University of Southern California Dissertations and Theses

Molecular studies of the human galactose-1-phosphate uridyltransferase gene

(USC Thesis Other)

Molecular studies of the human galactose-1-phosphate uridyltransferase gene

PDF

Download

Open document

Flip pages

Download a page range

Download transcript

Copy asset link

Request this asset

Transcript (if available)

Content MOLECULAR STUDIES OF THE HUMAN GALACTOSE-1-
PHOSPHATE URIDYLTRANSFERASE GENE
by
Hsien-Chin Lin
A Thesis Presented to the
FACULTY OF THE GRADUATE SCHOOL
UNIVERSITY OF SOUTHERN CALIFORNIA
In Partial Fulfillment of the
Requirements for the Degree
MASTER OF SCIENCE
(Biochemistry)
August 1994
Copyright 1994 Hsien-Chin Lin
UMI Number: EP41363
All rights reserved
INFORMATION TO ALL USERS
The quality of this reproduction is dependent upon the quality of the copy submitted.
In the unlikely event that the author did not send a complete manuscript
and there are missing pages, these will be noted. Also, if material had to be removed,
a note will indicate the deletion.
Dissertation Publishing
UMI EP41363
Published by ProQuest LLC (2014). Copyright in the Dissertation held by the Author.
Microform Edition © ProQuest LLC.
All rights reserved. This work is protected against
unauthorized copying under Title 17, United States Code
ProQuest LLC.
789 East Eisenhower Parkway
P.O. Box 1346
Ann Arbor, Ml 48106-1346
UNIVERSITY O F S O U T H E R N C ALIFORNIA
T H E G R A D U A T E S C H O O L
U N IV E R S IT Y P A R K
L O S A N G E L E S , C A L IF O R N IA 9 0 0 0 7
This thesis, written by
under the direction of h....y.....Thesis Committee,
and approved by all its members, has been pre
sented to and accepted by the Dean of The
Graduate School, in partial fulfillment of the
requirements for the degree of
Dean
D a t e June 17, 1994
THESIS COMMITTEE
Chairman
ii
This thesis is dedicated to m y parents, whose love and support
are always inside m y heart.
iii
ACKNOWLEDGEMENTS
First of all, I like to thank Dr. Juergen K.V. Reichardt who
provided m e the great opportunity to research the hum an
genetic d isease- Galactosemia. I appreciate his help,
encouragem ent, and guidance.
I also thank all the people I was working w ith in Dr.
R eichardt1 s laboratory for their technical assistance and
valuable suggestions.
I really thank m y family, owing to their support an d
understanding, I can concentrate to pursue m y degree.
Finally, thank all the people for concerning about me.
iv
T A B L E O F CONTENTS
PAGE
Acknowledgem ents iii
List of Tables vi
List of Figures vii
A bstract viii
Chapter 1: Introduction ±
1.1 Galactosemia 2
1.2 M echanism and Molecular Study of Galactosemia 3
1.3 Experim ental Purpose and Significance 4
Chapter 2: On the Molecular Nature of the Duarte 7
Variant of Galactose-1-phosphate
Uridyl transferase (G ALT)
2.1 A bstract 9
2.2 Introduction 10
2.3 M aterials and Methods 11
2.4 Results 12
2.5 Discussion 13
2.6 References 21
Chapter 3: Linkage Disequilibrium Between a Sac I 24
Restriction Fragment Length Polymorphism
and Two Galactosemia Mutations
3.1 A bstract 26
3.2 Introduction 27
3.3 M aterials and M ethods 29
3.4 Results and Discussion 30
3.5 References 38
V
Chapter 4: Molecular Characterization of 40
Galactosemia Mutation (Type 1) in
Japanese
4.1 A bstract 42
4.2 Introduction 43
4.3 Patients and Methods 44
4.4 Results 48
4.5 Discussion 50
4.6 References 63
Chapter 5: Conclusion and Discussion 66
5.1 Work in Progress 67
References
71
vi
C hapter 2:
Table
C hapter 3:
Table
LIST OF TABLES
. Correlation of galactose-1-phosphate
uridyl transferase (GALT) biochem ical
genotypes with the N314D polym orphism
. Frequency of the Sac I RFLP in various
populations
PAGE
18
35
C hapter 4:
Table 1. Expression analysis of R231H m utation 54
LIST OF FIGURES
PAGE
C hapter 2:
Figure 1: Screen for the N314D allele 19
C hapter 3:
Figure 1: Detection of the Sac I polym orphism 36
by PCR
C hapter 4:
Figure 1: 3,-fragm ents of GALT cDNA of patien t 1 55
and control were sequenced w ith specific
oligonucleotide prim er
Figure 2: 5’-fragm ent of GALT cDNA of p atien t 2 57
healthy control was sequenced w ith
universal prim er
Figure 3: The subcloned genomic DNA in exon 3 59
to 5 o r in intron 2 to 5 was sequenced w ith
specific oligonucleotide prim er
Figure 4: Consensus sequence shows base 61
arrangem ent in 3'splice acceptor site
viii
ABSTRACT
Deficiency of galactose-1-phosphate uridyl transferase
(GALT) is a m ajor known cause of an inborn m etabolic disease
called galactosemia. In the GALT gene, twelve m issense
m utations, four polym orphism s, one silent nucleotide
substitution, and one restriction fragm ent length polym orphism
(RFLP) have been identified thus far. The purpose of m y thesis
was first to study the m olecular nature of the D uarte of GALT,
second to identify linkage disequilibrium betw een a Sac I
restriction fragm ent length polym orphism (RFLP) and two
galactosem ia m utations, and third to identify new m utations. In
this thesis, by using a "candidate m utation" approach, I propose
th at the N314D encodes the D uarte variant of GALT an d that
m olecular testing for N314D m ay be useful to confirm a
biochem ical diagnosis of Duarte variant of GALT. By using the
polym erase chain reaction (PCR), I have also dem onstrated th at
Q188R and N314D are the two m ost com m on m utations in
Caucasian population m ay have arisen independently in
evolution on different chrom osom al backgrounds. Meanwhile, a
m issense m utation (R231H) and a novel splicing m utation
(3 18A--G) of GALT have been characterized in Japanese
patients, both resulting in reduction of GALT activity to either
15% or less than 1% of norm al controls. In sum m ary,
galactosem ia is characterized by genotypic and phenotypic
diversity of the GALT gene at the m olecular an d evolutional
level.
1
Chapter 1
Introduction
2
INTRODUCTION
1.1 Galactosem ia
There are three enzymes involved in galactose
m etabolism , galactokinase (GALK), galactose-1-phosphate
uridyltransferase (GALT), UDP-Gal 4'- epim erase (GALE),
deficiency of each one m ay cause "galactosemia" (Segal, 1989).
The deficiency of galactose -1-phosphate uridyltransferase
(GALT) is a m ajor known cause of this autosom al inherited
disease w ith the prevalence of 1: 60,000 in Caucasian (Levy
and Hamm ersen, 1978) and 1: 1,000,000 in Japan (Aoki an d
Wada, 1988). The m ajor defect in galactose m etabolism is GALT
deficiency which results in inability to convert galactose to
glucose leading to an elevated level of galactose and its
m etabolites. Early sym ptom s include neonatal jaundice,
vom iting, diarrhea, hepatom egaly, and failure to thrive. O ther
com m on sym ptom s are Escherichia coli sepsis, ovary failure,
and cataracts form ation (Segal, 1989). These sym ptom s
disappear w hen patients are rigorously m aintained on a
lactose-free diet. Newborn screening program s for galactosem ia
have been done in m any developed countries for decades.
However, long-term com plications such as neurological
abnorm alities and ovarian failure still persist in m any well-
m anaged patients (W aggoner et al.. 1990).
3
1.2 M echanism and M olecular Study of Galactosemia
Galactose-1-phosphate uridyltransferase (EC 2. 7. 7. 12)
catalyzes the interconversion of UDP-glucose and galactose-1-
phosphate w ith UDP-galactose and glucose-1-phosphate by a
double-displacem ent m echanism (Kalckar et al.. 1953).
