094-4-6 (2007).
192 Piccio, L., Stark, J. L. & Cross, A. H. Chronic calorie restriction attenuates experimental
autoimmune encephalomyelitis. Journal of leukocyte biology 84, 940-948,
doi:10.1189/jlb.0208133 (2008).
193 Kim do, Y. et al. Inflammation-mediated memory dysfunction and effects of a ketogenic diet in a
murine model of multiple sclerosis. PloS one 7, e35476, doi:10.1371/journal.pone.0035476
(2012).
194 Kafami, L. et al. Intermittent feeding attenuates clinical course of experimental autoimmune
encephalomyelitis in C57BL/6 mice. Avicenna journal of medical biotechnology 2, 47-52 (2010).
195 Gao, Z. & Tsirka, S. E. Animal Models of MS Reveal Multiple Roles of Microglia in Disease
Pathogenesis. Neurology research international 2011, 383087, doi:10.1155/2011/383087
(2011).
196 Friese, M. A. & Fugger, L. T cells and microglia as drivers of multiple sclerosis pathology. Brain : a
journal of neurology 130, 2755-2757, doi:10.1093/brain/awm246 (2007).
197 Ponomarev, E. D., Shriver, L. P., Maresz, K. & Dittel, B. N. Microglial cell activation and
proliferation precedes the onset of CNS autoimmunity. Journal of neuroscience research 81, 374-
389, doi:10.1002/jnr.20488 (2005).
198 Heppner, F. L. et al. Experimental autoimmune encephalomyelitis repressed by microglial
paralysis. Nature medicine 11, 146-152, doi:10.1038/nm1177 (2005).
199 Herold, M. J., McPherson, K. G. & Reichardt, H. M. Glucocorticoids in T cell apoptosis and
function. Cellular and molecular life sciences : CMLS 63, 60-72, doi:10.1007/s00018-005-5390-y
(2006).
200 Planey, S. L. & Litwack, G. Glucocorticoid-induced apoptosis in lymphocytes. Biochemical and
biophysical research communications 279, 307-312, doi:10.1006/bbrc.2000.3922 (2000).
201 Ashwell, J. D., Lu, F. W. & Vacchio, M. S. Glucocorticoids in T cell development and function*.
Annual review of immunology 18, 309-345, doi:10.1146/annurev.immunol.18.1.309 (2000).
202 Vegiopoulos, A. & Herzig, S. Glucocorticoids, metabolism and metabolic diseases. Molecular and
cellular endocrinology 275, 43-61, doi:10.1016/j.mce.2007.05.015 (2007).
203 Ransohoff, R. M. Animal models of multiple sclerosis: the good, the bad and the bottom line.
Nature neuroscience 15, 1074-1077, doi:10.1038/nn.3168 (2012).
104

204 Torkildsen, O., Brunborg, L. A., Myhr, K. M. & Bo, L. The cuprizone model for demyelination. Acta
neurologica Scandinavica. Supplementum 188, 72-76, doi:10.1111/j.1600-0404.2008.01036.x
(2008).
205 Laplante, M. & Sabatini, D. M. mTOR signaling in growth control and disease. Cell 149, 274-293,
doi:10.1016/j.cell.2012.03.017 (2012).
206 Zeng, H. et al. mTORC1 couples immune signals and metabolic programming to establish T(reg)-
cell function. Nature 499, 485-490, doi:10.1038/nature12297 (2013).
207 Nath, N. et al. Metformin attenuated the autoimmune disease of the central nervous system in
animal models of multiple sclerosis. Journal of immunology 182, 8005-8014,
doi:10.4049/jimmunol.0803563 (2009).
208 Esposito, M. et al. Rapamycin inhibits relapsing experimental autoimmune encephalomyelitis by
both effector and regulatory T cells modulation. Journal of neuroimmunology 220, 52-63,
doi:10.1016/j.jneuroim.2010.01.001 (2010).
209 Roth, P., Wick, W. & Weller, M. Steroids in neurooncology: actions, indications, side-effects.
Current opinion in neurology 23, 597-602, doi:10.1097/WCO.0b013e32833e5a5d (2010).
210 Ce, P., Gedizlioglu, M., Gelal, F., Coban, P. & Ozbek, G. Avascular necrosis of the bones: an
overlooked complication of pulse steroid treatment of multiple sclerosis. European journal of
neurology : the official journal of the European Federation of Neurological Societies 13, 857-861,
doi:10.1111/j.1468-1331.2006.01375.x (2006).
211 Uttner, I. et al. Reversible impaired memory induced by pulsed methylprednisolone in patients
with MS. Neurology 64, 1971-1973, doi:10.1212/01.WNL.0000163804.94163.91 (2005).
212 Brusaferri, F. & Candelise, L. Steroids for multiple sclerosis and optic neuritis: a meta-analysis of
randomized controlled clinical trials. Journal of neurology 247, 435-442 (2000).

