University of Southern California Dissertations and Theses

Neuroinflammatory effects of urban traffic-derived nanoparticulate matter on neural systems

(USC Thesis Other)

Neuroinflammatory effects of urban traffic-derived nanoparticulate matter on neural systems

PDF

Download a page range

Download transcript

Copy asset link

Request this asset

Transcript (if available)

Content NEUROINFLAMMATORY EFFECTS OF URBAN TRAFFIC-DERIVED NANOPARTICULATE MATTER ON NEURAL SYSTEMS by Hank Cheng A Dissertation Presented to the FACULTY OF THE USC GRADUATE SCHOOL UNIVERSITY OF SOUTHERN CALIFORNIA In Partial Fullfillment of the Requirements for the Degree DOCTOR OF PHILOSOPHY (MOLECULAR BIOLOGY) May 2016 Copyright 2016 Hank Cheng ii TABLE OF CONTENTS Page No. Approval of Dissertation ..................................................................................................iv Dedication ....................................................................................................................... v Acknowledgments ...........................................................................................................vi LIST OF TABLES AND FIGURES ................................................................................. vii ABSTRACT .....................................................................................................................ix CHAPTER 1: Introduction ............................................................................................. 1 Composition and Properties of Air Pollution ................................................................. 2 Neuroepithelium as a Gateway to the Brain ................................................................. 3 Particulate matter induces neuroinflammation and oxidative stress in nose and brain 8 Microglial contributions to ultrafine particle exposure and neuroinflammation ........... 13 References ................................................................................................................. 16 CHAPTER 2: Nano-scale particulate matter from urban traffic rapidly induces oxidative stress and inflammation in olfactory epithelium with concomitant effects on brain ........................................................................................................... 25 Abstract ...................................................................................................................... 25 Introduction ................................................................................................................ 26 Material and Methods ................................................................................................ 28 Results ....................................................................................................................... 34 Discussion.................................................................................................................. 46 Conclusions ............................................................................................................... 51 References: ................................................................................................................ 53 CHAPTER 3: Urban traffic-derived nanoparticulate matter reduces neurite outgrowth via TNFα in vitro ........................................................................................ 61 Abstract ...................................................................................................................... 61 Background ................................................................................................................ 62 Methods ..................................................................................................................... 63 Results ....................................................................................................................... 69 iii Discussion.................................................................................................................. 85 Conclusions ............................................................................................................... 90 List of abbreviations ................................................................................................... 90 References ................................................................................................................. 92 CHAPTER 4: Applications, Synthesis, and Conclusions ....................................... 100 Stroke damage is exacerbated by nano-size particulate matter in a mouse model . 100 Concluding remarks ................................................................................................. 108 References ............................................................................................................... 110 iv Approval of Dissertation This dissertation has been approved. v Dedication To my family, who has supported, encouraged, and trusted me to successfully pursue a daring, but enriching journey in a non-engineering field. vi Acknowledgments First and foremost, I would like to extend my sincerest gratitudes to my mentor Dr. Caleb E. Finch. He has taught me outside-the-box thinking, and shown by example, the way to foster collaborations, project management, and present oneself as a leader. While he would be considered a tough mentor, his ideas and sharpness inspire scientists of all seniorities around him. I would also like to thank my committee members John Tower, Sean Curran, and Berislav Zlokovic. John Tower has been very affable and approachable for graduate students, and gives great advice regarding how my research can pertain to aging and his model of flies. Sean Curran is someone I feel like I can talk to as a friend. If you see how his lab works, it’s very obvious that he has the ability to inspire young scientists to work hard and enjoy the process. Despite being so busy, Berislav Zlokovic has always managed to find time to meet with me before committee meetings to discuss my progress and give feedback. Amongst faculty, I must also give a special thanks to Todd E. Morgan, who has been a great force of emotional support for the Finch lab and Xuelin Wu, who has really engaged me into research as a rotation student in her lab. I also wish. I also thank Bill Mack for being a mentor on the medical research side. I would also like to thank my lab mentors David A. Davis, Mafalda Cacciottolo, and Jason Arimoto who trained me when I didn’t know anything. I must also thank my lab mates Nick Woodward for long-term lab company and collaboration, Namrata Bali, Nahoko Iwata, Eliza Bacon. I also appreciate my collaborations with Arian Saffari from chemical engineering all these years. A big thank you to the Curran Lab: Akshat Khanna, Lori Thomas, Jackie Lo, Dana Lynn, Hans Dalton for all the company over the years. Finally, I would like to acknowledge help from the USC MCB BISC GERO department. vii LIST OF TABLES AND FIGURES Page No. Chapter 1: Introduction Table 1.1: Size-resolved PM mass concentration, chemical composition and redox activities. ......................................................................................................................... 2 Figure 1.1: Model Olfactory Epithelium Diagram ............................................................. 5 Chapter 2: Nano-scale particulate matter from urban traffic rapidly induces oxidative stress and inflammation in olfactory epithelium with concomitant effects on brain Figure 2.1: Time course of nPM exposure. ................................................................... 29 Figure 2.2: Model of olfactory gateway to brain. ............................................................ 34 Figure 2.3: Acute in vivo nPM exposure induced oxidative stress and inflammation in olfactory epithelium (OE): immunohistochemistry. ........................................................ 36 Figure 2.4: Acute in vivo nPM exposure responses in olfactory bulb (OB): immunohistochemistry. .................................................................................................. 37 Figure 2.5: Ex vivo exposure to nPM rapidly induced inflammatory responses in OE. .. 39 Figure 2.6: In vitro time course exposure to nPM induced oxidative stress and inflammation in primary cultures of rat OE and cerebral cortex mixed glia. ................... 40 Figure 2.7: nPM in vivo exposure induced oxidative stress and inflammation in the OE. ...................................................................................................................................... 42 Figure 2.8: nPM in vivo exposure induced oxidative stress and inflammation in the OB. ...................................................................................................................................... 43 Figure 2.9: Extended nPM in vivo exposure induced TNFα in the cerebral cortex and cerebellum. .................................................................................................................... 45 Figure 2.10: Model of nPM effects from nose to brain. .................................................. 52 Chapter 3: Urban traffic-derived nanoparticulate matter reduces neurite outgrowth via TNFα in vitro Table 3.1: Composition of nPM ..................................................................................... 64 viii Figure 3.1: Anatomical schema and cell types in neonatal mouse olfactory neuroepithelium. ............................................................................................................ 70 Figure 3.2: nPM shrinks dendritic layer of OE septum and increased macrophages in OSN layer. ..................................................................................................................... 72 Figure 3.3: nPM rapidly induced cytokine mRNA in ex vivo olfactory neuroepithelium. 73 Figure 3.4: Mixed glia exposed to nPM: increased TNFα mRNA and protein. .............. 75 Figure 3.5: CM from glia treated with nPM decreased neurite outgrowth. ..................... 77 Figure 3.6: Mixed glia exposed to LPS show increased TNFα mRNA and protein. ....... 78 Figure 3.7: CM from microglia treated with LPS decreased neurite outgrowth. ............. 79 Figure 3.8: TNFα siRNA rescued the inhibition of neurite outgrowth in nPM-CM. ......... 81 Figure 3.9: Immunoneutralization of TNFα in CM rescued nPM-inhibition of neurite outgrowth. ..................................................................................................................... 82 Figure 3.10: TNFR1-blocking peptide rescued neurite outgrowth and growth cone collapse. ........................................................................................................................ 83 Figure 3.11: NMDA Antagonism does not interact with TNFα. ...................................... 84 Figure 3.12: Interaction model for direct and indirect effects of nPM on neurite outgrowth. ..................................................................................................................... 89 Chapter 4: Applications, Synthesis, and Conclusions Figure 4.1 (credit Qinghai Liu): Infarct volume and reperfusion following murine stroke. .................................................................................................................................... 101 Figure 4.2: Semiquantitative immunohistochemical analysis demonstrates C5 is increased in mice exposed to nPM. ............................................................................ 103 Figure 4.3: Semiquantitative immunohistochemical analysis demonstrates C5a and C5a receptor (CD88) are increased in mice exposed to nPM. ............................................ 104 Figure 4.4: Semiquantitative immunohistochemical analysis demonstrates gp91phox is increased in mice exposed to nPM. ............................................................................ 105 ix ABSTRACT Urban particulate air pollution has been epidemiologically associated with cognitive impairments and accelerated neuropathology. Of the various size classes of particulates, nanoparticulate matter (diameter <200 nm, nPM) show higher toxicity than larger particles. Although air pollution particulates have traditionally been studied in cardiovascular systems, epidemiology and neurobiological studies on air pollution biology has shown strong evidence that the brain is adversely affected. Pilot studies of in vivo mice and in vitro rat mixed glial/neuronal culture models show that nPM exposure induced inflammatory markers such as TNFα and IL-1α in rodent brains. However, it is unknown how relevant in vitro models are because the question of whether traffic-derived nPM can actually reach the brain has not been sufficiently explored or addressed. Additionally, there are gaps in the literature regarding how nPM interacts with the neural systems on the cellular and tissue levels. Our work has revealed a role for the olfactory neuroepithelium (OE) with regard to nPM toxicity in the brain. The olfactory sensory neurons of the OE are exposed to the external environment, which allows them to interact directly with nPM and other environmental toxins. Additionally, these neurons have axons that bundle together into nerve fibers that cross the cribriform plate and synapse in the olfactory bulb. We show that the OE has the most rapid responses to nPM exposure, with induction of TNFα and oxidative/nitrosative stress markers 4-hydroxynonenal (4-HNE) and 3-nitrotyrosine (3-NT). Induction of 4-HNE and 3-NT in OE preceded responses in the olfactory bulb, which also preceded response in cortex and cerebellum. On the cellular level, nPM modestly reduced the dendritic x lengths of olfactory sensory neurons, suggesting that there may be neurodegenerative actions of nPMs. To extend these findings, we use in vitro models of rat cortical glia and neurons to investigate potential neurotoxic actions of nPM. Conditioned media derived from nPM treated mixed glia reduces neurite outgrowth. siRNA and immunoneutralization knockdown of TNFα mRNA and protein rescued the conditioned media effect on neurite outgrowth in vitro. Additionally, blocking the type 1 TNF receptor also curbed the reduction of neurite outgrowth. These findings provide novel evidence that nPM induces oxidative stress and neuroinflammation in a time and region specific manner throughout the olfactory gateways (OE and olfactory bulb) and brain. Understanding the mechanisms in which nPM elicits its neurotoxic effects in different brain regions is crucial to detecting potential accelerated pathologies in people living in high pollution zones. Further knowledge of nanoparticulate matter biology may call for improvements in environmental and industrial regulations to improve the health of the general population. 1 CHAPTER 1 Introduction Air pollution is a widely studied environmental hazard with many known systemic effects. While the majority of air pollution studies have investigated the respiratory and cardiovascular systems, the brain has emerged as a direct target of these pollutants. Of the various components of air pollution, ultrafine particulate matter (ufPM, <200nm diameter) is more toxic to macrophages, epithelial cells, and neurons than larger particulate matter (PM) (Ibald-Mulli et al. 2002, Li et al. 2003, Gillespie et al. 2013) and warrants urgent attention. The US National Ambient Air Quality Standards (NAAQS) has established six principle air pollutant categories that include PM10 and PM2.5, but excludes ufPMs from consideration and monitoring, likely due to lack of awareness. However, several studies in Beijing, Mexico City, and various European cities have been conducted that show associations of ufPM with cognitive decline and mortality rates (Ibald-Mulli et al. 2002, Kipen et al. 2010, Calderón-Garcidueñas et al. 2008). The size of ufPM results in a high particle density concentration and high surface area to volume ratio, which has important implications to their interactions with neuro-biological systems. These interactions include their ability to traverse and deposit into the central nervous system (CNS) leading to oxidative stress and neuroinflammation. Importantly, there have been numerous proposed mechanisms for the entry of ufPMs into the brain, including through blood circulation and disruption of the blood brain barrier (BBB) (Muhlfeld et al. 2008, Oppenheim et al. 2013) and through the olfactory pathway (Lucchini et al. 2012), 2 with ample evidence supporting both as potential entryways to the CNS (Oberdörster et al. 2004). Composition and Properties of Air Pollution The composition of urban traffic-derived air pollution varies with time of day and season (Kim et al. 2002, Zhu et al. 2004). However, the particulate fraction of air pollution derived from fossil fuel combustion sources are well-documented and characterized (Table 1.1, Delfino et al. 2005, Hu et al. 2008, Delfino et al. 2010, Hasheminassab et al. 2014). ufPMs consist mostly of primary combustion products from mobile source emissions such as diesel and automobile exhaust, organic compounds, elemental carbons, and transition metals (Kim et al. 2002, Hu et al. 2008). Due to their size, large surface area, and lung deposition efficiency, ufPMs must be better investigated for determining health effects. Table 1.1: Size-resolved PM mass concentration, chemical composition and redox activities. Size Class Mass (µg/m 3 ) Organic Carbon (%) Elemental Carbon (%) SO4 2 - (%) NO3- (%) Na+ (%) NH4+ (%) K+ (%) Metals & Elements (%) DTT (nmol min -1 / µg PM) Macrophage ROS (µg Zymosan Units / µg PM) Quasi-ufPM (PM0.25) 5.23 34.82 11.08 16.73 4.22 1.28 6.93 0.27 5.15 0.04 0.45 Accumulation (PM0.25-2.5) 7.13 12.95 1.90 25.08 16.37 7.07 8.87 0.47 12.30 0.02 0.16 Coarse (PM2.5-10) 8.45 8.42 1.12 5.88 17.62 12.40 1.37 0.63 12.07 0.01 0.12 These data represent the average values of 6 sampling sites in southern California (Adapted from Hu et al. 2008). 3 The UfPM surface can carry large amounts of adsorbed or condensed toxic air pollutants with them, such as transition metals, organic compounds and oxidant gases (Hu et al. 2008). ufPMs have relatively low densities, which in conjunction with their large surface area, corresponds to a higher mobility size (McMurry et al. 2002, Sioutas et al. 2005). This contributes to the ability for ufPMs to induce the greatest amount of inflammation and oxidative stress compared to larger PM (Table 1.1, Li et al. 2003, Sioutas et al. 2005). Although Hu et al. 2008 showed dithiothreitol (DTT) activity correlated most strongly with organic carbon, transition metals associated with ufPM surface can also contribute to oxidative stress in biological systems (Cakmak et al. 2014). Additionally, they can aggregate to form larger accumulation mode particulates (PM2.5). Air pollution is an increasing problem around the world. Many people around the world especially in China, India and certain US cities are exposed to concentrations of air pollution far above the recommended safety standards (Akimoto et al. 2003), leading to increased mortality rates (Chen et al. 2013) and cognitive diseases of accelerated aging (Chen et al. 2009). To better understand how air pollution may affect the CNS, it is critical to understand how air pollutants can translocate to the brain where it may have direct effects on neurons and glia. Neuroepithelium as a Gateway to the Brain The olfactory neuroepithelium (OE) has been gaining interest over the past few years partly due to accumulating evidence that it acts as a gateway to the brain for inhaled PM. Olfactory impairments are also early markers of neurodegenerative diseases such as 4 schizophrenia, Alzheimer’s, and Parkinson’s disease (Trojanowski et al. 1991, Ruan et al. 2012). The OE is located in the dorsoposterior aspect of the nasal cavity, septum, and ethmoturbinates. The exact anatomical distribution and size covered by the olfactory epithelium in human adults are not well defined (Escada et al. 2009), but they consist of a pseudostratified columnar epithelium that rests on top of a lamina propria (Fig. 1.1). There are four main cell types that comprise the OE: olfactory sensory neurons (OSN), sustentacular cells, basal cells, and microvillar cells (Escada et al. 2009). The OSN that lie on the surface of the OE are special because they are the one of the few neurons that make physical contact with the outside environment. They are bipolar and project a single ciliated dendrite to the surface of the neuroepithelium and a single axon to the main olfactory bulb. The OSN axons cross the basement membrane of the neuroepithelium where they join together to form fascicles and nerve bundles (first cranial nerve, aka. olfactory nerve) and cross through the foramina of the cribriform plate to synapse within the olfactory bulb (Fig. 1.1). Because the OSNs are in contact with the external environment, they must have significant support and regenerative capabilities in order to function. The sustentacular cells surround the OSNs and contribute to regulating and maintaining ionic conditions for optimal olfactory transduction (Hadley et al. 2004). The basal cells rests on the basement membrane where they act as a niche of stem cells in the OE and can continuously regenerate OSNs along the lifespan of the animal. Basal cells of the OE have been documented to be multipotent and can give rise to other cell types (Hahn et al. 2005). 5 Microvillar cells play a role in chemoreception of odorants in the OE, distinct from the OSNs (Hadley et al. 2004). Figure 1.1: Model Olfactory Epithelium Diagram The olfactory ensheathing cells and the Bowman’s gland are two cell types localized to the lamina propria (Fig. 1.1). The olfactory ensheathing cells are a unique line of glial cells that play an important role in the support of olfactory receptor neurons. The Bowman gland is an exocrine organ that contributes to the mucous layer of the olfactory lining and is essential for olfactory transduction (Hadley et al. 2004). 6 Landmark studies in the mid-1900s demonstrated that inhaled nano-sized particles of the poliovirus (30nm) and silver-coated gold colloid particles (50nm) bypass the BB via retrograde transport into the olfactory bulb via axons of olfactory nerves (Bodian et al. 1941, DeLorenzo 1970). Since then, several studies have shown that exposure to nano- sized particles of elemental carbon ( 13 C), titanium oxide (TiO2), and manganese oxide (MnO) leads to accumulation in the olfactory bulb (Oberdörster et al. 2004, Elder et al. 2006, Wang et al. 2008). More specifically, ultrafine particles of Mn oxide accumulates efficiently (between 20- 30%) in the rodent olfactory bulb after intranasal instillation of the particles (Elder et al. 2006). Occluding the right nares of the rodent causes Mn to accumulate only in the left olfactory bulb, conclusively shows that there is a nose-brain connection in the uptake of ultrafine particles. Once deposited in the olfactory bulb, the particles can then disrupt the oxidative balance and lead to stress and neuroinflammation. However, an intranasal instillation of ultrafine particles may not represent physiological conditions. Also, unlike humans, rodents are obligate nasal breathers and have different nasal epithelial anatomy (Lucchini et al. 2012). Despite these differences, the the nasal olfactory transport pathway is functional in human beings. The transport of nasally- administered thallium ( 201 Tl) to the human brain in healthy volunteers has been tracked using a combination of single photon emission computed tomography (SPECT), X-ray computed tomography (CT), and MRI (Shiga et al. 2011). This study demonstrated clear translocation of 201 Tl to the human olfactory bulb with transport kinetics that are consistent 7 with delivery via the olfactory nerve. Another study showed that whole body exposure of rodents to ultrafine 13 C graphite also significantly increased the accumulation of ultrafine 13 C in the olfactory bulb, although the majority of particles ended up depositing in the lung (Oberdörster et al. 2004). It should also be noted that ultrafine particles are small enough to traverse the olfactory neuron axons and cribriform plate, which are <200nm in diameter (Elder et al. 2006). An important finding in the study was that the ultrafine particles in the olfactory bulb were preferentially located in the mitochondria, which might be a key site of initial damage with potential for dysregulating energy metabolism (Xia et al. 2006). In studies of postmortem humans from highly polluted Mexico City, ufPMs were detected in the olfactory bulb (Calderón-Garcidueñas et al. 2010). UfPMs were also observed in erythrocytes from lung, frontal and trigeminal ganglia capillaries (Calderón-Garcidueñas et al. 2008). The presence of PM in young human olfactory bulb neurons, was identified by neuronal-specific enolase staining. Furthermore, dogs living in highly polluted cities showed damaged nasal respiratory epithelium with patchy replacement of the mucociliary epithelium by squamous metaplasia (Calderón-Garcidueñas et al. 2008). Because the OE is vulnerable to environmental toxins, it must be able to regulate and protects itself against the insults. The OE maintains continuous neuronal cell replacement to maintain its function. As noted above, basal cells constantly replace olfactory sensory neurons that are lost via damage and apoptosis. Basal cells first give rise to immature neurons that further differentiate dendritic cilia and extension axons through the foramina of the cribriform plate to synapse in the olfactory bulb, where the neurons derive trophic 8 factors necessary for survival. Neurons that do not synapse into the olfactory bulb undergo apoptosis due to lack of trophic support (Robinson et al. 2002). As a result, there is always a baseline rate of apoptosis in olfactory sensory neurons even in the absence of insults. This balance between regeneration by basal cells and apoptosis is termed olfactory neuronal homeostasis. While this homeostasis is maintained throughout adult life, aging changes gene expression in the OE in a way that favors apoptosis (Robinson et al. 2002). ufPM is predicted to be able to overwhelm the homeostatic balance, and lead to disrupted OE morphology and loss of olfactory sensory neurons. Particulate matter induces neuroinflammation and oxidative stress in nose and brain Oxidative stress occurs when production of reactive oxidative species (ROS) overwhelms the cellular antioxidant systems. Air pollution consists of many oxidative species such as ozone and PMs, which may contain transition metals and various organic carbons (Kim et al. 2002, Delfino et al. 2005, Sioutas et al. 2005) that may damage cells. The presence of PMs in brain is associated with abnormal cell and tissue morphology, white matter lesions, and oxidative stress markers (Calderón-Garcidueñas et al. 2012), which contribute to neuroinflammation, neurodegeneration, and the acceleration of brain aging and pathology. Of all size fractions of PM, UfPMs induce the formation of ROS far more significantly than PM2.5 and PM10 as quantified by the dithiothreitol (DTT) assay (Li et al. 2003). 