University of Southern California Dissertations and Theses

Novel roles for Maf1 in embryonic stem cell differentiation and adipogenesis

(USC Thesis Other)

Novel roles for Maf1 in embryonic stem cell differentiation and adipogenesis

PDF

Download a page range

Download transcript

Copy asset link

Request this asset

Transcript (if available)

Content
Novel Roles for Maf1 in Embryonic Stem Cell Differentiation and
Adipogenesis

By

Chun-Yuan Chen

A Dissertation presented to
THE FACULTY OF THE USC GRADUATE SCHOOL
UNIVERSITY OF SOUTHERN CALIFORNIA
In Partial Fulfillment of the
Requirements of the degree
DOCTOR OF PHILOSOPHY
(GENETIC, CELLULAR AND MOLECULAR BIOLOGY)
December 2016

Copyright 2016 Chun-Yuan Chen

i
Dedication
To My Family and My Love

ii
Acknowledgements
I would like to thank my mentor, Dr. Debbie Johnson, for her guidance, support, and
encouragement. She gave me the confidence in my ability as a scientist. She
encouraged me to explore every possibility of my graduate studies, and helped me
realize the beauty of science. I would also like to thank my thesis committee members,
Dr. Michael Stallcup, Dr. Robert Maxson, and Dr. Wange Lu. They provided me with a
lot of constructive suggestions to better my research study, and always gave me
positive feedback.

I would like to thank Dr. Sandra Johnson who taught me how to design and perform
experiments. I would like to thank Dr. Beth Palian and Dr. Aarti Rohira who were always
supportive throughout my graduate life, and shared their lab and life experiences with
me. I would like to acknowledge Dr. Christopher Walkey who gave me valuable advice
on my research. I would also like to thank my labmates, Eric Wang, Alex Guo, Alexa
Billow, Dr. Justin Lin, Ellen Busschers, and Dr. Xianlong Wang for all their support and
useful discussion.

Lastly, I would like to thank my parents, my wife, my daughter, my brothers, my cousin
Henry’s family and my family in Taiwan for their limitless support and love. They
motivated me to remain positive and strong while chasing my dreams. I would also like
to thank all my supportive friends who shared every moment of joy with me.

iii
Table of Contents
Dedication ......................................................................................................................... i
Acknowledgements .......................................................................................................... ii
List of Figures ................................................................................................................... v
Abstract ........................................................................................................................... vi
Chapter 1: Introduction ..................................................................................................... 1
1.1: Maf1, a transcriptional repressor ........................................................................................ 2
1.2: Embryonic stem cells .......................................................................................................... 6
1.3: Adipogenesis ................................................................................................................... 10
Chapter 2: Characterizing Maf1 expression in embryonic stem cells ............................ 16
2.1: Maf1 expression is markedly reduced during mouse ES cell differentiation ................... 16
2.2: Maf1 expression is markedly reduced during human ES cell differentiation ................... 17
2.3: Summary ......................................................................................................................... 18
Chapter 3: Analysis of the role of Maf1 in ES cell self-renewal and differentiation ........ 19
3.1: Reduction of Maf1 expression does not affect ES cell self-renewal ................................ 19
3.2: Maf1 selectively perturbs the differentiation of mouse ES cells into mesoderm .............. 21
3.3: Summary ......................................................................................................................... 23
Chapter 4: Maf1 promotes adipogenesis ....................................................................... 23
4.1: Decreased Maf1 expression inhibits the terminal differentiation of ES cells into
adipocytes .............................................................................................................................. 23
4.2: Maf1 knockdown impairs adipogenesis of 3T3-L1 cells .................................................. 26
Chapter 4.3: Expression of Maf1 in Maf1-deficient MEFs promotes adipogenesis ................ 28
4.4: Summary ......................................................................................................................... 30

iv
Chapter 5: RNA Pol III-dependent transcription repression contributes to adipogenesis
........................................................................................................................................ 30
5.1: Treatment with the RNA Pol III inhibitor, ML-60218, promotes adipogenesis of 3T3-L1
cells ........................................................................................................................................ 30
5.2: Brf1 knockdown promotes adipogenesis of 3T3-L1 cells ................................................ 32
5.3: Summary ......................................................................................................................... 33
Chapter 6: RNA Pol III-dependent transcription repression requires Maf1 to facilitate
adipogenesis .................................................................................................................. 34
6.1: Treatment with ML-60218 has no effect on adipogenesis in 3T3L1 cells with decreased
Maf1 expression ..................................................................................................................... 34
6.2: Treatment with ML60218 has no effect on adipogenesis in Maf1-/- MEFs ..................... 36
6.3: Summary ......................................................................................................................... 38
Chapter 7: Discussion .................................................................................................... 39
7.1: Maf1 promotes ES cell differentiation into mesoderm ..................................................... 39
7.2: Maf1 promotes adipogenesis .......................................................................................... 43
7.3: The mechanism of Maf1-mediated induction of adipogenesis ........................................ 45
7.4: Summary ......................................................................................................................... 49
References ..................................................................................................................... 57

v
List of Figures
Figure 1: Maf1 protein expression is markedly reduced during mouse ES cell
differentiation into EBs. ........................................................................................... 17
Figure 2: Maf1 protein expression is markedly reduced during human ES cell
differentiation into EBs. ........................................................................................... 18
Figure 3: Maf1 knockdown does not affect ES cell self-renewal .................................... 20
Figure 4: Maf1 promotes the expression of mesodermal markers ................................. 22
Figure 5: Maf1 knockdown compromises adipogenesis in mouse ES cells. .................. 25
Figure 6: Maf1 knockdown compromises adipogenesis in 3T3-L1 cells. ....................... 27
Figure 7: Ectopic expression of Maf1 induces adipogenesis in Maf1-/- MEFs. .............. 29
Figure 8 ：ML-60218 treatment enhances adipogenesis in 3T3-L1 cells. ...................... 31
Figure 9: Brf1 knockdown promotes adipogenesis in 3T3-L1 cells. ............................... 33
Figure 10: ML-60218 treatment has no effect on adipogenesis in 3T3-L1 cells with
decreased Maf1 expression. ................................................................................... 35
Figure 11: ML-60218 treatment has no effect on adipogenesis in Maf1-/- MEFs. ......... 37

vi
Abstract
Maf1 represses transcription from select RNA Polymerase (Pol) II- and RNA Pol III-
dependent genes. Our previous studies demonstrated that Maf1 functions as a tumor
suppressor and it negatively regulates intracellular lipid accumulation. Together, these
results identify Maf1 as an important link in between metabolism and cancer. However,
a potential biological role for Maf1 in early development and cellular differentiation has
not yet been examined.

Maf1 expression was analyzed in human and mouse embryonic stem (ES) cells and as
they differentiate into embryoid bodies (EBs). Maf1 protein expression is high in ES
cells, and markedly reduced during their differentiation into EBs. This corresponded with
a reciprocal change in the amounts of RNA Pol III-dependent transcripts. We further
examined whether Maf1 was required for the two properties of ES cells, self-renewal
and pluripotency. Maf1 knockdown did not affect ES cell self-renewal or proliferation.
However, analysis of markers associated with the three germ layers in EBs showed that
alterations in Maf1 expression significantly affected the expression of mesoderm-
associated genes. These results indicate that Maf1 is important for driving ES cell
induction into mesoderm. As Maf1 negatively regulates intracellular lipid accumulation,
and adipocytes are one of the derivatives of mesoderm, we examined whether Maf1 is
required for adipogenesis. Mouse ES cells, 3T3-L1 preadipocytes, and Maf1-/- mouse
embryo fibroblasts (MEFs) were terminally differentiated into mature adipocytes.
Reduced Maf1 expression in either mouse ES or 3T3-L1 cells resulted in enhanced
RNA Pol III-dependent transcription, reduced expression of key adipogenic genes,

vii
PPARγ, C/EBPα, and FABP4, and compromised adipocyte formation. Ectopic
expression of Maf1 in Maf1-/- MEFs enhanced adipocyte differentiation, correlating with
an increase in adipogenic gene expression and a decrease in RNA Pol III-dependent
transcription. Given that Maf1 is an established repressor of RNA Pol III-dependent
transcription, we examined whether this Maf1 function contributes to the ability of Maf1
to induce adipogenesis. Repression of RNA Pol III-dependent transcription in 3T3-L1
cells by either treatment of a RNA Pol III inhibitor, ML-60218, or knockdown of the RNA
pol III-specific transcription factor, Brf1, resulted in a significant increase in adipogenic
gene expression and adipocyte differentiation. However, treatment with the RNA Pol III
inhibitor in Maf1-knockdown 3T3-L1 cells or Maf1-/- MEFs did not lead to induction of
adipogenic gene expression or adipogenesis. Together, our findings reveal a novel and
unexpected role for Maf1 and RNA Pol III-dependent transcription in lineage
specification and differentiation. Our results support a model in which Maf1 promotes
formation of mesoderm and it also drives the terminal differentiation of adipocytes.
These results further reveal that repression of RNA Pol III-dependent transcription
contributes to Maf1-mediated induction of adipogenesis.

1
Chapter 1: Introduction
Eukaryotic transcription is a process by which genetic information is transcribed from
DNA to RNA by three functionally distinct nuclear RNA polymerases (RNA Pols). RNA
Pol I transcribes three large ribosomal RNAs (rRNAs). RNA Pol II transcribes
messenger RNAs (mRNAs), and certain small nuclear RNAs (snRNAs). RNA pol III
transcribes small non-coding RNAs including tRNAs and 5S rRNA (required for protein
synthesis), U6 snRNA (involved in RNA processing), and 7SL RNA (required for protein
transport) (Paule and White, 2000). RNA Pol I- and Pol III-dependent transcription
accounts for more than 80% of total RNA synthesis in replicating cells. Therefore, the
regulation of these processes is critical for mediating the protein synthesis requirement
for cellular growth (Paule and White, 2000).

RNA Pol III is recruited to its target promoters through interactions with multi-protein
complexes which together form the transcription initiation complex. RNA Pol III-
dependent transcription requires the TFIIIB complex (Oler et al., 2010; White, 2004).
TFIIIB is composed of three subunits, TATA-binding protein (TBP), BDP1, and one of
the TFIIB related factors, Brf1, or Brf2. Transcription of RNA Pol III-dependent genes
that possess internal promoters, such tRNA genes, requires Brf1. Brf2 is used by RNA
Pol III-dependent genes that have external promoters, such as U6 snRNA. In addition,
tRNA promoters additionally require TFIIIC, 5S rRNA requires TFIIIC and TFIIIA, and
U6 snRNA genes require small nuclear RNA activating protein complex (SNAPc)
(Schramm and Hernandez, 2002).

2
1.1: Maf1, a transcriptional repressor
Maf1 was first identified in Saccharomyces cerevisiae as a repressor of RNA Pol III-
dependent transcription. In yeast, Maf1 is required for inhibiting RNA Pol III transcription
under stress conditions including nutrient limitation, DNA damage, secretory defects,
and environmental stress (Boguta et al., 1997; Upadhya et al., 2002). Yeast Maf1 is
phosphorylated by protein kinase A (PKA) and Sch9 under favorable growth conditions,
which inactivates Maf1 by sequestering it in the cytoplasm. Upon stress or rapamycin
treatment, Maf1 is then rapidly dephosphorylated by protein phosphatase 2A (PP2A)
and transported into the nucleus where it can then repress RNA Pol III-dependent
transcription (Huber et al., 2009; Moir et al., 2006; Oficjalska-Pham et al., 2006). Maf1
binds directly to RNA Pol III to prevent RNA Pol III interaction with TFIIIB and their
recruitment to promoters. Maf1 can also interact with Brf1 to interfere with the assembly
of TFIIIB onto preinitiation complexes (Desai et al., 2005; Vannini et al., 2010).

Maf1 is conserved from yeast to humans. Eukaryotic Maf1 shares three conserved
domains, but the functions of these domains have not yet been identified. Our lab and
others have revealed that mammalian Maf1 is a general repressor of RNA Pol III-
dependent transcription (Goodfellow et al., 2008; Johnson et al., 2007; Reina et al.,
2006). Mammalian Maf1 interacts with Brf1, and two RNA pol III subunits, RPC1 and
RPC2. Similar to yeast Maf1, mammalian Maf1 is a phosphoprotein that is
phosphorylated by mammalian target of rapamycin complex 1 (mTORC1) (Kantidakis et
al., 2010; Michels et al., 2010; Shor et al., 2010). Treatment of cells with methyl

3
methanesulfonate (MMS) or rapamycin leads to Maf1 dephosphorylation, which
facilitates Maf1 interaction with RNA Pol III and transcription repression.

Studies in our lab have revealed Maf1 is covalently modified by the small ubiquitin-like
modifier (SUMO)(Rohira et al., 2013). Maf1 is SUMOylated by either SUMO1 or
SUMO2, and is de-sumoylated by the deSUMOylase SENP1. Enhanced Maf1
SUMOylation is observed by overexpressing SUMO1 or SUMO2 in U87 glioblastoma
cells and this increases Maf1-mediated RNA Pol III-dependent transcription repression.
In contrast, down-regulation of the only SUMO-conjugating enzyme, Ubc9, enhances
RNA Pol III-dependent transcription. These studies further indicate that the major
SUMOylation site on Maf1 is Lysine-35 (K35). Increased SUMOylation of Maf1
promotes its association with RNA Pol III. However, even with enhanced SUMO1
expression, Maf1 K35R does not effectively interact with RNA Pol III. Furthermore, Maf1
SUMOylation is not affected by its phosphorylation state. These results indicate that
SUMOylation is important for Maf1’s ability to repress RNA Pol III-dependent
transcription.

In addition to its role in repressing RNA Pol III-dependent transcription, our lab
demonstrated that Maf1 can also repress transcription by RNA Pol I and Pol II in
mammalian cells (Johnson et al., 2007). Maf1-mediated repression of RNA Pol I
transcription occurs through its ability to repress TBP expression. Since TBP can be
limiting for RNA pol I-dependent transcription, Maf1-mediated decreases in TBP can
indirectly decrease the transcription of these genes. Maf1 is also directly recruited to

4
specific RNA pol II-dependent promoters. Maf1 is associated with the TBP promoter
and its occupancy is reciprocal with that of Elk-1. Maf1 also selectively represses other
Elk-1-regulated promoters, such as egr-1, but not c-fos. Furthermore, Maf1 was
reported to regulate the expression of other RNA Pol II-transcribed genes. Maf1 was
reported to repress cyclin-dependent kinase inhibitor 1A (CDKN1A) expression by
occupying the promoter-associated short interspersed element (SINE) (Lee et al., 2015).
In this case, the occupancy of RNA Pol II and Pol III are reciprocal to that of Maf1 on the
same region. In another example, Maf1 represses the expression of fatty acid synthase
(FASN) and Acetyl-CoA Carboxylase-1 (ACC1) and binds to the FASN promoter (Palian
et al., 2014). Studies in C. Elegans (Khanna et al., 2014) further support the idea that
Maf1 represses the expression of FASN and ACC1. In contrast to its established
repressive role, Maf1 was recently reported to induce the expression of PTEN. Maf1 is
recruited to the PTEN promoter, where it enhances chromatin acetylation (Li et al.,
2016). Together, these studies indicate that Maf1 is recruited to select RNA Pol II-
dependent genes to regulate their expression.