Abstract (if available)

Abstract Dietary restriction has been well established as a pro‐longevity stimulant that increases not only one’s chronological life span but also one’s health span. Prolonged fasting, a severe form of dietary restriction lasting 48-120 hours, has many beneficial effects in multiple systems by promoting metabolic and cellular changes that affect oxidative damage and inflammation, optimize energy metabolism and enhance cellular protection. From our previous studies, we have shown that prolonged fasting (or cycles of PF) results in a reduction of pro‐growth or nutrient‐sensing signaling, including Insulin/IGF‐1 for systematic nutrient sensing and TOR for local/cellular nutrient sensing. It has also been shown to initiate atrophy in the existing differentiated cell population followed by stimulation of stem‐cell self‐renewal upon re‐feeding, hence promoting efficient tissue regeneration. ❧ We investigated the effects of dietary restrictions, in the form of prolonged fasting or cycles of the fasting mimicking diet (FMD), in the chemotherapy induced neurotoxicity model, the aging model and the neurodegenerative disease model. We found that PF protected mice from chemo‐induced cognitive impairments by reducing hippocampal inflammation and promoting hippocampal cell proliferation. Furthermore, we report that the cycles of FMD reversed the age‐dependent decline in neurogenesis, the process of making new neurons, and reversed the age‐associated memory and cognitive deficits. We found that the fasting mimicking diet can slow down and even reverse some key phenomena related to these degenerations, at least in part, by lowering IGF‐1 level and PKA activity and elevating NeuroD1. We also report that FMD is an effective treatment for neurodegenerative diseases, in particular, multiple sclerosis (MS). Cycles of FMD reduced central nervous system (CNS) autoimmune response by inducing atrophy of existing autoreactive lymphocytes and by promoting regeneration of naive lymphocytes. The FMD treatment also reduced autoreactive lymphocytes and increased regulatory T cells. Moreover, FMD promoted oligodendrocyte progenitor and oligodendrocyte regeneration, resulting in accelerated remyelination. ❧ These findings reveal the anti‐inflammatory and pro‐regenerative effects of the prolonged fasting and FMD in regulating CNS inflammation and neural cell regeneration, suggesting that this dynamic metabolic program can be a cost‐effective, simple yet potent intervention to treat many neurodegenerative diseases.

Linked assets

University of Southern California Dissertations and Theses

Conceptually similar

PDF

Pro-regenerative effects of fasting/fasting mimicking diet (FMD) on hematopoietic system and pancreatic islet

PDF

The effects of a fasting mimicking diet (FMD) on mouse models of Alzheimer's and Parkinson's disease

PDF

Fasting-based differential stress resistance to enhance cancer treatment: a novel strategy to protect normal cells and sensitize cancer cells to chemotherapy

PDF

Differential effects of starvation in normal and cancer cells: from EGR1-dependent protection to p53-mediated apoptosis

PDF

The role of endoplasmic reticulum chaperones in regulating hematopoietic stem cells and hematological malignancies

Asset Metadata

Creator Choi, In Young (author)

Core Title The effects of prolonged fasting/ fasting mimicking diet (FMD) on CNS protection, regeneration, and treatment

School Keck School of Medicine

Degree Doctor of Philosophy

Degree Program Genetic, Molecular and Cellular Biology

Publication Date 05/02/2016

Defense Date 03/22/2016

Publisher University of Southern California (original), University of Southern California. Libraries (digital)

Tag adult neurogenesis,CNS protection,dietary intervention,dietary restriction,fasting,multiple sclerosis,OAI-PMH Harvest,prolonged fasting

Format application/pdf (imt)

Language English

Contributor Electronically uploaded by the author (provenance)

Advisor Longo, Valter (committee chair), Curran, Sean (committee member), Pike, Christian (committee member)

Creator Email inyoungc@usc.edu,inyoungc88@gmail.com

Permanent Link (DOI) https://doi.org/10.25549/usctheses-c40-245901

Unique identifier UC11278230

Identifier etd-ChoiInYoun-4398.pdf (filename),usctheses-c40-245901 (legacy record id)

Legacy Identifier etd-ChoiInYoun-4398.pdf

Dmrecord 245901

Document Type Dissertation

Format application/pdf (imt)

Rights Choi, In Young

Type texts

Source University of Southern California (contributing entity), University of Southern California Dissertations and Theses (collection)

Access Conditions The author retains rights to his/her dissertation, thesis or other graduate work according to U.S. copyright law. Electronic access is being provided by the USC Libraries in agreement with the a...

Repository Name University of Southern California Digital Library

Repository Location USC Digital Library, University of Southern California, University Park Campus MC 2810, 3434 South Grand Avenue, 2nd Floor, Los Angeles, California 90089-2810, USA