Im portant evidence supporting the double-displacem ent
m echanism was obtained by using nuclear m agnetic resonance
an d m ass spectroscopic techniques (Sheu et al.. 1979;
A rabshahi et al.. 1986). A full-length cDNA and gene encoding
GALT have been cloned, sequenced, characterized and m apped
to chrom osom e 9pl3-21 (Reichardt and Berg, 1988; Flach,
R eichardt and Elsas, 1990; Leslie et al.. 1992). N ucleotide
sequences of GALT cDNA is about 1400 bases in length and
encodes a 43,000 Mr protein (Reichardt an d Berg, 1988).
However, a 1295 base revised length GALT cDNA was
described by Flach et al.. 1990.
A com parison of the hom ologous enzymes gal T from
Escherichia coli, GAL 7 from Saccharomvces cerevisiae an d
GALT from hum an shows a overall of 35% sequences identify in
these three species w ith several com pletely conserved short
regions (Reichardt and Berg, 1988; Flach et al.. 1990).
M utations can happen either in consensus sequences or
nonconserved dom ains. Three m utations, F171S , Q188R,
L195P, were identified around the putative active site
nucleophile- histidine 186. The other galactosem ia m issense
4
m utations were dispersed throughout the GALT gene
(R eichardt and Woo, 1991: Reichardt et al.. 1991, 1992 a,b).
However, m any galactosem ia variants, e.g., the D uarte and Los
Angeles variants, have been described in hum an GALT based
on the increased electrophoretic m obility in native gels and
different enzym atic activity (Segal, 1989). Thus, "classic"
galactosem ia with no detectable enzym e activity in
erythrocytes and severe neonatal sym ptom s, while "variant"
galactosem ia with m easurable residual reduce enzym e activity
an d m ilder sym ptom s have been defined. Using m olecular
strategies, twelve missense disease-causing m utations, four
polym orphism s, one silent nucleotide substitution, an d one
RFLP have been identified in the GALT gene thus far
(Reichardt, 1992; Flach et al.. 1990b).
1.3 Experim ental Purpose and Significance
To investigate the m olecular level of genotypic variability
and the relationship between different known m utations in
status of evolution, I have screened Duarte, galactosemia, and
o th er alleles for a "candidate m utation": N314D, which results
from an A- to G- transition of nucleotide 968 in GALT cDNA
(Reichardt and Woo, 1991). N314D substitutes asparagine-314
w ith aspartic acid m ight account for the altered electrophoretic
properties of the D variant of GALT. N314D also encodes
substantial residual activity when overexpressed in COS cells. I
5
rep o rt here a close association betw een N314D polym orphism
an d the D uarte variant of GALT. I also propose th at m olecular
testing for N314D m ight be useful to confirm a biochem ical
diagnosis of D variant of GALT.
I have identified a novel Sac I RFLP in hum an GALT gene.
The m ost com m on m utation, Q188R, accounts for over 60% in
Caucasian galactosem ia alleles and has been characterized as
the severe "classic" transferase deficiency galactosem ia (Ng £t
al.. 1994). The N314D m utation (asparagine-314 to aspartate)
encodes the "Duarte" (D) variant of the GALT enzym e (Lin et al..
1994). The high frequency of these two m utations: Q188R and
N314D, particularly in Caucasian patients led m e to investigate
their genetic origin. On the basis of the frequency of the Sac I
RFLP in various chrom osom al backgrounds, I suggest th at these
two m utations arose independently and probably occurred only
once in evolution.
Finally, through collaboration with Dr. Okano's laboratory
in Japan, we characterized a missense and a novel splicing
m utations of GALT gene, R231H and 318A--G. The m issense
m utation, R231H (arginine substitutes to histidine), results
from a G to A transition in exon 8, and encodes a reduction of
GALT activity to 15% of norm al in COS cell expression system.
The splicing m utation, 318A--G, was an A to G transition at the
38th nucleotide in exon 3, resulting in a 38 bp deletion of GALT
cDNA and 92 am ino acids com pared w ith the norm al 379 am ino
6
acids. Both hom ozygous genotypes of R231H/R231H an d 318A-
-G/318A--G expressed less than 1% of erythrocyte GALT
activity and caused classic galactosemia. The frequency of
N314D, Q188R, and R333W m utations are also described here
in ord er to com pare the m olecular basis am ong O rientals an d
Caucasians.
7
Chapter 2
On the Molecular Nature of the Duarte Variant of
Galactose-1-Phosphate Uridyltransferase (GALT)
Hum. Genet. (1994) 93: 167-169
(Springer-Verlag owns the copyright to the article an d
perm ission to reproduce this article has been granted)
8
On the Molecular Nature of the Duarte Variant of
Galactose-1-Phosphate Uridyltransferase (GALT)
ACKNOW LEDGEM ENTS
I thank Drs. R. Allen (Michigan), J. Belmont (Baylor), H.
Levy (H arvard), and S. Packman (UCSF) for im portant sam ples.
W ork in the laboratory of J. K. V. R. is supported in p a rt by a
Basil O’Connor Starter Scholar Award from the M arch of Dimes
(5-FY92-1310) and by the Betty Lou W arren Research Fund. J.
K. V. R. is a fellow of the James H. Zumberge Faculty Research
and Innovation Fund at the University of Southern California.
W. G. N. is supported in p art by the C hildren’s Hospital Los
Angeles Research Program. We thank Dr. Lawrence Wong
(C hildren's Hospital Vancouver) for assistance in obtaining
specim ens and Ms. H eather Wildgrove (C hildren’s Hospital
Vancouver) for technical assistance.
9
2.1 ABSTRACT
Galactosem ia is an inborn error of galactose m etabolism
secondary to deficiency of galactose-1-phosphate
uridyltransferase (GALT). GALT is a polym orphic enzym e an d
D uarte (D) is the m ost com m on enzyme variant. This v ariant is
characterized by faster electrophoretic m obility and reduced
activity. D uarte/galactosem ia com pound heterozygotes (D/G)
are com m only identified in galactosem ia new born screening
program s. However, these patients do n o t generally require
treatm ent. By using a "candidate m utation" approach to define
the m olecular basis of the Duarte variant of GALT, a close
association betw een the previously reported N314D
polym orphism and the D uarte variant of GALT was found. We
suggest th at N314D encodes the D variant of GALT and th at
m olecular testing for N314D m ight be useful to confirm a
biochem ical diagnosis of D uarte variant of GALT.
10
2.2 INTRODUCTION
Norm al galactose m etabolism involves three enzymes:
galactokinase (GALK), galactose-1-phosphate uridyltransferase
(GALT), an d UDP-gal 4 ' -epim erase (GALE; Segal, 1989).
Deficiency of each one of these enzym es can result in
galactosem ia (Segal, 1989). However, the m ost com m on and
m ost severe form of galactosemia is secondary to transferase
deficiency (MIM 230400). GALT is a polym orphic enzym e, and
the m ost com m on variant is the D uarte variant (D), which was
described by M athai and Beutler (1966) and soon thereafter
characterized biochem ically by Beutler and Baluda (1966) an d
Ng et al. (1969). This variant is characterized by faster
electrophoretic m obility and slightly reduced activity.
D uarte/galactosem ia com pound heterozygotes (D/G) are
com m only identified in new born screening program s because
of reduced enzym e activity and altered enzym e m obility.
However, these patients do not generally require treatm ent.
The cloning and characterization of a full-length,
expressible GALT cDNA (Reichardt and Berg, 1988; Flach et al..
1990) have allowed researchers to identify a num ber of
disease-causing m utations and polym orphism s (reviewed by
Reichardt, 1992). We, therefore, screened D uarte, galactosem ia,
an d o ther alleles for a "candidate m utation": N314D, which
results from an A- to -G transition of nucleotide 968 in the
GALT cDNA (Reichardt and Woo, 1991). N314D substitutes
11
asparagine-314 w ith aspartic acid and thereby m ight account
for the altered electrophoretic properties of the D v ariant of
GALT. N314D also encodes substantial residual activity w hen
overexpressed in COS cells. We report here a close association
betw een the N314D polym orphism and the D uarte v arian t of
GALT. We suggest th at m olecular testing for N314D m ay be
useful to confirm a biochem ical diagnosis of D v ariant of GALT.