9 A link between air pollution exposure and airway nasal epithelial damage has been established. In the Southwest Metropolitan Mexico City study, dogs residing in more polluted areas displayed disrupted sensory olfactory and sustentacular cell layers, with an overall thinning of the OE (Calderón-Garcidueñas et al. 2002). There was also an increase in scattered polymorphonuclear leukocytes and monocytes in the epithelium and submucosa, implicating an increase in inflammatory mediator cells. Notably, the animals in the polluted cities had much higher incidence of neuroepithelial degeneration, inflammation, respiratory metaplasia, basal cell hyperplasia, and increased positive inducible nitric oxide synthase (iNOS) staining in the olfactory neurons indicative of increased oxidative stress (Calderón-Garcidueñas et al. 2002). Since ufPMs preferentially localize to the mitochondria (Oberdörster et al. 2004, Xia et al. 2006), and mitochondria themselves are a major source of endogenous ROS production, there may be an increase in overall ROS released into the cell. The ROS are often intermediates of oxygen reduction of the electron transport chain that leak out and can attack the bases or DNA backbone, forming products such as 8-oxoguanine. An increase in the number of AP sites is a relative measurement of oxidative DNA damage. The dogs from the most polluted city showed a 2-fold increase of AP sites/10 6 nucleotides in the olfactory bulb and hippocampus, but not OE or cortex (Calderón-Garcidueñas et al. 2003). These exposed animals also demonstrated neuronal nuclear NFκB translocation and glial iNOS expression, in addition to disruptions of the nasal and olfactory barriers and the BBB (Calderón-Garcidueñas et al. 2003). 10 With regards to oxidative stress, it is important to look at the Nrf2 antioxidant response pathway as well as the redox sensitive NFκB transcription factor that acts as an early inflammatory mediator (Delfino et al. 2010). Ultrafine particles can induce cellular heme oxygenase-1 (HO-1) and deplete intracellular glutathione in macrophages, both being markers of oxidative stress and activation of the Nrf2 anti-oxidant pathways (Li et al. 2003). Recent rodent studies of the CNS have shown increases in GCLM, GCLC, NQO1, and HO-1 mRNA and protein in cerebellum as well as Nrf2 mRNA expression in the hippocampus after exposure to combustion derived ufPMs (Bos et al. 2012, Zhang et al. 2012). Notably, the phase II enzymes were only significantly increased in young, not old animals, indicating an aging component to oxidative stress response (Zhang et al. 2012). Another study showed increases in HO-1 mRNA in olfactory bulb, striatum, frontal cortex, and hippocampus after exposure to ufPM (Guerra et al. 2013). Redox-sensitive NFκB is normally kept in the cytosol by IκB, but phosphorylation of IκB causes it to be ubiquitinated and degraded, allowing NFκB to translocate to the nucleus where it can initiate transcription of inflammatory mediators. PM can activate NFκB through increased hydrogen peroxide (H2O2), nitric oxide (NO •) or other oxidants (Nam et al. 2004, Premasekharan et al. 2011). Similarly, concentrated ambient ufPMs can activate NFκB and stress response transcription factor AP-1 in the cortex through oxidative mechanisms (Kleinman et al. 2008). Another possible mechanism of NFκB activation is through transition metals such as iron on the surface of ufPM. It has been demonstrated that oxidative activation of NFκB in macrophages by ultrafine particles involves a non- 11 classical pathway in which iron-dependent lipid peroxidation (measured by diphenyl-1- pyrenylphosphine fluorescence) activates NFκB through lipid raft disruption and phosphatidylcholine specific phospholipase C (Premasekharan et al. 2011). Several studies showed increases of lipid peroxidation post exposure to PM. For example ambient PM exposure induced malondialdehyde, a marker of oxidized lipids, in cerebral cortex (Zanchi et al. 2010). Because the brain has high oxygen consumption, high lipid content, and relatively low antioxidant enzymes compared to other tissue (Mattson et al. 2001), it is at high risk for lipid peroxidation by free radicals. There is an abundance of brain cephaline and sphingoglycolipid that comprise of myelin sheathes of neurons, as well as the phospho and glycolipids that comprise of their membranes. Mechanisms of lipid peroxidation in cells are not limited to transition metal mediated redox chemistry. There are many inflammatory mediators such as TNFα that can also regulate lipid peroxidation in brain. Intraperitoneal injection of TNFα leads to alterations in activity of sphingomyelinase and accumulation of lipid peroxidation products in cerebellum and hippocampus (Gutner et al. 2005). This is relevant because TNFα is induced in vivo and in vitro following ufPM exposure (Morgan et al. 2011). ufPM and cellular interactions also include complex responses with regards to calcium signaling, lipid peroxidation, and nitrosative stress. In the presence of lipid peroxidation mediated damage, the membrane releases calcium from calcium-binding proteins at the intracellular plasma membrane via lipid raft disruption (Premasekharan et al. 2011). The elevated intracellular calcium can activate the constitutive nitric oxide synthases eNOS or 12 nNOS, which will generate more nitric oxide and stress in the cell. Nitric oxide is involved in the reduction of synaptic function of CA1 neurons after chronic exposure to ufPM (Davis et al. 2013). A 50% increase of S-nitrosylation of cysteine residues on GluN2A and GluA1 subunits implicates susceptibility to neuronal excitotoxicity. Lastly, metals present on PM warrant evaluation. Exposure to transition metals alone is sufficient to elicit biological responses in mammalian models. Intranasal instillation of ultrafine TiO2 leads to production of the O • 2 − , which can cross cellular membranes and react with other transition metals to form the hydroxyl radical (Wang et al. 2008), leading to lipid peroxidation products and loss of membrane integrity. Additionally, transmission electron microscopy (TEM) has revealed crimpled and decreased mitochondria in the CA1 region of hippocampus following exposure to TiO2 (Wang et al. 2008), which may be related to transition metal tendency to localize to mitochondria in cells. Metals present in the mitochondria may also support and accelerate electron transport, which produces more ROS (Ghio et al. 2012). These facts corroborate findings that mitochondrial haplotypes changes the relationship between ufPM exposure and induction of inflammatory biomarkers. People with mitochondria haplotype U (less coupled respiratory chain and less ROS) did not show increases in blood inflammatory markers compared to people with haplotype H (coupled respiratory chain and more ROS) (Wittkopp et al. 2013). Transition metals are sufficient but not necessary for all biological effects of ufPMs, as inflammation and intracellular calcium induction by ultrafine carbon black has been shown to be independent of transition metals. Treatment of ultrafine carbon black with desferal 13 (a metal chelator) is a model of ufPM without the adsorbed components (transition metals and other soluble components), and induces inflammation and oxidative stress, demonstrating that size alone can contribute to inflammatory effects of ufPM (Brown et al. 2000). Studies that compare ultrafine vs fine particles of carbon black and polystyrene correlate the larger surface area of ufPMs with larger inflammatory responses (Oberdörster et al. 2000, Brown et al. 2001). For example, polysterene ufPMs, but not fine PMs, induced IL-8 and neutrophils in the lung, and increased intracellular calcium in monocytes (Brown et al. 2001). Because immune cells such as monocytes and microglia are amongst the most reactive cells to ufPMs, they warrant discussion under the context of neuroinflammation. Microglial contributions to ultrafine particle exposure and neuroinflammation Microglia are the innate immune cells in the brain and are the primary regulators of neuroinflammation, as shown by their robust production of pro-inflammatory cytokines and chemokines such as interleukin-1 (IL-1), tumor necrosis factor (TNFα), prostaglandins, and interferon-γ and reactive oxygen species such as NO • , H2O2, (O • 2 − ), and peroxynitrite (ONOO − ) (Block et al. 2007). Activated microglia is a hallmark of many neurodegenerative diseases such as Alzheimer’s disease (Tai et al. 2015) which are linked to air pollution (Block et al. 2009). Autopsy studies from Mexico City show increased CD14 (a microglial marker) in brains of people living in polluted areas (Calderón-Garcidueñas et al. 2008), indicating either resident microglial activation or increases in infiltrating monocytes or both. 14 Microglia can activated by ufPMs and diesel exhaust particles (Block et al. 2004, Levesque et al. 2011). In vitro cultures of microglia treated with ultrafine diesel particles show activated morphology and increased superoxide production (Block et al. 2004). Additionally, transition metals associated with air pollution such as Mn can also activate microglia, causing them to release hydrogen peroxide (Zhang et al. 2007), which can potentially be converted to radicals by Fenton chemistry. Activation of microglia can cause them to secrete inflammatory factors and ROS, which can lead to neuroinflammation and neurotoxicity (Block et al. 2004). Application of conditioned media taken from microglia treated with ufPMs on cortical neurons reduce neurite outgrowth, which has implications for synaptic plasticity that may contribute to cognitive impairment (Morgan et al. 2011). Dopaminergic neurons treated with ultrafine diesel exhaust only exhibited neurotoxicity in the presence of microglia (Block et al. 2004). Also, regions with high microglial density have been shown to have higher levels of neuroinflammatory markers (Levesque et al. 2014). Taken together, these results delineate the importance of microglia in mediating air pollution effects in brain. Not much is known about the role of microglia and resident macrophages in the OE in the context of air pollution. The OE and olfactory bulbs are intimately connected, as removal of the olfactory bulb causes OSNs to undergo apoptosis (Escada et al. 2009). This leads to activation of resident macrophages in the OE, which scavenge and remove the dead cells (Borders et al. 2007). For example, intranasal instillation of nano-sized neurovirulent influenza A virus caused olfactory sensory neurons to undergo apoptosis, followed by increases in Iba1-expressing (monocyte marker) activated macrophages that remove the 15 apoptotic bodies (Mori et al. 2002). A similar mechanism may apply to olfactory sensory neurons in the context of ufPM exposure, but further investigation is needed. 16 References 1. Akimoto H. 2003. Global Air Quality and Pollution. Science 302:1716-1719. 2. Block ML, Calderón-Garcidueñas L. 2009. Air pollution: Mechanisms of neuroinflammation and CNS disease. Trends in Neurosci 32:506-516. 3. Block ML, Hong JS. Chronic microglial activation and progressive dopaminergic neurotoxicity. 2007. Biochem Soc Trans 35:1127–1132. 4. Block ML, Wu X, Pei Z, Li G, Wang T, Qin L, et al. 2004. Nanometer size diesel exhaust particles are selectively toxic to dopaminergic neurons: the role of microglia, phagocytosis, and NADPH oxidase. FASEB J 18:1619-1620. 5. Bodian D, Howe HA. 1941. The rate of progression of poliomyelitis virus in nerves. Proc Soc exp Biol and Med 41:540. 6. Borders AS, Getchell ML, Etscheidt JT, VanRooijen N, Cohen DA, Getchell TV. 2007. Macrophage depletion in the murine olfactory epithelium leads to increased neuronal death and decreased neurogenesis. J Comp Neurol 501:206-218. 7. Bos I, DeBoever P, Emmerechts J, Buekers J, Vanoirbeek J, Meeusen R, et al. 2012. Changed gene expression in brains of mice exposed to traffic in a highway tunnel. Inhal Toxicol 24:676-686. 8. Brown DM. 2000. Increased inflammation and intracellular calcium caused by ultrafine carbon black is independent of transition metals or other soluble components. J Occup Env Med 57: 685-691. 9. Brown DM, Wilson MR, MacNee W, Stone V, Donaldson K. 2001. Size-dependent proinflammatory effects of ultrafine polystyrene particles: a role for surface area and 17 oxidative stress in the enhanced activity of ultrafines. Toxicol Appl Pharmacol 175:191-199. 10. Cakmak S, Dales R, Kauri LM, Mahmud M, Ryswyk KV, Vanos J, et al. 2014. Metal composition of fine particulate air pollution and acute changes in cardiorespiratory physiology. Environ Pollut 189:208-214. 11. Calderón-Garcidueña L, Azzarelli B, Acuna H, Garcia R, Gambling TM, Osnaya N, et al. 2002. Air pollution and brain damage. Toxicol Pathol 30:373-389. 12. Calderón-Garcidueña L, Franco-Lira M, Henríquez-Roldán C, Osnaya N, Gonzalez- Maciel A, Reynoso-Robles R, et al. 2010. Olfactory dysfunction, olfactory bulb pathology and urban air pollution. Exp Toxicol Pathol 62:91-102. 13. Calderón-Garcidueñas L, Kavanaugh M, Block M, D'Angiulli A, Delgado-Chávez R, Torres-Jardón R, et al. 2012. Neuroinflammation, hyperphosphorylated tau, diffuse amyloid plaques, and downregulation of the cellular prion protein in air pollution exposed children and young adults. J Alzheimers Dis 28:93-107 14. Calderón-Garcidueña L, Maronpot RR, Torres-Jardon R, Henríquez-Roldán C, Schoonhoven R, Acuña-Ayala H, et al. 2003. DNA Damage in Nasal and Brain Tissues of Canines Exposed to Air Pollutants Is Associated with Evidence of Chronic Brain Inflammation and Neurodegeneration. Toxicol Pathol 31:524-538. 15. Calderón-Garcidueñas L, Mora-Tiscareño A, Ontiveros E, Gómez-Garza G, Barragán-Mejía G, Broadway J, et al. 2008. Air pollution, cognitive deficits and brain abnormalities: A pilot study with children and dogs. Brain Cogn 68:117-127. 16. Calderon-Garciduenas L, Solt AC, Henriquez-Roldan C, Torres-Jardon R, Nuse B, Herritt L, et al. 2008. Long-term air pollution exposure is associated with 18 neuroinflammation, an altered innate immune response, disruption of the blood-brain barrier, ultrafine particulate deposition, and accumulation of amyloid-beta 42 and alpha-synuclein in children and young adults. Toxicol Pathol 36:289-310. 17. Chen JC, Schwartz J. 2009. Neurobehavioral effects of ambient air pollution on cognitive performance in US adults. Neurotoxicol 30: 231-39. 18. Chen Y, Ebenstein A, Greenstone M, Li H. 2013. Evidence on the impact of sustained exposure to air pollution on life expectancy from China’s Huai River policy. PNAS 110:12936-12941. 19. Davis DA, Akopian G, Walsh JP, Sioutas C, Morgan TE, Finch CE. 2013. Urban air pollutants reduce synaptic function of CA1 neurons via an NMDA/NȮ pathway. J Neurochem 127:509-519. 20. Delfino RJ, Sioutas C, Malik S. 2005. Potential role of ultrafine particles in associations between airborne particle mass and cardiovascular health. Environ Health Perspect 113:934-946. 21. Delfino RJ, Staimer N, Tjoa T, Arhami M, Polidori A, Gillen DL, et al. 2010. Association of biomarkers of systemic inflammation with organic components and source tracers in quasi-ultrafine particles. Environ Health Perspect 118:756-762. 22. Delfino RJ, Staimer N, Vaziri ND. Air pollution and circulating biomarkers of oxidative stress. Air Qual Atmos Health 4:37–52. 23. De Lorenzo AJ. 1970. The olfactory neuron and the blood-brain barrier. In: Wolstenholme G, Knight J, editors. Taste and Smell in Vertebrates. London: Churchill. p.151–176. 19 24. Elder A, Gelein R, Silva V, Feikert T, Opanashuk L, Carter J, et al. 2006. Translocation of inhaled ultrafine manganese oxide particles to the central nervous system. Environ Health Perspect 114:1172-1178. 25. Escada PA, Lima C, Silva JM. 2009. The human olfactory mucosa. Eur Arch Otorhinolaryngol 266:1675-1680. 26. Ghio AJ, Carraway MS, Madden MC. 2012. Composition of air pollution particles and oxidative stress in cells, tissues, and living systems. J Toxicol Environ Health B 15:1- 21. 27. Gillespie P, Tajuba J, Lippmann M, Chen LC, Veronesi B. 2013. Particulate matter neurotoxicity in culture is size-dependent. Neurotoxicol 36:112-117. 28. Guerra R, Vera-Aguilar E, Uribe-Ramirez M, Gookin G, Camacho J, Osornio-Vargas AR, et al. 2013. Exposure to inhaled particulate matter activates early markers of oxidative stress, inflammation and unfolded protein response in rat striatum. Toxicol Lett 222:146-154. 29. Gutner UA, Dudnik LB, Korobko VG, Alesenko AV. 2005. The influence of tumor necrosis factor alpha on the processes of sphingomyelin cycle and lipid peroxidation in brain Zh Nevrol Psikhiatr Im S S Korsakova 195:48-54. 30. Hadley K, Orlandi RR, Fong KJ. 2004. Basic anatomy and physiology of olfaction and taste. Otolaryngol Clin North Am 37:1115-1126. 31. Hahn CG, Han LY, Rawson NE, Mirza N, Borgmann-Winter K, Lenox RH, et al. 2005. In vivo and in vitro neurogenesis in human olfactory epithelium. J Comp Neurol 483:154-163. 20 32. Hasheminassab S, Daher N, Schauer JJ, Sioutas C. 2013. Source apportionment and organic compound characterization of ambient ultrafine particulate matter (PM) in the Los Angeles Basin. Atmos Environ 79:529–539. 33. Hu S, Polidori A, Arhami M, Shafer MM, Schauer JJ, Cho A, Sioutas C. 2008. Redox activity and chemical speciation of size fractioned PM in the communities of the Los Angeles-Long Beach harbor. Atmos Chem Phys 8:6439-6451. 34. Ibald-Mulli A, Wichmann HE, Kreyling W, Peters A. 2002. Epidemiological Evidence on Health Effects of Ultrafine Particles. J Aerosol Med 15:189-201. 35. Kim S, Shen S, Sioutas C, Zhu Y, Hinds WC. 2002. Size distribution and diurnal and seasonal trends of ultrafine particles in source and receptor sites of the Los Angeles Basin. J Air Waste Manag Assoc 52:297-307. 36. Kipen H, Rich D, Huang W, Zhu T, Wang G, Hu M, et al. 2010. Measurement of inflammation and oxidative stress following drastic changes in air pollution during the Beijing Olympics: A panel study approach. Ann NY Acad Sci 1203:160-167. 37. Kleinman MT, Araujo JA, Nel A, Sioutas C, Campbell A, Cong PQ, et al. 2008. Inhaled ultrafine particulate matter affects CNS inflammatory processes and may act via MAP kinase signaling pathways. Toxicol Lett 178:127-130. 38. Kumagai Y, Koide S, Taguchi K, Endo A, Nakai Y, Yoshikawa T, et al. 2002. Oxidation of proximal protein sulfhydryls by phenanthraquinone, a component of diesel exhaust particles. Chem Res Toxicol 15:483-489. 39. Levesque S, Taetzsch T, Lull ME, Kodavanti U, Stadler K, Wagner A, et al. 2011a. Diesel exhaust activates and primes microglia: air pollution, neuroinflammation, and regulation of dopaminergic neurotoxicity. Environ Health Perspect 1198:1149-1155. 21 40. Li N, Sioutas C, Cho A, Schmitz D, Misra C, Sempf J. et al. 2003. Ultrafine particulate pollutants induce oxidative stress and mitochondrial damage. Environ Health Perspect 111:455-60. 41. Lucchini RG, Dorman DC, Elder A, Veronesi B. 2012. Neurological impacts from inhalation of pollutants and the nose–brain connection. Neurotoxicol 33:838-41. 42. Mattson MP. 2001. The pathogenesis of neurodegenerative disorders. Totowa, NJ: Humana P. 43. McMurry PH, Wang X, Park K, Ehara K. 2002. The relationship between mass and mobility for atmospheric particles: a new technique for measuring particle density. Aerosol Sci Technol 36:227–238. 44. Morgan TE, Davis DD, Iwata N, Tanner JM, Snyder D, Ning Z, et al. 2011. Glutamatergic neurons in rodent models respond to nanoscale particulate urban air pollutants in vivo and in vitro. Env Health Perspect 119:1003-1009. 45. Mori I, Goshima F, Imai Y, Kohsaka S, Sugiyama T, Yoshida T, et al. 2002. Olfactory receptor neurons prevent dissemination of neurovirulent influenza A virus into the brain by undergoing virus-induced apoptosis. J Gen Virol 83:2109–2116. 46. Muhlfeld C, Rothen-Rutishauser B, Blank F, Vanhecke D, Ochs M, Gehr P. 2008. Interactions of nanoparticles with pulmonary structures and cellular responses. Am J Physiol Lung Cell Mol Physiol 294:817-829. 47. Nam H. 2004. The role of nitric oxide in the particulate matter (PM2.5)-induced NFκB activation in lung epithelial cells. Toxicol Lett 148:95-102. 22 48. Oberdörster G, Finkelstein JN, Johnston C, Gelein R, Cox C, Baggs R, Elder AC. 2000. Acute pulmonary effects of ultrafine particles in rats and mice. Res Rep Health Eff Inst 96:5-86. 49. Oberdörster G, Sharp Z, Atudorei V, Elder A, Gelein R, Kreyling W, et al. 2004. Translocation of inhaled ultrafine particles to the brain. Inhal Toxicol 16:437-445. 50. Oppenheim HA, Lucero J, Guyot A, Herbert LM, Mcdonald JD, Mabondzo A, et al. 2013. Exposure to vehicle emissions results in altered blood brain barrier permeability and expression of matrix metalloproteinases and tight junction proteins in mice. Part Fibre Toxicol 10:62. 51. Premasekharan G, Nguyen K, Contreras J, Ramon V, Leppert VJ, Forman HJ. 2011. Iron-mediated lipid peroxidation and lipid raft disruption in low-dose silica-induced macrophage cytokine production. Free Radic Biol Med 51:1184-1194. 52. Robinson AM, Conley DB, Shinners MJ, Kern RC. 2002. Apoptosis in the aging olfactory epithelium. Laryngoscope 112:1431-1435. 53. Ruan Y, Zheng XY, Zhang HL, Zhu W, Zhu J. 2012. Olfactory dysfunctions in neurodegenerative disorders. J Neurosci Res 90:1693-1700. 54. Shiga H, Taki J, Yamada M, Washiyama K, Amano R, Matsuura Y, et al. 2011. Evaluation of the olfactory nerve transport function by SPECT-MRI fusion image with nasal Thallium-201 administration. Mol Imaging Biol 13:1262-1266. 55. Sioutas C, Delfino RJ, Singh M. 2005. Exposure assessment for atmospheric ultrafine particles (UFP) and implications in epidemiological research. Environ Health Perspect.113:947–955. 23 56. Tai LM, Ghura S, Koster KP, Liakaite V, Maienschein-Cline M, Kanabar P, et al. 2015. APOE-modulated AB-induced neuroinflammation in Alzheimer’s disease: current landscape, novel data, and future perspective. J Neurochem 133:465-488. 57. Trojanowski JQ, Newman PD, Hill WD, Lee VM. 1991. Human olfactory epithelium in normal aging, Alzheimer's disease, and other neurodegenerative disorders. J Comp Neurol 310:365-376. 58. Wang J, Liu Y, Jiao F, Lao F, Li W, Gu Y, et al. 2008. Time-dependent translocation and potential impairment on central nervous system by intranasally instilled TiO2 nanoparticles. Toxicol 254:82-90. 59. Wittkopp S, Staimer N, Tjoa T, Gillen D, Daher N, Shafer M, et al. 2013. Mitochondrial genetic background modifies the relationship between traffic-related air pollution exposure and systemic biomarkers of inflammation. PLoS ONE 8. DOI: 10.1371/journal.pone.0064444. 60. Xia T, Kovochich M, Brant J, Hotze M, Sempf J, Oberley T, et al. 2006. Comparison of the abilities of ambient and manufactured nanoparticles to induce cellular toxicity according to an oxidative stress paradigm. Nano Lett 6:1794-1807. 61. Zanchi AC, Fagundes LS, Barbosa F Jr, Bernardi R, Rhoden CR, et al. 2010. Pre and post-natal exposure to ambient level of air pollution impairs memory of rats: The role of oxidative stress. Inhal Toxicol 22:910-918. 62. Zhang HQ, Liu H, Davies KJ, Sioutas C, Finch CE, Morgan TE, Forman HJ. 2012. Nrf2-regulated phase II enzymes are induced by chronic ambient nanoparticle exposure in young mice with age-related impairments Free Radic Biol Med 52:2038- 2046. 24 63. Zhang P, Hatter A, Liu B. 2007. Manganese chloride stimulates rat microglia to release hydrogen peroxide. Toxicol Lett 173:88-100. 64. Zhu Y, Hinds WC, Kim S, Shen S, Sioutas C. 2004. Seasonal trends of concentration and size distributions of ultrafine particles near major highways in Los Angeles. Aerosol Sci Technol 38:5-13. 25 CHAPTER 2 Nano-scale particulate matter from urban traffic rapidly induces oxidative stress and inflammation in olfactory epithelium with concomitant effects on brain (Adapted from Environmental Health Perspectives. 