Recent studies in our lab and others showed that the PI3K/AKT pathway regulates Maf1
expression (Khanna et al., 2014; Palian et al., 2014). PTEN positively regulates Maf1
expression by inhibiting the PI3K/AKT pathway. Forkhead box protein 01 (FoxO1), a
downstream effector that is negatively regulated by the PI3K/AKT pathway, induces
Maf1 protein expression. Importantly, these results identified Maf1 as a downstream
effector of PI3K/AKT signaling that regulates lipid metabolism and oncogenesis. As
Maf1 represses the expression of FASN and ACC1, the key enzymes that drive de novo

5
lipogenesis, reduced Maf1 expression increases lipid accumulation in Huh-7 cells. In
addition, studies in C. elegans showed that siRNA knockdown of Maf1 enhances lipid
accumulation in the intestine (Khanna et al., 2014). Together, these results establish an
important role for Maf1 in the regulation of lipid homeostasis.

Enhanced expression of FASN and ACC1, resulting in an increase in de novo
lipogenesis (Flavin et al., 2010; Jones and Infante, 2015), and the deregulation of Pol III
transcription are hallmarks of transformed cells and cancers (Bywater et al., 2013). As
Maf1 negatively regulates RNA Pol III-dependent transcription and lipogenesis, this
suggests that Maf1 may function as a potential tumor suppressor. Accordingly, our lab
showed that nuclear Maf1 expression is reduced in hepatocellular carcinoma and
prostate cancer tissues compared to matched normal tissues (Palian et al., 2014). More
extensive analysis further showed that Maf1 expression is frequently lost in different
subtypes of human liver cancers (Li et al., 2016). Maf1 overexpression decreases
anchorage independent growth in U87 glioblastoma cells (Johnson et al., 2007).
Furthermore, Maf1 expression also inhibits liver cell proliferation and its overexpression
delays tumor growth of Huh-7 cells in mice (Palian et al., 2014). Together, these results
support the idea that Maf1 is a tumor suppressor.

Recent studies reported that a whole-body knockout of Maf1 in mice exhibits a lean
phenotype (Bonhoure et al., 2015). The Maf1-deficient mice are resistant to diet-
induced obesity and nonalcoholic fatty liver disease. Energy expenditure is increased in
Maf1-deficient mice by several mechanisms. Maf1 knockout mice tissues display an

6
increase in precursor tRNAs synthesis, however no significant changes are observed in
mature tRNA amounts. Although lipogenesis is increased in the livers of Maf1-deficient
mice, induction of autophagy is also observed. This enhances lipid consumption,
resulting in a futile cycling of hepatic lipids. Thus, the Maf1-deficient mice do not
properly accumulate lipid in the liver under a high-fat diet due to metabolic inefficiency.

1.2: Embryonic stem cells
There are numerous cell types that comprise mammalian organisms. Multiple cell fate
decisions and precise differentiation steps generate these different cell types during
embryogenesis and early development. Therefore, understanding the molecular
mechanisms of early development is crucial in order to uncover the causes and
development of diseases. This knowledge can then be applied to facilitate our ability to
engineer cells and tissues to cure these defects. Since the technologies for examining
in vivo embryogenesis or early development is limited, model systems have been
developed in order to examine these processes in vitro (Nishikawa et al., 2007).

Embryonic stem (ES) cells are derived from the inner cell mass (ICM) of blastocyst-
stage embryos (Evans and Kaufman, 1981; Thomson et al., 1998). ES cells possess
two key properties, self-renewal and pluripotency. Self-renewal is the process by which
stem cells divide to make more stem cells, and the daughter cells maintain the same
developmental potential as the mother cells. Another important property of ES cells is
that they are pluripotent and can give rise to all cell types in the body. Because of these
two key properties, ES cells provide a suitable model for studying the molecular and

7
cellular biology of embryogenesis and early development. The pluripotency and self-
renewal of mammalian ES cells are maintained by several cellular mechanisms, the
most important of which is the core self-regulatory circuit, which is formed by three
transcription factors: Oct4, SOX2, and Nanog (Boyer et al., 2005). In controlling the ES
cell state, these three transcription factors function cooperatively to positively regulate
their own promoters, forming an autoregulatory and feed-forward loop. The core self-
regulator loop activates the expression of genes that are required for maintaining the
undifferentiated state of ES cells, and represses a subset of lineage-specific
differentiation genes to prevent the cells from exiting the ground state.

Both mouse and human ES cells can be cultured in vitro such that they maintain their
developmental properties under specific culture conditions. Leukemia inhibitory factor
(LIF) is important for supporting the maintenance of mouse ES cells in vitro, and can
stimulate its downstream effector, STAT3, to further activate the transcriptional network
of self-renewal genes (Smith et al., 1988). LIF withdrawal from mouse ES cell culture
leads to spontaneous differentiation of mouse ES cells into a mixed cell population. In
addition, inhibition of WNT and MEK/ERK signaling also play important roles in
maintaining mouse ES cells in vitro. By combining two small-molecule inhibitors (2i) of
glycogen synthase kinase-3 (GSK3), CHIR-99021, and mitogen-activated kinase kinase
(MEK), PD0325901, in the media, long-term mouse ES cell propagation can be
supported in vitro (Ying et al., 2008). In contrast to mouse ES cell cultures, LIF and 2i
are not sufficient to maintain human ES cells in vitro. Instead, fibroblast growth factor
(FGF) and Activin/Nodal signaling plays a central role in maintaining the ground state of

8
human ES cells (James et al., 2005; Vallier et al., 2005). To study ES cell differentiation
and embryogenesis at the cellular level, formation of embryoid bodies (EBs) from ES
cells provides a convenient system to examine the differentiation of these cells into the
three germ layers. To generate EBs, the extrinsic factors for maintaining the ES cell
state are withdrawn and cells aggregate spontaneously to form ball-shape cell bodies in
suspension conditions. The formation of EBs from ES cells mimics the process of early
embryonic development, and contains endoderm, ectoderm and mesoderm. EBs are a
niche for the subsequent formation of most cell lineages. Therefore, EBs can be further
terminally differentiated into specific cell types using different culture conditions.

Emerging evidence supports the idea that RNA Pol III-dependent transcription is
involved in regulating ES cell properties. ChIP-sequence analysis of RNA pol III
occupancy in human ES cells shows that RNA Pol III occupies a relative larger subset
of RNA Pol III-transcribed genes compared to other human cell types. This correlates
with active chromatin marks, such as H3K4me3. In addition, the occupancy of a subset
of self-renewal transcription factors, especially Nanog and Oct4, overlap with Pol III-
bound genes (Alla and Cairns, 2014). This suggests that self-renewal factors might help
RNA Pol III recruitment to its target genes. In addition, one report indicates that a
specific isoform of one of the RNA Pol III subunits, POLR3G, is important for
maintaining human ES cells in an undifferentiated state. POLR3G expression is
upregulated by Oct4 and Nanog. Reduced POLR3G expression promotes differentiation
of ES cells into the three germ layers. Interestingly, while down-regulation of POLR3G
promotes differentiation of ES cells this does not decrease global RNA Pol III-

9
dependent transcription, but instead, increases certain Pol III transcripts, such as
tRNA
Leu
and 5S rRNA (Wong et al., 2011). Together, these initial studies suggest that
RNA Pol III-dependent transcripts may play a role in determining the properties of ES
cells.

PI3K/AKT signaling is critical for maintaining the undifferentiated state of both human
and mouse ES cells (Singh et al., 2012; Watanabe et al., 2006). In ES cells, activated
PI3K/AKT signaling maintains ES cell self-renewal through repression of MEK/ERK and
canonical WNT signaling, which drives the expression of differentiation genes. Under
these conditions, Smad2/3 induces the expression of Nanog. Upon loss of PI3K/AKT
activity the WNT signaling target, GSK-3β, is activated by ERK that together with
Smad2/3 promotes the induction of differentiation genes. Hence, Smad2/3 serves as a
switch in controlling the balance of ES cell self-renewal and differentiation. Furthermore,
Phosphatase and Tensin Homolog (PTEN), the suppressor of PI3K/AKT signaling, is
also a key regulator of ES cell growth and differentiation (Alva et al., 2011). PTEN
knockdown increases the self-renewal ability, survival, and proliferation of ES cells, and
PTEN inhibition in mouse embryo fibroblasts (MEFs) promotes the production of
induced pluripotent stem cells (Liao et al., 2013).

In addition, studies have shown that FoxO1, a downstream effector of PI3K/AKT
signaling, is required for human ES cell self-renewal (Zhang et al., 2011). FoxO1
directly activates the expression of Oct4 and SOX2 by binding to their promoters.
Moreover, FoxO1 decreases the induction of endoderm and mesoderm marker genes,

10
but has no effect on ectoderm. Another downstream effector of PI3K/AKT signaling,
mTOR, plays an essential role in the proliferation and growth of mouse embryos and ES
cells (Murakami et al., 2004). In human ES cells, mTOR supports long-term ES cell self-
renewal and proliferation, and suppresses the induction of endoderm and mesoderm
(Zhou et al., 2009). However, long-term treatment of rapamycin or depletion of mTOR
can affect both mTOR complexes (mTORCs), mTORC1 and mTORC2 and these
different components may play different roles in regulating ES cell properties (Easley et
al., 2010). These studies indicated that mTORC2 activation in human ES cells is
important for maintaining the pluripotent ES cell states while mTORC1 activation is
required for inducing protein translation and ES cell differentiation. Collectively, these
studies suggest that the downstream effectors of PI3K/AKT signaling play diverse roles
in controlling ES cell properties.

1.3: Adipogenesis
Adipose tissue is a connective tissue that is able to store energy intake in the form of
lipid droplets, and plays a central role in regulating energy balance and glucose
homeostasis (Rosen and Spiegelman, 2006). There are two distinct types of adipose
tissues, brown (BAT) and white adipose tissue (WAT). BAT is only found in mammals.
This tissue serves as a center for thermogenesis to maintain core body temperature in
response to cold (Virtanen et al., 2009). WAT serves as an energy depot for lipid
storage. In addition to regulating energy storage, WAT has been characterized as an
endocrine organ involved in the regulation of the immune response, vascular
haemostasis, angiogenesis, blood pressure, and lipid metabolism etc. (Trayhurn, 2005).

11
Therefore, understanding adipose biology is important for identifying the causes of
metabolic diseases and designing treatments.

Adipocytes are the major component of adipose tissue. Adipocytes are derived from
multipotent mesenchymal stem cells, which originate from mesoderm. Adipogenesis is
the process by which stem cells or pre-adipocytes differentiate into mature adipocytes.
Adipogenesis has two phases. The first phase is the commitment of pluripotent or
multipotent stem cells to the adipocyte lineage, where stem cells are converted into pre-
adipocytes. The second phase is the terminal differentiation of the pre-adipocytes into
mature lipid containing adipocytes (Rosen and MacDougald, 2006). Since adipose
tissue contains a mixed population of cells, in order to study the specific formation of
adipocytes, in vitro differentiation of adipocytes from pluri- or multi-potent stem cells and
pre-adipocytes have been used to better understand the molecular mechanisms
underlying adipogenesis.

A complex and dynamic transcription factor network regulates adipogenesis.
Peroxisome proliferator-activated receptor γ (PPARγ) and the CCAAT-enhancer-binding
protein (C/EBP) family are the primary regulators of adipogenesis (Rosen et al., 2000).
PPARγ is a member of the nuclear hormone receptor superfamily, and it hetrodimerizes
with retinoid X receptor (RXR) to regulate transcription (Tontonoz et al., 1994). PPARγ
regulates a large number of genes that contain PPARγ response elements (PPREs).
These genes are required for different stages of adipocyte differentiation and function,
and include FABP4, GLUT4, and adiponectin (Lehmann et al., 1995). PPARγ is the

12
master regulator of adipogenesis, and is induced at an early stage of the process. Loss-
of-function studies have shown that PPARγ-null cells do not form adipose tissue in
chimeric mice. In addition, the PPARγ-null mouse ES cells fail to undergo adipogenesis
in vitro (Rosen et al., 1999).

The C/EBP family also plays an important role in adipogenesis. C/EBPβ and C/EBPδ
are the upstream transcriptional regulators of PPARγ and C/EBPα in adipogenesis.
These factors induce PPARγ expression by directly binding to the PPARγ promoter (Wu
et al., 1996; Wu et al., 1995). C/EBPα is another crucial factor for adipogenesis that
forms a positive feedback loop with PPARγ (Wu et al., 1999). C/EBPα induces
expression of the PPARγ promoter, and C/EBPα is also positively regulated by PPARγ
(Hamm et al., 2001; Wu et al., 1999). Depletion of C/EBPα in mice causes a selective
loss of WAT, but mammary fat and BAT is still formed (Linhart et al., 2001). Although
the C/EBP family is required for adipogenesis, these factors cannot promote
adipogenesis in the absence of PPARγ. For example, ectopic expression of C/EBPα
does not promote adipogenesis in PPARγ-deficient MEFs (Rosen et al., 2002). In
contrast, activation and expression of PPARγ induces adipogenesis in C/EBPα-null
MEFs (Wu et al., 1999). However, these C/EBPα-null adipocytes, which are
differentiated from C/EBPα-null MEFs with PPARγ expression, are defective as they
accumulate fewer lipids and have lower insulin sensitivity. PPARγ and C/EBPα
synergistically activate key adipocyte genes (Madsen et al., 2014). PPARγ facilitates
C/EBPα binding to their shared target genes and vice versa. Together, these results

13
demonstrate that PPARγ is the master regulator of adipogenesis, and it cooperates with
C/EBPα to generate functional adipocytes.