2.3 M ATERIALS AND M ETHODS
Patient m aterials
Subjects were diagnosed by standard biochem ical
m ethods using a quantitative enzym e assay and electrophoresis
to establish genotypes (Lee and Ng, 1982). Blood spots (applied
to "Guthrie cards") or purified genomic DNA were used as
polym erase chain reaction (PCR) tem plates. O ur sam ple
population includes Caucasian, Hispanic-American, an d African-
A m erican individuals.
PCR assay
A l-m m ^ sam ple from a blood spot or 0.1 jjg genom ic
DNA was am plified in a 100 (i reaction with 0.5 M g of each
p rim er (10-5’: GGGTTTGGGAGTAGGTGCT; 10-3':
GGGCAACAGAAGTATCAGGT; Appligene, Pleasanton, Calif.;
am plifying all of exon 10 in the nom enclature of Leslie et al..
12
1992) as follows: after an initial denaturation at 97°C for 5 m in,
prim ers were annealed for 10 sec a t 50°C, 1,5 units Taq DNA
polym erase (Promega, Madison, Wis.) was added, an d the
products were then extended for 5 m in at 72°C. Next, 40 cycles
consisting of denaturation for 1 m in at 94°C, annealing for 10
sec at 57°C, and extension for 40 sec at 72°C were perform ed in
an Ericomp Twinblock (San Diego, Calif.). Finally, the PCR
products were blunted for 5 m in at 72°C.
Ava II a$$ay
A 20 j l i I sam ple of the PCR reaction was m ixed w ith 2 ju l of
buffer C (Promega) and 2 units of Ava II (Promega) were
added. PCR products were digested overnight at 37°C an d then
analyzed on a 4% NuSieve 3: 1 agarose gel (FMC, Rockland, Me.).
2.4 RESULTS
We screened for N314D in our sam ple population by
scoring the fortuitously created Ava II restriction site. O ur PCR
procedure amplifies the entire exon 10 of the GALT gene
(Leslie et al.. 1992). This exon also contains a constant Ava II
site, which provides a convenient internal digestion control.
The newly created Ava II site on N314D chrom osom es can
easily be resolved by agarose gel electrophoresis (Fig. 1). All
13
N314D genotypes - norm al, heterozygote, and hom ozygote - can
be readily distinguished from each other (Fig. 1).
The d ata sum m arized in Table 1 dem onstrate th at the
N314D polym orphism was found on 34 of 35 different D uarte
alleles exam ined and was never found in electrophoretically
and biochem ically norm al controls (0/50). However, it was
som etim es present on classic galactosem ia alleles (4 /9 5 , Table
1). Sequencing of three independent D alleles did n o t reveal
any additional nucleotide substitutions in the entire GALT
coding region (data not shown).
2.5 DISCUSSION
O ur objective was to define the m olecular n atu re of the
D uarte variant of GALT. We decided to pursue a ’ ’candidate
m u tatio n ” approach by analogy to the candidate gene strategy
com m only used in hum an m olecular genetics. Accordingly, we
identified likely m utations or polym orphism s. We chose N314D
(R eichardt and Woo, 1991) as a ’ ’candidate m u tatio n ” because
the substitution of aspartate for asparagine-314 increases the
n et negative charge of the enzyme. Therefore, this protein
polym orphism could account for the increased m obility of the D
variant of GALT in native gels (M athai and Beutler, 1966; Ng
al.. 1969). N314D encodes substantial residual GALT activity
14
w hen overexpressed in COS m onkey cells (Reichardt and Woo,
1991).
The N314D polym orphism probably encodes the D uarte
v ariant because we detected N314D on 34 of 35 different D
alleles exam ined (Table 1, Fig. 1). We did, however, find one
discordant allele (Table 1). Reinspection of the biochem ical d ata
for the two affected heterozygous individuals from the sam e
fam ily suggested that this was n o t a "classical" D allele. The
GALT specific activity and the banding p attern were as
expected; however, the relative staining intensities of the
bands were abnorm al in these two probands. Thus, this allele
probably represents a novel GALT coding region of three
indep en d en t D alleles did not reveal any additional nucleotide
substitutions (data not shown).
O ur PCR and restriction digestion assay are quick an d
sim ple. Therefore, it should be readily adaptable to the clinical
laboratory and could be used to distinguish "classic" D alleles
from o th er sim ilar variants (see Table 1). For example,
D uarte/galactosem ia com pound heterozygotes are often
identified in new born screening program s. However, in general
they do not require treatm ent. Our assay could be used
routinely to confirm the presence of a suspected D allele in a
new born screening positive suspected of carrying one or two D
alleles based on biochem ical data.
15
We never observed N314D on biochem ically and
electrophoretically norm al alleles (Table 1). N314D was,
however, found occasionally in biochem ically and
electrophoretically untested "normal" people w ithout clinical
sym ptom s of galactosem ia (2/32 alleles; d ata not shown).
N314D, as a polym orphism , m ay be present on
electrophoretically an d enzym atically untested "normal" alleles
since the D uarte variant occurs with a frequency of about 5.5%
in the general population (Mathai and Beutler, 1966). We
suspect th at the two N314D-positive "normal" people we
identified am ong our untested, clinically unaffected population
are in fact unrecognized D carriers since N314D was p resen t in
the heterozygous state in both.
We propose that the D variant of GALT is encoded by a
previously described protein polym orphism , N314D. This
hypothesis is consistent with the following five observations.
First, the D variant is a structural m utation (M athai and
Beutler, 1966). Second, the increased negative charge im parted
by this protein polym orphism (asparagine-314 to aspartate) is
consistent w ith the increased electrophoretic m obility of the D
v arian t in native gels. Third, substantial GALT activity is
associated w ith N314D when it is overexpressed in COS cells
(R eichardt and Woo, 1991), which m ay account for som e of the
activity observed for the D variant. Fourth, the association of
N314D is very strong, and finally, no additional nucleotide
16
substitutions were found on three independent D alleles when
they were sequenced throughout their entire coding region. It
is also possible th at N314D is a m arker in linkage
disequilibrium w ith D. However, we do not favor this
alternative explanation of o ur data because of the five
argum ents presented above.
The hum an GALT enzym e is characterized by substantial
m icroheterogeneity: it separates into m ultiple bands upon
isoelectric focusing (IEF; Banroques et al.. 1981; Williams et al..
1982; Kelley et al.. 1983). Therefore, we have n o t attem pted to
com pare the N314D protein overexpressed in COS m onkey cells
to the D enzym e present in hum an erythrocytes.
We also found N314D on all five Los Angeles (LA) alleles
th at we exam ined (data not shown). This is an o th er GALT
enzym e variant w ith m obility in native gels sim ilar to D (Ng ££
al.. 1972). The specific activities of the D and LA variants in red
blood cells are, however, different (Ng et al.. 1972). Leslie et al..
1992 also reported an "association” betw een a few D, LA, and
"normal" alleles and the N314D polym orphism . D etailed
m olecular studies of the m olecular genetic basis of the LA
v ariant will be undertaken w hen m ore alleles becom e available
to us.
N314D was found on a few rare galactosem ia alleles
(Table 1). Galactosemia m utations m ay occur on an already
polym orphic background bearing N314D, or, alternatively,
17
N314D m ay be introduced by recom bination or gene conversion
onto a preexisting galactosemic chrom osom e. Furtherm ore,
since classical galactosemia m utations produce changes that
m arkedly im pair gene expression, the presence of N314D
w ould be m asked. Thus, N314D m ay be present on galactosem ic
chrom osom es but can n o t be detected biochem ically. This
finding, however, limits the usefulness of N314D for DNA
testing since N314D can also be associated with otherw ise
inactive galactosem ia alleles. Therefore, N314D m olecular
genetic testing should only be used to confirm a suspected D
v ariant diagnosis and can not substitute for initial biochem ical
screening an d work-up.
In sum m ary, we rep o rt here a simple, m olecular genetic,
PCR-based detection system for N314D th at we propose to
encode th e D uarte variant of GALT. We suggest th at m olecular
genetic testing for N314D be considered to confirm the
biochem ical diagnosis of the D variant of GALT, in particu lar to
distinguish "classic" D alleles from other sim ilar variants.