2016.) Abstract Rodent models for urban air pollution show consistent induction of inflammatory responses in major brain regions. However, the initial impact of air pollution particulate material on olfactory gateways has not been reported. We evaluated the olfactory neuroepithelium (OE) and brain regional responses to a nano-sized subfraction of urban traffic ultrafine particulate matter (nPM, < 200 nm) in vivo, ex vivo and in vitro. Adult mice were exposed to re-aerosolized nPM for 5-, 20-, and 45- cumulative hours (h) over 3 weeks. The OE, olfactory bulb (OB), cerebral cortex, and cerebellum were analyzed for oxidative stress and inflammatory responses. Acute responses of the OE to liquid nPM suspensions were studied with ex vivo and primary OE cultures. After exposure to nPM, the OE and OB had rapid increases of 4-hydroxy-2-nonenal (4-HNE) and 3- nitrotyrosine (3-NT) protein adducts, while cortex and cerebellum did not respond at any time. All brain regions showed increased tumor necrosis factor-α (TNFα) protein by 45 h, with earlier induction of TNFα mRNA in OE and OB. These responses corresponded to in vitro OE and mixed glial responses, with rapid induction of nitrite and inducible nitric oxide synthase (iNOS), followed by TNFα. These findings show the differential 26 time course of oxidative stress and inflammatory responses to nPM between the olfactory gateway and the brain. Slow cumulative transport of inhaled nPM into the brain may contribute to delayed responses of proximal and distal brain regions, with potential input from systemic factors. Introduction Urban air pollutants are associated with neurodegeneration. Population based studies show cognitive impairments increase in proportion to levels of PM2.5 (Ailshire et al. 2014; Gatto et al. 2014; Tonne et al. 2014) and ozone (Chen and Schwartz 2009; Gatto et al. 2014), which approximate 1-2 years of accelerated cognitive aging. Correspondingly, white matter loss was increased by 1% per 3 µg/m 3 PM2.5 in an MRI analysis of elderly women of the WHIMS cohort (Chen et al. 2015). Frontal cortical white matter hyperintensities and inflammation were also reported in a small sample of postmortem children from highly polluted Mexico City (Calderón-Garcidueñas et al. 2011). Rodent models further document inflammatory responses to relatively short term exposure of automotive-derived air particulate matter (Campbell et al. 2005; Levesque et al. 2011a; Morgan et al. 2011; Block et al. 2012). Notably, TNFα induced by nano- sized particulate matter (nPM) can impair neurite outgrowth (Cheng et al. 2016). To resolve possible sequences of brain responses, we examined the time course of oxidative stress and inflammation in both the mice nasal olfactory epithelium (OE) and brain. The ultrafine class of PM (i.e. particles with diameter < 200 nm) is used here because of its higher in vivo and in vitro toxicity than the larger PM derived from combustion engines (Li et al. 2002; Gillespie et al. 2013). Moreover, in inhalation 27 studies, nano-sized particles could physically translocate to the olfactory bulb (OB) and brain from the OE (Oberdörster et al. 2004; Elder et al. 2006). These observations are supplemented by nasal instillation studies of ultrafine particles, which show induction of inflammatory TNFα and MIP1α in OB (Wen-shwe et al. 2006), as well as accumulation of particles in the OB, striatum, and cortex (Gianutsos et al. 1997; Elder et al. 2006). Our exposure paradigm uses a chemically defined nano-scale subfraction, designated as nPM, to distinguish it from the total ultrafine PM0.2µm class (Morgan et al. 2011). In vivo and in vitro, nPM induced IL-1α, IL-6, and TNFα, with glial responses (CD68, GFAP) (Morgan et al. 2011; Cheng et al. 2016). Similarly, nano-scale diesel exhaust (DE) induced TNFα, IL-6, MIP-1α in olfactory bulb (OB) and post-olfactory brain regions (Levesque et al. 2011a). Taken together, there is a growing literature documenting the importance of the OE in ultrafine air pollution neurobiology. While the OE is gaining attention as a gateway to the brain and an initiation point of air pollution toxicity (Block et al. 2012; Lucchini et al. 2013; Cheng et al. 2016), the dearth of reports on OE responses to acute air pollution PM in rodent models is in surprising contrast to the well-documented OE responses to ozone (Wagner et al. 2002; Ong et al. 2015). Because the OE is the first neuronal contact to inhaled PM, and that OE neuron dendrites regress with acute exposure in vitro to nPM (Cheng et al. 2016), we hypothesized that OE responses would be rapid and precede brain responses. We therefore defined the time course response of OE, OB, cerebral cortex, and cerebellum to nPM in vivo for oxidative stress (4-hydroxynonenal, 4-HNE and 3-nitrotyrosine, 3-NT) and inflammatory responses (TNFα and microglia). Furthermore, we introduce an ex vivo model of the OE for studying acute responses to nPM. 28 Material and Methods nPM collection and extraction. Nano-scale particulate matter (nPM, <0.2 μm in diameter) was collected on Teflon filters by a High-Volume Ultrafine Particle (HVUP) Sampler (Misra et al. 2002) at 400 L/min flow, about 150 meters downwind of the I-110 Freeway in central Los Angeles. nPM collected at this location between August and September 2012 represent urban ultrafine particles, dominantly originating from vehicular combustion emissions in addition to other less substantial sources such as sub-micron road dust (Hassheminassab et al. 2013; Saffari et al. 2013). The composition of collected nPM samples was similar to that of prior studies (Morgan et al. 2011). Filter-trapped dried nPM were eluted by sonication into deionized water. nPM suspensions (150 μg/ml) were tested for sterility (no microbial growth in nutrient media) and stored at -20 °C. nPM slurries were endotoxin-free as assayed by Limulus assay (Davis et al. 2013). As controls for nPM extracts, fresh sterile filters were sham extracted. The slurries were then either re-aerosolized for animal exposure or used for treating cell cultures. Animals and Ethics Statement. In vivo and ex vivo studies used 3 month old adult C57BL/6J male mice (body weight average: 27 g) purchased from Jackson Laboratories (Sacramento, CA, USA). In vitro studies with primary cultures used pups from pregnant Sprague Dawley rats from Harlan Labs (Livermore, CA, USA). Protocols were approved by the USC Institutional Animal Care & Use Committee (IACUC); animals were 29 maintained following NIH guidelines. For tissue collection, animals were euthanized by isoflurane or CO2, followed by cervical dislocation. Exposure conditions. Mice were exposed to nPM re-aerosolized by a HOPE nebulizer (B&B Medical Technologies) (Wang et al. 2013) at 343 μg/m 3 for 5 h/day, 3 d (MWF)/week for cumulative 5, 20, or 45 h (Fig. 2.1). The nPM slurry is dehydrated and charge-neutralized in the nebulizer chambers before being exposed to the mice. Particle number concentration of the inlet aerosol was monitored during exposures by a condensation particle counter (CPC, TSI Inc.). For exposure, mice were transferred from home cages into sealed exposure chambers that allowed adequate ventilation and with individual separation to minimize aggression. Exposed mice remained healthy and did not incur changes in body weight or core temperatures prior to euthanasia (not shown). Figure 2.1: Time course of nPM exposure. Mice were exposed to re-aerosolized nPM (343 µg/m 3 ) for 5 h/day, 3 d/week for a total of 5, 20, and 45 cumulative hours. Tissues were collected 18 h after the last exposure. Cell culture. For ex vivo OE organ cultures, adult mice were cardiac perfused with PBS (pH 7.4) and the nasal mucosa was delaminated as paired tissue ribbons (10 mg wet weight per mouse; 2 mice pooled per sample). The OE here is designated as the nasal 30 mucosa lining the nasoturbinates and ethmoturbinates (Fig. 2.2A). OE were rinsed in PBS before 2 h incubation with 150 µl of nPM (12 µg/ml) diluted in artificial cerebral spinal fluid (aCSF). Conditioned media were collected, centrifuged at 10,000g/5 min, and analyzed. Tissues were processed for RNA. In vitro primary cell culture studies were originated from OE and mixed glia from cerebral cortex of postnatal day 3 (P3) rats. For cell cultures, OE was dissociated via trituration and filtering using a 70 µm cell strainer. Cells were grown for 2 weeks in 6- well plates until 95% confluence, prior to addition of nPM for nitrite time course (Griess assay). OE primary cell cultures at confluence contain mainly spindle-shaped cells (lacking GFAP, Iba1, and NeuN); a minority of cells (< 5%) expressed GFAP, Iba1, or NeuN (not shown). For cerebral cortex mixed glia, cultures were grown for 2.5 weeks and comprised of 3:1 astrocytes: microglia, prior to treatment with trypsin for secondary cultures in 6- well plates. Secondary cultures were plated at approximately 1,000,000 cells/well. All primary cultures (OE, mixed glia) were grown in Dulbecco’s modified Eagle’s medium/Ham’s F12 50/50 Mix (DMEM F12 50/50) supplemented with 10% fetal bovine serum (FBS), 1% Pen/Strep and 1% L-glutamine in a humidified incubator (37°C/5%CO2) (Rozovsky et al. 1998). For treatment of cells, nPM (12 µg/ml) was diluted in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 15 mM HEPES, 1% sodium pyruvate, 0.24% BSA, 1% Pen/Strep, and 1% L-glutamine and applied onto cells for 1, 6, 12, and 24 hours. Cell culture experiments were repeated 3 times. 31 Nitrite assay. Griess reagent (Ignarro et al. 1993) with NaNO2 as a standard, and untreated media as a blank control. Western blots. Brain regions were homogenized by a motor driven pestle on ice in 1x RIPA buffer (Millipore) supplemented with 1mM PMSF, 1mM Na3VO2, 10 mM NaF, phosphatase inhibitor cocktails (Sigma), and Roche Complete Mini EDTA-free Protease Inhibitor Cocktail Tablet (Roche). Homogenates were centrifuged 10,000 g x 10 min/4°C; supernatants were analyzed by Western blots with 20 µg of total protein on Novex NuPAGE 4-12% Bis-Tris protein gels (Thermo Scientific). Membranes were washed with phosphate buffered saline with 0.05% tween-20 (PBST), then blocked with 5% milk/PBST or 5% BSA/PBST for 1 hour at room temperature, followed by overnight incubation with primary antibodies at 4°C: anti-TNFα (1:250, mouse; R&D Systems), anti-3-nitrotyrosine (1:1000, rabbit; Millipore), anti-4-hydroxynonenal (1:250, mouse; R&D Systems), anti-OMP (1:400, goat; Santa Cruz), anti-cleaved caspase 3 (1:1000, rabbit; Cell Signaling), anti-caspase 3 (1:1000, rabbit; Cell Signaling), anti-actin (1:10000, mouse; Sigma). HRP (1:10000, goat; Jackson) enhanced chemiluminescence was detected using West Pico Chemiluminescent Substrate (Thermo Scientific). Density of bands was assessed with imageJ. Immunohistochemistry. Following nPM treatment and euthanasia, heads de-skinned, fixed in 10% neutral-buffered formalin in 4°C overnight and de-calcified (Shandon’s TBD-1 Decalcifier; Thermo Scientific, Waltham, MA), followed by cryoprotection by submersion in a 10-30% sucrose/PBS pH 7.4 gradient. Heads were embedded in OCT 32 compound for cryostat sectioning. For OE sections, brain tissue was removed posterior to the olfactory bulb (OB). Tissue sections (18 µm) on glass slides were permeabilized with 1% NP-40/PBS and blocked with 5% BSA. Primary antibodies were added at room temperature overnight for markers of olfactory sensory neurons (OMP - 1:100, goat; Santa Cruz, and NeuN - 1:100, mouse; Millipore), astrocytes (GFAP - 1:400, mouse; Sigma), microglia (Iba1 - 1:200, rabbit; Wako), and oxidative stress (4-HNE - 1:100, rabbit; Millipore, and 3-NT - 1:100, rabbit; Abcam). Immunofluorescence was visualized using Alexa Fluor 488 and 594 antibodies (1:400, goat; Molecular Probes) and HRP (1:400, goat; Jackson) + DAB. Image Analysis. Images loaded onto ImageJ were converted into 8-bit, then stringently thresholded prior to particle and density analysis. Approximately 12 images were taken for each mouse OB and OE per stain. For microglia, only cells larger than 20 pixels 2 were considered for analysis. Morphology was determined based on number of visible primary processes (30 per OB for 8 animals). Data was normalized to the pixel area of the tissue when appropriate. Quantitative Polymerase Chain Reaction (qPCR). Total cellular RNA was extracted by TriReagent (Sigma) and 1-bromo-3-chloropropane (Sigma). cDNA was reverse transcribed (Superscript III kit; Invitrogen) from 2 μg RNA; qPCR used appropriate primers for mouse or rat (Valuegene, San Diego, CA). Data were normalized to GAPDH. 33 Statistical Analysis. Statistical analyses used Prism Version 6 (Graph Pad, La Jolla, CA). One-tailed t-test were used to test single comparisons regarding inflammatory responses that have been documented in the literature. Two-tailed t-tests were used to test single comparisons regarding oxidative stress responses and neuronal OMP. Multiple comparisons used ANOVA with Tukey post-test for adjustments. Data were plotted as mean ± SE. Threshold significance level of alpha = 0.05. 34 Results Inhaled nPM rapidly induced oxidative stress in olfactory gateways Cell types in brain that responded to nPM in vivo (Morgan et al. 2011; Levesque et al. 2011a; Win-shwe et al. 2015) were identified immunohistochemically in olfactory epithelium (OE) and olfactory bulb (OB) (Fig. 2.2A). Olfactory sensory neurons (OSN) line the nasal cavity, with dendrites projecting into the mucosal lining that interfaces with the external environment (Fig. 2.2B). Iba1-expressing (immunopositive) macrophages localize primarily in the lamina propria of the OE, with scattered presence in the OSN layer. Astrocytic GFAP was not detectable in the OSN layer, but showed diffuse staining in the lamina propria without definitive astrocytic cell bodies, (Fig. 2.2B). In contrast, GFAP in the OB showed robust staining of astrocytes with classical morphology in the OB glomerular layer, together with Iba1-expressing microglia (Fig. 2.2C). Figure 2.2: Model of olfactory gateway to brain. (A) Schema, dorsal transverse plane, of the olfactory epithelium (OE) and olfactory bulb (OB). Also see Harkema et al. 2006. The outlined box identifies displayed regions for 35 OE and OB; red dashed line represents an OSN and olfactory axon projection to OB. (B) Olfactory epithelium lining the ethmoturbinate space contains olfactory sensory neurons (OSNs) and Iba1-expressing macrophages; GFAP shows diffuse staining in lamina propria, but was not detected above background in the OSN layer. (C) The OB contains OSN projections in the glomerular layer (glom. layer), astrocytes, and microglia. Olfactory marker protein (OMP) staining is shown at lower magnification for clarity. Scale bar = 50 µm. To investigate the earliest OE and OB cellular responses to nPM, adult mice were exposed to re-aerosolized nPM for 5 h and euthanized the next day (Fig. 2.1). The OE showed 20% increases in the oxidative stress markers 4-hydroxynonenal (4-HNE) and 3-nitrotyrosine (3-NT) (Fig. 2.3A,B). The positive correlation of 4-HNE and 3-NT (Fig. 2.3C) suggests shared biochemical mechanisms in response to nPM. The number of Iba1-positive macrophages was increased by 30% in the OE turbinates, but did not change in quantity or morphology in the OE septum (Fig. 2.3D,E). In contrast to the OE, the OB did not show increased 4-HNE or 3-NT staining (Fig. 2.4A, B). However, the number of Iba1-positive microglia in the OB glomerular layer increased by 30%, without change in the adjacent mitral or granule cell layers (Fig. 2.4C,D). nPM doubled the number of amoeboid microglia (0-1 primary processes), which implies activation (Fig. 2.4E). Astrocytic GFAP staining did not change in any OB layer (Fig. 2.4F,G). 36 Figure 2.3: Acute in vivo nPM exposure induced oxidative stress and inflammation in olfactory epithelium (OE): immunohistochemistry. (A) Representative immunostaining of 4-hydroxynonenal (4-HNE) and 3-nitrotyrosine (3- NT) in OE. (B) 5 h exposure increased 4-HNE and 3-NT staining by 25% in OE vs. controls (n = 8 noses/group). Scale bar = 100 µm. (C) 4-HNE and 3-NT staining were positively correlated (r 2 = 0.27). (D) Iba1-expressing macrophages. (E) Macrophage numbers increased in the OE turbinates, but not in the OE septum (left: CTL, right: nPM). Scale bar = 50 µm. (*; p<0.05; t-test). 37 Figure 2.4: Acute in vivo nPM exposure responses in olfactory bulb (OB): immunohistochemistry. (A) Immunostaining of 4-HNE and 3-NT in OB. (B) 4-HNE and 3-NT did not change significantly (n = 8). Scale bar = 100 µm. (C) Representative immunostaining of Iba1- positive macrophages. (D) nPM exposure increased the number of microglia (Iba1- expressing) in the OB glomerular layer by 30%, but not in mitral or granule cell layers. (E) Representative images of ramified vs amoeboid microglia. Scale bar = 25 µm. nPM doubled the percentage of microglia without multiple processes; the total percent of activated microglia did not change. (*; p<0.05; two-way ANOVA). (F) Immunostaining of 38 astrocytes with GFAP. (G) GFAP immunostained area per region was not altered by nPM exposure in any OB layer. Scale bar = 50 µm. (*; p<0.05; t-test). nPM exposure of the olfactory epithelium ex vivo To further investigate initial reactions of the OE, we developed two models: (I) ex vivo OE organ culture and (II) dissociated OE primary mixed cell cultures. The OE tissue was incubated in CSF media with 12 µg/ml of nPM, a concentration that induced TNFα in mixed cerebral cortical glia (Morgan et al. 2011, Cheng et al. 2016). After 2 h incubation, RNA responses included 30% increase of CD68, IL-1α, and TNFα (Fig. 2.5A). nPM induced oxidative stress and inflammation in vitro The induction of reactive nitrogen species was suggested by the increased 3-NT (Fig. 2.3A,B). Correspondingly, the conditioned media (CM) from ex vivo OE organ culture showed a 50% increase of nitrite after 2 h of nPM (Fig. 2.5B). Dissociated mixed cell OE cultures also showed increased CM nitrite, continuing through 24 h (Fig. 2.6A). Because the OE primary cell cultures included OSN cell bodies, we examined mixed cortical glia cultures which have negligible neuronal content. During nPM exposure, nitrite in the CM also increased progressively over 24 h (Fig. 2.6B). iNOS mRNA was rapidly, but transiently induced by 1 h, with subsequent decrease paralleling nitrite level increases. Other nitric oxide synthases, eNOS and nNOS, had CT values below reliable quantification (CT > 30, not shown), suggesting that iNOS is the major contributor to the nitrite induction. TNFα mRNA showed a slower induction, increasing after 12-24 h (Fig. 2.6C). 39 Figure 2.5: Ex vivo exposure to nPM rapidly induced inflammatory responses in OE. (A) Ex vivo treatment of OE for 2 h with 12 µg/ml nPM induced TNFα, IL-1α, and CD68 mRNAs by 35% (n = 8 noses/group); PCR CT range: TNFα 28-30, IL-1α 28-30, and CD68 24-26. (B) Nitrite in the ex vivo OE conditioned media (CM) increased 50%. (*; p<0.05; **; p<0.01; t-test) 40 Figure 2.6: In vitro time course exposure to nPM induced oxidative stress and inflammation in primary cultures of rat OE and cerebral cortex mixed glia. (A) Conditioned media (CM) from dissociated OE cultures with 12 µg/ml nPM showed time-dependent increase of nitrite. (B) Cerebral cortex mixed glial (MxG) cultures with 12 µg/ml nPM transiently induced iNOS mRNA by 160% without change in nNOS and eNOS mRNA (CT > 30). Correspondingly, nPM doubled the CM nitrite by 12 h. (C) TNFα mRNA was increased by 125% after 12 h, remaining elevated at 24 h (n = 6/group/time). (*; p<0.05, **; p<0.01; t-test). 41 Extended in vivo nPM exposure induced rapid oxidative stress and inflammation in OE and OB We extended the in vivo time course of nPM response to total exposures of up to 45 h over 3 weeks (Fig. 2.1). Corresponding to the immunohistochemistry of the OE (Fig. 2.3), Western blots of OE showed 30% increase in 4-HNE and 3-NT that persisted from 5, 20, and 45 h of total nPM exposure (Fig. 2.7B). The olfactory marker protein (OMP), expressed only by mature OSNs, was reduced by 25% at 45 h of nPM (Fig. 2.7B). The decrease of OMP varied inversely with levels of cleaved caspase-3, a marker of apoptosis (Fig. 2.7C). As an indirect measurement of cleaved caspase-3 activity, PARP1 also increased at 45 h in the OE (Fig. 2.7C). TNFα responded more slowly: the only significant changes were in TNFα mRNA (+75%) at 20 h and in TNFα protein (+60%) at 45 h (Fig. 2.7A). IL-1α and IL-1β fluctuated, with possible transient increase at 20h (not shown). There were no responses of the microglial marker CD68 (Fig. 2.7A), or of immediate early genes c-Fos, c-Jun, JNK (not shown). 42 Figure 2.7: nPM in vivo exposure induced oxidative stress and inflammation in the OE. (A) TNFα mRNA transiently increased 70% in OE after 20 h of cumulative nPM exposure vs. controls. TNFα protein increased later 60% at 45 h. CD68 did not change (n = 6 mice/group/time point). (B) 4-HNE adducted proteins were increased 30% after 5 h of exposure, and remained elevated at 45 h of exposure. 3-NT adducted proteins were increased 50% after 5 h, and 75% after 45 h of exposure. Olfactory marker protein (OMP) was decreased 25% by 45 h of exposure. (C) Cleaved caspase-3 showed a 20% increase by 20 h and 45 h of exposure. OMP varied inversely with cleaved caspase-3 (Spearman correlation, r = -0.61). Each data point represents the % change vs controls. Cleaved PARP1, an indirect product of cleaved caspase-3 activity, was increased 60% after 45 h of exposure. (*; p<0.05; t-test). 43 The OB showed similarly modest inflammatory and oxidative stress responses to extended nPM exposure (Fig. 2.8). TNFα mRNA, but not protein, showed a transient increase at 20 h of exposure, while TNFα protein was only increased after 45 h. CD68 mRNA was more consistently increased at 20 h and 45 h (Fig. 2.8A). Unlike OE responses, 4-HNE and 3-NT increased in the OB only at 45 h (Fig. 2.8B). The olfactory marker protein (OMP) of the olfactory nerve projections did not respond at any time (not shown). Figure 2.8: nPM in vivo exposure induced oxidative stress and inflammation in the OB. (A) TNFα mRNA transiently increased by 90% in OB after 20 h of cumulative nPM exposure vs. controls (n = 6 mice/group/time). TNFα protein increased by 60% after 45 h. CD68 mRNA increased by 25% by 20 h and 45 h. (B) 4-HNE and 3-NT increased 50% by 45 h. (*; p<0.05; t-test). 44 Down-stream responses of cerebral cortex and cerebellum We assayed the cerebral cortex and cerebellum, which receive olfactory nerve input through polysynaptic pathways. TNFα mRNA increased 50% after 45 h in both cortex and cerebellum (Fig. 2.9A, B, D). In parallel to mRNA, TNFα protein increased at 45 h (Fig. 2.9A, B). Cerebellar CD68 mRNA was increased 50% at 20 h and 45 h, but cerebral cortex CD68 did not respond (Fig. 2.9A, B). 3-NT (not shown) and 4-HNE (Fig. 2.9C) did not change in either region. For comparison with 150 h total exposure over 10 weeks (Morgan et al. 2011), Fig. 2.9D shows combined data for cerebral cortex CD68 and TNFα mRNA. 45 Figure 2.9: Extended nPM in vivo exposure induced TNFα in the cerebral cortex and cerebellum. (A) TNFα mRNA increased 50% in cortex after 45 h of cumulative nPM exposure vs. controls (n = 6 mice/group/time). TNFα protein increased 50% after 45 h. CD68 mRNA did not change. (B) Cerebellar TNFα mRNA increased 70% after 45 h. TNFα protein increased by 30% after 45 h. CD68 mRNA was increased 50% at 20 h and 45 h. (C) 4- HNE did not change in cerebral cortex or cerebellum. (D) Present data are graphed with prior findings from 150 h nPM exposure, which increased TNFα and CD68 by 50% and 90% respectively (Morgan et al. 2011). (*; p<0.05; t-test). 