A variety of extracellular signaling pathways are also involved in the regulation of
adipogenesis. Insulin and insulin-like growth factors (IGF-1) are key hormones that
promote adipocyte differentiation (Chaika et al., 1997; Coutts et al., 1994). Insulin-
receptor substrate (IRS)/PI3K/AKT signaling is stimulated by insulin and IGF-1.
Knockout of select IRS proteins inhibit white adipocyte differentiation (Tseng et al.,
2004). IRS proteins also activate their downstream effector PI3K, which is also
important for adipogenesis. Inhibition of PI3K activity inhibits both human and mouse
adipocyte differentiation (Aubin et al., 2005; Sakaue et al., 1998; Tomiyama et al.,
1995). PI3K target, AKT, also plays a role in adipogenesis. siRNA knockdown of AKT1
blocks adipogenesis in 3T3-L1 cells (Xu and Liao, 2004), whereas inhibition of AKT2
decreases adipogenesis in human preadipocytes and mice (Fischer-Posovszky et al.,
2012; Garofalo et al., 2003).

The effects of FoxO1, another downstream effector of insulin signaling, on adipogenesis
are controversial. Some studies indicate that downregulation of FoxO1 decreases
adipogenesis (Munekata and Sakamoto, 2009), while others show that expression of a
constitutively active and gain-of-function mutant of FoxO1 at the early stage prevents
adipogenesis (Nakae et al., 2003). However, recent reports provide possible answers to
this controversy. FoxO1 expression is dynamic during adipogenesis, indicating that
altering FoxO1 expression at different stages may have different consequences on

14
adipogenesis (Zou et al., 2014). In addition, acetylation and deacetylation of FoxO1
through SIRT1, SIRT2, and miR-146b plays an important role in regulating FoxO1
function. Acetylated FoxO1 contributes to the induction of adiponectin expression, a
PPARγ target gene, through interaction with C/EBPα (Ahn et al., 2013; Qiao and Shao,
2006). In contrast, deacetylated FoxO1 represses PPARγ expression and further
decreases adipogenesis (Ahn et al., 2013; Jing et al., 2007; Qiao and Shao, 2006;
Wang and Tong, 2009).

Another downstream effector of insulin signaling, mTORC1 is involved in the regulation
of adipogenesis. Reduction of mTORC1 activity by rapamycin treatment or the knockout
of raptor, an mTORC1 component, decreases adipogenesis (Bell et al., 2000; Gagnon
et al., 2001; Polak et al., 2008). Furthermore, repression of S6K1, a downstream target
of mTORC1, impairs adipogenesis (Yoon et al., 2013). These results suggest that
mTORC1 and S6K positively regulate adipogenesis. Collectively, these reports indicate
that insulin and PI3K/AKT signaling plays an important role in adipogenesis to regulate
adipocyte differentiation at different stages.

The roles of Maf1 in controlling the cell growth properties and lipid biogenesis have
been revealed, and it functions as a tumor suppressor. As described above, Maf1 is
regulated by PI3K/AKT signaling including its downstream effectors, FoxO1 and
mTORC1. These effectors of PI3K/AKT pathway have been shown to play diverse but
important roles in early development including the regulation of ES cell states,
differentiation, and adipogenesis. Therefore, we were interested in understanding

15
whether Maf1 might play a role in early development and cellular differentiation. In this
study, we used in vitro model systems to explore a potential role for Maf1 in maintaining
ES cell properties. We determined that Maf1 positively regulates mouse ES cell
differentiation into mesoderm, but that it does not regulate mouse ES cell self-renewal.
We further demonstrated that Maf1 plays a positive role in the terminal differentiation of
these and other cells into adipocytes. Importantly, we found that Maf1 promotes
adipogenesis, at least in part, through its ability to repress RNA pol III-dependent
transcription. Together, our findings uncover a new role for Maf1 and RNA pol III-
dependent transcription in the regulation of ES cell differentiation and adipogenesis.

16
Chapter 2: Characterizing Maf1 expression in embryonic stem cells
2.1: Maf1 expression is markedly reduced during mouse ES cell differentiation
To characterize the role of Maf1 in early development, we first analyzed the
expression of Maf1 in mouse embryonic stem (ES) cells, and embryoid bodies (EBs)
derived from mouse ES cells. The differentiation of ES cells into EBs recapitulates
the early events of embryogenesis (Itskovitz-Eldor et al., 2000; Keller, 2005),
providing a proper in vitro model for studying Maf1 function during development. We
found that cellular Maf1 protein amounts were high in mouse ES cells, and they were
gradually reduced during the differentiation of mouse ES cells into EBs (Figure 1A).
However, there were no significant changes in Maf1 mRNA levels during
differentiation. Since Maf1 is a repressor of RNA Pol III-dependent transcription, we
examined the expression of RNA Pol III-dependent genes, pre-tRNA
Leu
and U6 small
nuclear RNAs, in mouse ES cells and EBs. Consistent with the reduction of Maf1
protein in mouse EBs, the expression of pre-tRNA
Leu
and U6 RNAs were increased
during ES cell differentiation into EBs (Figure 1B).

17

Figure 1: Maf1 protein expression is markedly reduced during mouse ES cell
differentiation into EBs.
(A) Immunoblot analysis of Maf1 protein expression in mouse ES cells and EBs at
the indicated days. Protein amounts were normalized to α-tubulin and the fold
change was calculated relative to the amount of protein in mES cells. (B) qRT-PCR
of Maf1 and Oct4 mRNA, and Maf1 target genes, tRNA
Leu
and U6 RNA, in mouse ES
cells and EBs at the indicated days. The amount of transcript was normalized to the
β-actin transcript levels. The fold change was calculated relative to the amount of
transcript in ES cells. Asterisks represent p<0.05 in a Student’s t test.

2.2: Maf1 expression is markedly reduced during human ES cell differentiation
In order to compare the expression profile of Maf1 in between mouse and human ES
cells, we examine the expression of Maf1 and its targets genes in human ES cells and
EBs to see whether the changes of Maf1 expression during differentiation are
conserved across species. Consistent with the results in mouse ES cells, Maf1 protein
levels were markedly reduced as the cells differentiated into EBs (Figure 2A). Also,
there were no significant changes in Maf1 mRNA levels during the differentiation
process. As Maf1 protein was reduced in EBs, pre-tRNA
Leu
and U6 RNA transcripts
were increased in human EBs compare to ES cells (Figure 2B).

18

Figure 2: Maf1 protein expression is markedly reduced during human ES cell
differentiation into EBs.
(A) Immunoblot analysis of Maf1 expression in human ES cells and EBs at day 14.
Protein amounts were normalized to α-tubulin and the fold change was calculated
relative to the amount of protein in hES cells. (B) qRT-PCR analysis of Maf1 and Oct4
mRNA, and Maf1 target genes: tRNA
Leu
, and U6 RNA. RNA was derived from human
ES cells and EBs at day 14. The amount of transcript was normalized to the
endogenous β-actin transcript levels. The fold change was calculated relative to the
amount of transcript in ES cells. Asterisks represent p<0.05 in a Student’s t test.

2.3: Summary
This data shows that Maf1 expression profiles are conserved during the differentiation
of ES cells into EBs. Maf1 protein expression is relatively high in both human and
mouse ES cells, and significantly reduced during their differentiation into EBs.
Moreover, a corresponding increase in Maf1-targeted RNA Pol III-dependent genes,
pre-tRNA
Leu
and U6 RNA, was observed as these cells differentiated into EBs.

19
Chapter 3: Analysis of the role of Maf1 in ES cell self-renewal and differentiation
3.1: Reduction of Maf1 expression does not affect ES cell self-renewal
ES cells have two key properties, self-renewal and pluripotency. In order to determine
whether Maf1 plays a role in either of these two properties, we first examined whether
Maf1 is necessary for ES cell self-renewal. Mouse ES cells were infected with two
different lentiviral shRNAs specific for Maf1 to decrease or knockdown Maf1 expression
(Figure 3A-B). Upon knockdown of Maf1, the Maf1 targeted gene, U6 RNA, was up-
regulated. However, Maf1 knockdown in mouse ES cells did not affect the expression of
key self-renewal genes, Oct4, Sox2, and Nanog compared with control cells (Figure
3B). These results suggested that Maf1 does not regulate the self-renewal of mouse ES
cells. To confirm this, control and Maf1-knockdown mouse ES cells were then analyzed
for the cell surface marker, SSEA-1 by immunostaining. The results showed that the
control and Maf1-knockdown ES cells were all equally stained SSEA-1 positive (Figure
3C). In addition, histochemical staining of another ES cell surface marker, alkaline
phosphatase (AP), showed that AP was comparably active in both control and Maf1-
knockdown mouse ES cells (Figure 3D). Moreover, reduced Maf1 expression in mouse
ES cells did not alter the accumulation rate of the cells (Figure 3E). Together, our
results indicate that altered Maf1 expression does not affect the self-renewal or the
proliferative capacity of mouse ES cells.

20

Figure 3: Maf1 knockdown does not affect ES cell self-renewal
Maf1 expression was decreased in mouse ES cells using a lentiviral pLKO.1 construct
and two unique shRNAs that target Maf1 mRNA. (A) Immunoblot analysis of Maf1
protein levels in control and Maf1 knockdown mouse ES cells. Protein amounts were
normalized to α-tubulin and the fold change was calculated relative to the amount of
protein in control ES cells. (B) qRT-PCR analysis of Maf1, Oct4, SOX2, and Nanog
mRNAs in mouse ES cells. The amount of transcript was normalized to the β-actin
transcripts. The fold change was calculated relative to the control lentivirus infected
cells. Asterisks represent p<0.05 in a Student’s t test. (C) Immunostaining images of
control and Maf1 knockdown mouse ES cells stained with antibody against SSEA1. (D)
Alkaline phosphatase staining of control and Maf1 knockdown mouse ES cells. (E) Cell
accumulation rates of control and Maf1 knockdown ES cells.

21
3.2: Maf1 selectively perturbs the differentiation of mouse ES cells into mesoderm
As altered Maf1 expression had no effect on mouse ES cell self-renewal, we next
assessed whether Maf1 is involved in regulating the pluripotency of mouse ES cells. We
reduced Maf1 expression in mouse ES cells and differentiated those cells into EBs that
comprise the three primary germ layers. The expression of markers that specify
endoderm (GATA4 and GATA6), mesoderm (T and Mesp1), and ectoderm (Nestin and
SOX1) were analyzed. Upon Maf1 knockdown, no significant changes in the expression
of either endoderm or ectoderm marker genes were observed (Figure 4A). However, a
dramatic reduction in mesoderm markers was observed in EBs. Consistent with these
results, increased Maf1 expression in mouse ES cells resulted in enhanced expression
of the mesoderm marker, T, at both the mRNA and protein levels in EBs (Figure 4B-C).

22

Figure 4: Maf1 promotes the expression of mesodermal markers
(A) qRT-PCR analysis was performed to determine potential changes in mRNA
expression of the markers associated with the three germ layers shown in control and
Maf1 knockdown mouse ES cells and EBs at the indicated days. Black bars represent
control cells, red bars represent the cells infected with Maf1 shRNA-1, and green bars
represent the cells infected with Maf1 shRNA-2. (B) qRT-PCR analysis to determine
changes in mRNA expression of Maf1, T, and Oct4 in rtTA-control and Maf1-induced
mouse ES cells and EBs. Black bars represent rtTA-control cells, and orange bars
represent the cells with ectopic expression of Maf1. (A-B) Transcript amounts were
normalized to β-actin and the fold change was calculated relative to the amount of
transcript in control ES cells. Asterisks represent p<0.05 in a Student’s t test. (C)
Immunoblot analysis of Maf1, T, and β-actin protein expression in mouse ES cells and
EBs at the indicated days. Protein amounts were normalized to β-actin and the fold
change was calculated relative to the amount of protein in control ES cells.

23
3.3: Summary
In this chapter our results demonstrated that altered Maf1 expression does not affect
the self-renewal property of mouse ES cells. Altered Maf1 expression in mouse ES cells
had no effect on the expression of the self-renewal genes, Oct4, SOX2, and Nanog.
Consistent with these results, no change in the surface markers, SSEA-1 and alkaline
phosphatase was observed. However, our results uncover a new role for Maf1 in mouse
ES cell pluripotency. A reduction in Maf1 expression resulted in a significant decrease in
the expression of mesoderm markers, but not in the expression of endoderm and
ectoderm markers. Together, our results indicate that Maf1 supports the commitment of
mouse ESs into EBs to form the mesoderm germ layer.

Chapter 4: Maf1 promotes adipogenesis
4.1: Decreased Maf1 expression inhibits the terminal differentiation of ES cells
into adipocytes
Since we determined that Maf1 promotes mesoderm differentiation, we further tested
whether altered Maf1 expression would affect the terminal differentiation of cells derived
from the mesoderm lineage. Given that Maf1 regulates lipid homeostasis (Bonhoure et
al., 2015; Palian et al., 2014), and adipocytes are one of the derivatives of mesoderm,
we examined whether decreased expression of Maf1 in mouse ES cells and the
impairment of mesoderm induction might affect the terminal differentiation of these cells
into adipocytes. Reduced Maf1 expression in mouse ES cells resulted in a significant
increase in RNA Pol III-dependent genes (Figure 5A). As the cells underwent terminal

24
differentiation into adipocytes, tRNA
Leu
and U6 RNA transcripts were reduced, even
when Maf1 expression was decreased. However, decreased Maf1 expression resulted
in a significant reduction in the two key adipogenic regulators, PPARγ and C/EBPα, and
their downstream target FABP4 in mature adipocytes (Figure 5A). This corresponded to
a marked decrease in the number of lipid producing colonies (Figure 5B). Together,
these results support the idea that Maf1 promotes the terminal differentiation of mouse
ES cells into adipocytes.

25

Figure 5: Maf1 knockdown compromises adipogenesis in mouse ES cells.
(A) qRT-PCR analysis to determine the changes in RNA expression of Maf1,
tRNA
Leu
, U6 RNA, PPARγ, C/EBPα, and FABP4 during the differentiation from
mouse ES cells into adipocytes at day 22 (D22). Transcript amounts were
normalized to β-actin and the fold change was calculated relative to the amount of
transcript in control ES cells. Black bars represent control cells, red bars represent
the cells infected with Maf1 shRNA-1, and white bars represent the cells infected
with Maf1 shRNA-2. Asterisks represent p<0.05 in a Student’s t test. (B) Oil-red O
staining represents the lipid accumulation in adipocytes that are differentiated from
control and Maf1 knockdown mouse ES cells, which is shown on the left.
Quantification of Oil-red O staining is shown on the right. Asterisks represent p<0.05
in a Student’s t test.