18
Table 1
Correlation of Galactose-1-Phosphate Uridyl transferase
(GALT) Biochemical Genotypes with the N314D
Polymorphism
Biochemical allele N314D polym orphism
D (Duarte) 34/35
N (norm al) 0 /5 0
G (Galactosemia) 4 /9 5
19
Figure 1: Screen for the N314D allele. DNA was am plified as
described in M aterials and M ethods, digested with Ava II and
subjected to agarose gel electrophoresis. The norm al allele is
cleaved into two bands of 215 (N314D) and 96 (constant). The
96-bp constant band is a convenient internal digestion control.
The polym orphic allele results in the introduction of a new Ava
II site in the upper band, which results in the appearance of
two closely spaced new bands of 111 and 104 bp (314D). These
two bands are n o t fully resolved in our gel system. N314D
denotes the norm al allele and 3 14D indicates the polym orphic
sequence. Lane 1 is an N314D hom ozygote, lanes 2 an d 3 are
heterozygotes, and lane 4 is norm al.
2 0
N314
314D
constant
21
2.6 REFERENCES
B anroques J, G regori C, S chapira F (1981) Purification and
characterization of hum an erythrocyte uridyltransferase.
Biochim. Biophys. Acta 657: 374-382.
B eutler E, B aluda MC (1966) Biochemical properties of
hu m an re d cell galactose-1-phosphate uridyltransferase (UDP
glucose: aD -galactose-1-phosphate uridyltransferase E. C. 2. 7.
7. 12) from norm al and m u tan t subjects. J. Lab. Clin. Med. 67:
947-954.
Flach JE, R eichardt JKV, Elsas I J (1990) Sequence of a
cDNA encoding hum an galactose-1-phosphate
uridyltransferase. Mol. Biol. Med. 7: 365-369.
Kelly RI, H arris H, M ellm an WJ (1983) C haracterization of
norm al and abnorm al variants of galactose-1-phosphate
uridyltransferase (EC 2. 7. 7. 12) by isoelectric focusing. Hum.
Genet. 63: 274-279.
Lee JES, Ng WG (1982) Semi-micro techniques for genotyping
of galactokinase and galactose-1-phosphate uridyltransferase.
Clin. Chim. Acta 124: 351-356.
Leslie ND, Im m erm an EB, Flach JE, Florez M, Fridovich-
Keil JL, Elsas IJ (1992) The hum an galactose-1-phosphate
uridyltransferase gene. Genomics 14: 474-480.
M athai CK, B eutler E (1966) Electrophoretic variation of
galactose-1-phosphate uridyltransferase. Science 154: 1179-
1180.
22
Ng WG, B ergren WR, Fields M, D onnell GN (1969) An
im proved electrophoretic procedure for galactose-1-phosphate
uridyltransferase: dem onstration of m ultiple activity bands
w ith the D uarte variant. Biochem. Biophys. Res. Commun. 37:
354-362.
Ng WG, B ergren WR, D onnell GN (1972) A new v ariant of
galactose-1-phosphate uridyltransferase in m an: the Los
Angeles variant. Ann. Hum. Genet. 37: 1-8.
R eich ard t JKV (1992) Genetic basis of galactosem ia. Hum.
M utat. 1: 190-196.
R eich ard t JKV, Berg P (1988) Cloning and characterization of
a cDNA encoding hum an galactose-1-phosphate
uridyltransferase. Mol. Biol. Med. 5: 107-122.
R eich ard t JKV, Woo SLC (1991) M olecular basis of
galactosem ia: m utations and polym orphism s in the gene
encoding hum an galactose-1-phosphate uridyltransferase. Proc.
Natl. Acad. Sci. USA 88: 2633-2637.
Segal S (1989) Disorders of galactose m etabolism . In: Scriver
CR, Beaudet AL, Sly WS, Valle D (eds) The m etabolic basis of
inh erited disease, 6th edn. McGraw-Hill, New York, p p 453-480.
Shin YS, N iederm eier HP, E ndres W, Schaub J,
W eidinger S (1987) Agarose gel isoelectrofocusing of UDP-
galactose pyrophosphorylase and galactose-1-phosphate
uridyltransferase: developm ental aspect of UDP-galactose
pyrophosphorylase Clin. Chim. Acta 166: 27-35.
23
W illiam s VP, H elm er GR, Fried C (1982) H um an galactose-
1-phosphate uridyltransferase: purification an d com parison of
the re d blood cell and placental enzymes. Arch. Biochem.
Biophys. 216: 503-511.
24
Chapter 3
Linkage Disequilibrium Between a Sac I Restriction
Fragment Length Polymorphism and Two Galactosemia
Mutations
25
Linkage Disequilibrium Between a Sac I Restriction
Fragment Length Polymorphism and two Galactosemia
Mutations
ACKNOW LEDGEM ENTS
I thank Pattie Tang (USC/Bravo Partnership) for
enthusiastic assistance and Drs. Richard Allen (Ann A rbor),
Daniel C ram er (Boston), Won Ng (Los Angeles) and Yoshiyuki
Okano (Osaka) for samples. Work in our laboratory is
supported in p a rt by a Basil O'Connor Award from the M arch of
Dimes (#5-FY93-0798). JKVR is also a Fellow of the Jam es
Zum berge Faculty Research and Innovation Fund at the
U niversity of Southern California.
26
3.1 ABSTRACT
We have identified a novel Sac I restriction fragm ent
length polym orphism (RFLP) in the hum an galactose-1-
phosphate uridyl transferase (GALT) gene. This RFLP can be
readily typed by the polym erase chain reaction (PCR). The
polym orphic allele is found on about 11 % of norm al
chrom osom es and is in linkage disequilibrium w ith the two
m ost com m on m utations identified in GALT thus far: Q188R
and N314D. Q188R is found exclusively on chrom osom es w ith
the Sac I restriction site while N314D is found only on
chrom osom es lacking this site. This suggests these two
m utations arose independently in evolution on different
chrom osom al backgrounds. Galactosemia patients w ithout the
Q188R m utation have a frequency of the Sac I polym orphism
sim ilar to norm al controls suggesting that several different
galactosem ia m utations m ust be present in them . The Sac I
RFLP will also be useful in the prenatal diagnosis of
galactosem ia.
27
3.2 INTRODUCTION
H um an galactose m etabolism involves three enzymes:
galactokinase (GALK), galactose-1-phosphate uridyl transferase
(GALT) an d UDP-galactose 4'-epim erase (GALE; Segal, 1989).
Deficiency of each one of these enzymes leads to elevated
levels of galactose and its m etabolites and is referred to as
galactosem ia. However, the m ost com m on form is secondary to
GALT-deficiency and, therefore, is often referred to as "classic"
galactosem ia (MIM 230400). Neonatal sym ptom s include
vom iting, diarrhea, failure to thrive, liver disease an d E.coli
sepsis (Segal, 1989). These sym ptom s resolve upo n the
institution of a galactose-restricted diet. Therefore, m ost US
states an d m any developed countries have im plem ented
new born screening program s for this m etabolic disorder. Long
term com plications, incl. variable neurologic deficits and
ovarian failure in women, persist in m ost patients despite
dietary therapy (Waggoner, Buist and Donnell, 1990).
A full-length cDNA and gene encoding h um an GALT have
been cloned, sequenced an d m apped to chrom osom e 9
(Reichardt and Berg, 1988; Flach, Reichardt an d Elsas, 1990;
Leslie et al.. 1992). Using these m olecular tools, a num ber of
m utations that cause transferase-deficiency galactosem ia have
been characterized (Reichardt, 1992). The m ost com m on
galactosem ia m utation described to date is Q188R (glutam ine-
188 to arginine) (Reichardt, Packman an d Woo, 1991; Leslie
28
al.. 1992). It accounts for over 60 % of all Caucasian
galactosem ia alleles and characterizes the severe "classic"
phenotype in Caucasian patients (Ng et al.. 1994). The N314D
m utation (asparagine-314 to aspartate; Reichardt an d Woo,
1991; Leslie et al.. 1992) encodes the "Duarte" (D) v ariant an d
possibly the "Los Angeles" (LA) variant of the GALT enzym e
(M athai an d Beutler, 1966; Ng, Bergren and Donnell, 1973; Lin
et al.. 1994). The high frequency of these two m utations, Q188R
and N314D, particularly in Caucasians led us to investigate
th eir genetic origin. The two m utations could have a) arisen
repeatedly as recurring m utations or b) could have occurred
once an d expanded subsequently. The linkage disequilibrium
d ata presented in this pap er supports the second hypothesis.