46 Discussion These studies provide the first data on rapid cell responses of the nasal olfactory epithelium (OE) to air pollution particulate matter and the first time course of spatial responses of any air pollutant from nose to brain regions. These experiments exposed rodent neural tissues to nPM, a nano-sized subfraction of PM2.5 which is enriched in water soluble organic compounds. The in vivo, ex vivo, and in vitro models of the OE showed rapid increase of oxidative stress by 24 h of nPM, with increased tissue levels of 4-HNE, 3-NT, and of TNFα. We anticipated that the OB would also show rapid responses, because olfactory neurons of the OE axonally transmitted nano-scale gold into the olfactory bulb (OB) (De Lorenzo 1970) and because inhaled nano-scale 14 C-graphite and intranasal Mn particles rapidly accumulated in the OB (Oberdörster et al. 2004; Elder et al 2006). However, the OB had smaller increases of 4-HNE and 3-NT and slower responses of TNFα until later in the series of exposures, as did cerebral cortex and cerebellum. Only after 45 h of total exposure to nPM during 3 weeks did cerebral cortex TNFα mRNA approach the levels from 150 h of nPM exposure over 10 weeks in our initial study (Morgan et al. 2011). These delayed responses suggest contributions from systemic responses to nPM that may interact with the direct olfactory nerve pathway from nose to brain. We also consider a neuronal degenerative response of the OE that differed from downstream brain regions. The olfactory sensory neurons (OSN) that line the OE are the only neurons in the respiratory tract that are directly exposed to the external environment, thereby the first neuronal responders to inhaled air pollutants. Early increases of 4-HNE and 3-NT after 47 a 5 h exposure were histochemically localized to the nasal epithelial mucosa, concurrent with increased numbers of macrophages (Iba1-expressing) in the turbinate zone (Fig. 2.3). However, TNFα increases were delayed in the OE until 20-45 h, as was a neuronal degenerative response in the 25% reduction of the olfactory neuron marker protein OMP with reciprocal increase of cleaved caspase-3 (Fig. 2.7). OB responses were more modest and delayed than in the OE. While 4-HNE and 3-NT increased by 45 h, we did not detect any change in neuronal OMP, unlike the OE. Furthermore, the downstream cerebral cortex or cerebellum did not show increased 4- HNE or 3-NT at any time, while TNFα was only increased by 45 h. We anticipate that longer exposure to nPM would increase 3-NT in the brain, as observed for 80 h cumulative exposure to diesel exhaust that increased whole brain nitrotyrosine by >100% (Levesque et al. 2011a). Because the cerebral cortex and cerebellum are at least 2 synapses from the OSN (Kronenbuerger et al. 2010), it is notable that their TNFα induction was similar in size to TNFα increases in the OB and OE. The relatively larger size of these nasally distant brain regions raises an important question: one might expect that transynaptically transported nPM would be diluted in some proportion to the brain mass, from the OB (25 mg wet weight) to the cerebral cortex (200 mg) and the more remote cerebellum (70 mg), yet the TNFα induction is similar. Could systemic mechanisms be involved? Several lines of evidence support the role of systemic import of particulate material or of pro-inflammatory factors. In the highly respected study of Oberdörster et al. 2004, a single exposure to inhaled nanoscale 14 C-graphite caused brain levels of 14 C that were as high or higher in cerebellum as in the OB after 5 days. These authors 48 discussed possible “…translocation across the blood-brain barrier in certain regions”. A blood-born source of the persisting 14 C elevations in cerebellum and cerebrum would be consistent with the large residual 14 C pool of the lung. Further evidence for a lung-to- brain axis in air pollution comes from brain responses to intra-tracheal installation of a PM10 air pollutant fraction, which induced the oxidatively sensitive HO-1 by >100% in both whole brain and lung (Farina et al. 2013). Systemic transmission of particles or inflammatory factors is also consistent with effects on fetal brain from intra-tracheal DEP (Bolton et al. 2014). Moreover, inhaled vehicular emissions increased permeability of the blood-brain barrier (BBB) in mice, while serum from pollution exposed mice increased BBB permeability in an in vitro model (Oppenheim et al. 2013) and altered vasorelaxation with CD36 dependence (Robertson et al. 2013). Lastly, we note that increased circulating cytokines from respiratory tract inflammation can cross the BBB and evoke neuroinflammatory responses (Peters et al. 2006; Erickson et al. 2012). Thus, systemic effects of air pollution warrant further study in conjunction with the established direct nose-brain pathway. We anticipate complex transitions of pathway specific mechanisms during prolonged exposures. Oxidative and inflammatory mechanisms are implicated by these responses to in vivo exposure. The rapid increase in 4-HNE and 3-NT in OE was associated with nitrosative stress with several in vitro models. Ex vivo intact OE was incubated with nPM under conditions based on prior studies of hippocampal slices, in which nPM increased nitric oxide (NO) and S-nitrosylation (Davis et al. 2013). The ex vivo and primary OE cultures showed increased nitrite in response to nPM (Fig 5, 6). Mixed glia from cerebral cortex also responded to nPM with induced nitrite and iNOS. The ex vivo 49 OE also showed induction of cytokines (IL-1α, TNFα) and macrophage activation (CD68). The neonatal rat OE had similar ex vivo responses (Cheng et al. 2016). These changes parallel the in vivo rapid inflammatory responses to nPM inhalation, which include increased Iba1-expressing macrophages in the OE turbinate layer and in the OB glomerular layer (Fig. 2.3, 2.4). The inflammatory changes seen in the OE and brain may be propagated by macrophage/microglial activation in response to oxidative stress induced by nPM. Macrophage scavenger receptors, including CD36, can be activated by 4-HNE (Ishii et al. 2004; Stewart et al. 2010). Additionally, modified adducts of HNE by glutathione may activate NF-KB (Ramana et al. 2006) as well as induce TNFα. These oxidative markers, 4-HNE and 3-NT, are implicated in the pathogenesis of Alzheimer’s disease (AD) and other neurodegenerative disorders (Shringarpure et al. 2000; Butterfield et al. 2007; Dalleau et al. 2013). There are notable variations of OB responses between exposure models (Levesque et al. 2011b; Gerlofs-Nijland et al. 2010; Guerra et al. 2013). The lack of, or attenuated, OB responses in longer exposures (op. cit.) with baseline return of TNFα mRNA by 45 h in our data suggests compensatory OB mechanisms. This warrants more attention: Ong et al. 2015 showed that a single 4 h exposure over 1 day to 0.5 ppm ozone, a gaseous pollutant absent from nPM, transiently induced TNFα mRNA by 70% in the nasal mucosa, with return to control levels by 4 d of exposure (Wagner et al. 2002; Ong et al. 2015). Moreover, there was rapid infiltration of neutrophils into the nasal mucosa within 2 h after initial exposure. In our model, the lack of TNFα, IL-1β, 50 CD68 mRNA responses in OE and OB by 1 d of nPM inhalation suggests that ozone- mediated toxicity in nasal mucosa occurs more rapidly through different mechanisms. Neurodegenerative changes in olfactory neurons arose much later in the OE, with a reduction in levels of the olfactory neuron specific protein OMP with inverse proportion to the apoptosis marker, cleaved caspase-3. Because OSNs are exposed to inhaled environmental toxins, they undergo apoptosis in conjunction with continual regeneration to maintain functionality (Holcomb et al. 1996). However, chronically high levels of nPM may exacerbate apoptotic responses to levels beyond normal function of the olfactory system. Additionally, the induction of TNFα in the OE may interfere with OSN regeneration (Turner et al. 2010). These observations are consistent with studies on domestic dogs from a highly polluted city which showed disrupted OSN and sustentacular cell layers, with an overall thinning of the OE (Garcidueñas et al. 2003). Relevant to humans, late onset olfactory dysfunction is a risk factor for AD (Devanand et al. 2000; Arnold et al. 2010). In vitro models of OE may help identify specific air pollution component cytotoxic activities. For example, we do not know the role of free radicals that persist in nPM at least 30 days after initial collection and subsequent re-aerosolization (Morgan et al. 2011). Further fractionation of nPM could also resolve the activities of particular water- insoluble organic compounds. The recent advance in technology will allow comparison of total ultrafine suspensions (BioSampler) with the filter eluted nPM (HVUP Sampler). 51 Conclusions These data support the hypothesis that inhaled nPM rapidly causes oxidative stress in the olfactory epithelium, with delayed inflammatory and neurodegenerative responses. Although the olfactory bulb receives direct input from olfactory neurons, inflammatory and oxidative stress responses were subsequent. The cerebral cortex and cerebellum also responded with slow increase of TNFα, but did not show increased nitrosylated proteins or oxidized lipids at any time. These slower brain responses suggest that inhaled nPM in the olfactory epithelium and bulb contribute to neurodegenerative effects of air pollution particulates. These data are summarized in Figure 2.10. We also recognize the possible role of systemic factors in brain responses to air pollution. We hypothesize that the brain-wide increase of TNFα and other cytokines from air pollution exposure contributes to the cognitive deficits epidemiologically associated with air pollutants. TNFα has well-defined links to glutamatergic functions in the hippocampus and cerebral cortex (Beattie et al. 2002; Santello and Volterra 2012) that are critical to learning and memory. 52 Figure 2.10: Model of nPM effects from nose to brain. CP = cribriform plate mOE = main olfactory epithelium NC = nasal cavity OB = olfactory bulb 53 References: 1. Ailshire JA, Crimmins EM. 2014. Fine particulate matter air pollution and cognitive function among older US adults. Am J Epidemiol 180:359-366. 2. Arnold SE, Lee EB, Moberg PJ, Stutzbach L, Kazi H, Han LY, et al. 2010. Olfactory Epithelium Amyloid-β and PHFtau Pathology in Alzheimer’s Disease. Ann Neurol 67:462-469. 3. Beattie EC, Stellwagen D, Morishita W, Bresnahan JC, Ha BK, Von Zastrow M,et al. 2002. Control of synaptic strength by glial TNF alpha. Science 295:2282- 2285. 4. Block ML, Elder A, Auten RL, Bilbo SD, Chen H, Chen JC, et al. 2012. The outdoor air pollution and brain health workshop. Neurotoxicology 33:972-984. 5. Bolton JL, Auten RL, Bilbo SD. 2014. Prenatal air pollution exposure induces sexually dimorphic fetal programming of metabolic and neuroinflammatory outcomes in adult offspring. Brain Behav Immun 37:30-44. 6. Butterfield DA, Reed TT, Perluigi M, Marco CD, Coccia R, Keller JN, et al. 2007. Elevated levels of 3-nitrotyrosine in brain from subjects with amnestic mild cognitive impairment: implications for the role of nitration in the progression of Alzheimer's disease. Brain Res 1148:243-248. 7. Calderón-Garcidueñas L, Engle R, Mora-Tiscareño A, Styner M, Gómez-Garza G, Zhu H, et al. 2011. Exposure to severe urban air pollution influences cognitive outcomes, brain volume and systemic inflammation in clinically healthy children. Brain Cognition 77:345-355. 54 8. Calderón-Garcidueñas L, Maronpot R, Torres-Jardon R, Henríquez-Roldán C, Schoonhoven R, Acuña-Ayala H, et al. 2003. DNA damage in nasal and brain tissues of canines exposed to air pollutants is associated with evidence of chronic brain inflammation and neurodegeneration. Toxicologic Path 31:524-538. 9. Campbell A, Oldham M, Becaria A, Bondy SC, Meacher D, Sioutas C, et al. 2005. Particulate matter in polluted air may increase biomarkers of inflammation in mouse brain. Neurotoxicology 26:133-140. 10. Chen JC, Schwartz J. 2009. Neurobehavioral effects of ambient air pollution on cognitive performance in US adults. Neurotoxicology 30:231-239. 11. Chen JC, Wang X, Wellenius G, Serre M, Driscoll I, Casanova R, et al. 2015. Ambient air pollution and neurotoxicity on brain structure: evidence from Women's Health Initiative Memory Study. Ann Neurol 78:466-476. 12. Cheng H, Davis DA, Hasheminassab S, Sioutas C, Morgan TE, Finch CE. 2016. Urban traffic-derived nanoparticulate matter reduces neurite outgrowth via TNFα in vitro. J Neuroinflammation 13: 19. 13. Dalleau S, Baradat M, Guéraud F, Huc L. 2013. Cell death and diseases related to oxidative stress: 4-hydroxynonenal (HNE) in the balance. Cell Death Differ 20:1615-1630. 14. Davis DA, Akopian G, Walsh JP, Sioutas C, Morgan TE, Finch CE. 2013. Urban air pollutants reduce synaptic function of CA1 neurons via an NMDA/NȮ pathway. J Neurochem 127:509-519. 15. DeLorenzo AJ. 1970. The olfactory neuron and the blood-brain barrier. In: Taste and Smell in Vertebrates. London: J&A Churchill, 151–176. 55 16. Devanand DP, Michaels-Marston KS, Liu X, Pelton GH, Padilla M, Marder K, et al. 2000. Olfactory deficits in patients with mild cognitive impairment predict Alzheimer's disease at follow-up. Am J Psychiatry 157:1399-1405. 17. Elder A, Gelein R, Silva V, Feikert T, Opanashuk L, Carter J, et al. 2006. Translocation of inhaled ultrafine manganese oxide particles to the central nervous system. Environ Health Perspect 114:1172-1178. 18. Erickson MA, Dohi K, Banks WA. 2012. Neuroinflammation: a common pathway in CNS diseases as mediated at the blood-brain barrier. Neuroimmunomodulation 19:121-130. 19. Farina F, Sancini G, Battaglia C, Tinaglia V, Mantecca P, Camatini M, et al. 2013. Milano summer particulate matter (PM10) triggers lung inflammation and extra pulmonary adverse events in mice. PLoS One 8:e56636; doi:10.1371/ journal.pone.0056636. 20. Gatto NM, Henderson VW, Hodis HN, St. John JA, Lurmann F, Chen JC, et al. 2014. Components of air pollution and cognitive function in middle-aged and older adults in Los Angeles. Neurotoxicology 40:1-7. 21. Gerlofs-Nijland ME, Totlandsdal AI, Kilinç E, Boere AJ, Fokkens PH, Leseman DL, et al. 2010. Pulmonary and cardiovascular effects of traffic-related particulate matter: 4-week exposure of rats to roadside and diesel engine exhaust particles. Inhal Toxicol 22:1162-1173. 22. Gianutsos G, Morrow GR, Morris JB. 1997. Accumulation of manganese in rat brain following intranasal administration. Fund Appl Toxicol. 37:102-105. 56 23. Gillespie P, Tajuba J, Lippmann M, Chen LC, Veronesi B. 2013. Particulate matter neurotoxicity in culture is size-dependent. Neurotoxicology 36:112-117. 24. Guerra R, Vera-Aguilar E, Uribe-Ramirez M, Gookin G, Camacho J, Osornio- Vargas AR, et al. 2013. Exposure to inhaled particulate matter activates early markers of oxidative stress, inflammation and unfolded protein response in rat striatum. Toxicol Lett 222:146-154. 25. Hasheminassab S, Daher N, Schauer JJ, Sioutas C. 2013. Source apportionment and organic compound characterization of ambient ultrafine particulate matter (PM) in the Los Angeles Basin. Atmos Environ 79:529–539. 26. Harkema JR, Carey SA, Wagner JG. 2006. The nose revisited: a brief review of the comparative structure, function, and toxicologic pathology of the nasal epithelium. Toxicol Pathol 34:252–269. 27. Holcomb DJ, Graham S, Calof AL. 1996. Neuronal homeostasis in mammalian olfactory epithelium: a review. Am J Rhinol 10:125-134. 28. Ignarro LJ, Fukuto JM, Griscavage JM, Rogers NE, Byrns RE. 1993. Oxidation of nitric oxide in aqueous solution to nitrite but not nitrate: comparison with enzymatically formed nitric oxide from L-arginine. Proc Natl Acad Sci U S A. 90:8103–8107. 29. Ishii T, Itoh K, Ruiz E, Leake DS, Unoki H, Yamamoto M, et al. 2004. Role of Nrf2 in the regulation of CD36 and stress protein expression in murine macrophages: activation by oxidatively modified LDL and 4-Hydroxynonenal. Circ Res 94: 609-616. 57 30. Kronenbuerger M, Zobel S, Ilgner J, Finkelmeyer A, Reinacher P, Coenen VA, et al. 2010. Effects of deep brain stimulation of the cerebellothalamic pathways on the sense of smell. Exp Neurol 222:144-152. 31. Li N, Sioutas C, Cho A, Schmitz D, Misra C, Sempf J, et al. 2002. Ultrafine particulate pollutants induce oxidative stress and mitochondrial damage. Environ Health Perspect 111:455-460. 32. Levesque S, Taetzsch T, Lull ME, Kodavanti U, Stadler K, Wagner A, et al. 2011a. Diesel exhaust activates and primes microglia: air pollution, neuroinflammation, and regulation of dopaminergic neurotoxicity. Environ Health Perspect 1198:1149-1155. 33. Levesque S, Surace MJ, Mcdonald J, Block ML. 2011b. Air pollution & the brain: subchronic diesel exhaust exposure causes neuroinflammation and elevates early markers of neurodegenerative disease." J Neuroinflammation 8:105; doi:10.1186/1742-2094-8-105. 34. Lucchini RG, Dorman DC, Elder A, Veronesi B. 2012. Neurological impacts from inhalation of pollutants and the nose–brain connection. Neurotoxicol. 33:838-41. 35. Misra C, Kim S, Shen S, Sioutas C. 2002. A high flow rate, very low pressure drop impactor for inertial separation of ultrafine from accumulation mode particles. J Aerosol Sci 33:735-752. 36. Morgan TE, Davis DD, Iwata N, Tanner JM, Snyder D, Ning Z, et al. 2011. Glutamatergic neurons in rodent models respond to nanoscale particulate urban air pollutants in vivo and in vitro. Env Health Perspect 119:1003-1009. 58 37. Oberdörster G, Sharp Z, Atudorei V, Elder A, Gelein R, Kreyling W, et al. 2004. Translocation of inhaled ultrafine particles to the brain. Inhal Toxicol 16:437-445. 38. Ong CB, Kumagai K, Brooks PT, Brandenberger C, Lewandowski RP, Jackson- Humbles DN, et al. 2015. Ozone-induced Type 2 immunity in nasal airways: development and lymphoid cell dependence in mice.Am J Respir Cell Mol Biol. Epub ahead of print. 39. Oppenheim HA, Lucero J, Guyot AC, Herbert LM, McDonald JD, Mabondzo A, et al. 2013. Exposure to vehicle emissions results in altered blood brain barrier permeability and expression of matrix metalloproteinases and tight junction proteins in mice. Part Fibre Toxicol 10:62. 40. Peters A, Veronesi B, Calderón-Garcidueñas L, Gehr P, Chen LC, Geiser M, et al. 2006. Translocation and potential neurological effects of fine and ultrafine particles a critical update. Part Fibre Toxicol 3:13; doi:10.1186/1743-8977-3-13. 41. Ramana KV, Fadl AA, Tammali R, Reddy BMA, Chopra AK, and Srivastava SD. 2006. Aldose Reductase Mediates the Lipopolysaccharide-induced Release of Inflammatory Mediators in RAW264.7 Murine Macrophages. J Biol Chem 281:33019-3029. 42. Robertson S, Colombo ES, Lucas SN, Hall PR, Febbraio M, Paffett ML, et al. 2013. CD36 mediates endothelial dysfunction downstream of circulating factors induced by O3 exposure. Toxicol Sci 134:304-311. 43. Rozovsky I, Finch CE, Morgan TE. 1998. Age-related activation of microglia and astrocytes: in vitro studies show persistent phenotypes of aging, increased proliferation, and resistance to down-regulation. Neurobiol Aging 19:97-103. 59 44. Saffari A, Daher N, Shafer MM, Schauer JJ, Sioutas C. 2013. Seasonal and spatial variation of trace elements and metals in quasi-ultrafine (PM0.25) particles in the Los Angeles metropolitan area and characterization of their sources. Environ Pollut 181:14–23. 45. Santello M, Volterra A. 2012. TNFα in synaptic function: switching gears. Trends Neurosci 35:638-647. 46. Shringarpure R, Grune T, Sitte N, Davies KJ. 2000. 4-Hydroxynonenal-modified amyloid-beta peptide inhibits the proteasome: possible importance in Alzheimer's disease. Cell Mol Life Sci 57:1802–1809. 47. Stewart CR, Stuart LM, Wilkinson K, van Gils JM, Deng J, Halle A, et al. 2010. CD36 ligands promote sterile inflammation through assembly of a Toll-like receptor 4 and 6 heterodimer. Nat Immunol 11:155-161. 48. Tonne C, Elbaz A, Beevers S, Singh-Manoux A. 2014. Traffic-related air pollution in relation to cognitive function in older adults. Epidemiology 25:674-681. 49. Turner JH, Liang KL, May L, Lane AP. 2010. Tumor Necrosis Factor-alpha inhibits olfactory regeneration in a transgenic model of chronic rhinosinusitis- associated olfactory loss. Am J Rhinol 24:336-340. 50. Wang D, Pakbin P, Saffari A, Shafer MM, Schauer JJ, Sioutas C. 2013. Development and evaluation of a high-volume aerosol-into-liquid collector for fine and ultrafine particulate matter. Aerosol Sci Tech 47:1226-1238. 51. Wagner JG, Hotchkiss JA, Harkema JR. 2002. Enhancement of nasal inflammatory and epithelial responses after ozone and allergen coexposure in Brown Norway rats. Toxicol Sci 67:284-294. 60 52. Win-Shwe TT, Yamamoto S, Ahmed S, Kakeyama M, Kobayashi T, Fujimaki H. 2006. Brain cytokine and chemokine mRNA expression in mice induced by intranasal instillation with ultrafine carbon black. Toxicol Lett 163:153-160. 53. Win-Shwe TT, Kyi-Tha-Thu C, Moe Y, Maekawa F, Yanagisawa R, Furuyama A, et al. 2015. Nano-sized secondary organic aerosol of diesel engine exhaust origin impairs olfactory-based spatial learning performance in preweaning mice. Nanomaterials 5:1147-1162. 61 CHAPTER 3 Urban traffic-derived nanoparticulate matter reduces neurite outgrowth via TNFα in vitro (Adapted from Journal of Neuroinflammation. 2016; 13:19) Abstract The basis for air pollution-associated neurodegenerative changes in humans is being studied in rodent models. We and others find that the ultrafine particulate matter (PM) derived from vehicular exhaust can induce synaptic dysfunction and inflammatory responses in vivo and in vitro. In particular, a nano-sized subfraction of particulate matter (nPM, PM0.2) from a local urban traffic corridor can induce glial TNFα production in mixed glia (astrocytes and microglia) derived from neonatal rat cerebral cortex. Here, we examine the role of TNFα in neurite dysfunctions induced by nPM in aqueous suspensions at 12 µg/ml. First, we show that the proximal brain gateway to nPM, the olfactory neuroepithelium (OE), rapidly responds to nPM ex vivo, with induction of TNFα, activation of macrophages, and dendritic shrinkage. Cell interactions were further analyzed with mixed glia and neurons from neonatal rat cerebral cortex. Microglia contributed more than astrocytes to TNFα induction by nPM. We then showed that the 3-fold higher TNFα in conditioned media (nPM-CM) from mixed glia was responsible for the inhibition of neurite outgrowth by siRNA TNFα knockdown and by TNFα immunoneutralization. Despite lack of TNFR1 induction by nPM in the OE, experimental blocking of TNFR1 by TNFα receptor blockers restored total neurite length. These 62 findings implicate microglia-derived TNFα as a mediator of nPM in air pollution- associated neurodegenerative changes which alter synaptic functions and neuronal growth. Background Air pollution epidemiology has traditionally focused on cardiovascular and respiratory outcomes. These adverse associations have been extended to show the acceleration of cognitive decline of elderly community-based populations [1-5] and neurodevelopmental impairments of children [6,7]. The causes of cognitive impairment are being analyzed in rodent and cell models, which implicate neuroinflammatory responses to urban air pollutants [8-11] Specifically, we and others observed that the ultrafine size class of air pollution PM0.2 (< 0.2 µm diameter) activated microglia and induced TNFα and IL-1, among other inflammatory responses [10,12-14]. This evidence supports findings of increased microglial activation and white matter hyperintensities in small postmortem samples of children from highly polluted Mexico City [7,15] and in the association of white matter loss in older human adults in an MRI analysis of the WHIMS cohort of U.S. women [16]. We focus on traffic-derived ultrafine PM, which consistently shows higher toxicity than larger PM in vivo and in vitro [17,18], in neonatal rodents. Artificial ultrafine PM is rapidly transported after inhalation into the brain via the olfactory pathway [19,20]. Within the ultrafine PM, we examined a subfraction eluted from filters into aqueous suspension for its neurotoxicity and pro-inflammatory activity [10,11]. This subfraction is designated as nano-sized PM (nPM) to distinguish it from the total ultrafine PM, and is 63 depleted in black carbon and water insoluble organics (Table 1) [10]. The nPM fraction is highly active in vitro and in vivo after re-aerosolization, with free radical EPR signals that persisted >30 days after initial collection. Notably, ozone and other gaseous pollutants with epidemiological cognitive associations [2,21] are absent from filter- collected nPM. In rodent cell models, nPM has both direct and indirect effects on neuronal viability and neurite outgrowth [10]. Because TNFα is induced by chronic inhalation of ultrafine PM [8,22] and because TNFα can alter neurite outgrowth [23-25], we further evaluated the role of TNFα in rapid brain responses to nPM. We first investigated the OE, since little is known about the initial cellular responses of the olfactory gateway to urban-traffic derived ultrafine (or, equivalently) nPM. Based on the precedent of ex vivo OE incubation from OE biopsies [26,27], we developed an ex vivo model for incubation of the intact OE within neonatal mouse nasal cavities with nPM suspensions. In addition, using glia and neurons derived from neonatal cerebral cortex, we analyzed mechanisms by which nPM-induced TNFα inhibits neurite outgrowth. Methods nPM collection and transfer into aqueous suspension Nanoscale particulate matter (nPM, <0.2 µm in diameter) was collected on Teflon filters by a High-Volume Ultrafine Particle (HVUP) Sampler [28] at 400 L/min flow in urban Los Angeles, downwind from the local I-110 Freeway [10]. These samples are a mix of fresh ambient PM, mostly from vehicular traffic emissions, and secondary aerosols [29,30]. The nPM samples were collected continuously July- Sept. 2010 and Nov. 2011- Feb. 2012; these pooled samples approximate the annual average composition of nPM 64 near the I-110 corridor [31]. The filter-trapped dried nPM were eluted by sonication into deionized water. The nPM comprise 20% by mass of ambient PM2.5. Water soluble metals and organic compounds were efficiently transferred (Table 1). Relative to the total filtered-trapped ultrafines (PM0.2), the nPM subfraction eluted into aqueous phases is depleted in black carbon and water insoluble organic compounds. nPM suspensions (350 µg/ml) were stored at -20 °C. For controls of nPM extracts, fresh sterile filters were sham extracted. Table 3.1: Composition of nPM ambient nPM eluted nPM % ambient in eluted nPM Black carbon 13% 1% 7% Organic carbon, water soluble 32% 34% 100% Organic carbon, water insoluble: hopanes-steranes 0.012% 0.001% 8.5% organic acids 0.097% 0.009% 9% polyaromatic hydrocarbons 0.02% not detected 0% Metals (Cu, Fe, Ni, V) >90% Content of black carbon, organic water soluble and insoluble carbons, and metals in ambient nPM compared with eluted filter-trapped nPM. Percent recovery of ambient 65 nPM in eluted samples was calculated to show efficiency of transfer. Data derived from [10]. Animals C57BL/6J mice were purchased from The Jackson Laboratory (Sacramento, CA, USA) for breeding; pregnant Sprague Dawley rats from Harlan Labs (Livermore, CA, USA). Animals were maintained following NIH guidelines, approved by the USC Institutional Animal Care & Use Committee (IACUC). Animals were euthanized by cervical dislocation after anesthesia by isoflurane or CO2. Nasal cavity ex vivo Incubation P3 mice (both sexes) were anaesthetized and decapitated; the nasal bone was removed to reveal the nasal cavity. The entire nasal cavity including the snout intact was removed in the gross. Nasal cavities were incubated with 12 µg/ml nPM in artificial cerebral spinal fluid (CSF) for 2 h/37°C. After incubation, the olfactory neuroepithelium (OE) was peeled from the nasal cavity for qPCR or immunohistochemistry. Mice were chosen for these experiments because their smaller size facilitates slide preparation and obviates decalcification. Cell culture Mixed glia were originated from cerebral cortex of postnatal day 3 (P3) rats (both sexes). Primary glia were grown in Dulbecco’s modified Eagle’s medium/Ham’s F12 50/50 Mix (DMEM F12 50/50) supplemented with 10% fetal bovine serum (FBS) and 66 1% L-glutamine in a humidified incubator (37°C/5%CO2) [32]. After culture for 2.5 weeks, their composition was 3:1 astrocytes: microglia. Microglia were isolated by shaking for 4 h/37°C. Embryonic day 18 (E18) rat cortical neurons were originated at 15,000 neurons/cm 2 on poly-D-lysine coated coverslips in DMEM supplemented with B27 (Invitrogen, Grand Island, NY). For in vitro exposure, mixed glia were trypsinized and replated in 6-well plates at 1x10 6 cells/well, and grown overnight. Secondary cultures of mixed glia were treated with nPM aqueous suspensions (12 µg/ml) diluted in neuronal media for 24 h before assay. This dose consistently induced glial TNFα and IL-1α mRNA (Morgan et al. 2011). The resulting conditioned media (CM) was collected and centrifuged (10000 g/ 10 min) to remove residual cells. For siRNA experiments, mixed glia were treated with siRNA (Silencer Negative Control No. 1 siRNA, AM4611; Ambion, Austin, TX) or TNFα siRNA (AM16708, Ambion). Scrambled and TNFα siRNAs were mixed with siPORT NeoFX transfection agent (Ambion) to 50 nM. Mixed glia were grown for 24 h post transfection, and then treated with nPM or vehicle before plating onto E18 neurons. Immunoneutralization of TNFα used 20 µg/ml antibody (MAB510; R&D Systems, Minneapolis, MN); TNF receptor activity was inhibited by TNFR1/2 blocking peptide (E- 20, L-20; SCBT, Dallas, TX) at 5 µg/ml before CM application. NMDA antagonist AP5 ((2R)-amino-5-phosphonopentanoic acid; Sigma Chemical Corp., St. Louis, MO) and rat recombinant TNFα (Pharmingen, San Diego, CA) were diluted in DMEM + B27 and applied directly. Rats were used for in vitro experiments, following our prior studies [10] and the better yields of microglia than from mice. 67 Quantitative polymerase chain reaction (qPCR) Total cellular RNA was extracted using TRI reagent (Sigma, St. Louis, MO). cDNA was prepared from 1 µg of RNA by Superscript III RT kit (Invitrogen, Carlsbad, CA) and analyzed by qPCR with appropriate primers for both mouse and rat for Ct (Threshold Cycle) values. Genes examined by qPCR include TNFα (forward: 5’ CGTCAGCCGATTTGCTATCT 3’; reverse: 5’ CGGACTCCGCAAAGTCTAAG 3’) (CT range 26-30), Iba1 (forward: 5' CCTGATTGGAGGTGGATGTCAC 3'; reverse: 5' GGCTCACGACTGTTTCTTTTTTCC 3') (CT range 25-26), IL-1α (forward: 5’ TCGGGAGGAGACGACTCTAA 3’; reverse: 5’ GTGCACCCGACTTTGTTCTT 3’) (CT range 29-31), GFAP (forward: 5' CCAAGCCAAACACGAAGCTAA 3'; reverse: 5' AGGAATGGTGATGCGGTTTTC 3') (CT range 30-31), iNOS (forward: 5' CATTGGAAGTGAAGCGTTTCG 3'; reverse: 5' CAGCTGGGCTGTACAAACCTT 3') (CT range 27-29), TNFR1 (forward: 5' GGGCACCTTTACGGCTTCC 3'; reverse: 5' GGTTCTCCTTACAGCCACACA 3') (CT range 22-23), TNFR2 (forward: 5' CAGGTTGTCTTGACACCCTAC 3' reverse: 5' GCACAGCACATCTGAGCCT 3') (CT range 25-26), βIII-tubulin (forward: 5' CGCACGACATCTAGGACTGA 3'; reverse: 5' TGAGGCCTCCTCTCACAAGT 3') (CT range 19-20). rGAPDH (forward: 5' AGACAGCCGCATCTTCTTGT 3'; reverse: 5' CTTGCCGTGGGTAGAGTCAT 3') (CT range 16-17) Data were normalized to GAPDH and quantified as ΔΔCt. ELISA Conditioned media (CM) from nPM treated glia was sampled after 24 h of exposure and analyzed for TNFα by solid phase sandwich ELISA (BD Biosciences, San Jose, CA). 