26
4.2: Maf1 knockdown impairs adipogenesis of 3T3-L1 cells
We showed that reduced Maf1 expression in mouse ES cells impairs their terminal
differentiation into adipocytes. This may be a result of defects in the differentiation of
these cells into mesoderm, or Maf1 may play an additional role in the terminal
differentiation of pre-adipocytes. To clarify this, we altered Maf1 expression in 3T3-L1
pre-adipocytes, and differentiated these cells into mature adipocytes. Upon
differentiation, Maf1 expression was increased (Figure 6A-B). Knockdown of Maf1
resulted in an increase in pre-tRNA
Leu
and pre-tRNA
i
Met
in pre-adipocytes; however, a
reproducible increase in pre-tRNA
Leu
was also observed when these cells were
differentiated into adipocytes. Furthermore, reduced Maf1 expression resulted in a
significant decrease in the induction of adipogenic genes, PPARγ, C/EBPα, and FABP4
in mature adipocytes at both the RNA and protein levels (Figure 6A-B). This resulted in
a corresponding decrease in adipocyte formation (Figure 6C). These results indicate
that Maf1 not only plays a role in the commitment of mouse ES cells to form mesoderm,
but it drives the terminal differentiation of pre-adipocytes.

27

Figure 6: Maf1 knockdown compromises adipogenesis in 3T3-L1 cells.
(A) qRT-PCR analysis to determine the changes in RNA expression of Maf1, tRNA
Leu
,
tRNA
i
Met
, PPARγ, C/EBPα, and FABP4 during the differentiation from 3T3-L1 cells into
adipocytes at day 6 (D6). Transcript amounts were normalized to β-actin and the fold
change was calculated relative to the amount of transcript in day 0 control 3T3-L1 cells.
Black bars represent control cells, green bars represent the cells infected with Maf1
shRNA. Asterisks represent p<0.05 in a Student’s t test. (B) Immunoblot analysis of
Maf1, PPARγ, C/EBPα, FABP4, perilipin, and α-tubulin in control and Maf1 knockdown
3T3-L1 cells at the indicated days. Quantification of immunoblots is shown on the right.
Protein amounts were normalized to α-tubulin and the fold change was calculated
relative to the amount of protein in day0 control 3T3-L1 cells. (C) Oil-red O staining
represents the lipid accumulation in adipocytes that are differentiated from control and
Maf1 knockdown 3T3-L1 cells. Quantification of Oil-red O staining is shown on the right.
Asterisks represent p<0.05 in a Student’s t test.

28
Chapter 4.3: Expression of Maf1 in Maf1-deficient MEFs promotes adipogenesis
To further examine the role of Maf1 in adipogenesis, we differentiated Maf1-/- mouse
embryonic fibroblasts (MEFs) into adipocytes with and without ectopically expressing
Maf1. Upon differentiation, ectopic expression of Maf1 in these cells dramatically
reduced the expression of tRNA transcripts (Figure 6A), and significantly enhanced the
mRNA and protein expression of PPARγ, C/EBPα, and FABP4 (Figure 7A-B) compared
to the cells without ectopic Maf1 expression. This corresponded to an increase of the
number of lipid producing colonies (Figure 7C). Collectively, these results support the
idea that Maf1 promotes adipogenesis.

29
Figure 7: Ectopic expression of Maf1 induces adipogenesis in Maf1-/- MEFs.
Maf1-/- MEF cells has infected with doxycycline inducible rtTA construct as control and
con-infected with rtTA and Maf1-HA constructs to ectopic express Maf1 in the cells. (A)
qRT-PCR analysis to determine the changes in RNA expression of tRNA
Leu
, tRNA
i
Met
,
PPARγ, C/EBPα, and FABP4 during the differentiation from rtTA and Maf1 expressed
Maf1-/- MEF cells into adipocytes at day 12 (D12). Transcript amounts were normalized
to β-actin and the fold change was calculated relative to the amount of transcript at day
0 rtTA Maf1-/- MEF cells. Black bars represent control rtTA cells, orange bars represent
the cells with ectopic expression of Maf1. Asterisks represent p<0.05 in a Student’s t
test. (B) Immunoblot of HA-tagged Maf1, PPARγ, C/EBPα, and FABP4, perilipin, and β-
actin in rtTA and Maf1 expressed Maf1-/- MEF cells. Quantification of immunoblots is
shown on the right. Protein amounts were normalized to α-tubulin and the fold change
was calculated relative to the amount of protein in day 0 rtTA control Maf1-/- MEF cells.
(C) Oil-red O staining represents the lipid accumulation in adipocytes that are
differentiated from control and Maf1-HA expressed Maf1 -/- MEFs. Quantification of Oil-
red O staining is shown on the right. Asterisks represent p<0.05 in a Student’s t test.

30
4.4: Summary
Our results define a novel role for Maf1 in cellular differentiation. Maf1 promotes the
ability of mouse ES cells, 3T3-L1 cells, and MEFs to differentiate into adipocytes. Maf1
expression is positively correlated with expression of the key pro-adipogenic genes,
PPARγ, C/EBPα, and their target gene, FABP4, and a corresponding increase in lipid
forming colonies. Together, our results indicate that Maf1 not only plays a role in the
early commitment of mouse ES cells into mesoderm, but that it also promotes the
terminal differentiation of these cells into adipocytes.

Chapter 5: RNA Pol III-dependent transcription repression contributes to
adipogenesis
5.1: Treatment with the RNA Pol III inhibitor, ML-60218, promotes adipogenesis of
3T3-L1 cells
As Maf1 negatively regulates RNA pol III-dependent transcription, we were interested in
determining whether repression of RNA Pol III-dependent transcription contributes to
the ability of Maf1 to enhance adipogenesis. To test this, we used ML-60218, a small-
molecule inhibitor of RNA Pol III (Wu et al., 2003), to repress RNA Pol III-dependent
transcription in 3T3-L1 cells, and examined whether it affected adipogenesis. 3T3-L1
pre-adipocytes were treated with ML-60218 for one day prior to the differentiation and it
was removed three days later. A modest but reproducible decrease in RNA pol III-
dependent transcripts was observed with the initial ML-60218 treatment (Figure 8A). As
the differentiation proceeded, the ML-60218 treatment resulted in enhancement of both

31
mRNA and protein expression of PPARγ, C/EBPα, and FABP4 (Figure 8A-B), resulting
in a corresponding increase in adipogenesis (Figure 8C).

Figure 8 ：ML-60218 treatment enhances adipogenesis in 3T3-L1 cells.
(A) qRT-PCR analysis to determine the changes in RNA expression of tRNA
Leu
,
tRNA
i
Met
, PPARγ, C/EBPα, and FABP4 during the differentiation from DMSO control
and ML-60218 treated 3T3-L1 cells into adipocytes at day 6 (D6). Transcript amounts
were normalized to β-actin and the fold change was calculated relative to the amount of
transcript at day 0 control cells. Black bars represent control cells with DMSO treatment,
green bars represent the cells with ML-60218 treatment. Asterisks represent p<0.05 in a
Student’s t test. (B) Immunoblot of PPARγ, C/EBPα, and FABP4, and β-actin in DMSO
control and ML-60218 treated 3T3-L1 cells. Quantification of immunoblots is shown on
the right. Protein amounts were normalized to β-actin and the fold change was
calculated relative to the amount of protein in day 0 DMSO control cells. (C) Oil-red O
staining represents the lipid accumulation in adipocytes that are differentiated from
DMSO control and ML-60218 treated 3T3-L1 cells. Quantification of Oil-red O staining is
shown on the right. Asterisks represent p<0.05 in a Student’s t test.

32
5.2: Brf1 knockdown promotes adipogenesis of 3T3-L1 cells
In order to validate our results that repression of RNA Pol III-dependent transcription
promotes adipogenesis in 3T3-L1 cells, we next repressed RNA Pol III-dependent
transcription in a different manner by decreasing the expression of Brf1, an RNA Pol III-
specific TFIIIB transcription component. Reduction of Brf1 expression in 3T3-L1 cells
produced a significant decrease in tRNA transcripts prior to differentiation (Figure 9A).
Consistent with that was observed with ML-60218 treatment, Brf1 knockdown led to a
substantial increase in both mRNA and protein expression of PPARγ, C/EBPα, and
FABP4 in the differentiated 3T3-L1 cells (Figure 9A-B). This corresponded to an
increase in adipogenesis (Figure 9C).

33

Figure 9: Brf1 knockdown promotes adipogenesis in 3T3-L1 cells.
(A) qRT-PCR analysis to determine the changes in RNA expression of tRNA
Leu
,
tRNA
i
Met
, PPARγ, C/EBPα, and FABP4 during the differentiation from control and Brf1-
knockdown 3T3-L1 cells into adipocytes at day 5 (D5). Transcript amounts were
normalized to β-actin and the fold change was calculated relative to the amount of
transcript at day 0 control cells. Asterisks represent p<0.05 in a Student’s t test. (B)
Immunoblot of Brf1, PPARγ, C/EBPα, and FABP4, and β-actin in control and Brf1-
knockdown 3T3-L1 cells. Quantification of immunoblots is shown on the right. Protein
amounts were normalized to β-actin and the fold change was calculated relative to the
amount of protein in day 0 control cells. (C) Oil-red O staining represents the lipid
accumulation in adipocytes that are differentiated from control and Brf1-knockdown
3T3-L1 cells. Quantification of Oil-red O staining is shown on the right.

5.3: Summary
In this chapter, our results demonstrate that repression of RNA Pol III-dependent
transcription by either ML-60218 treatment or Brf1 knockdown enhances the expression
of pro-adipogenic genes, PPARγ, C/EBPα, and FABP4, producing a corresponding
increase in adipogenic differentiation of 3T3-L1 cells. These results reveal that the

34
repression of RNA Pol III-dependent transcription contributes to the ability of Maf1 to
enhance the adipogenesis.

Chapter 6: RNA Pol III-dependent transcription repression requires Maf1 to
facilitate adipogenesis
6.1: Treatment with ML-60218 has no effect on adipogenesis in 3T3L1 cells with
decreased Maf1 expression
To determine whether repression of RNA Pol III-dependent transcription, alone, can
restore the impairment of adipogenesis seen in the Maf1-knockdown 3T3-L1 cells, we
treated the Maf1-knockdown 3T3-L1 cells with the ML-60218 from day -1 to day 3 of the
differentiation. In contrast to what was observed in control cells treated with ML-60218,
there was no change in the expression of the RNA pol III transcripts in Maf1 knockdown
cells treated with ML-60218. While mRNA and protein expression of PPARγ, C/EBPα,
and FABP4 were elevated in ML-60218-treated control cells, surprisingly, no significant
changes of these pro-adipogenic genes were observed in the ML-60218-treated Maf1-
knockdown 3T3-L1 cells (Figure 10A-B). Consistent with these results, the formation of
lipid producing colonies was increased in ML-60218-treated control cells, but no
significant changes were observed in Maf1-knockdown ML-60218-treated 3T3-L1 cells
(Figure 10C).

35

Figure 10: ML-60218 treatment has no effect on adipogenesis in 3T3-L1 cells with
decreased Maf1 expression.
(A) qRT-PCR analysis to determine the changes in RNA expression of Maf1, tRNA
Leu
,
tRNA
i
Met
, PPARγ, C/EBPα, and FABP4 during the differentiation from DMSO and ML-
60218 treated control and Maf1-knockdown 3T3-L1 cells into adipocytes at day 6 (D6).
Transcript amounts were normalized to β-actin and the fold change was calculated
relative to the amount of transcript at day 0 control cells. Asterisks represent p<0.05 in a
Student’s t test. (B) Immunoblot of PPARγ, C/EBPα, and FABP4, and β-actin in DMSO
and ML-60218 treated control and Maf1-knockdown 3T3-L1 cells. Quantification of
immunoblots is shown on the right. Protein amounts were normalized to β-actin and the
fold change was calculated relative to the amount of protein in day 0 DMSO control
cells. (C) Oil-red O staining represents the lipid accumulation in adipocytes that are
differentiated from DMSO and ML-60218 treated control and Maf1-knockdown 3T3-L1
cells. Quantification of Oil-red O staining is shown on the right.

36
6.2: Treatment with ML60218 has no effect on adipogenesis in Maf1-/- MEFs
To further test if RNA pol III inhibition would affect adipogenesis in the absence of Maf1,
we treated Maf1-/- MEFs with ML-60218 with and without ectopic expression of Maf1.
Cells were incubated with ML-60218 one day prior to the addition of the differentiation
cocktail and removed three days later. Significant deceases in tRNA gene transcripts
were observed in the ML-60218-treated control cells on day 0 compared to DMSO-
treated control cells. While ectopic expression of Maf1 significantly repressed tRNA
gene transcripts compared to DMSO-treated control cells, no further effect was
observed with the additional treatment of ML-60218 (Figure 11A). Consistent with the
results in Maf1-knockdown 3T3-L1 cells, little change in PPARγ, C/EBPα, and FABP4
expression was observed with ML-60218-treated Maf1-/- MEFs. However, ectopic Maf1
expression enhanced the expression of PPARγ, C/EBPα, and FABP4 compared to
either DMSO- or ML-60218-treated cells. Additional ML-60218 treatment further
enhanced the expression of PPARγ, C/EBPα, and FABP4 (Figure 11A). A modest but
reproducible corresponding change in adipocyte formation was observed by Oil-red O
staining (Figure 11B)

37

Figure 11: ML-60218 treatment has no effect on adipogenesis in Maf1-/- MEFs.
(A) qRT-PCR analysis to determine the changes in RNA expression of tRNA
Leu
,
tRNA
i
Met
, PPARγ, C/EBPα, and FABP4 during the differentiation from DMSO and ML-
60218 treated control and Maf1-expressed Maf1-/- MEFs into adipocytes at day 12
(D12). Transcript amounts were normalized to β-actin and the fold change was
calculated relative to the amount of transcript in day 0 control cells. Asterisks represent
p<0.05 in a Student’s t test. (B) Oil-red O staining represents the lipid accumulation in
adipocytes that are differentiated from DMSO and ML-60218 treated control and Maf1-
expressed Maf1-/- MEFs. Quantification of Oil-red O staining is shown on the right.

38
6.3: Summary
Our results indicate that treatment with the RNA pol III inhibitor, ML-60218, in Maf1-
knockdown 3T3-L1 cells or Maf1-deficient MEFs is unable to induce expression of
PPARγ, C/EBPα, and FABP4 and enhance adipogenesis. These results indicate that
decreases in RNA pol III-dependent transcription, alone, are not sufficient to drive
adipogenesis and that minimum levels of cellular Maf1 are needed in order for RNA pol
III repression to enhance adipogenesis. This results further support the idea that Maf1
may possess other functions, in addition to repressing RNA pol III-mediated
transcription, in order to facilitate changes in the expression of the pro-adipogenic
genes and adipogenesis.