29
3.3 MATERIALS AND METHODS
PCR Am plification
O ur sam ples have been described previously (Lin et al..
1994; Ng et al.. 1994). Briefly, they include African-American,
Asian, Caucasian and Latino patients and their biochem ical and
m olecular genotypes have been determ ined. PCR (polym erase
chain reaction) tem plates included purified genom ic DNA an d
"Guthrie" cards (bloodspots). PCR am plification of exon 6 and
flanking intronic sequences of the hum an GALT gene was
prim ed w ith the previously reported oligonucleotides was as
described (Ng et al.. 1994). A single m odification was
introduced into our PCR protocol: Taq DNA polym erase was
purchased from Life Technologies (G aithersburg, MD).
Sac I Assay
20 i^l of PCR-amplified m aterial were mixed w ith 2 \xl
buffer A (Boehringer M annhein; Indianapolis, IN) an d 1 u Sac I
from the sam e m anufacturer. Digests were incubated overnight
at 37°C an d then electrophoresed on analytical 4 % NuSieve 3:1
agarose gel (FMC, Rockland, ME).
30
3.4 RESU LTS AND DISCUSSION
The entire exon 6 of the hum an GALT gene an d its
surrounding intronic sequences were PCR-amplified as
described (Ng et al.. 1994). While sequencing several
galactosem ia patients in this region we discovered a recurring
G to A transition at nucleotide 1391 of the hum an GALT gene
(Leslie et al.. 1992). This substitution is located in in tro n E
rem oved from any splicing consensus sequences (Shapiro and
Senapathy, 1987). This transition abolishes the norm al Sac I
restriction site present in this intron (Leslie et al.. 1992)
resulting in a RFLP. Our PCR-amplification p roduct of exon 6
an d its surrounding sequences is 185 bp long and can be typed
easily for the Sac I RFLP. Amplified exon 6 DNA is norm ally
cleaved into two bands of 125 and 60 bp if digested w ith Sac I
(Sac I +). The polym orphic product, however, is refractory to
Sac I digestion (185 bp; Sac I-). All possible genotypes -Sac I
+/+ hom ozygotes, Sac I +/- heterozygotes an d Sac I-/-
hom ozygotes- can be easily distinguished by scoring the
respective diagnostic bands (Fig. 1).
We have exam ined a variety of sam ples th at included
galactosem ia and "normal" (i.e., non-galactosem ic) alleles for
the frequency of this novel Sac I RFLP. We first concentrated
on the relationship betw een the two galactosem ia m ost
com m on m utations in Caucasians -Q188R an d N314D- an d the
31
Sac I RFLP. The Sac I site was present (Sac I +) on all 37
galactosem ic chrom osom es bearing the Q188R m utation th at we
exam ined. In contrast, this site was absent on all of the 24
chrom osom es with the N314D m utation th at we typed (Sac I
Table 1). The N314D alleles included 21 D uarte (D; M athai and
Beutler, 1966) and 3 Los Angeles (LA; Ng, Bergren and Donnell,
1973) variants. This data confirm s the previously rep o rted
m olecular genetic sim ilarity of the D and LA variants of GALT
(Lin et al.. 1994). Furtherm ore, the Q188R and N314D GALT
m utations are in linkage disequilibrium w ith presence o r
absence of the Sac I restriction site respectively. Therefore,
these two m utations arose independently on different
chrom osom al backgrounds and probably only once in evolution.
T heir expansion -particularly am ong Caucasian individuals-
m ay be due to a) a founder effect, b) genetic drift a n d /o r c)
positive selection (e.g., through heterozygote advantage;
Zlotogora, 1994). Future studies m ay address these three
intriguing possibilities. We also exam ined several Asian
sam ples available to us. Presence of the Sac I (Sac I +) RFLP
was detected on all of the 20 norm al Taiwanese, 11
galactosem ic Japanese (which are all not-Q188R) an d 4 norm al
Japanese chrom osom es that we studied.
We found the restriction site to be absent (Sac I -) on 5 of
47 galactosem ia chrom osom es w ithout the Q188R m utation th at
we screened (Table 1). This suggests th at at least two
32
different galactosem ia m utations m ust be presen t in Q188R
negative galactosem ia patients since the Sac I polym orphism
can be either present or absent in this patient group. Absence
of the Sac I site (Sac I-), the polym orphic allele, was found on
14 of the 132 non-galactosem ic ("norm al") Caucasian
chrom osom es exam ined (11 %; Table 1). The n u m b er of
asym ptom atic D and LA carriers in o u r "normal" population is
unknow n since these individuals are defined solely by the
absence of the clinical sym ptom s of galactosemia. It is
notew orthy th at the Sac I RFLP occurs in "normal" an d non-
Q18 8R galactosemic individuals with the identical frequency of
11 % (Table). This suggests th at these as of yet uncharacterized
galactosem ia m utations arose after establishm ent of the Sac I
polym orphism in hum ans.
We have also genotyped a lim ited num ber of sam ples
from Asian individuals (Ashino et al.. subm itted; Lin et al..
unpublished). The Sac I (Sac I-) RFLP was n o t detected on any
of the 20 norm al Taiwanese, 11 galactosemic Japanese (which
do n o t bear the Q188R m utation) and 4 norm al Japanese alleles
th at we studied (this d ata was included in Table 1). The Sac I-
RFLP was found on the D uarte allele encoded by the N314D
m utation in a Japanese patient (Ashino et al.. subm itted).
Finally, the D uarte and N314D GALT alleles were p resen t on the
sam e Sac I- chrom osom e in a Chinese fam ily exactly as in
Caucasian individuals (cf. Table 1) (Lin et al.. unpublished). This
33
small d ata set suggests that the D uarte and N314D GALT alleles
arose on a single Sac I- chrom osom e before Asian (particularly
Chinese and Japanese) and Caucasian people diverged. Thus,
both the N314D GALT m utation and the Sac I RFLP in the
hum an GALT gene appear to be ancient genetic variations.
However, m ore Asian (and other non-Caucasian) patients will
have to be exam ined to confirm these two im portant
propositions. The D and LA variants of GALT are rare in
African-American an d Chinese people (Ng, Bergren an d Donnell,
1973; Xu and Ng, 1983) which will m ake additional
investigations difficult.
In sum m ary, we have identified the first RFLP described
in the hum an GALT gene. It abolishes a Sac I restriction site in
in tro n E (Sac I -) and can be easily typed by PCR. Presence of
the norm al site is associated with the com m on Q188R
galactosem ia m utation in Caucasian while absence of this site
is found on N314D chrom osom es. Thus, the Q188R and N314D
GALT m utations are in linkage disequilibrium with different
Sac I RFLP alleles. Linkage betw een the N314D GALT m utation
and the Sac I RFLP exists in Asian and Caucasian patients. This
d ata suggests th at the Q188R and N314D galactosem ia
m utations arose independently and probably only once in
evolution. Patients with uncharacterized galactosem ia
m utations have the "normal" frequency of the Sac I RFLP.
34
Therefore, RFLP analysis could be used in the p ren atal
diagnosis of galactosem ia in inform ative families. Finally,
m ultiple galactosem ia m utations m ust exist in patients w ithout
the com m on Caucasian Q188R m utation.
35
Table 1
Frequency of the Sac I R F L P in Various Populations
Chrom osom e Sac I - Sac I + Frequency
norm al (non-galactosemic; n=132) 14 118 11%
Q18 8R (galactosemic; n= 37) 0 37 0 %
N314D (D&LA; n=24) 24 0 100%
non-Q188R galactosemic (n=47) 5 42 11 %
36
Figure 1: Detection of the Sac I polym orphism by PCR.
Lanes 1 is m arker. Lanes 2, 3 and 4 are restriction digests
of PCR-amplified m aterial from hom ozygous Sac I +/+,
heterozygous Sac I +/- and hom ozygous Sac I -/- individuals
respectively. The positions of the diagnostic bands are
indicated by arrows next to them .