68 Immunohistochemistry (IHC) The olfactory epithelium and olfactory bulb of P3 neonatal mice were fixed with 4% paraformaldehyde in phosphate buffered saline pH 7.4 (PBS). Specimens were immersed in 10% sucrose/PBS pH 7.4, then 30% sucrose/PBS pH 7.4 at 4°C, then embedded in optimal cutting temperature compound (OCT; Fisher Scientific, Waltham, MA) before transverse cryostat sectioning (18 µm). Antigen retrieval was performed by submerging slides in 10mM sodium citrate buffer and microwaving 3 min. Tissue was permeabilized with 1% NP-40/PBS and blocked with 5% BSA, then probed with antibodies specific for the Olfactory Marker Protein of olfactory sensory neurons (OMP 1:100; SCBT, Dallas, TX), βIII-tubulin (1:400; Sigma Chemical Co., St. Louis, MO), astrocytes (GFAP 1:400; Sigma), and microglia (Iba1 1:200, Wako). Immunofluorescence was visualized with Alexa Fluor 488 or 594 antibodies (1:400; Molecular Probes). Microscopy Fluorescent images were analyzed with a Nikon Eclipse TE300 microscope (Nikon, Melville, NY). 100 neurons were selected from a distribution of 9 images per coverslip for analysis. Neurite outgrowth assays After exposure to glial conditioned media, E18 neurons were fixed in 4% paraformaldehyde and immunostained with anti-βIII-tubulin (1:400). Neurites were visualized by F-actin with Rhodamine phalloidin (1:50; Molecular probes, Carlsbad, CA). 69 Images were analyzed for neurite length, density and number by NeuronJ of ImageJ software; soma size was determined by the Neurphology plugin of ImageJ. Only neurons with neurites fully visible were analyzed. Neurite density was assayed as total βIII-tubulin fluorescence after skeletonizing. Axons were identified as the longest neurite [33]. Image analysis The olfactory sensory neuron (OSN) dendritic layer of the OE was assessed by NeuronJ plugin of imageJ in 20 evenly spaced regions in the nasal septum and ethmoturbinates. The dendritic layer thickness was defined as distance between OSN cell body and the outer edge of the sensory dendrites in the nasal cavity. Statistical Analysis GraphPad Prism Version 5 (Graph Pad, La Jolla, CA). Single and multiple comparisons used Student’s t-test (unpaired) and ANOVA/ Tukey’s multiple comparison post-test respectively. Level of significance alpha = 0.05. Results nPM rapidly induced TNF α in Olfactory Neuroepithelium (OE) ex vivo First, we characterized the OE cell populations which are incompletely described for neonatal mice. Fig. 3.1a represents the main anatomic features of the nasal cavity. The olfactory neuroepithelium (OE) contains well differentiated olfactory sensory neurons (OSN) (βIII-tubulin-immunopositive) with perikarya on the inner face of the OE 70 (Fig. 3.1b); the OSN dendrites extend into the mucosa lining the turbinate space as a layer distinct from their perikarya; axon bundles of the OSN project through the cribriform plate to the olfactory bulb (OB), identified by immunostaining for the OSN- specific Olfactory Marker Protein (not shown). Macrophages (Iba1-immunopositive) defined a dense layer in the lamina propria, sharply demarcated from their lower density in the adjacent OSN layer/lamina propria (Fig. 3.1c). GFAP immunostaining for astrocytes was not above background in the OE; in contrast, the OB has numerous GFAP-positive astrocytes (not shown). Figure 3.1: Anatomical schema and cell types in neonatal mouse olfactory neuroepithelium. (a) Schematic for a transverse section of neonatal mouse nares to show the nasal cavity, cribriform plate, and olfactory bulb (OB). Olfactory sensory neurons (OSN, red) 71 are within the lamina propria mucosal layer of the medial nasal septum and ethmoturbinates. OSN axon bundles project to the OB through the cribriform plate as olfactory nerves (red-dashed line; red diamond, perikarya). The box outline locates IHC images of panels b,c. (b) OE turbinates and medial septum contain βIII-tubulin positive OSNs. The larger magnification of the turbinate region shows the dendritic layer (DL) and the OSN axon bundles in the lamina propria (lam. prop.). Scale bar = 50 µm. (c) Iba1-immunopositive macrophages in OE form a dense layer in the lamina propria. As an ex vivo model for the initial contact of brain with nPM, the nasal cavities of neonatal mice were incubated with nPM suspensions. Ex vivo nasal cavities were incubated with 12 µg/ml nPM for 2 h, conditions that induced TNFα in mixed glial cultures [10]. The OSN responded with shrinkage of the dendritic layer in the OE septal zone by 10% across the dendritic length frequency distribution; turbinate zone dendrites had smaller responses (Fig. 3.2a). Macrophages also responded, with a 50% increase in Iba1-immunopositive cells in the OSN layer (Fig. 3.2b). By qPCR, we found increased levels of inflammation-related mRNAs in the OE including 45% increase of TNFα mRNA and 20% increase of Iba1 mRNA (Fig. 3.3a,c), with trends for increased IL-1α and TNFR1 (Fig. 3.3b,d); definitive non-changers included iNOS, TNFR2 and βIII-tubulin mRNA (not shown). GFAP mRNA was below reliable CT values (see Fig. 3.3 legend), consistent with background GFAP immunostaining in the OE noted above. Because TNFα inhibits neurite outgrowth in vitro and in vivo [24,34], we hypothesized that TNFα secreted by OE macrophages is an initial event in neurite shrinkage. 72 Figure 3.2: nPM shrinks dendritic layer of OE septum and increased macrophages in OSN layer. (a) Thickness of the dendritic layer in the OE turbinate and septum in response to incubation with nPM. The OE septal dendrites showed a 10% shrinkage in response to nPM, with consistent shift across all size classes in the frequency distribution (left panel; *; p<0.05; t-test; n=8 nares per group; 30 DL thickness measurements per condition); the means did not differ significantly (CTL: 18.0 ± 0.95 µm, nPM: 16.2 ± 1.01 µm). The turbinate dendritic layer did not respond to nPM. (b) Macrophage numbers (Iba1-immunopositive) in the OSN were increased 50% by nPM, with no change of total Iba1 staining within the lamina propria (*; p<0.05, **; p<0.01; t-test). nPM treatment did not detectibly alter Iba1 staining or MP cell morphology. 73 Figure 3.3: nPM rapidly induced cytokine mRNA in ex vivo olfactory neuroepithelium. (a,c) Incubation with nPM (12 µg/ml, 2 h) increased TNFα-mRNA by 50% and Iba1 by 20% (*; p<0.05; t-test; n=7). (b,d) IL-1α and TNFR1 (p = 0.079, 0.058 respectively). GFAP mRNA was below reliable PCR values (OE Ct>30 vs cerebral cortex Ct<24, positive control). nPM induced TNF α in both astrocytes and microglia To facilitate analysis of relationships between the glial secretion of TNFα and neurite length, we used mixed glial cultures from cerebral cortex of neonatal rat, in which TNFα mRNA was readily induced by nPM (Fig. 3.4a). The dose response reported for a prior sample of nPM collected in January 2009 [10] was closely matching. Extending these findings, exposure to nPM at 12 µg/ml for 24 h induced TNFα mRNA 74 >3-fold in cultures of separated microglia or astrocytes (Fig. 3.4b). Microglial responses were larger than astrocytes by the TNFα/GAPDH ratio. The conditioned media from mixed glia that were exposed to nPM (nPM-CM) showed corresponding increases in TNFα protein, again with greater increases from microglia (Fig. 3.4c). Cell levels of TNFα mRNA and of CM TNFα protein were positively correlated (r 2 = 0.28, not shown). Because glial gene expression can depend on contact between microglia and astrocytes, e.g., apolipoprotein E and apolipoprotein J [35,36], it is notable that the TNFα/GAPDH in separated astrocytes (0.0048) and microglia (0.0145) approximated that of mixed glia (0.0755) after adjusting for their relative proportions in mixed glia. Despite their minority as ~25% of the cells in mixed glia, microglia contributed 60% of the TNFα protein in CM. 75 Figure 3.4: Mixed glia exposed to nPM: increased TNFα mRNA and protein. (a) TNFα mRNA was significantly induced by 6 and 12 µg/ml nPM. (*; p<0.05, ##; p<0.01, ***; p<0.001; ANOVA with Tukey post test; n=6). Prior data (cross-hatched) was shown to document equivalent activity of different samples of nPM collected at the same site on different years (2009 vs 2010-11). (b) TNFα-mRNA in mixed glia, enriched astrocytes, and enriched microglia treated with nPM were increased by >3-fold vs CTL: microglia>mixed glia>astrocytes (*; p<0.05, **; p<0.01; t-test; n=9). Treated microglia had the lowest base Ct values. (c) TNFα protein in CM was increased by 5-fold vs CTL. ELISA. (**; p<0.01; ***; p<0.001; t-test; n=6). Conditioned media (CM) from nPM-treated astrocytes and microglia reduced neurite outgrowth 76 nPM-CM from mixed glia or enriched astrocytes and microglia was analyzed for neurotrophic activity by neurite outgrowth of E18 rat cerebral cortex neurons and supported less neurite outgrowth, assessed by length: mixed glia, -20%; astrocytes, - 15%; microglia, -30% (total neurite length per neuron) (Fig. 3.5a-c) with a trend for fewer neurites (Fig. 3.5d). Neurons grown in microglial CM had lower baseline neurite outgrowth (Fig. 3.5c). Conditioned media from LPS-treated microglia reduced neurite outgrowth Enriched astrocytes and astrocytes were also treated with lipopolysaccharide (LPS) as a positive control for inflammation. TNFα was induced > 8 fold by LPS in microglial cultures, but unresponsive in astrocyte cultures (Fig. 3.6a-d). The baseline normalized expression of TNFα was 3-fold higher in microglia (0.00108) compared to astrocytes (0.000359). CM TNFα protein was increased more modestly in enriched cultures: astrocytes, 2-fold increase; microglia, 4.5-fold increase (Fig 3.6e). While LPS- CM from astrocytes did not affect neurite outgrowth, LPS-CM from microglia reduced neurite length by 60% and neurite number by 25% (Fig. 3.7). 77 Figure 3.5: CM from glia treated with nPM decreased neurite outgrowth. (a) Neurons treated with mixed glial-CM; βIII-tubulin IHC; Scale bar = 40 µm. (b) Neurons treated with CM from nPM treated mixed glia; βIII-tubulin IHC; Scale bar = 40 µm. (c) Addition of CM from nPM-treated mixed glia, astrocytes or microglia decreased neurite length by 20%, 15%, and 30% respectively vs controls. Microglial-CM controls had lower baseline neurite outgrowth compared to mixed glia-CM and astrocyte-CM. (*; p<0.05, ***; p<0.001; ANOVA with Tukey post-test; n=100 neurons). (d) Neurite number showed trend for decrease by addition of CM from nPM treated mixed glia, astrocyte, or microglia (n.s., ANOVA). 78 Figure 3.6: Mixed glia exposed to LPS show increased TNFα mRNA and protein. (a) Normalized TNFα was strongly induced by LPS in microglial cultures compared to astrocytes and mixed glia. (b) LPS induced TNFα mRNA by >300% in mixed glia cultures. (**; p<0.01; t-test; n=6) (c) LPS did not significantly induce TNFα mRNA in astrocyte cultures. (d) LPS induced TNFα mRNA by >700% in microglia cultures. (**; p<0.01; t-test; n=6) (e) LPS induced CM TNFα by 100% in astrocytes, and 350% in microglia. Western blot. (*; p<0.05; t-test; n=6) 79 Figure 3.7: CM from microglia treated with LPS decreased neurite outgrowth. (a) Addition of CM from LPS-treated microglia decreased neurite length by 60% vs controls. CM from LPS-treated astrocytes did not affect neurite outgrowth. (***; p<0.001; ANOVA with Tukey post-test; n=100 neurons). (b) Addition of CM from LPS-treated microglia decreased neurite number by 25% vs controls. CM from LPS-treated astrocytes did not affect neurite number even compared to microglia CTL CM. (***; p<0.001; ANOVA with Tukey post-test; n=100 neurons). (c) Representative images of neurons grown under each condition. βIII-tubulin IHC, Scale bar = 40 µm. 80 Inhibiting or reducing TNF α in the CM rescued neurite outgrowth To define the role of TNFα in nPM-CM in neurite outgrowth inhibition, mixed glia were transfected with TNFα siRNA, which reduced TNFα mRNA by 70% vs scrambled siRNA control (not shown). CM from TNFα siRNA-treated glia (also nPM exposed) rescued neurite outgrowth, total neurite density, and axon length (Fig. 3.8a,c,e), but without altering total neurite number or the area of neuronal perikarya (Fig. 3.8b,d). The frequency distribution of total neurite lengths showed consistent shortening: 35% of neurons grown in nPM or nPM + scrambled siRNA glial media had total neurite lengths <100 µm vs 20% in control or TNFα-silenced conditions. Only 10% of these neurons had total neurite lengths >200 µm vs 20% of control and siRNA treatments (Fig. 3.8f). The role of TNFα in the nPM-CM was further shown by immunoneutralization with anti-TNFα antibodies, which also rescued neurite outgrowth (Fig. 3.9). Blocking TNFR1 in neurons reduced the CM effect on neurite outgrowth The role of TNFα receptors was evaluated by ‘blocking peptides’ (antibodies) to the C-terminus of their respective TNFRs. Neurons were pre-incubated with blocking peptides before application of nPM-CM. The anti-TNFR1 peptide restored total neurite length to control levels, while anti-TNFR2 had no effect on the nPM-CM inhibition (Fig. 3.10a). Growth cones were increased 30% only by anti-TNFR1 (Fig. 3.10b,c), with 10% fewer neurites <100 µm vs nPM-CM treated cultures (data not shown). 81 Figure 3.8: TNFα siRNA rescued the inhibition of neurite outgrowth in nPM-CM. (a) CM from glia cultures transfected with siRNA to TNFα showed a rescue of total neurite outgrowth vs control cultures transfected with scrambled siRNA and treated with nPM (**; p<0.01, ***; p<0.001; ANOVA with Tukey post-test). (b) Neurite number, not altered by treatment. (c) Neurite associated βIII-tubulin changed in parallel with total neurite length. 82 (d) Neuronal perikaryal area, not altered by treatment. (e) Mean axon length shortening by nPM treatment was rescued with TNFα siRNA. (f) Neurons treated with nPM or scrambled siRNA + nPM mixed glial-CM had shorter neurites (**; p<0.01; 2-way ANOVA with Tukey post-test; avg. 3 experiments). Figure 3.9: Immunoneutralization of TNFα in CM rescued nPM-inhibition of neurite outgrowth. Neurite outgrowth was inhibited by 25% in CM from nPM-exposed mixed glia (nPM-CM) (*; p<0.05; ANOVA). TNFα immunoneutralization of CM rescued neurite length. 83 Figure 3.10: TNFR1-blocking peptide rescued neurite outgrowth and growth cone collapse. (a) Pre-incubation of neurons with TNFR1-blocking peptide (TNFR1p) before exposure to nPM-CM restored neurite outgrowth to control levels. Pre-incubation with TNFR2- blocking peptide (TNFR2p) did not alter the nPM effect on neurite outgrowth. (**; p<0.01; ***;p<0.001; ANOVA with Tukey post-test; n=50). (b) Image of representative neuron with 2 intact and 5 collapsed growth cones. Intact growth cones have lamellipodia and multiple filopodia. Scale bar = 50 µm. (c) Blocking TNFR1 inhibited the nPM effect on percent intact growth cones per neuron. (*; p<0.05; ANOVA). NMDA antagonist AP5 did not rescue conditioned media effect on neurite outgrowth In prior studies, the direct application of 2 µg/ml nPM onto neurons inhibited neurite outgrowth, which was rescued by the competitive NMDA antagonist AP5 [10]. In 84 conditioned media, treatment with AP5 did not rescue neurite outgrowth, which argues against a role of NMDA-dependent mechanisms in the CM-neurite inhibiting activity (Fig. 3.11a). These results also indicate that the CM contains negligible residual nPM. As positive controls, both 2 µg/ml nPM and 1 ng/ml TNFα reduced neurite outgrowth by 30%. However, only AP5 rescued the direct effect of nPM on neurite outgrowth; inhibition by TNFα was also not altered by AP5 (Fig. 3.11b). These findings indicate that the inhibition of neurite outgrowth by TNFα in CM does not involve NMDA dependent mechanisms. Figure 3.11: NMDA Antagonism does not interact with TNFα. (a) The NMDA antagonist AP5 (50 µM) did not rescue the CM-inhibition of neurite outgrowth. (b) AP5 rescued neurite outgrowth in neurons treated directly with 2 µg/ml nPM, but did not alter the TNFα (1 ng/ml) mediated neurite outgrowth inhibition. (*; P<0.05, **; P<0.01, ***; P<0.001; ANOVA.) 85 Discussion These studies further document the role of glial TNFα in neuroinflammatory responses to air pollution particulate matter that modify neuronal function. In particular, we studied nano-sized particulate matter (nPM), which are a subfraction of urban PM2.5 (Methods) that epidemiological studies have associated with neurodevelopmental dysfunctions from pre-and early childhood exposure [37,38]. Rodent models include exposure of pregnant rats to nPM, which altered neonatal neuronal maturation [39] and exposure of early postnatal mice to ultrafine PM, which caused ventriculomegaly and glial activation [22]. For inflammatory responses, we focused on TNFα because of its consistent elevation in rodent models of air pollution [8,10,40-42] as well as in postmortem human brains from a highly polluted megacity [15]. In vitro activities of nPM include induction of TNFα in mixed glia from cerebral cortex and reduced neurotrophic support by the conditioned media (CM) of mixed glia exposed to nPM [10]. We also document the stability of nPM activity to induce TNFα, in which the dose response was nearly identical, despite collection from the same site on different years. We hypothesized that glial TNFα was a mediator of these CM effects because TNFα in vitro inhibits neurite outgrowth [24,34] with growth cone collapse [43] and inhibits astrocytic neurotrophic support [44]. Before further analysis of cerebral cortex glia, we investigated if TNFα induction by air pollution PM extended to the olfactory epithelium (OE) which is the initial site of exposure of inhaled air pollutants from which olfactory neurons project into the brain. Importantly, besides the acute inflammatory responses of TNFα and macrophage activation, the OE expresses high levels of phase I and phase II detoxifying enzymes, e.g. cytochrome P450 (CYP) isoforms and 86 glutathione S-transferases (GST) [45,46], which may mediate detoxifying environmental pollutants. We developed an ex vivo model for the initial impact of air pollution on olfactory neurons, in which the neonatal mouse nose is incubated with aqueous suspensions of nPM. During ex vivo incubation with nPM, the neonatal OE showed rapid shrinkage of the olfactory sensory neuron (OSN) dendritic layer concurrently with induction of TNFα and macrophage activation in the OE. We hypothesized that olfactory neuron dendritic regression was driven by TNFα from macrophages in the OE. This is supported by another model of olfactory damage, where TNFα was shown to inhibit OE regeneration [47]. We further tested this hypothesis with primary glial cultures from the neonatal mouse cerebral cortex as discussed below. In rodent models, nano-scale PM cross from the nose into the brain by undefined transport processes which are presumed to include the projections of OSN axons that synapse in the main olfactory bulb [20,48]. Studies with different artificial ultrafine PM observed that inhaled [19] or nasally instilled [20] reached the forebrain and cerebellum as well as the OB within 24 hours [49]. The passage of nPM from the nares beyond the OB into posterior brain structures gives a rationale for using cerebral cortex glia as an experimental model for direct nPM exposure. Although astrocyte cell bodies were not detected in the OE, there still may be a role of astrocytic TNFα in the OB which has deep neuronal projections caudally into the brain. To develop our observations of OE dendritic shrinkage, we further analyzed mechanisms of neuronal responses to nPM with a model of primary cultures of mixed glia and neurons from cerebral cortex. We extended our observation that conditioned 87 media (CM) from nPM exposed mixed glia inhibited neurite outgrowth [10] by resolving cell type contributions. In subcultures from mixed glia, microglia contributed 60% of the TNFα in in CM, consistent with the greater inhibition of neurite outgrowth by CM from microglia. Similarly, the microglial-CM caused more inhibition of neurite outgrowth and neurite density than the astrocyte-CM. A primary role of microglia in nPM responses is also consistent with the low abundance of GFAP-immunopositive cells or processes in the OE, especially during development [50]. The precise mechanism of nPM uptake in cells is not well defined, but could include phagocytosis [51] as well as direct diffusion [52]. The LPS experiments add further support that TNFα is a mediator of neurite outgrowth inhibition. TNFα was relatively unresponsive in astrocyte cultures treated with LPS, and correspondingly, LPS astrocyte-CM did not significantly influence neurite outgrowth. Microglia, however, showed a large induction of TNFα in response to LPS, which corresponded to a severe reduction of neurite outgrowth upon CM application vs controls (Fig. 3.6, 3.7). The role of TNFα in neurite outgrowth inhibition was further defined by suppressing TNFα expression with siRNA; by immuno-blockade of TNFα; and by TNFR1 blockade, all of which restored neurite outgrowth to control levels. The restoration of axonal length by TNFα immunoblockade is also consistent with enhanced axonal regeneration by TNFα blockade after injury [34]. Because these conditions did not consistently alter the total number of neurites or neuronal perikaryal size, they define an experimental model for effects of nPM on neuronal plasticity without major cell damage that could be useful for efficient screening of neuroprotective agents. These 88 findings document that acute nPM exposure to brain cells can have both direct and indirect effects on neuronal structure and development (outlined in Fig. 3.12). In contrast to the indirect TNFα-dependent mechanism, direct actions of nPM on neurite outgrowth involve glutamatergic mechanisms that are blocked in vitro by the NMDA antagonist AP5. Several mechanisms may mediate the glial-derived TNFα influences on neurite outgrowth. Although TNFα has both cytosolic and transmembrane forms, we would not expect a significant role for transmembrane TNFα because the nPM-CM has negligible cell membrane content. Notably, of the two defined TNFRs, only blockade of TNFR1 rescued the nPM-CM effect. This specificity is consistent with the 20-fold higher affinity of TNFR1 (Ka) to soluble TNFα vs TNFR2 [53-55]. TNFR1 activation is associated with reduced neuronal differentiation, as well as apoptosis, whereas TNFR2 is associated with neuroprotection and survival [56]. Blocking TNFR1 may have improved neurite outgrowth by diminishing growth cone collapse (Fig. 3.10c) through reduction of CM TNFα signaling. The small GTPase RhoA mediates the TNFα inhibition of neurite outgrowth [24], but mechanisms from receptor signaling to neurite outgrowth inhibition are less defined. RhoA activation by TNFα can cause growth cone collapse and attenuate neurite outgrowth [24,34,57] but this process has not been directly linked to TNFR1/2 signaling [23]. 89 Figure 3.12: Interaction model for direct and indirect effects of nPM on neurite outgrowth. nPM can influence neurite outgrowth directly via NMDA receptors [10] and indirectly through glial secretion of TNFα. Both mechanisms involve the collapse of growth cones and the inhibition of neurite outgrowth. 