39
Chapter 7: Discussion
7.1: Maf1 promotes ES cell differentiation into mesoderm
Previous studies have focused on the ability of Maf1 to regulate cellular growth
properties and tumorigenesis. Given that many developmental pathways are
deregulated in cancer, we chose to examine a potential role for Maf1 in early
development. In our current study, we uncovered a new biological role for Maf1 in
regulating ES cell differentiation.

Our results showed that Maf1 protein expression is relatively high in both human and
mouse ES cells, and markedly reduced during their differentiation into EBs. We further
showed that manipulation of Maf1 expression in mouse ES cells led to a corresponding
increase in RNA Pol III-dependent transcripts. However, no changes in Oct4, SOX2,
and Nanog mRNAs were observed. Additionally, altered Maf1 expression did not affect
the maintenance of mouse ES cell self-renewal state, as revealed by histochemical
staining and immunostaining of the mouse ES cell surface markers, alkaline
phosphatase and SSEA-1, respectively. Furthermore, accumulation rates of mouse ES
cells in culture are not affected by changes in Maf1 expression. Collectively, our results
indicate that Maf1 does not appear to be involved in the regulation of mouse ES cell
self-renewal. However, Maf1 is still functioning to repress RNA Pol III-dependent
transcription in mouse ES cells. Therefore, these results suggest that Maf1 may function
as a RNA Pol III-dependent transcription repressor in mouse ES cells and that this
repression may be needed to prevent the differentiation of the ES cells.

40
Since altered Maf1 did not affect mouse ES cell self-renewal, we then examined
whether Maf1 might play a role in regulating mouse ES cell differentiation. Our results
showed that alterations in Maf1 expression positively correlates with the expression of a
subset of mesodermal marker genes, which suggests that Maf1 may facilitate the
differentiation of mouse ES cells into mesoderm. In contrast, our results showed that
changes in Maf1 expression did not significantly affect the expression of a subset of
endoderm and ectoderm marker genes. However, we cannot rule out that Maf1 could
also regulate other subsets of endodermal or ectodermal genes and play a role in the
development of these germ layers. Therefore, further studies are needed to examine
the overall impact of Maf1 in germ layer development during ES cell differentiation.

Our results demonstrate that Maf1 functions as a RNA Pol III-dependent transcription
repressor in mouse ES cells and that RNA Pol III-dependent transcription is upregulated
during ES cell differentiation into EBs. This supports the idea that RNA Pol III-
dependent transcription could play a role in ES cell differentiation. Consistent with this
idea, previous studies reported that RNA Pol III transcripts, ribosome biogenesis, and
protein translation are all upregulated during ES cell differentiation (Easley et al., 2010;
Sampath et al., 2008; Sanchez et al., 2016; Wong et al., 2011). One of the RNA Pol III
subunits, POLR3G, is upregulated during ES cell differentiation into EBs (Wong et al.,
2011). POLR3G is required for ES cell self-renewal and its downregulation leads to
differentiation. Interestingly, increases in a subset of RNA Pol III-transcripts, including
tRNA
Leu
and 5S rRNA, were observed in these differentiated ES cells (Wong et al.,

41
2011). These results are consistent with our overall observations supporting the idea
that RNA Pol III-dependent transcription plays a role in ES cell differentiation.

Emerging evidence indicates that protein translation and ribosome biogenesis are
increased during ES cell differentiation. A global increase in polysomes, protein
synthesis, and protein content is observed during the differentiation of mouse ES cells
into EBs (Sampath et al., 2008). Consistent with these results, global protein translation
is increased in human ES-differentiated fibroblasts compared to human ES cells (Easley
et al., 2010). Furthermore, it has been shown that enhanced ribosome biogenesis is
accompanied by an increase in protein synthesis during Drosophila germline stem cell
differentiation (Sanchez et al., 2016). Interestingly, a hemizygous chromosomal deletion
of ribosomal protein S5 (Rps5), a 40S ribosomal subunit, in mouse ES cells impairs the
expression of mesoderm genes in EBs, but this deletion does not affect ES cell self-
renewal (Fortier et al., 2015). These results and our observed enhanced expression of
tRNAs in EBs, components of the protein synthesis machinery, suggest that tRNA
increases could mediate changes in protein translation to drive the ES differentiation
process.

Our results show that Maf1 protein amounts are markedly decreased during ES cell
differentiation, yet how the cellular concentrations of Maf1 are regulated to produce
these changes is unknown. Previous studies showed that Maf1 protein amounts are
negatively regulated by PI3K/AKT signaling. However, PI3K/AKT signaling is activated
in ES cells and this is necessary for maintaining the ES cell self-renewal property

42
(Watanabe et al., 2006). This suggests that PI3K/AKT signaling may not be the
predominant pathway that regulates Maf1 in this context. Interestingly, FoxO1, which is
negatively regulated and excluded from the nucleus by PI3K/AKT activation (Brunet et
al., 1999), was shown to have a similar expression pattern as Maf1 during human and
mouse ES cell differentiation (Zhang et al., 2011). In addition, FoxO1 is mostly nuclear-
localized despite the activation of PI3K/AKT signaling in human ES cells. As previous
studies demonstrated that FoxO1 positively regulates Maf1 protein expression in other
cell lines (Palian et al., 2014), FoxO1 could be a potential regulator of Maf1 in ES cells.
However, further studies are needed to determine whether FoxO1 regulates Maf1, or
whether other signaling pathways are involve in the regulation Maf1 expression as ES
cells differentiate into EBs.

Maf1 is inhibited by mTORC1-dependent phosphorylation, and enhanced by covalent
SUMO modification (Michels et al., 2010; Rohira et al., 2013; Shor et al., 2010).
Whether these post-translational modifications play any role in regulating Maf1 activity
in ES cells remains to be determined. Intriguingly, previous reports indicate that
activated mTORC1 signaling is required to induce protein translation and promote ES
differentiation (Easley et al., 2010; Sampath et al., 2008; Sanchez et al., 2016).
However, another study showed that mTORC1 inhibition impedes endoderm
differentiation, significantly enhances the expression of a mesoderm marker gene, T,
and promotes the differentiation of human ES cells into mesoderm (Nazareth et al.,
2016). These results suggest that mTORC1 may have different activities in affecting ES
cell fate-decisions. As mTORC1 inactivation could potentially increase Maf1 activity,

43
and our results show that Maf1 positively regulates mesoderm marker induction, it is
possible that mTORC1 might regulate Maf1 activity in ES cells and EBs. As Maf1
protein amounts are significantly decreased in the EBs, this may allow for enhanced
Maf1 activity during the differentiation process. However, further analysis of possible
changes in the phosphorylation state of Maf1 is needed to test this idea.

7.2: Maf1 promotes adipogenesis
Our study found that Maf1 positively regulates ES cell induction into mesoderm. Since
mesoderm can give rise to many different cell types, including adipocytes,
cardiomyocytes, blood cells, and bone cells (Williams et al., 2012), we were interested
in whether Maf1 might regulate the terminal differentiation of mesoderm derivatives. As
Maf1 negatively regulates lipid biogenesis, and adipocytes are one of the lineages of
mesoderm, we decided to examine if Maf1 plays a role in the terminal differentiation of
adipocytes.

Our results demonstrated that Maf1 promotes adipogenesis in three different cell
models. Mouse ES cells that were differentiated into EBs were programmed to further
terminally differentiate into adipocytes. Knockdown of Maf1 impaired the terminal
differentiation of these cells into adipocytes, as revealed by Oil-red O staining. A
reduction in Maf1 expression resulted in a decrease in the expression of the key
adipogenic factors, PPARγ, C/EBPα, and FABP4 during the terminal differentiation of
the ES cells. To determine whether this effect was a result of a defect in mesoderm
induction, or whether Maf1 has an additional role in adipogenesis, we used two other

44
models to specifically examine the role of Maf1 in adipogenesis, subsequent to
appropriate mesoderm formation. Consistent with the results in ES cells, we found that
downregulation of Maf1 during the terminal differentiation of 3T3-L1 preadipocytes also
inhibited adipogenesis. These results support the idea that in addition to its role in
mesoderm formation, Maf1 plays an additional role in the terminal differentiation of
preadipocytes into adipocytes. To further test these results, we used Maf1-deficient
MEFs to investigate the role of Maf1 in adipogenesis. While the Maf1-deficient MEFs
did not undergo adipogenesis as robustly as what was observed in either mouse ES
and 3T3-L1 cells, ectopic expression of Maf1 in the Maf1-deficient MEFs enhanced the
expression of PPARγ, C/EBPα, and FABP4, which further led to an increase in the
number of mature adipocyte colonies. Together, we have shown that Maf1 positively
regulates the expression of the key adipogenic factors, and enhances the terminal
differentiation of all three different cell types into mature adipocytes. These results
reveal that Maf1 not only plays a role in the commitment of mouse ES cells into
mesoderm, but it also promotes the terminal differentiation of preadipocytes into mature
adipocytes.

Recent studies demonstrated that a whole-body knockout of Maf1 in mice results in a
lean phenotype (Bonhoure et al., 2015). A robust increase in precursor tRNAs are
formed in the livers of the mice, yet the amount of total mature tRNAs remains similar to
the wild type mice. The energy expenditure is enhanced in the Maf1-deficient mice due
to the high nucleotide consumption, which leads to an increase in lipid consumption.
Therefore, the Maf1-deficient mice do not store lipids in the liver under a high-fat diet

45
due to metabolic inefficiency. These results appear to be inconsistent with previous
studies demonstrating that ectopic Maf1 expression inhibits intracellular lipid
accumulation in the liver of mice fed a high-carbohydrate diet (Palian et al., 2014). While
metabolic inefficiency clearly contributes to the mouse Maf1 knockout phenotype, our
current study provides an additional explanation for the apparent discrepancy in the two
studies. Our results show that Maf1 plays a role in facilitating mesoderm formation
during embryogenesis and the subsequent differentiation of adipocytes. Deletion of
Maf1 in early embryonic development may disrupt the proper formation of these cells.
However, when cells are appropriately differentiated, Maf1 may then switch its role to
repress lipid biogenesis to regulate lipid homeostasis. Further work is needed to test
this hypothesis.

7.3: The mechanism of Maf1-mediated induction of adipogenesis
As our results uncovered a novel role for Maf1 in adipogenesis, we further examined
how Maf1 drives adipogenesis. Maf1 is a transcription repressor that represses both
RNA Pol III-dependent and select RNA Pol II-dependent transcription (Johnson et al.,
2007; Khanna et al., 2014; Lee et al., 2015; Palian et al., 2014). In addition, a recent
study reported that Maf1 is associated with the PTEN promoter to enhance PTEN
expression. Our results show that Maf1 enhances the expression of the key pro-
adipogenic factors, PPARγ and C/EBPα. There are three potential mechanisms by
which Maf1 could regulate these genes. First, Maf1-mediated repression of RNA Pol III-
dependent transcription may indirectly enhance the expression of pro-adipogenic genes.
Second, Maf1 may repress the expression of genes whose products repress these pro-

46
adipogenic genes. Third, Maf1 may directly promote the expression of these pro-
adipogenic genes.

To test the first possibility, we determined whether Maf1-mediated repression of RNA
Pol III-dependent transcription contributes to its ability to promote adipogenesis. To do
so, we used two approaches, one using a chemical compound, ML-60218, that inhibits
RNA pol III, and in the other approach, we decreased the expression of one of the
TFIIIB components, Brf1. Interestingly, we found that repression of RNA Pol III-
dependent transcription in 3T3-L1 cells enhanced the expression of PPARγ, C/EBPα,
and FABP4, and enhanced adipogenesis. These results support the idea that RNA Pol
III-dependent transcription repression contributes to Maf1-mediated induction of
adipogenesis. However, the repression of RNA pol III was unable to drive adipogenesis
when Maf1 expression was decreased in these cells. Thus, our results also suggest that
RNA pol III repression, alone, is insufficient to promote adipogenesis and that Maf1
needs to be adequately expressed in these cells in order to promote adipogenesis.
These results are further substantiated in Maf1-deficient MEFs, as decreased RNA Pol
III-dependent transcription does not promote adipogenesis Maf1-deficient MEFs.
However, decreased RNA pol III-dependent transcription, together with ectopic
expression of Maf1, was able to enhance adipogenesis. Together, our results suggest
that RNA Pol III-dependent transcription repression drives the terminal differentiation of
pre-adipocytes but requires adequate expression of Maf1 in order to facilitate
adipogenesis. These results further indicate that Maf1 has other functions, in addition to
its repression of RNA Pol III-dependent transcription, that work to promote adipogenesis.

47

So how are RNA pol III-mediated transcription changes driving adipogenesis? Recent
studies showed that when adipose-derived stem cells (ADSCs) are reprogramed to
induced pluripotent stem cells (iPSCs), RNA Pol III occupies a relatively larger subset of
RNA Pol III genes in iPSCs (Alla and Cairns, 2014). Conversely, during the
differentiation of pluripotent stem cells into the precursor cells of the adipose lineage,
RNA Pol III occupies a smaller subset of RNA Pol III genes. In addition, most of the
RNA Pol III genes that were bound by RNA Pol III in ADSCs were also occupied in
iPSCs. However, upon induction of the ADSCs into pluripotent stem cells, RNA Pol III
bound additional Pol III genes, and more than half of these additional genes are tRNAs.
These results support our data and suggest that the repression of RNA Pol III-
dependent transcription promotes adipogenesis. Furthermore, repression of some
specific group of RNA Pol III genes may be important for the commitment of pluripotent
stem cells to differentiate into the adipose lineage. Further studies are needed to test
these hypotheses.

Our results indicate that repression of RNA Pol III-dependent transcription, either by a
chemical inhibitor or by Brf1 knockdown, enhances the expression of the key
adipogenic genes. This suggests that changes in RNA Pol III-dependent transcription
could also affect the expression of RNA Pol II transcripts. One recent study supports
this possibility. This study showed that specific tRNA species are highly expressed in
metastatic breast cancer cell lines compared with non-transformed cells (Goodarzi et al.,
2016). Manipulating the expression of these tRNA species affected breast cancer

48
progression and the metastatic capacity of the cells. Furthermore, manipulation of one
of the specific tRNA species, tRNA
Glu
UUC
, modulates the expression of two breast
cancer metastatic genes, EXOSC2 and GRIPAP1, due to the specific codon usage of
these two genes that could favor their translation (Goodarzi et al., 2016). Therefore,
these results indicate that the expression of specific proteins can be modulated
depending on the codon usage and the specific cellular tRNA content.