Sac I
Sac I
38
3.5 REFERENCES
Flach JE, R eichardt JKV, Elsas LJ (1990) Sequence of a
cDNA encoding Hum an Galactose-1-phosphate Uridyl
Transferase. Molec. Biol. Med. Z, 365-369.
Leslie ND, Im m erm an EB., Flach JE, Florez M,
Fridovich-K eil JL, Elsas LJ (1992) The H um an Galactose-1-
p h osphate UridylTransferase Gene. Genomics 14, 474-480.
Lin H-C, K irby LT, Ng WG, R eichardt JKV (1994) On the
M olecular N ature of the D uarte V ariant of Galactose-1-
phosphate Uridyl Transferase (GALT). Hum. Genet. 22, 167-
169.
M athai CM, B eutler E (1966) Electrophoretic V ariation of
G alactose-1-phosphate Uridyl Transferase. Science 154. 1179-
1180.
Ng WG, B ergren WR, D onnell GN (1973) A New V ariant of
G alactose-1-phosphate U ridyltransferase in Man: The Los
Angeles V ariant. Ann. Hum. Genet. 2Z, 1-8.
Ng WG, Xu Y-K, W olf JA, A llen RA, R eichardt, JKV
(1994) Biochemical an d M olecular Analysis of 132 Galactosem ia
Patients. Hum. Genet, in press
R eich ard t JKV, Berg P (1988) Cloning an d C haracterization
of a cDNA Encoding Hum an Galactose-1-phosphate Uridyl
Transferase. Molec. Biol. Med. 5., 107-122.
R eich ard t JKV, Woo SLC (1991) M olecular Basis of
Galactosemia: M utations and Polym orphism s in the Gene
39
Encoding Hum an Galactose-1-phosphate U ridyltransferase.
Proc. Natl. Acad. Sci. USA 88.2633-2637.
R eichardt, JKV, Packm an S, Woo SLC (1991) M olecular
C haracterization of Two Galactosemia M utations: C orrelation of
M utations w ith Highly Conserved Domains in G alactose-1-
p h osphate Uridyl Transferase. Am. J. Hum. Genet. 42, 860-867.
R eich ard t JKV (1992) Genetic Basis of Galactosemia. Hum.
Mut. 1, 190-196.
Segal S (1989) Disorders of Galactose M etabolism in The
M etabolic Basis of Inherited Disease. New York, NY: McGraw-
Hill, 453-480.
S hapiro MB, S en ap ath y P (1987) RNA Splice Junctions of
Different Classes of Eukaryotes: Sequence Statistics and
Functional Im plications in Gene Expression. Nucl. Acids Res. JJj>,
7155-7174.
W aggoner, DD, NRM Buist a n d GN D onnell (1990) Long-
Term Prognosis in Galactosemia: Results of a Survey of 350
Cases. J. Inher. Metabol. Dis. 12, 802-818.
Xu Y-K, Ng WG (1983) Polym orphism of Erythrocyte
G alactose-1-phosphate U ridyltransferase Among Chinese. Hum.
Genet. £2, 280-282.
Z lotogora J (1994) High Frequency of Hum an Genetic Disease:
Founder Effect w ith Genetic Drift? Am. J. Med. Gen. 42, 10-13.
40
Chapter 4
Molecular Characterization of Galactosemia Mutations
(type 1) in Japanese
41
Molecular Characterization of Galactosemia Mutations
(type 1) in Japanese
ACKNOW LEDGEM ENTS
This work was supported by the grants from the
M orinaga Housikai (YO), the M inistry of Education, Science and
C ulture Japan (GI), the March of Dimes (JKVR), the Betty Lou
W arren Research Fund (JKVR), and the Jam es H. Zum berge
Faculty an d Innovation Fund at University of S outhern
California (JKVR).
42
4.1 ABSTRACT
We characterized a m issense an d a novel splicing
m utation of the galactose-1-phosphate uridyltransferase
(GALT) gene in two Japanese patients w ith GALT deficiency,
and identified N314D and R333W m utations, w hich was found
in Caucasians. The m issense m utation was a G to A transition in
exon 8, resulting in the substitution of Arg by His at the codon
231 (R231H). The GALT activity of the R231H m u tan t construct
was reduced to 15% of norm al controls in a COS cell expression
system. The splicing m utation was an A to G transition at the
38th nucleotide in exon 3 (318A— G), resulting in a 38 bp
deletion of GALT cDNA in exon 3 for a cryptic splice acceptor
site. In seven Japanese families (14 alleles for classic form and
one allele for D uarte variant) w ith GALT deficiency, the R231H
and 318A--G m utations were found only in both alleles of each
proband. N314D and R333W m utations were found in each of
one allele. The Q188R m utation was n o t found in Japanese
patients, although this m utation is prevalent in the U nited
States. The N314D m utation is associated w ith the D uarte
variant in Japanese as well as in Caucasians, an d the new
m utations are associated w ith classic transferase deficiency
galactosem ia.
43
4.2 INTRODUCTION
Classic transferase deficiency galactosem ia is an
autosom al recessive genetic disorder caused by a deficiency of
galactose-1-phosphate uridyl transferase (GALT) (Segal, 1989)
w ith an incidence of 1: 60,000 in the U nited States (Levy and
Ham m ersen, 1978) and 1: 1,000,000 in Japan (Aoki an d W ada,
1988). The disease causes neonatal jaundice, cataracts,
hepatom egaly, failure to thrive, and even neonatal death,
unless the patient is rigorously m aintained on a lactose-free
diet. M any developed countries have instituted new born
screening program s for galactosemia.
The study of galactosem ia at the m olecular level began
w ith cloning and characterization of the hum an GALT cDNA
(R eichardt and Berg, 1988 Flach et al.. 1990a). The entire gene
for h um an GALT has been characterized by Leslie et al.. 1992.
More th an 10 m issense and splicing m utations have been
identified in Caucasian and African-Americans (Flach et al..
1990b; Reichardt et al.. 1991a, 1991b, 1992b, 1992c). The
relationship betw een genotype an d clinical phenotype has been
exam ined in Caucasians. The Q188R m utation, w hich is the m ost
prevalent, and several other m utations have been associated
w ith classic transferase deficiency galactosem ia (Reichardt,
1992a). The N314D m utation has shown overexpression in a
COS cell system , and has been seen in a m ild clinical phenotype
of the D uarte and Los Angeles Variants (Lin et al.. 1994).
44
However, GALT m utations have n o t been identified in O rientals
an d are suspected to be different m utations from those found
in Caucasians in part, because m olecular analysis of o th er
inh erited m etabolic disorders has revealed different m utations
(Okano et al.. 1992). In addition, the frequency of the classic
transferase deficiency galactosem ia an d the D uarte v arian t in
Japan is 1 /2 0 less than that in the United States (Levy an d
H am m ersen, 1978; Aoki and Wada, 1988). We rep o rt here a
novel m issense m utation and a novel splicing m utation in two
Japanese patients with classic transferase deficiency
galactosem ia and the distribution of N314D, Q188R, and R333W
m utations in seven Japanese families.
4.3 PATIENTS AND M ETHODS
Patient?
Patients 1 and 2 were identified w ith typical sym ptom s
of galactosem ia and were diagnosed with classic transferase
deficiency galactosem ia by having less than 1% of norm al
erythrocyte GALT activity. Patient 1 was non consanguineous,
b u t b o th parents came from Okinawa island, and p atien t 2 was
consanguineous. Seven other Japanese patients (five families)
w ere identified through the Japanese Regional Newborn
Screening Program , showing abnorm ally low GALT activity. In
one family, the elder sister had the phenotype of D uarte
variant/C lassic transferase deficiency galactosem ia (D/G) and
45
showed 20% of norm al GALT activity. The younger sister h ad
the G/G phenotype, and showed less th an 1% activity.