90 Conclusions These experimental findings suggest a role for TNFα induction by the nPM subfraction of PM2.5. We propose that TNFα from microglia-macrophage activation by nPM in inhaled air pollutants is a main mediator of neuroinflammation and neurodevelopmental impairments from airborne particulate pollution. Studies are needed to evaluate other TNF superfamily receptors and their relation to the glutamatergic changes observed in rodent models of air pollution [10,11,42]. Further fractionation of the nPM may resolve the role of the persistent free radicals in nPM [10] and specific chemical components in the heterogeneous nPM. Although these nPM fractions do not include ozone and other gases with cognitive epidemiological associations [2,21], gaseous pollutants could still contribute to nPM neurotoxicity in the real world. Identifying the neurotoxic components in air pollution could prioritize environmental policy targets to minimize neurodegenerative activities in the urban air we must breathe. List of abbreviations CM: conditioned media, CTL: control, DL: dendritic layer, GFAP: glial fibrillary acidic protein, Iba1: ionized calcium-binding adaptor molecule 1 and monocytic marker, IHC: immunohistochemistry, IL-1: interleukin 1, nPM: nano-sized particulate matter, PM: particulate matter, OB: olfactory bulb, OE: olfactory neuroepithelium, OSN: olfactory sensory neuron, TNFα: tumor necrosis factor alpha, TNFR: tumor necrosis factor receptor 91 Authors’ information 1 Davis School of Gerontology, 2 Virterbi School of Engineering, 3 USC Dornsife College University of Southern California, Los Angeles, CA 90089 Authors’ contributions HC carried out the experiments, data analysis, and drafted the manuscript. DAD assisted with neuronal cultures. SH contributed to the collection, extraction, and chemical characterization of nPM samples. CS contributed the nPM samples and designed the nPM collection. TEM participated in design of studies and manuscript editing. CEF conceived the study, guided experimental design, and edited drafts. Acknowledgements This work was supported by grants from grants to CEF from the NIA (R21AG040753, R21AG040683); the Ellison Medical Foundation; and the USC Zumberge Research and Innovation Fund; SCEHSC Center grant P30ES007048. 92 References 1. Ailshire JA, Crimmins EM. Fine particulate matter air pollution and cognitive function among older US adults. Am J Epidemiol. 2014;180:359-66. 2. Chen JC, Schwartz J. Neurobehavioral effects of ambient air pollution on cognitive performance in US adults. Neurotoxicology. 2009;30:231-9. 3. Gatto NM, Henderson VW, Hodis HN, St. John JA, Lurmann F, Chen JC, et al. Components of air pollution and cognitive function in middle-aged and older adults in Los Angeles. Neurotoxicology. 2014;40:1-7. 4. Jung CR, Lin YT, Hwang BF. Ozone, particulate matter, and newly diagnosed Alzheimer’s Disease: A population-based cohort study in Taiwan. J Alzheimer’s Dis. 2015;44:573-584. 5. Weuve J, Puett RC, Schwartz J, Yanosky JD, Laden F, Grodstein F. Exposure to particulate air pollution and cognitive decline in older women. Arch Intern Med. 2012;172:219-27. 6. Volk HE, Lurmann F, Penfold B, Hertz-Picciotto I, McConnell R. Traffic-related air pollution, particulate matter, and autism. JAMA Psychiatry. 2013;70:71-7. 7. Calderón-Garcidueñas L, Torres-Jardon R, Kulesza RJ, Park SB, D’Angiulli A. Air pollution and detrimental effects on children’s brain. The need for a multidisciplinary approach to the issue complexity and challenges. Front Hum Neurosci. 2014;8:613. 8. Levesque S, Taetzsch T, Lull ME, Kodavanti U, Stadler K, Wagner A, et al. Diesel exhaust activates and primes microglia: air pollution, neuroinflammation, 93 and regulation of dopaminergic neurotoxicity. Environ Health Perspect. 2011;1198:1149-55. 9. Genc S, Zadeoglulari Z, Fuss SH, Genc K. The adverse effects of air pollution on the nervous system. J Toxicol. 2012;2012:1-23. 10. Morgan TE, Davis DD, Iwata N, Tanner JM, Snyder D, Ning Z, et al. Glutamatergic neurons in rodent models respond to nanoscale particulate urban air pollutants in vivo and in vitro. Env Health Perspect. 2011;119:1003-1009. 11. Davis DA, Akopian G, Walsh JP, Sioutas C, Morgan TE, Finch CE. Urban air pollutants reduce synaptic function of CA1 neurons via an NMDA/NȮ pathway in vitro. J Neurochem. 2013a;127:509-19. 12. Zhang H, Liu H, Davies KJ, Sioutas C, Finch CE, Morgan TE, Forman HJ. Nrf2- regulated phase II enzymes are induced by chronic ambient nanoparticle exposure in young mice with age-related impairments. Free Radic Biol Med. 2012;52:2038-46. 13. Kleinman MT, Araujo JA, Nel A, Sioutas C, Campbell A, Cong PQ, Li H, Bondy SC. Inhaled ultrafine particulate matter affects CNS inflammatory processes and may act via MAP kinase signaling pathways. Toxicol Lett. 2008;178:127-30. 14. Block ML, Calderón-Garcidueñas L. Air pollution: mechanisms of neuroinflammation and CNS disease. Trends Neurosci. 2009;32:506-16. 15. Calderón-Garcidueñas L, Engle R, Mora-Tiscareño A, Styner M, Gómez-Garza G, Zhu H, et al. Exposure to severe urban air pollution influences cognitive outcomes, brain volume and systemic inflammation in clinically healthy children. Brain Cogn. 2011;77:345-55. 94 16. Chen JC, Wang X, Wellenius G, Serre M, Driscoll I, Casanova R, McArdle JJ, et al. Ambient air pollution and neurotoxicity on brain structure: evidence from Women's Health Initiative Memory Study. Ann Neurol. 2015;78:466-476. 17. Li N, Sioutas C, Cho A, Schmitz D, Misra C, Sempf J, et al. Ultrafine particulate pollutants induce oxidative stress and mitochondrial damage. Environ Health Perspect. 2003;111:455-60. 18. Gillespie P, Tajuba J, Lippmann M, Chen LC, Veronesi B. Particulate matter neurotoxicity in culture is size-dependent. Neurotoxicology. 2013;36:112-7. 19. Oberdörster G, Sharp Z, Atudorei V, Elder A, Gelein R, Kreyling W, et al. Translocation of inhaled ultrafine particles to the brain. Inhal Toxicol. 2004;16:437-445. 20. Elder A, Gelein R, Silva V, Feikert T, Opanashuk L, Carter J, et al. Translocation of inhaled ultrafine manganese oxide particles to the central nervous system. Environ Health Perspect. 2006;114:1172-8. 21. Wu YC, Lin YC, Yu HL, Chen JH, Chen TF, Sun Y, et al. Association between air pollutants and dementia risk in the elderly. DADM. 2015;1:220-28. 22. Allen JL, Liu X, Pelkowski S, Palmer B, Conrad K, Oberdörster G, et al. Early postnatal exposure to ultrafine particulate matter air pollution: persistent ventriculomegaly, neurochemical disruption, and glial activation preferentially in male mice. Environ Health Perspect. 2014;122:939-45. 23. Mathew SJ, Haubert D, Kronke M, Leptin M. Looking beyond death: a morphogenetic role for the TNF signalling pathway. J Cell Sci. 2009;122:1939- 946. 95 24. Neumann H, Schweigreiter R, Yamashita T, Rosenkranz K, Wekerle H, Barde YA. Tumor Necrosis Factor inhibits neurite outgrowth and branching of hippocampal neurons by a Rho-dependent mechanism. J Neurosci. 2002;22:854-62. 25. Wójciak-Stothard B, Entwistle A, Garg R, Ridley AJ. Regulation of TNF-α- induced reorganization of the actin cytoskeleton and cell-cell junctions by Rho, Rac, and Cdc42 in human endothelial cells. J Cell Physiol. 1998;176:150-65. 26. Bourhis ML, Rimbaud S, Grebert D, Congar P, Meunier N. Endothelin uncouples gap junctions in sustentacular cells and olfactory ensheathing cells of the olfactory mucosa. Eur J Neurosci. 2014;40:2878-887. 27. Ronnett GV, Leopold D, Cai X, Hoffbuhr KC, Moses L, Hoffman EP, et al. Olfactory biopsies demonstrate a defect in neuronal development in Rett's Syndrome. Ann Neurol. 2003;54:206-18. 28. Misra C, Kim S, Shen S, Sioutas C. A high flow rate, very low pressure drop impactor for inertial separation of ultrafine from accumulation mode particles. J Aerosol Sci. 2002;33:735-752. 29. Saffari A, Daher N, Shafer MM, Schauer JJ, Sioutas C. Seasonal and spatial variation in reactive oxygen species activity of quasi-ultrafine particles (PM 0.25) in the Los Angeles metropolitan area and its association with chemical composition. Atmos Environ. 2013;79:566-575. 30. Ning Z, Geller MD, Moore KF, Sheesley R, Schauer JJ, Sioutas C. Daily variation in chemical characteristics of urban ultrafine aerosols and inference of their sources. Environ Sci Technol. 2007;41:6000-6006. 96 31. Daher N, Hasheminassab S, Shafer MM, Schauer JJ, Sioutas C. Seasonal and spatial variability in chemical composition and mass closure of ambient ultrafine particles in the megacity of Los Angeles. Environ Sci Process Impacts. 2013;15:283-295. 32. Rozovsky I, Finch CE, Morgan TE. Age-related activation of microglia and astrocytes: in vitro studies show persistent phenotypes of aging, increased proliferation, and resistance to down-regulation. Neurobiol Aging. 1998;19:97- 103. 33. Yamamoto H, Demura T, Morita M, Banker GA, Tanii T, Nakamura S. Differential neurite outgrowth is required for axon specification by cultured hippocampal neurons. J Neurochem. 2012;123:904-10. 34. Kato K, Liu H, Kikuchi S, Myers RR, Shubayev VI. Immediate anti-Tumor Necrosis Factor-alpha (etanercept) therapy enhances axonal regeneration after sciatic nerve crush. J Neurosci Res. 2010;88:360-68. 35. Morgan TE, Laping NJ, Rozovsky I, Oda T, Hogan TH, Finch CE, et al. Clusterin expression by astrocytes is influenced by transforming growth factor beta 1 and heterotypic cell interactions. J Neuroimmunol. 1995;58:101-10. 36. Stone DJ, Rozovsky I, Morgan TE, Anderson CP, Hajian H, Finch CE. Astrocytes and microglia respond to estrogen with increased apoE mRNA in vivo and in vitro. Exp Neurol. 1997;143:313-8. 37. Sunyer J, Esnaola M, Alvarez-Pedrerol M, Forns J, Rivas I, López-Vicente M, et al. Association between Traffic-Related Air Pollution in Schools and Cognitive 97 Development in Primary School Children: A Prospective Cohort Study. PLoS Med. 2015; doi:10.1371/journal.pmed.1001792. 38. Woodward N, Finch CE, Morgan TE. Traffic-related air pollution and brain development. AIMS Environ Sci. 2015;2:353-73. 39. Davis DA, Bortolato M, Godar SC, Sander TK, Iwata N, Pakbin P, et al. Prenatal exposure to urban air nanoparticles in mice causes altered neuronal differentiation and depression-like responses. PLoS One. 2013b; doi:10.1371/journal.pone.0064128. 40. Campbell A, Oldham M, Becaria A, Bondy SC, Meacher D, Sioutas C, et al. Particulate matter in polluted air may increase biomarkers of inflammation in mouse brain. Neurotoxicology. 2005;26:133-40. 41. Campbell A, Daher N, Solaimani P, Mendoza K, Sioutas C. Human brain derived cells respond in a type-specific manner after exposure to urban particulate matter. Toxicol In Vitro. 2014;28:1290-295. 42. Wen-Shwe TT, Mitsushima D, Yamamoto S, Fukushima A, Funabashi T, Kobayashi T, et al. Changes in neurotransmitter levels and proinflammatory cytokine mRNA Expressions in the mice olfactory bulb following nanoparticle exposure. Toxicol Appl Pharm. 2008;226:192-98. 43. Gelbard HA, Dzenko KA, Wang L, Talley A, James H, Epstein L. HIV-1-derived neurotoxic factors: effects on human neuronal cultures. In: Major EO, Levy JA, Schoenberg D, editors. Technical Advances in AIDS Research in the Human Nervous System. New York: Plenum Press 1995. p. 61-72. 98 44. Abd-El-Basse EM. Pro-inflammatory cytokine; Tumor Necrosis Factor alpha (TNF-α) inhibits astrocytic support of neuronal survival and neurites outgrowth. Adv Biosci Biotechnol. 2013;4:73-80. 45. Bond JA, Harkema JR, Russell VI. Regional distribution of xenobiotic metabolizing enzymes in respiratory airways of dogs. Drug Metab Dispos. 1988;16:116–24. 46. Longo V, Ingelman-Sundberg M, Amato G, Salvetti A, Gervasi PG. Effect of starvation and chlormethiazole on cytochrome P450s of rat nasal mucosa. Biochem Pharmacol. 2000;59:1425–32. 47. Turner JH, Liang KL, May L, Lane AP. Tumor Necrosis Factor alpha inhibits olfactory regeneration in a transgenic model of chronic rhinosinusitis-associated olfactory loss. Am J Rhinol Allergy. 2010;24:336-40. 48. Oberdörster G, Sharp Z, Atudorei V, Elder A, Gelein R, Kreyling W, Cox C. Translocation of inhaled ultrafine particles to the brain. Inhal Toxicol. 2004;16:437-45. 49. Oberdörster G, Elder A, Rinderknecht A. Nanoparticles and the brain: cause for concern? J Nanosci Nanotechno. 2009;9:4996–5007. 50. Vincent AJ, West AK, Chuah MI. Morphological and functional plasticity of olfactory ensheathing cells. J Neurocytol. 2005;34:65-80. 51. Xia T, Kovochich M, Brant J, Hotze M, Sempf J, Oberley T, Sioutas C, et al. Comparison of the abilities of ambient and manufactured nanoparticles to induce 99 cellular toxicity according to an oxidative stress paradigm. Nano Lett. 2006;6:1794-807. 52. Geiser M, Rothen-Rutishauser B, Kapp N, Schürch S, Kreyling W, Schulz H, et al. Ultrafine Particles Cross Cellular Membranes by Nonphagocytic Mechanisms in Lungs and in Cultured Cells. Environ Health Perspect. 2005;113:1555-60. 53. Ksontini R. Revisiting the role of Tumor Necrosis Factor alpha and the response to surgical injury and inflammation. Arch Surg. 1998;133:558-67. 54. Cabal-Hierro L, Lazo PS. Signal transduction by Tumor Necrosis Factor receptors. Cell Signal. 2012;24:1297-305. 55. Grell M, Wajant H, Zimmermann G, Scheurich P. The type 1 receptor (CD120a) is the high-affinity receptor for soluble tumor necrosis factor. Proc Natl Acad Sci 1998;95:570-5. 56. Chen Z, Palmer TD. Differential roles of TNFR1 and TNFR2 signaling in adult hippocampal neurogenesis. Brain Behav Immun. 2013;30:45-53. 57. Wu KY, Hengst U, Cox LJ, Macosko EZ, Jeromin A, Urquhart ER, Jaffrey SR. Local translation of RhoA regulates growth cone collapse. Nature. 2005;436:1020-024. 100 CHAPTER 4 Applications, Synthesis, and Conclusions Understanding what happens to the brain after nPM exposure creates a basis for exploring disease and environment interactions. We have established that nPM is a potent source of neuroinflammation and oxidative stress, which are processes implicated in stroke and Alzheimer’s disease progression. These relationships are important to document because they help explain correlations from epidemiological studies of pollution with stroke and cognitive impairment (Wellenius et al. 2012, Ailshire et al. 2014). Stroke damage is exacerbated by nano-size particulate matter in a mouse model (data published in Liu et al. 2016. PLoS ONE) The effects of nPM exposure was examined in a model of mouse reperfused stroke. Exposure to nPM is hypothesized to exacerbate stroke due to increased neuroinflammation that influences the recruitment of marginally viable penumbral tissue into the ischemic core. Mice were exposed for 45 cumulative hours before undergoing 35 minutes of middle cerebral artery occlusion (MCAO), a method for inducing ischemic stroke, followed by cerebral reperfusion. Infarct volume was assessed 24 hours post- ischemia by Triphenyl tetrazolium chloride (TTC) staining and 3 mice brains from each group were set aside for immunohistochemistry. Reperfusion of cerebral blood flow was measured using Laser Doppler Flowmetry (LDF). C5, C5a (the active form of C5), and 101 C5a receptor were chosen as markers for inflammation, while NADPH oxidase subunits gp91phox and p47phox were chosen as markers of oxidative stress. Infarct volume and reperfusion Following cerebral ischemia/ reperfusion, mice exposed to nPM demonstrated larger infarct volumes [20.6 ±6.4% (n=8) vs. 11.3 ±6.6% (n=9); p=0.018] when compared to mice exposed to filtered air (Fig. 4.1A,C). LDF analysis did not demonstrate significant differences reperfusion in the cohort of mice exposed to nPM (64 ±39%, n=10) when compared to those exposed to filtered air (86 ±24%, n=10, p=ns; Fig. 4.1B) Figure 4.1 (credit Qinghai Liu): Infarct volume and reperfusion following murine stroke. (A) Cerebral infarct volumes are larger in mice exposed to nPM when compared to those exposed to filtered air. (B) Percent reperfusion differences do not differ significantly between the two groups. (C) Representative TTC staining of infarcts. * Signifies p<0.05. 102 Complement C5, C5a, C5a receptor density Following cerebral ischemia/ reperfusion, mice exposed to nPM demonstrated significantly higher complement C5 densities in the ischemic core [1378.18 ±127.97 (n=3)] when compared to mice exposed to filtered air [761.29 ±82.93 (n=3); p<0.01; Fig. 4.2]. C5 deposition was most evident on neurons (Fig. 4.2A). Further, the mice exposed to nPM demonstrated higher C5 densities in the contralateral hemisphere [478.82 ±165.77 (n=3)] than did the mice exposed to filtered air [130.09 ±46.74 (n=3); p=0.0893; figure 4b]. Mice exposed to nPM demonstrated significantly higher complement C5a [1905.00 ±365.40 (n=3)] and C5a receptor (CD88) [805.06 ±49.34 (n=3)] densities in the ischemic core when compared to mice exposed to filtered air [669.19 ±157.23 (n=3); p<0.05; 387.21 ±72.31 (n=3); p<0.01, respectively], (Figure 5). Further, the mice exposed to nPM demonstrated higher C5a densities in the contralateral hemisphere [808.68 ±296.18 (n=3)] than did the mice exposed to filtered air [31.62 ±4.05 (n=3); p=0.0586; figure 5]. C5a and C5a receptor densities demonstrated a strong correlation across all mice (r 2 =0.57; p=0.0821). 103 Figure 4.2: Semiquantitative immunohistochemical analysis demonstrates C5 is increased in mice exposed to nPM. (A) Filtered air and nPM exposed mice euthanized at 24 hours and stained for C5 (green) in the ischemic region. Nuclei (DAPI) are stained in blue. Neurons are stained in red. (B) Graphical representation of C5 density per high-powered field (40X objective) for filtered air and nPM exposed mice in the ischemic region and contralateral hemispheres. ** Signifies comparison of ipsilateral hemisphere counts (P<0.01). # Signifies comparison of contralateral hemisphere counts (0.05<P<0.1). Scale bar: 50 μm. 104 Figure 4.3: Semiquantitative immunohistochemical analysis demonstrates C5a and C5a receptor (CD88) are increased in mice exposed to nPM. (A) Filtered air and nPM exposed mice euthanized at 24 hours and stained for C5a (red) in the ischemic region. Nuclei (DAPI) are stained in blue. (B) Graphical representation of C5a density per high-powered field (40X objective) for filtered air and nPM exposed mice in the ischemic region and contralateral hemispheres. (C) Filtered air and nPM exposed mice euthanized at 24 hours and stained for C5a receptor (CD88) (green) in the ischemic region. Nuclei (DAPI) are stained in blue. (D) Graphical representation of CD88 densities per high-powered field (40X objective) for filtered air and nPM exposed mice in the ischemic region and contralateral hemisphere across all samples. ** Signifies comparison of ipsilateral hemisphere counts (P<0.01). # Signifies comparison of contralateral hemisphere counts (0.05<P<0.1). Scale bar: 50 μm. 105 Gp91phox/ p47phox density Following cerebral ischemia/ reperfusion, mice exposed to nPM demonstrated significantly higher GP91phox densities in the ischemic core [502.51 ±7.31 (n=3)] when compared to mice exposed to filtered air [357.27 ±48.45 (n=3); p<0.05]. p47phox densities did not differ significantly between the two cohorts (Figure 6). Figure 4.4: Semiquantitative immunohistochemical analysis demonstrates gp91phox is increased in mice exposed to nPM. (A) Filtered air and nPM exposed mice euthanized at 24 hours and stained for gp91phox (red) in the ischemic region. 106 Nuclei (DAPI) are stained in blue. (B) Graphical representation of gp91 density per high- powered field (40X objective) for filtered air and nPM exposed mice in the ischemic region and contralateral hemispheres. (C) Filtered air and nPM exposed mice euthanized at 24 hours and stained for p47phox (red) in the ischemic region. Nuclei (DAPI) are stained in blue. (D) Graphical representation of p47phox densities per high- powered field (40X objective) for filtered air and nPM exposed mice in the ischemic region and contralateral hemisphere. * Signifies comparison of ipsilateral hemisphere counts (P<0.05). Scale bar: 50 μm. Discussion This is the first study to characterize the effects of nPM in a murine stroke model. These data suggests that subchronic nPM exposure result in larger infarct volumes after cerebral ischemia. We hypothesize that the larger infarct sizes may be due to concomitant neuroinflammation caused by nPM. Importantly, these findings implicate nPM exposure as a variable risk factor that affects the size and severity of acute stroke. Inflammatory factors such as TNFα and C5 are known to mediate stroke damage. Blocking these factors by using antibody blockers or genetic knockout models significantly reduces the infarct volumes (Barone et al. 1997, Liu et al. 2013). The presence of these cytokines and chemokines in the brain increases susceptibility of the brain to stroke because it recruits more reactive astrocytes and microglia. During ischemic stroke, astrocytes and microglia especially can promote further damage by releasing oxygen free radicals. In fact, a study of nano-sized diesel exhaust exposure to microglia showed upregulation of NADPH oxidases, which resulted in superoxide mediated injury (Block et al. 2004). Our data indicated that the NADPH oxidase subunit gp91phox was significantly increased in the ischemic core. This could be linked to the increased microglia burden in the ipsi- and contralateral hemispheres (not shown), as 107 activation of gp91phox mediates damage by ischemia-activated microglia (Hur et al. 2010). C5 was studied in this model because of its role in ischemic stroke and white matter injury (Liu et al. 2013). Epidemiological studies have demonstrated that air pollution is associated with smaller white matter volume (Chen et al. 2015), which has serious implications for neurodegeneration and disease. Because stroke causes significant white matter injury and increased C5 protein deposition in corpus callosum (Liu et al. 2015), it is important to document possible synergistic effects that could exacerbate outcomes. During inflammation, C5 can be cleaved into C5a, which has chemotactic and anaphylactic properties, and C5b. The increased presence of C5a can attract resident microglia and other immune cells to the site of injury (Miller et al. 2009). Accordingly, C5-deficient mice have decreased white matter ischemia and fewer reactive astrocytes and microglia at the corpus callosum following bilateral carotid artery stenosis (BCAS) induced stroke (Liu et al. 2015). C5a can also induce microglia to release TNFα (Yang et al. 2013), which can then further propagate neuroinflammation. While the contralateral hemispheres did not show significant changes in C5 and C5a due to low power, the effect size is large and the p values were < 0.1. Conversely, the oxidative markers gp91phox and p47phox showed no difference on the contralateral side. These findings are consistent with the short term time course exposure at 45 hours, where cortex showed an increase in inflammation, but not oxidative stress (Fig. 2.9A,C). 108 The experimental design of this study aims to assess the impact of nPM exposure on stroke progression and the fate of marginally viable tissue in the setting of cerebral ischemia. While there are limitations such as the duration and concentration of exposure, this study revealed that nPM exposure may increase susceptibility to negative outcomes of stroke. Ultimately, for this to have significant societal impact, translational studies will be needed to characterize air pollution exposures and clinical outcomes for susceptible patients at high risk for ischemic stroke. Concluding remarks We have demonstrated that nPM exposure causes neuroinflammation and exacerbates stroke. Our studies are the first to document the effects of nPM on the OE tissue and on stroke infarct volumes. These findings will advance the field of environmental neurotoxicity and brings the significance of olfactory-brain connection to the discussion. Because the OE is amongst the first cell layer to come into contact with inhaled air pollutants, it is important to understand exactly how they respond and propagate downstream effects in both cellular and tissue/organ systems. While it has been established that nPM can induce neuroinflammation, neurotoxicity, oxidative stress, and accelerate cognitive/behavioral deficits, their interactions with different CNS regions and tissue deposition properties are different and must be resolved. We have documented differential regional responses of neural tissue to nPM, as well as elucidated the cellular responses of glia to potential mechanisms of neurite degeneration. 109 Overall, these discoveries contribute to the increasing body of evidence that show nPM should be considered in governmental regulations due to their increased ability to generate ROS and elicit neurotoxic effects compared to larger PM. Because air pollution is so prevalent in our industrialized world and affects billions of humans, zoning in on the implications of exposure is a step towards awareness and intervention. As our society moves forward with new technologies, conveniences, and industries that generate nPM, we should learn exactly what their health implications are to improve regulations for the benefit of society. This field of research requires a multidisciplinary approach from ranging from epidemiology, toxicology, engineering, biochemistry, policy and more in order to begin making a difference in global health in response to air pollution. 110 References 1. Ailshire JA, Crimmins EM. 2014. Fine particulate matter air pollution and cognitive function among older US adults. Am J Epidemiol 180:359-66. 2. Barone FC, Arvin B, White RF, Miller A, Webb CL, Willette RC, et al. 1997. Tumor necrosis factor-alpha. A mediator of focal ischemic brain injury. Stroke 28:1233-44. 3. Block ML, Wu X, Pei Z, Li G, Wang T, Qin L, et al. 2004. Nanometer size diesel exhaust particles are selectively toxic to dopaminergic neurons: the role of microglia, phagocytosis, and NADPH oxidase. FASEB J 18:1618-1620. 4. Chen JC, Wang X, Wellenius G, Serre M, Driscoll I, Casanova R, et al. 2015. Ambient air pollution and neurotoxicity on brain structure: evidence from Women's Health Initiative Memory Study. Ann Neurol. 78:466-476. 5. Hur J, Lee P, Kim MJ, Kim Y, Cho YW. 2010. Ischemia-activated microglia induces neuronal injury via activation of gp91phox NADPH oxidase. Biochem Biophys Res Commun 391:1526-30. 6. Liu Q, He S, Groysman L, Shaked D, Russin J, Cen S, et al. 2013. White matter injury due to experimental chronic cerebral hyoperfusion is associated with C5 deposition. PLoS ONE 8:12. 7. Miller AM, Stella N. 2009. Microglial cell migration stimulated by ATP and C5a involve distinct molecular mechanisms. Glia 57:875-83. 8. Wellenius GA, Burger MR, Coull BA, Schwartz J, Suh HH, Koutrakis P, et al. 2012. Ambient air pollution and the risk of acute ischemic stroke. Arch Intern Med 172:229- 234. 111 9. Yang F, Li D, Xu S. 2013. The roles of C5a and C5aR antagonist in TNF-α secretion and CD88 expression of BV2 microglial cells treated with Aβ1-42 oligomer. Xi Bao Yu Fen Zi Mian Yi Xue Za Zhi. 29:265-268.