While our studies demonstrate that repression of RNA pol III-transcription drives
adipogenesis, they further suggest that Maf1 has additional roles in this process. This
may include its repression of RNA pol II-transcribed genes whose products inhibit the
activation of the pro-adipogenic genes. With this possibility, we examined the
expression of some known repressors of adipogenesis after manipulating the
expression of Maf1. However, no significant Maf1-dependent changes in the expression
of these repressors were observed (data not shown). Whether Maf1 might directly
induce the expression of some subset of the adipogenic genes still needs to be tested.
We are currently, performing RNA-sequencing (RNA-seq) analysis after altering either
Maf1 expression or RNA Pol III-dependent transcription in 3T3-L1 cells. These
experiments will identify gene expression changes produced by Maf1 and by RNA pol III
inhibition, alone, and determine whether the same or different subsets of genes are
altered in the early process of adipocyte differentiation. Future studies will use a
chromatin immunoprecipitation and deep sequencing to determine whether Maf1
directly activates or represses these genes that we identify from the RNA-seq analysis.

49
7.4: Summary
In this study, we revealed an unexpected and novel role for Maf1 and RNA Pol III-
dependent transcription in early development. Maf1 promotes the induction of ES cells
into mesoderm, and further enhances the terminal differentiation of mesoderm into
mature adipocytes. In addition, repression of RNA Pol III-dependent transcription
contributes to Maf1’s ability to promote adipogenesis. Our study uncovers a new
pathway that regulates the differentiation of ES cells and adipogenesis. However, more
studies are needed to determine the mechanisms that regulate Maf1 expression during
these processes. In addition, it will be important to define the specific genes that are
targeted by Maf1 and how changes in RNA pol III-dependent transcription, and tRNA
expression, drive differentiation and development.

50
Chapter 8: Material and methods
Cell culture
46C mouse embryonic stem (ES) cells were cultured on 0.1% gelatin coated plates.
GMEM medium was used to maintain the mouse ES cells (Sigma-Aldrich, G5154) and it
was supplemented with 15% embryonic stem cell-qualified fetal Bovine serum (Life
technologies), 0.1 mM MEM non-essential amino acids, 2 mM GlutaMax, 1 mM Sodium
Pyruvate, 0.1 mM β-mercaptoethanol, 1% penicillin/streptomycin, 100 units/ml LIF
(prepared in house). H9 human ES cells were maintained on matrigel-coated plates with
MEF-conditioned medium consisting of DMEM/F12 supplemented with 20% knockout
serum replacement (Life technologies), 0.1 mM MEM non-essential amino acids, 0.1
mM β-mercaptoethanol, 1% penicillin/streptomycin, and 4 ng/ml recombinant human
FGF2 (Invitrogen). 3T3L1 mouse preadipocyte cells, mouse embryonic fibroblasts
(MEF), and HEK293T cells were maintained in DMEM (with 4.5 mg/ml glucose)
supplemented with 10% fetal bovine serum, 2 mM GlutaMax, and 1% penicillin
/streptomycin. All cell lines were cultured in incubators with 5% CO
2
at 37ºC.

Production of Lentiviral constructs
Non-silencing empty vector control, pLKO.1-mouse Maf1 shRNA (clone IDs:
TRCN0000125776 and TRCN0000125778), and pLKO.1-mouse Brf1 shRNA (clone ID:
TRCN0000119897) were purchased from Sigma-Aldrich. The inducible pFTREW-Maf1-
HA expression construct and FUIPW-rtTA (lentiviral tetracycline transactivator) was
previously described (Palian et al., 2014).

51
Lentiviral particles were produced by calcium phosphate-mediated transfection of
HEK293T cells. The lentiviral vectors were transfected into HEK293T cells with psPAX2
(packaging vector), and pMD2.G (vesicular stomatitis virus envelope protein (VSV-G)
expression vector). Fresh media was added to the cells the next day. Virus containing
media was collected 48 hrs later and sterile filtered through a 0.45 µm filter. Viruses
were then concentrated by Lenti-X concentrator (Clontech), pelleted at 1,500xg for 45
minutes at 4℃, and resuspended in DPBS. Cell lines were transduced with the
concentrated virus for 16 to 24 hours. Two days after transduction, the infected cells
were selected with puromycin.

In vitro differentiation of ES cells
For mouse embryoid body (EB) formation, 300,000 cells/ml mouse ES cells were
cultured in mouse ES cell medium without LIF on 6-well Ultra-Low attachment plates
(Corning). For human EBs formation, 100,000 cells/ml human ES cells were cultured in
DMEM/F12 supplemented with 10% FBS on 6-well Ultra-Low attachment plates. For
both mouse and human EBs, media was changed every other day. EBs were collected
at the indicated time points described in the figures.

Differentiation of mouse ES, 3T3-L1, and MEF cells into adipocytes
For the differentiation of mouse ES cells into adipocytes, mouse ES cells were first
dissociated to form EBs. On day 2, EBs were collected and plated on gelatin-coated
plates with mouse ES cell medium without LIF. On day 3, media containing 1 µM
retinoic acid (RA) and 12.5µg/mL ascorbic acid (AsA) was added and changed every

52
day until day 7. After day 7, media containing 0.5 µg/mL Insulin, 3nM triiodothyronine
(T3), and 12.5 µg/mL AsA was added and changed daily up to day 11. On day 12, the
attached EBs were dissociated by Accutase (Life technologies), and 100,000 cells per
well of a 6-well plate were re-plated in differentiation medium with the same hormone
cocktail as day 7 to 11. The media was changed daily until day 15. After day 15, the
medium was changed every other day and included 0.5 mM 3-isobutyl-1-methyl
xanthine (IBMX), 0.1 µM Dexamethasone (Dex), 20 µg/mL Insulin, 0.06 mM
indomethacin, and 25 µg/mL AsA until day 21. From day 21 to the end of the
differentiation (approximately day 27), the media was changed daily and included 20
µg/mL Insulin, 25 µg/mL AsA, 3 nM and T3.

To differentiate the 3T3-L1 and MEF cells into adipocytes, cells were first grown to
confluency. The 2-day post-confluent cells were induced to differentiate with the
differentiation cocktail which contained 10 µg/mL Insulin, 2 µM Dex, 0.5 mM IBMX and
25 µg/mL AsA. The duration of differentiation cocktail treatment varied in different
experiments, and was between 1 to 6 days (Table 1). During the treatment of the
differentiation cocktail, the media was changed every 3 days. After the differentiation
cocktail was no longer used in the media, the media was changed every other day and
contained10 µg/mL Insulin, and 25 µg/mL AsA until the differentiated cellswere collected
and analyzed.

53
Table 1: Differentiation conditions of different experiments
Experiments Duration of differentiation cocktail
treatment (days)
Maf1-knockdown 3T3-L1, Maf1-/- MEFs 6 days
RNA Pol III inhibitor-treated Maf1-
knockdown 3T3-L1 cells
4 days
Brf1 knockdown 3T3-L1 cells 2 days
RNA Pol III inhibitor-treated 3T3L1 cells 1 day

RNA Pol III inhibitor treatment
RNA Pol III chemical inhibitor, ML-60218 (Millipore), was dissolved in DMSO at a final
concentration of 25 mM. The RNA Pol III inhibitor was added to the cells at (20µM or)
40 µM one day before the differentiation cocktail was added, and removed 3 days later.
The control cells were treated with an equal volume of DMSO.

RNA isolation and Quantitative Real-Time PCR
Total RNA was isolated from cells using the Zymo Directzol RNA Kit. The RNAs were
then reverse-transcribed into cDNA with the Superscript III first strand synthesis Kit
(Invitrogen). Real-time quantitative PCR was performed on the Lightcycler 480 (Roche)
with SYBR fast qPCR kit (KAPA Biosystems). Relative amounts of transcripts were
quantified by comparative threshold cycle method (ΔΔCt) with actin or PPia1 as the
endogenous reference control. The primers for targets are listed in Table 2. For
statistical analysis, unpaired, two-tailed, student’s t-test was used for all comparisons.
The data in Figures 5, 10, and 12 are representive results with one biological and two
technical replicates. All other results are from three biological and two technical
replicates.

54
Table 2: Primers for qRT-PCR
Targets Forward Reverse
Maf1 GACTATGACTTCAGCACAGCC CTGGGTTATAGCTGTAGATGTCAC
pre-
tRNA
i
Met

CTGGGCCCATAACCCAGAG TGGTAGCAGAGGATGGTTTC
pre-
tRNA
Leu

GTCAGGATGGCCGAGTGGTCTAAG
CCACGCCTCCATACGGAGAACCA
GAAGACCC
U6 RNA
GGAATCTAGAACATATACTAAAATT
GGAAC
GGAACTCGAGTTTGCGTGTCATCC
TTGCGC
GATA4 GATGGGACGGGACACTACCTG TGGCAGTTGGCACAGGAGA
GATA6
GACGGCACCGGTCATTACC ACAGTTGGCACAGGACAGTCC
T
GCTCTAAGGAACCACCGGTCATC ATGGGACTGCAGCATGGACAG
MESP1 GTTCCTGTACGCAGAAACAGCATC TCAGACAGGGTGACAATCATCCG
Nestin GCTTAGAGGTGCAGCAGCT CTGTAGACCCTGCTTCTCCTGCT
SOX1
AGGCAGCTGGGTCTCAGAA GACTCTGTGGTGGTGAGGTC
Pou5f1
(Oct4)
GTGGAGGAAGCCGACAACAATGA CAAGCTGATTGGCGATGTGAG
SOX2
CAGGAGAACCCCAAGATGCACAA AATCCGGGTGCTCCTTCATGTG
Nanog TGGTCCCCACAGTTTGCCTAGTTC CAGGTCTTCAGAGGAAGGGCGA
PPARγ ATCATCTACACGATGCTGGCCT TGAGGAACTCCCTGGTCATGAATC
C/EBPα
GAACAGCAACGAGTACCGGGTA CCATGGCCTTGACCAAGGAG
FABP4
TCGAATTCCACGCCCAGTTTGA TCGAATTCCACGCCCAGTTTGA
Brf1
GGAAAGGAATCAAGAGCACAGACC
C
GTCCTCGGGTAAGATGCTTGCTT
β-actin
CGACAACGGCTCCGGCATG
CTGGGGTGTTGAAGGTCTCAAACA
TG
PPia1
CGAGCTGTTTGCAGACAAAGTTCC CCCTGGCACATGAATCCTGG
GAPDH GATGGGTGTGAACCACGAGAA GGGCCATCCACAGTCTTCTG

55
Immunoblot analysis and antibodies
Cells were washed with DPBS twice, then scrapped and pelleted at 400g for 5 minutes.
After removing the supernatant, the cells were lysed in triple lysis buffer, (50 mM Tris-Cl
pH 8.0, 150 mM sodium chloride, 0.02% w/v sodium azide, 1% w/v SDS, 1 % v/v NP-
40, 0.5% w/v sodium deoxycholate, containing protease inhibitor cocktail set III (EMD
Millipore)) for 20 minutes on ice, and sonicated for 15 seconds. After sonication, the
cells were centrifuged for 20 minutes at 10,000g, and the supernatant was collected.
The protein concentration was determined by using the Biorad Protein Dc assay. Cell
lysates were subjected to immunoblot analysis and transferred onto a nitrocellulose
membrane (GE-Healthcare). Membranes were probed using the following antibodies:
Maf1 (Abcam), PPARγ, C/EBPα, FABP4, and Perilipin (Cell Signaling), HA (Roche), T
(Santa Cruz), Brf1 (Bethyl), actin (Sigma Aldrich), α-tubulin (Invitrogen). Proteins of
interest were quantified using Image Lab software (Bio-Rad).

Immunohistochemistry
For Alkaline Phosphatase (AP) staining, 46C mouse ES cells were cultured on 0.1%
gelatin coated plates with medium with culture conditions as described above for
maintaining the mouse ES cells. After two days, the cells were washed with DPBS
twice, and fixed with 4% paraformaldehyde for 10 minutes. The fixed cells were stained
using the Vectastain ABC-AP kit (Vector Laboratories). After staining, the cells were
washed three times with DPBS.

56
For Oil-red O staining, the differentiated adipocytes from mES, 3T3-L1, and MEF cells
were washed twice with DPBS, and fixed with 4% paraformaldehyde for 10 minutes.
The fixed cells were stained with 0.3% Oil-red O solution (Sigma-Aldrich) for 15
minutes. After staining, the cells were washed three times with DPBS. The pictures
were taken using the EVOS XL imaging system at the Human Stem Cell core at Baylor
College of Medicine. For quantification, the dye was extracted by 100% isopropanol,
and the intensity of Oil-red O extracts was quantified by measuring absorbance at 490
nm. The second method was to quantify the lipid staining area by using the particle
analysis function of the ImageJ software.

Immunostaining
Control and Maf1 knockdown mouse ES cells were plated on 12-well plates. 48 hours
later, the cells were fixed with 4% paraformaldehyde for 10 minutes, and blocked using
10% normal goat serum for 1 hour at room temperature. After blocking, the cells were
incubated with primary SSEA1 antibody (University of Iowa, Developmental Studies
Hybridoma Bank) at a dilution of 1:500, overnight at 4℃. The next day, the cells were
incubated with Alexa Fluor 488 (Molecular Probes) at a dilution of 1:250 for 1 hour at
room temperature. After washing with PBS, the cells were incubated with DAPI solution
(Sigma-Aldrich) at 0.05 µg/ml for 10 minutes at room temperature. The images were
captured using a Zeiss Axiovert 200 microscope with a DVC-1310C digital camera
(DVC).