PCR am plification and sequence analysis of GALT cDNA
Total RNA was isolated from lym phoblasts transform ed
w ith Epstein-Barr virus using the acid guanidium
isothiocyanate/phenol/chloroform extraction m ethod
(Chomczynski and Sacchi, 1987). For cDNA synthesis, 20giof
total RNA was reverse transcribed by using oligo (dT) 12-18
(Pharm acia LKB Biotechnology Inc.) and 30 units of avian
m yeloblastosis virus reverse transcriptase (Life Science) as
described elsewhere (Kobayashi et al.. 1990). The GALT coding
region was am plified w ith prim ers hG5-19 (5'-
TTTTTCCAGCGGATCCCCC-3'), hG3-23 (5'-
CTTAATTCAGCAAGACTGTTGAA), 1 mM each dNTP, 4 units of
the Taq DNA polym erase (TOYOBO) and 10X reaction buffer
(TOYOBO) by 35 cycles at 94°C for 80 sec, 50°C for 120 sec, 72°C
foe 180 sec in a therm al sequencer (Iwaki). Amplified products
were purified by elution from 1.2% low m elting tem perature
agarose gel, treated with blunting kits (Takara), an d digested
w ith Xho-1. Both 5 f- and 3'-fragm ents were subcloned into
M 13m pl9 w ith Sma-1 and Sal-1 sites. More th an five clones
for each fragm ent were sequenced with universal and specific
oligonucleotide prim ers for the GALT sequence using a
Sequenase DNA sequencing kit (USB). Genome DNA sequencing
46
Genomic DNA was isolated from lym phoblasts of Japanese
patients w ith GALT deficiency. The exons 3 to 5 and their
flanking in tro n region of the GALT genom e DNA were am plified
w ith prim ers (5'- TGGGTCATATCCCACCAAGC -3’) and (51 -
TGGAAACAGAAATGTTACTCC -3’) by PCR as described above.
Am plified DNA was purified by elution from 2% low m elting
tem perature agarose gel and recovered using Gene-Clean kit
(Bio 101). The purified DNA was digested with Hind III and
subcloned into pUC 18 and sequenced w ith specific prim er foe
in tro n 3.
Expression analysis
Part (439 base pairs) of the m u tan t GALT cDNA including
the R231H m utation was rem oved from the M 13m pl9 m u tan t
GALT cDNA by digesting with Bgl II and Pvu II sites of PJR16
GALT, a m am m alian expression vector containing norm al GALT
cDNA. The m u tan t and norm al PJR16 were introduced into
m onkey-kidney COS cells in a m ixture of 20 mM HEPES, pH
7.05, 137 mM NaCl, 5 mM KC1, 0.7 mM Na2HP04, and 6 mM
dextrose by electroporation with a Gene Pulser (Bio-Rad) at
200V w ith 960 |iF capacitance. After 72 hours of culture, the
cells were harvested, and the GALT mRNA and GALT activity
were determ ined in cellular extracts. GALT mRNA levels in
cellular extracts were determ ined by dot-blot hybridization for
serially diluted RNA samples using a GALT cDNA probe labeled
47
w ith [ a-32p ] dCTP (Du-Point-NEN) by M egaprime DNA
labeling system s (Amershasm). GALT activity was determ ined
by GALT assay kits (Sigma) with nicotinam ide adenine
dinucleotidase.
ASO hybridization an d restriction enzym e assay
The am plified DNA samples were d en atu red an d applied
on Gene Screen nylon m em branes (NEN) with a dot-blot
m anifold (Schleicher & Schuell), and were hybridized w ith
allele-specific oligonucleotide probes labeled w ith 32p fQ r the
norm al alleles (5T - CCTAGGAACGTCTGGTCCT -3T for R231H
m utation, 5 T - TGTTTGACAACGACTTCCC -3T for 318A--G
m utation) and m u tan t alleles (5'- CCTAGGAACATCTGGTCCT -3T
for R231H m utation, 5T - TGTTTGACAGCGACTTCCC -3T for 318A -
G m utation), as described elsewhere (DiLella et al.. 1988).
Q188R, N314D, and R333W m utations w ere detected by
digesting w ith restriction enzym e after PCR. For the Q188R
m utation, PCR-amplified product of exon 6 were digested w ith
Hpa II. For the N314D m utation, PCR am plification of exon 10
was digested w ith Ava II (Lin et al.. 1994), and for R333W
m utation, exon 10 was digested w ith Hpa II.
48
4.4 RESULTS
Identification of a m issense m utation in patient 1
In p atien t 1, we detected a m issense m utation (G to A
transition) at nucleotide 720 of the GALT cDNA in 3'-
fragm ents of GALT cDNA, resulting in the substitution of
arginine by histidine at codon 231 (R231H) (Fig. 1). This
m utation was present in all five independent clones. The
sequence of 5'- fragm ents of GALT cDNA in all five
in d ep en d en t clones was the sam e as th at of healthy controls.
The results indicated the hom ozygous n atu re of this m utation
in p atien t 1. To determ ine w hether the R231H m utation caused
galactosem ia, expression analysis was perform ed in COS cells.
In dot-blot hybridization of serially diluted RNA from
transfected cells, mRNA levels of the norm al GALT cDNA
constructs expressed 1.5 times the mRNA level of m u tan t GALT
cDNA constructs. The GALT activity of the m u tan t p rotein was
10% of the norm al GALT. The GALT activity of the R231H
m u tan t constructs in the COS cell expression system was 15% of
the norm al control after correcting for the efficiency of
transfection into COS cells (Table 1).
Identification of a splicing m utation in p atien t 2
In patient 2, the m utation was a 38 bp deletion from
nucleotide 281 to 318 of the GALT cDNA by sequencing 5'-
49
fragm ents of GALT cDNA in all six independent clones (Fig. 2).
This deletion is located from nucleotide 1 to 38 in exon 3 of
GALT genomic DNA. The sequence of 3 fragments of GALT
cDNA in all six independent clones was norm al. Therefore, this
was a hom ozygous m utation in patient 2. To identify the
m olecular defect in the genomic DNA, we sequenced exon 3
and the flanking intron regions of the GALT genom ic DNA. We
found an A to G transition at the 38th base in exon 3 (318A--
G), which produced a new cryptic splice acceptor site (AA— AG)
and caused the first 38 bp deletion in exon 3 in GALT cDNA
(Fig. 3).
Frequency of galactosemic m utations in Tapanese
Dot-blot hybridization for R231H and 318A— G m utations
was perform ed on seven Japanese GALT families (15 alleles).
The R231H m utation was found only in both alleles of p atien t
1, an d the 3 18A--G m utation was found only in b o th alleles of
p atien t 2. Digestion w ith restriction enzymes for Q188R, N314D,
and R333W m utations was also perform ed. The Q188R
m utation was n o t identified, and the R333W m utation was
found in one allele. N314D was identified in one allele of the
elder sister w ith 20% GALT activity but was n o t found in the
younger sister w ith less than 1% GALT activity.
50
4.5 DISCUSSION
Eight m issense m utations, three splicing m utations, an d
three polym orphism s have been identified in Caucasians an d
African-Americans with transferase deficiency galactosem ia
(Reichardt, 1992a). Five of 14 nucleotide substitutions w ere in
CpG dinucleotides, which are known to be high frequency
m utation sites in hum an genetic disease (Cooper and
Youssoufian, 1988). The R231H m utation was CGT (Arg) to CAT
(His) transition at nucleotide 720 of the GALT gene an d also
occurred at the CpG dinucleotides. Furtherm ore, this R231H
m utation was form ed from a conserved dom ain in the
hom ologous enzym e from E.coli, yeast, an d hum ans (Tajim a £l
al.. 1985; Lemaire and Mueller-Hill, 1986). In expression
analysis of the R231H m utation, the GALT activity of the
m u tan t protein was 15% of the norm al GALT protein.
Interestingly, GALT activity of erythrocytes in p atien t 1 w ith
the genotype of R231H/R231H was less than 1% of healthy
controls. The reasons for the discrepancy betw een the GALT
activity in COS cells and that in erythrocytes are n o t clear. It is
likely that, there are some differences in the regulation of the
GALT gene an d in posttranscriptional regulatory properties of
the two systems. The Q188R m utation which was m ost
prevalent in Caucasian patients with classic transferase
deficiency galactosem ia showed about 10% of the control GALT
activity in the COS cell expression system. Similarly, GALT
51
activity of erythrocytes from patients with the hom ozygous
Q188R m utation was less than 1% of controls (R eichardt et al..