Abstract (if available)

Abstract Urban particulate air pollution has been epidemiologically associated with cognitive impairments and accelerated neuropathology. Of the various size classes of particulates, nanoparticulate matter (diameter <200 nm, nPM) show higher toxicity than larger particles. Although air pollution particulates have traditionally been studied in cardiovascular systems, epidemiology and neurobiological studies on air pollution biology has shown strong evidence that the brain is adversely affected. Pilot studies of in vivo mice and in vitro rat mixed glial/neuronal culture models show that nPM exposure induced inflammatory markers such as TNFα and IL-1α in rodent brains. However, it is unknown how relevant in vitro models are because the question of whether traffic-derived nPM can actually reach the brain has not been sufficiently explored or addressed. Additionally, there are gaps in the literature regarding how nPM interacts with the neural systems on the cellular and tissue levels. ❧ Our work has revealed a role for the olfactory neuroepithelium (OE) with regard to nPM toxicity in the brain. The olfactory sensory neurons of the OE are exposed to the external environment, which allows them to interact directly with nPM and other environmental toxins. Additionally, these neurons have axons that bundle together into nerve fibers that cross the cribriform plate and synapse in the olfactory bulb. We show that the OE has the most rapid responses to nPM exposure, with induction of TNFα and oxidative/nitrosative stress markers 4-hydroxynonenal (4-HNE) and 3-nitrotyrosine (3-NT). Induction of 4-HNE and 3-NT in OE preceded responses in the olfactory bulb, which also preceded response in cortex and cerebellum. On the cellular level, nPM modestly reduced the dendritic lengths of olfactory sensory neurons, suggesting that there may be neurodegenerative actions of nPMs. ❧ To extend these findings, we use in vitro models of rat cortical glia and neurons to investigate potential neurotoxic actions of nPM. Conditioned media derived from nPM treated mixed glia reduces neurite outgrowth. siRNA and immunoneutralization knockdown of TNFα mRNA and protein rescued the conditioned media effect on neurite outgrowth in vitro. Additionally, blocking the type 1 TNF receptor also curbed the reduction of neurite outgrowth. ❧ These findings provide novel evidence that nPM induces oxidative stress and neuroinflammation in a time and region specific manner throughout the olfactory gateways (OE and olfactory bulb) and brain. Understanding the mechanisms in which nPM elicits its neurotoxic effects in different brain regions is crucial to detecting potential accelerated pathologies in people living in high pollution zones. Further knowledge of nanoparticulate matter biology may call for improvements in environmental and industrial regulations to improve the health of the general population.