57
References
Ahn, J., Lee, H., Jung, C.H., Jeon, T.-I., and Ha, T.Y. (2013). MicroRNA-146b promotes
adipogenesis by suppressing the SIRT1-FOXO1 cascade. EMBO molecular medicine 5,
1602-1612.
Alla, R.K., and Cairns, B.R. (2014). RNA Polymerase III Transcriptomes in Human
Embryonic Stem Cells and Induced Pluripotent Stem Cells, and Relationships with
Pluripotency Transcription Factors. PLoS ONE 9, e85648-85617.
Alva, J.A., Lee, G.E., Escobar, E.E., and Pyle, A.D. (2011). Phosphatase and tensin
homolog regulates the pluripotent state and lineage fate choice in human embryonic
stem cells. Stem Cells 29, 1952-1962.
Aubin, D., Gagnon, A., and Sorisky, A. (2005). Phosphoinositide 3-kinase is required for
human adipocyte differentiation in culture. Int J Obes (Lond) 29, 1006-1009.
Bell, A., Grunder, L., and Sorisky, A. (2000). Rapamycin inhibits human adipocyte
differentiation in primary culture. Obes Res 8, 249-254.
Boguta, M., Czerska, K., and Zoladek, T. (1997). Mutation in a new gene MAF1 affects
tRNA suppressor efficiency in Saccharomyces cerevisiae. Gene 185, 291-296.
Bonhoure, N., Byrnes, A., Moir, R.D., Hodroj, W., Preitner, F., Praz, V., Marcelin, G.,
Chua, S.C., Martinez-Lopez, N., Singh, R., et al. (2015). Loss of the RNA polymerase III
repressor MAF1 confers obesity resistance. Genes & Development 29, 934-947.
Boyer, L.A., Lee, T.I., Cole, M.F., Johnstone, S.E., Levine, S.S., Zucker, J.P., Guenther,
M.G., Kumar, R.M., Murray, H.L., Jenner, R.G., et al. (2005). Core transcriptional
regulatory circuitry in human embryonic stem cells. Cell 122, 947-956.
Brunet, A., Bonni, A., Zigmond, M.J., Lin, M.Z., Juo, P., Hu, L.S., Anderson, M.J.,
Arden, K.C., Blenis, J., and Greenberg, M.E. (1999). Akt promotes cell survival by
phosphorylating and inhibiting a Forkhead transcription factor. Cell 96, 857-868.
Bywater, M.J., Pearson, R.B., McArthur, G.A., and Hannan, R.D. (2013). Dysregulation
of the basal RNA polymerase transcription apparatus in cancer. Nat Rev Cancer 13,
299-314.

58
Chaika, O.V., Chaika, N., Volle, D.J., Wilden, P.A., Pirrucello, S.J., and Lewis, R.E.
(1997). CSF-1 receptor/insulin receptor chimera permits CSF-1-dependent
differentiation of 3T3-L1 preadipocytes. J Biol Chem 272, 11968-11974.
Coutts, A.J., Dawson, S., Willoughby, K., and Gaskell, R.M. (1994). Isolation of feline
respiratory viruses from clinically healthy cats at UK cat shows. Vet Rec 135, 555-556.
Desai, N., Lee, J., Upadhya, R., Chu, Y., Moir, R.D., and Willis, I.M. (2005). Two steps
in Maf1-dependent repression of transcription by RNA polymerase III. The Journal of
biological chemistry 280, 6455-6462.
Easley, C.A.t., Ben-Yehudah, A., Redinger, C.J., Oliver, S.L., Varum, S.T., Eisinger,
V.M., Carlisle, D.L., Donovan, P.J., and Schatten, G.P. (2010). mTOR-mediated
activation of p70 S6K induces differentiation of pluripotent human embryonic stem cells.
Cell Reprogram 12, 263-273.
Evans, M.J., and Kaufman, M.H. (1981). Establishment in culture of pluripotential cells
from mouse embryos. Nature 292, 154-156.
Fischer-Posovszky, P., Tews, D., Horenburg, S., Debatin, K.M., and Wabitsch, M.
(2012). Differential function of Akt1 and Akt2 in human adipocytes. Mol Cell Endocrinol
358, 135-143.
Flavin, R., Peluso, S., Nguyen, P.L., and Loda, M. (2010). Fatty acid synthase as a
potential therapeutic target in cancer. Future Oncol 6, 551-562.
Fortier, S., MacRae, T., Bilodeau, M., Sargeant, T., and Sauvageau, G. (2015).
Haploinsufficiency screen highlights two distinct groups of ribosomal protein genes
essential for embryonic stem cell fate. Proc Natl Acad Sci U S A 112, 2127-2132.
Gagnon, A., Lau, S., and Sorisky, A. (2001). Rapamycin-sensitive phase of 3T3-L1
preadipocyte differentiation after clonal expansion. J Cell Physiol 189, 14-22.
Garofalo, R.S., Orena, S.J., Rafidi, K., Torchia, A.J., Stock, J.L., Hildebrandt, A.L.,
Coskran, T., Black, S.C., Brees, D.J., Wicks, J.R., et al. (2003). Severe diabetes, age-
dependent loss of adipose tissue, and mild growth deficiency in mice lacking Akt2/PKB
beta. J Clin Invest 112, 197-208.

59
Goodarzi, H., Nguyen, H.C.B., Zhang, S., Dill, B.D., Molina, H., and Tavazoie, S.F.
(2016). Modulated Expression of Specific tRNAs Drives Gene Expression and Cancer
Progression. Cell 165, 1416-1427.
Goodfellow, S.J., Graham, E.L., Kantidakis, T., Marshall, L., Coppins, B.A., Oficjalska-
Pham, D., Gérard, M., Lefebvre, O., and White, R.J. (2008). Regulation of RNA
polymerase III transcription by Maf1 in mammalian cells. Journal of molecular biology
378, 481-491.
Hamm, J.K., Park, B.H., and Farmer, S.R. (2001). A role for C/EBPbeta in regulating
peroxisome proliferator-activated receptor gamma activity during adipogenesis in 3T3-
L1 preadipocytes. J Biol Chem 276, 18464-18471.
Huber, A., Bodenmiller, B., Uotila, A., Stahl, M., Wanka, S., Gerrits, B., Aebersold, R.,
and Loewith, R. (2009). Characterization of the rapamycin-sensitive phosphoproteome
reveals that Sch9 is a central coordinator of protein synthesis. Genes &
Development 23, 1929-1943.
Itskovitz-Eldor, J., Schuldiner, M., Karsenti, D., Eden, A., Yanuka, O., Amit, M., Soreq,
H., and Benvenisty, N. (2000). Differentiation of human embryonic stem cells into
embryoid bodies compromising the three embryonic germ layers. Mol Med 6, 88-95.
James, D., Levine, A.J., Besser, D., and Hemmati-Brivanlou, A. (2005).
TGFbeta/activin/nodal signaling is necessary for the maintenance of pluripotency in
human embryonic stem cells. Development 132, 1273-1282.
Jing, E., Gesta, S., and Kahn, C.R. (2007). SIRT2 regulates adipocyte differentiation
through FoxO1 acetylation/deacetylation. Cell metabolism 6, 105-114.
Johnson, S.S., Zhang, C., Fromm, J., Willis, I.M., and Johnson, D.L. (2007). Mammalian
Maf1 is a negative regulator of transcription by all three nuclear RNA polymerases.
Molecular cell 26, 367-379.
Jones, S.F., and Infante, J.R. (2015). Molecular Pathways: Fatty Acid Synthase. Clin
Cancer Res 21, 5434-5438.
Kantidakis, T., Ramsbottom, B.A., Birch, J.L., Dowding, S.N., and White, R.J. (2010).
mTOR associates with TFIIIC, is found at tRNA and 5S rRNA genes, and targets their
repressor Maf1. Proc Natl Acad Sci U S A 107, 11823-11828.

60
Keller, G. (2005). Embryonic stem cell differentiation: emergence of a new era in biology
and medicine. Genes & Development 19, 1129-1155.
Khanna, A., Johnson, D.L., and Curran, S.P. (2014). Physiological roles for mafr-1 in
reproduction and lipid homeostasis. Cell reports 9, 2180-2191.
Lee, Y.-L., Li, Y.-C., Su, C.-H., Chiao, C.-H., Lin, I.-H., and Hsu, M.-T. (2015). MAF1
represses CDKN1A through a Pol III-dependent mechanism. eLife 4.
Lehmann, J.M., Moore, L.B., Smith-Oliver, T.A., Wilkison, W.O., Willson, T.M., and
Kliewer, S.A. (1995). An antidiabetic thiazolidinedione is a high affinity ligand for
peroxisome proliferator-activated receptor gamma (PPAR gamma). J Biol Chem 270,
12953-12956.
Li, Y., Tsang, C.K., Wang, S., Li, X.X., Yang, Y., Fu, L., Huang, W., Li, M., Wang, H.Y.,
and Zheng, X.F. (2016). MAF1 suppresses AKT-mTOR signaling and liver cancer
through activation of PTEN transcription. Hepatology 63, 1928-1942.
Liao, J., Marumoto, T., Yamaguchi, S., Okano, S., Takeda, N., Sakamoto, C., Kawano,
H., Nii, T., Miyamato, S., Nagai, Y., et al. (2013). Inhibition of PTEN tumor suppressor
promotes the generation of induced pluripotent stem cells. Mol Ther 21, 1242-1250.
Linhart, H.G., Ishimura-Oka, K., DeMayo, F., Kibe, T., Repka, D., Poindexter, B., Bick,
R.J., and Darlington, G.J. (2001). C/EBPalpha is required for differentiation of white, but
not brown, adipose tissue. Proc Natl Acad Sci U S A 98, 12532-12537.
Madsen, M.S., Siersbaek, R., Boergesen, M., Nielsen, R., and Mandrup, S. (2014).
Peroxisome proliferator-activated receptor gamma and C/EBPalpha synergistically
activate key metabolic adipocyte genes by assisted loading. Mol Cell Biol 34, 939-954.
Michels, A.A., Robitaille, A.M., Buczynski-Ruchonnet, D., Hodroj, W., Reina, J.H., Hall,
M.N., and Hernandez, N. (2010). mTORC1 directly phosphorylates and regulates
human MAF1. Mol Cell Biol 30, 3749-3757.
Moir, R.D., Lee, J., Haeusler, R.A., Desai, N., Engelke, D.R., and Willis, I.M. (2006).
Protein kinase A regulates RNA polymerase III transcription through the nuclear
localization of Maf1. Proceedings of the National Academy of Sciences of the United
States of America 103, 15044-15049.

61
Munekata, K., and Sakamoto, K. (2009). Forkhead transcription factor Foxo1 is
essential for adipocyte differentiation. In Vitro Cell Dev Biol Anim 45, 642-651.
Murakami, M., Ichisaka, T., Maeda, M., Oshiro, N., Hara, K., Edenhofer, F., Kiyama, H.,
Yonezawa, K., and Yamanaka, S. (2004). mTOR Is Essential for Growth and
Proliferation in Early Mouse Embryos and Embryonic Stem Cells. Molecular and cellular
biology 24, 6710-6718.
Nakae, J., Kitamura, T., Kitamura, Y., Biggs, W.H., 3rd, Arden, K.C., and Accili, D.
(2003). The forkhead transcription factor Foxo1 regulates adipocyte differentiation. Dev
Cell 4, 119-129.
Nazareth, E.J., Rahman, N., Yin, T., and Zandstra, P.W. (2016). A Multi-Lineage Screen
Reveals mTORC1 Inhibition Enhances Human Pluripotent Stem Cell Mesendoderm and
Blood Progenitor Production. Stem Cell Reports 6, 679-691.
Nishikawa, S., Jakt, L.M., and Era, T. (2007). Embryonic stem-cell culture as a tool for
developmental cell biology. Nat Rev Mol Cell Biol 8, 502-507.
Oficjalska-Pham, D., Harismendy, O., Smagowicz, W.J., Gonzalez de Peredo, A.,
Boguta, M., Sentenac, A., and Lefebvre, O. (2006). General repression of RNA
polymerase III transcription is triggered by protein phosphatase type 2A-mediated
dephosphorylation of Maf1. Molecular cell 22, 623-632.
Oler, A.J., Alla, R.K., Roberts, D.N., Wong, A., Hollenhorst, P.C., Chandler, K.J.,
Cassiday, P.A., Nelson, C.A., Hagedorn, C.H., Graves, B.J., et al. (2010). Human RNA
polymerase III transcriptomes and relationships to Pol II promoter chromatin and
enhancer-binding factors. Nature Structural & Molecular Biology 17, 620-628.
Palian, B.M., Rohira, A.D., Johnson, S.A.S., He, L., Zheng, N., Dubeau, L., Stiles, B.L.,
and Johnson, D.L. (2014). Maf1 is a novel target of PTEN and PI3K signaling that
negatively regulates oncogenesis and lipid metabolism. PLoS Genetics 10, e1004789.
Paule, M.R., and White, R.J. (2000). Survey and summary: transcription by RNA
polymerases I and III. Nucleic Acids Res 28, 1283-1298.
Polak, P., Cybulski, N., Feige, J.N., Auwerx, J., Ruegg, M.A., and Hall, M.N. (2008).
Adipose-specific knockout of raptor results in lean mice with enhanced mitochondrial
respiration. Cell Metab 8, 399-410.

62
Qiao, L., and Shao, J. (2006). SIRT1 regulates adiponectin gene expression through
Foxo1-C/enhancer-binding protein alpha transcriptional complex. J Biol Chem 281,
39915-39924.
Reina, J.H., Azzouz, T.N., and Hernandez, N. (2006). Maf1, a New Player in the
Regulation of Human RNA Polymerase III Transcription. PLoS ONE 1, e134.
Rohira, A.D., Chen, C.Y., Allen, J.R., and Johnson, D.L. (2013). Covalent Small
Ubiquitin-like Modifier (SUMO) Modification of Maf1 Protein Controls RNA Polymerase
III-dependent Transcription Repression. The Journal of biological chemistry 288, 19288-
19295.
Rosen, E.D., Hsu, C.H., Wang, X., Sakai, S., Freeman, M.W., Gonzalez, F.J., and
Spiegelman, B.M. (2002). C/EBPalpha induces adipogenesis through PPARgamma: a
unified pathway. Genes Dev 16, 22-26.
Rosen, E.D., and MacDougald, O.A. (2006). Adipocyte differentiation from the inside
out. Nat Rev Mol Cell Biol 7, 885-896.
Rosen, E.D., Sarraf, P., Troy, A.E., Bradwin, G., Moore, K., Milstone, D.S., Spiegelman,
B.M., and Mortensen, R.M. (1999). PPAR gamma is required for the differentiation of
adipose tissue in vivo and in vitro. Mol Cell 4, 611-617.
Rosen, E.D., and Spiegelman, B.M. (2006). Adipocytes as regulators of energy balance
and glucose homeostasis. Nature 444, 847-853.
Rosen, E.D., Walkey, C.J., Puigserver, P., and Spiegelman, B.M. (2000).
Transcriptional regulation of adipogenesis. Genes Dev 14, 1293-1307.
Sakaue, H., Ogawa, W., Matsumoto, M., Kuroda, S., Takata, M., Sugimoto, T.,
Spiegelman, B.M., and Kasuga, M. (1998). Posttranscriptional control of adipocyte
differentiation through activation of phosphoinositide 3-kinase. J Biol Chem 273, 28945-
28952.
Sampath, P., Pritchard, D.K., Pabon, L., Reinecke, H., Schwartz, S.M., Morris, D.R.,
and Murry, C.E. (2008). A hierarchical network controls protein translation during murine
embryonic stem cell self-renewal and differentiation. Cell Stem Cell 2, 448-460.

63
Sanchez, C.G., Teixeira, F.K., Czech, B., Preall, J.B., Zamparini, A.L., Seifert, J.R.,
Malone, C.D., Hannon, G.J., and Lehmann, R. (2016). Regulation of Ribosome
Biogenesis and Protein Synthesis Controls Germline Stem Cell Differentiation. Cell
Stem Cell 18, 276-290.
Schramm, L., and Hernandez, N. (2002). Recruitment of RNA polymerase III to its
target promoters. Genes & Development 16, 2593-2620.
Shor, B., Wu, J., Shakey, Q., Toral-Barza, L., Shi, C., Follettie, M., and Yu, K. (2010).
Requirement of the mTOR kinase for the regulation of Maf1 phosphorylation and control
of RNA polymerase III-dependent transcription in cancer cells. J Biol Chem 285, 15380-
15392.
Singh, A.M., Reynolds, D., Cliff, T., Ohtsuka, S., Mattheyses, A.L., Sun, Y., Menendez,
L., Kulik, M., and Dalton, S. (2012). Signaling network crosstalk in human pluripotent
cells: a Smad2/3-regulated switch that controls the balance between self-renewal and
differentiation. Cell Stem Cell 10, 312-326.
Smith, A.G., Heath, J.K., Donaldson, D.D., Wong, G.G., Moreau, J., Stahl, M., and
Rogers, D. (1988). Inhibition of pluripotential embryonic stem cell differentiation by
purified polypeptides. Nature 336, 688-690.
Thomson, J.A., Itskovitz-Eldor, J., Shapiro, S.S., Waknitz, M.A., Swiergiel, J.J.,
Marshall, V.S., and Jones, J.M. (1998). Embryonic stem cell lines derived from human
blastocysts. Science 282, 1145-1147.
Tomiyama, K., Nakata, H., Sasa, H., Arimura, S., Nishio, E., and Watanabe, Y. (1995).
Wortmannin, a specific phosphatidylinositol 3-kinase inhibitor, inhibits adipocytic
differentiation of 3T3-L1 cells. Biochem Biophys Res Commun 212, 263-269.
Tontonoz, P., Hu, E., Graves, R.A., Budavari, A.I., and Spiegelman, B.M. (1994).
mPPAR gamma 2: tissue-specific regulator of an adipocyte enhancer. Genes Dev 8,
1224-1234.
Trayhurn, P. (2005). Endocrine and signalling role of adipose tissue: new perspectives
on fat. Acta Physiol Scand 184, 285-293.
Tseng, Y.H., Kriauciunas, K.M., Kokkotou, E., and Kahn, C.R. (2004). Differential roles
of insulin receptor substrates in brown adipocyte differentiation. Mol Cell Biol 24, 1918-
1929.

64
Upadhya, R., Lee, J., and Willis, I.M. (2002). Maf1 is an essential mediator of diverse
signals that repress RNA polymerase III transcription. Mol Cell 10, 1489-1494.
Vallier, L., Alexander, M., and Pedersen, R.A. (2005). Activin/Nodal and FGF pathways
cooperate to maintain pluripotency of human embryonic stem cells. J Cell Sci 118,
4495-4509.
Vannini, A., Ringel, R., Kusser, A.G., Berninghausen, O., Kassavetis, G.A., and Cramer,
P. (2010). Molecular basis of RNA polymerase III transcription repression by Maf1. Cell
143, 59-70.
Virtanen, K.A., Lidell, M.E., Orava, J., Heglind, M., Westergren, R., Niemi, T., Taittonen,
M., Laine, J., Savisto, N.J., Enerback, S., et al. (2009). Functional brown adipose tissue
in healthy adults. N Engl J Med 360, 1518-1525.
Wang, F., and Tong, Q. (2009). SIRT2 suppresses adipocyte differentiation by
deacetylating FOXO1 and enhancing FOXO1's repressive interaction with
PPARgamma. Molecular biology of the cell 20, 801-808.
Watanabe, S., Umehara, H., Murayama, K., Okabe, M., Kimura, T., and Nakano, T.
(2006). Activation of Akt signaling is sufficient to maintain pluripotency in mouse and
primate embryonic stem cells. Oncogene 25, 2697-2707.
White, R.J. (2004). RNA polymerase III transcription and cancer. Oncogene 23, 3208-
3216.
Williams, L.A., Davis-Dusenbery, B.N., and Eggan, K.C. (2012). SnapShot: Directed
Differentiation of Pluripotent Stem Cells. Cell 149, 1174-1174.e1171.
Wong, R.C., Pollan, S., Fong, H., Ibrahim, A., Smith, E.L., Ho, M., Laslett, A.L., and
Donovan, P.J. (2011). A novel role for an RNA polymerase III subunit POLR3G in
regulating pluripotency in human embryonic stem cells. Stem Cells 29, 1517-1527.
Wu, L., Pan, J., Thoroddsen, V., Wysong, D.R., Blackman, R.K., Bulawa, C.E., Gould,
A.E., Ocain, T.D., Dick, L.R., Errada, P., et al. (2003). Novel small-molecule inhibitors of
RNA polymerase III. Eukaryotic cell 2, 256-264.

65
Wu, Z., Bucher, N.L., and Farmer, S.R. (1996). Induction of peroxisome proliferator-
activated receptor gamma during the conversion of 3T3 fibroblasts into adipocytes is
mediated by C/EBPbeta, C/EBPdelta, and glucocorticoids. Mol Cell Biol 16, 4128-4136.
Wu, Z., Rosen, E.D., Brun, R., Hauser, S., Adelmant, G., Troy, A.E., McKeon, C.,
Darlington, G.J., and Spiegelman, B.M. (1999). Cross-regulation of C/EBP alpha and
PPAR gamma controls the transcriptional pathway of adipogenesis and insulin
sensitivity. Mol Cell 3, 151-158.
Wu, Z., Xie, Y., Bucher, N.L., and Farmer, S.R. (1995). Conditional ectopic expression
of C/EBP beta in NIH-3T3 cells induces PPAR gamma and stimulates adipogenesis.
Genes Dev 9, 2350-2363.
Xu, J., and Liao, K. (2004). Protein kinase B/AKT 1 plays a pivotal role in insulin-like
growth factor-1 receptor signaling induced 3T3-L1 adipocyte differentiation. J Biol Chem
279, 35914-35922.
Ying, Q.L., Wray, J., Nichols, J., Batlle-Morera, L., Doble, B., Woodgett, J., Cohen, P.,
and Smith, A. (2008). The ground state of embryonic stem cell self-renewal. Nature 453,
519-523.
Yoon, M.S., Zhang, C., Sun, Y., Schoenherr, C.J., and Chen, J. (2013). Mechanistic
target of rapamycin controls homeostasis of adipogenesis. J Lipid Res 54, 2166-2173.
Zhang, X., Yalcin, S., Lee, D.F., Yeh, T.Y., Lee, S.M., Su, J., Mungamuri, S.K.,
Rimmele, P., Kennedy, M., Sellers, R., et al. (2011). FOXO1 is an essential regulator of
pluripotency in human embryonic stem cells. Nat Cell Biol 13, 1092-1099.
Zhou, J., Su, P., Wang, L., Chen, J., Zimmermann, M., Genbacev, O., Afonja, O.,
Horne, M.C., Tanaka, T., Duan, E., et al. (2009). mTOR supports long-term self-renewal
and suppresses mesoderm and endoderm activities of human embryonic stem cells.
Proceedings of the National Academy of Sciences of the United States of America 106,
7840-7845.
Zou, P., Liu, L., Zheng, L., Liu, L., Stoneman, R.E., Cho, A., Emery, A., Gilbert, E.R.,
and Cheng, Z. (2014). Targeting FoxO1 with AS1842856 suppresses adipogenesis. Cell
cycle (Georgetown, Tex) 13, 3759-3767.

Abstract (if available)

Abstract Maf1 represses transcription from select RNA Polymerase (Pol) II‐ and RNA Pol III‐dependent genes. Our previous studies demonstrated that Maf1 functions as a tumor suppressor and it negatively regulates intracellular lipid accumulation. Together, these results identify Maf1 as an important link in between metabolism and cancer. However, a potential biological role for Maf1 in early development and cellular differentiation has not yet been examined. ❧ Maf1 expression was analyzed in human and mouse embryonic stem (ES) cells and as they differentiate into embryoid bodies (EBs). Maf1 protein expression is high in ES cells, and markedly reduced during their differentiation into EBs. This corresponded with a reciprocal change in the amounts of RNA Pol III‐dependent transcripts. We further examined whether Maf1 was required for the two properties of ES cells, self‐renewal and pluripotency. Maf1 knockdown did not affect ES cell self‐renewal or proliferation. However, analysis of markers associated with the three germ layers in EBs showed that alterations in Maf1 expression significantly affected the expression of mesoderm‐associated genes. These results indicate that Maf1 is important for driving ES cell induction into mesoderm. As Maf1 negatively regulates intracellular lipid accumulation, and adipocytes are one of the derivatives of mesoderm, we examined whether Maf1 is required for adipogenesis. Mouse ES cells, 3T3‐L1 preadipocytes, and Maf1-/- mouse embryo fibroblasts (MEFs) were terminally differentiated into mature adipocytes. Reduced Maf1 expression in either mouse ES or 3T3‐L1 cells resulted in enhanced RNA Pol III‐dependent transcription, reduced expression of key adipogenic genes, PPARγ, C/EBPα, and FABP4, and compromised adipocyte formation. Ectopic expression of Maf1 in Maf1-/- MEFs enhanced adipocyte differentiation, correlating with an increase in adipogenic gene expression and a decrease in RNA Pol III‐dependent transcription. Given that Maf1 is an established repressor of RNA Pol III‐dependent transcription, we examined whether this Maf1 function contributes to the ability of Maf1 to induce adipogenesis. Repression of RNA Pol III‐dependent transcription in 3T3‐L1 cells by either treatment of a RNA Pol III inhibitor, ML‐60218, or knockdown of the RNA pol III‐specific transcription factor, Brf1, resulted in a significant increase in adipogenic gene expression and adipocyte differentiation. However, treatment with the RNA Pol III inhibitor in Maf1‐knockdown 3T3‐L1 cells or Maf1-/- MEFs did not lead to induction of adipogenic gene expression or adipogenesis. Together, our findings reveal a novel and unexpected role for Maf1 and RNA Pol III‐dependent transcription in lineage specification and differentiation. Our results support a model in which Maf1 promotes formation of mesoderm and it also drives the terminal differentiation of adipocytes. These results further reveal that repression of RNA Pol III‐dependent transcription contributes to Maf1‐mediated induction of adipogenesis.

Linked assets

University of Southern California Dissertations and Theses

Conceptually similar

PDF

SUMOylation regulates RNA polymerase III -- dependent transcripton via MAF1

PDF

Maf1 is a novel target of the tumor suppressor PTEN and a negative regulator of lipid metabolism

PDF

Investigating the role of STAT3 in mouse and rat embryonic stem cell self-renewal and differentiation

PDF

Role of beta-catenin in mouse epiblast stem cell, embryonic stem cell self-renewal and differentiation

PDF

Characterizing the physiological roles and regulatory mechanisms of Maf1

PDF

Mechanism of repression of RNA polymerase III-dependent transcription under hypoxia

PDF

Pleotropic potential of Stat3 in determining self-renewal, apoptosis, and differentiation in mouse embryonic stem cells

PDF

Molecular basis of mouse epiblast stem cell and human embryonic stem cell self‐renewal

PDF

Dissecting novel roles for MAFR-1 in reproduction and metabolic homeostasis

PDF

Hepatic differentiation in human naïve stem cells compared to human embryonic stem cells

PDF

Role of STAT3 phosphorylation in mouse embryonic stem cell self-renewal and differentiation

PDF

RNA polymerase III-dependent transcription is repressed under prolonged hypoxic conditions

PDF

Exploring stem cell pluripotency through long range chromosome interactions

PDF

Differential role of two coactivators, CCAR1 and CARM1, for dysregulated beta-catenin activity in colorectal cancer cell growth and gene expression

PDF

The role of miRNA and its regulation in pulmonary hypertension in sickle cell disease

PDF

Epigenetic plasticity of cultured female human embryonic stem cells and regulation of gene expression and chromatin by PR-SET7 mediated H4K20me1

PDF

The role of Prkci in stem cell maintenance and cell polarity using a 3-D culture system

PDF

The function of BS69 in mouse embryogenesis and embryonic stem cell differentiation

PDF

Characterization of human embryonic stem cell derived retinal pigment epithelial cells for age-related macular degeneration

PDF

The splicing error of FOXP1 in type I myotonic dystrophy

Asset Metadata

Creator Chen, Chun-Yuan (author)

Core Title Novel roles for Maf1 in embryonic stem cell differentiation and adipogenesis

School Keck School of Medicine

Degree Doctor of Philosophy

Degree Program Genetic, Molecular and Cellular Biology

Publication Date 09/21/2016

Defense Date 07/27/2016

Publisher University of Southern California (original), University of Southern California. Libraries (digital)

Tag adipogenesis,cellular differentiation,embryonic stem cells,Maf1,OAI-PMH Harvest,RNA polymerase III

Format application/pdf (imt)

Language English

Contributor Electronically uploaded by the author (provenance)

Advisor Stallcup, Michael (committee chair), Johnson, Deborah (committee member), Lu, Wange (committee member), Maxson, Robert (committee member)

Creator Email chunyuan@usc.edu,elliotc@bcm.edu

Permanent Link (DOI) https://doi.org/10.25549/usctheses-c40-302969

Unique identifier UC11279390

Identifier etd-ChenChunYu-4786.pdf (filename),usctheses-c40-302969 (legacy record id)

Legacy Identifier etd-ChenChunYu-4786.pdf

Dmrecord 302969

Document Type Dissertation

Format application/pdf (imt)

Rights Chen, Chun-Yuan

Type texts

Source University of Southern California (contributing entity), University of Southern California Dissertations and Theses (collection)

Access Conditions The author retains rights to his/her dissertation, thesis or other graduate work according to U.S. copyright law. Electronic access is being provided by the USC Libraries in agreement with the a...

Repository Name University of Southern California Digital Library

Repository Location USC Digital Library, University of Southern California, University Park Campus MC 2810, 3434 South Grand Avenue, 2nd Floor, Los Angeles, California 90089-2810, USA