Linked assets

University of Southern California Dissertations and Theses

Conceptually similar

PDF

Neuroinflammation and the behavioral consequences of air pollution over the life course

PDF

Air pollution neurotoxicity throughout the lifespan: studies on the mechanism of toxicity and interactions with effects of sex and genetic background

PDF

Glial support of neurite outgrowth: effects of aging and estrogen

PDF

Toxicity of urban particulate matter: long-term health risks, influences of surrounding geography, and diurnal variation in chemical composition and the cellular oxidative stress response

PDF

The effects of prolonged fasting/ fasting mimicking diet (FMD) on CNS protection, regeneration, and treatment

PDF

To adapt or not to adapt: the age-specific and sex-dependent differences in the adaptive stress response

Asset Metadata

Creator Cheng, Hank (author)

Core Title Neuroinflammatory effects of urban traffic-derived nanoparticulate matter on neural systems

School College of Letters, Arts and Sciences

Degree Doctor of Philosophy

Degree Program Molecular Biology

Publication Date 04/20/2016

Defense Date 03/17/2016

Publisher University of Southern California (original), University of Southern California. Libraries (digital)

Tag Air pollution,brain,microglia,nanoparticulate matter,neuroinflammation,neuron,OAI-PMH Harvest,olfactory epithelium,oxidative stress,TNFalpha

Format application/pdf (imt)

Language English

Contributor Electronically uploaded by the author (provenance)

Advisor Finch, Caleb E. (committee chair), Curran, Sean P. (committee member), Tower, John G. (committee member), Zlokovic, Berislav (committee member)

Creator Email hankc@usc.edu,hcheng10@gmail.com

Permanent Link (DOI) https://doi.org/10.25549/usctheses-c40-234781

Unique identifier UC11279282

Identifier etd-ChengHank-4313.pdf (filename),usctheses-c40-234781 (legacy record id)

Legacy Identifier etd-ChengHank-4313.pdf

Dmrecord 234781

Document Type Dissertation

Format application/pdf (imt)

Rights Cheng, Hank

Type texts

Source University of Southern California (contributing entity), University of Southern California Dissertations and Theses (collection)

Access Conditions The author retains rights to his/her dissertation, thesis or other graduate work according to U.S. copyright law. Electronic access is being provided by the USC Libraries in agreement with the a...

Repository Name University of Southern California Digital Library

Repository Location USC Digital Library, University of Southern California, University Park Campus MC 2810, 3434 South Grand Avenue, 2nd Floor, Los Angeles, California 90089-2810, USA