1991a). It also has been reported that phenylalanine
hydroxylase activity in the COS cell expression system is higher
th an activity observed in the liver of patients w ith
phenylketonuria (Okano et al.. 1991). Thus, the COS cell
expression system m ay result in overestim ation of the level of
activity of certain m u tan t enzymes. We concluded that the
R231H m utation was the cause of the reduced GALT enzym e
activity and resulted in galactosemia.
We identified the 38 bp deletion in exon 3 by GALT cDNA
analysis and the A to G transition at nucleotide 38 in exon 3 by
genom ic DNA analysis. This m utation produced a cryptic splice
acceptor site (AG) an d caused the skipping of the first 38 bp in
exon 3. Shapio and Senapathy (1987) have rep o rted a splicing
score system at 3' splice acceptor sites with nucleotides of
CAGG an d pyrim idine tract. The score at the original splice
acceptor site in in tro n 2 was 78.4. whereas the score at the
novel cryptic splice acceptor site in exon 3 was 87.6 (Fig. 4).
F urtherm ore, the splicing m utation of 318A--G produced a
fram e shift, which subsequently caused a stop codon (TGA) at
the eighth am ino acid from the point of codon shift. This GALT
p rotein of 318A--G m utation was constructed w ith 92 am ino
acids com pared with the norm al 379 am ino acids. Patient 2,
w ith the genotype of 318A--G/318A-G, showed classic
52
transferase deficiency galactosem ia an d less than 1% of
erythrocyte GALT activity. This 318A--G m utation reduced the
GALT enzym e activity and caused classic galactosemia. The
Q188R, N314D, and R333W m utations which were identified in
Caucasians were analyzed in Japanese patients w ith GALT
deficiency. It has been generally reported that m utations w hich
cause in inherited m etabolic disorders are different am ong
different races, whereas when m utations are in CpG
dinucleotides, the m utation is recurrent am ong different races.
In fact, the Q188R m utation is not found in Japanese, despite
Q188R being the m ost prevalent m utation in the U S, w here the
frequency has been reported to be 25% to 66% (Reichardt et al..
1991a; Leslie et al.. 1992). The R333W m utation in CpG
dinucleotides was found in one allele in Japanese patients,
despite R333W being a less frequent m utation (1 out of 20
alleles) in the U S (Reichardt et al.. 1991a). The N314D m utation
has been recognized by polym orphism , since the GALT activity
of the m utation in COS cells was 129% of the control (R eichardt
an d Woo, 1991b). Lin et al.. 1994 have found the N314D
m utation in 34 of 35 different D uarte alleles exam ined, and
suggested th at the N314D m utation encodes the D uarte v ariant
of GALT. We detected the N314D m utation in one allele from
the sister w ith D/G phenotype. The N314D m utation is n o t in
CpG dinucleotides, and it is not clear w hether N314D occurred
53
originally in Japanese patients. However, the N314D m utation
m ay be com m on for D uarte variant in o th er populations.
Finally, the R231H and 318A--G m utations, newly
identified in Japanese patients, were found in both alleles of
each proband. The N314D and R333w m utations identified in
Caucasians were found in each of one allele. We detected 6 of
15 alleles (40%) in Japanese patients with GALT deficiency.
Thus, it appears th at transferase deficiency galactosem ia in
Japan is caused by different m utations than those in the U S.
54
Table 1
Expression analysis of R231H mutation
GALT
activity
(units/m g
of protein)
mRNA
(cpm)
^Percent of
norm al GALT
activity
Mock 18.2 237 0
Normal 111.3 17433 100
M utant 27.3 13107 15
Mock shows crude extracts of COS cells. * The values
reflect corrections of the GALT activity of Mock and the
efficiency of transfection into COS cells.
55
Figure 1: 3'- fragm ents of GALT cDNA of patien t 1 an d control
were sequenced w ith specific oligonucleotide p rim er (51 -
CATGATGGAGGCTAGAT -31 ). Both norm al and m u tan t sequences
were ru n in parallel and shown side by side. The m u tan t
sequence showed a G to A transition at nucleotide 720 of the
GALT cDNA, resulting in the substitution of arginine by
histidine at codon 231 (R231H). The arrow denotes the position
of R231H m utation.
56
N orm al M utant
GATC GATC
Arg2 3 1
N o rm a i 5 ’ -AAGGAACGTC TG G TC -31
M utant 5 ’ ------------CAT------------ 3 ’
H i s
57
Figure 2: 5f- fragm ents of GALT cDNA of p atien t 2 an d healthy
control were sequenced w ith universal prim er (5f-
GTTTCCCAGTCACGAC -3f). Both norm al and m u tan t sequences
were ru n in parallel and shown side by side. The m u tan t
sequence showed a 38 bp deletion from nucleotide 281 to 318
of the GALT cDNA. The deletion was located from nucleotide 1
to 38 in exon 3 of GALT genomic DNA.
58
Normal 5
M u ta n t 5
Normal M u ta n t
G A T C G A T C
i i
■ - gg agagotcaatccc- - - ^
’ _________ GGAGAG-CGACTT-------------------- 3'
59
Figure 3: The subcloned genomic DNA in exon 3 to 5 o r in
in tro n 2 to 5 was sequenced with specific oligonucleotide
p rim er (5T - TATCACTCTCTGCAGCAG -3') in in tro n 3. Both
norm al and m u tan t sequences were ru n in parallel an d shown
side by side. M utant sequence showed an A to G transition at
the 38th base in exon 3 (318A--G). The arrow s denote the
position of 318A— G m utation.
60
N o rm a l M u t a n t
G AT C G A T C
N o rm al 5 ’ -TTTGACAACGACTTC-3'
M u t a n t 5 ’ ----------- AG------------- 3 ’
61
Figure4: Consensus sequence shows base arrangem ent in 3'
splice acceptor site. (Y: pyrim idine, N: any base, %: Frequency of
occurrence). Normal genomic DNA shows the sequence of the
splice acceptor site of exon 3 and upstream in the GALT
genom ic DNA of the control. The m utant genomic DNA shows
the sequence of the cryptic splice acceptor site in exon 3 an d
the upstream site in the GALT genomic DNA of 318A— G
m utation.
62
Consensus -14-13-12-11-10-9 -8 -7 -6 -5-4 -3 -2 -1 +1
Sequence Y Y Y Y Y Y Y Y Y Y N C A G G
% 76 78 82 86 82 79 75 73 87 86 74 100 100 49
Normal 5 ' Intron 2 11 Exon 3
genomic DNA A T C C T T G T C G G T A G G T G A A
Mutant A
genomic DNA T T C C T G T T T G A C G A C T
+38
5' Exon 3------------------------------------------------
63
4.6 REFERENCES
Aoki K, W ada Y (1988) Outcome of the patients detected by
new born screening in Japan. Acta. Paediatr. Jpn. 30: 429-434.
C hom czynski P, Sacchi N (1987) Single-step m ethod of RNA
isolation by acid guanidiunium thiocyanate-phenol-chloroform
extraction. Anal. Biochem. 162: 156-159.
C ooper DN, Y oussoufian H (1989) The CpG dinucleotide and
hu m an genetic disease. Hum. Genet. 78: 151-155.
DiLella AG, H uang W-M, Woo SLC (1988) Screening for
phenylketonuria m utations by DNA am plification w ith the
polym erase chain reaction. Lancet 5: 497-499.
Flach JE, R eichardt JKV, Elsas LJ (1990a) Sequence of cDNA
encoding hum an galactose-1-phosphate uridyltransferase. Mol.
Biol. Med. 7: 365-369.
Flach JE, D em bure P, Elsas LJ (1990b) Transferase
deficiency galactosemia: a m olecular analysis. Am. J. Hum.
Genet. 47: A155.
K obayashi K, Jackson MJ, Tick DB, O 'Brien WE, B eaudet
AL (1990) H eterogeneity of m utations in arginiosuccinate
synthetase causing hum an citrullinem ia. L. Biol. Chem. 265:
11361-11367.
L em aire HG, M ueller-Hill B (1986) Nucleotide sequence for
the gal E and gal T gene of E.coli. Nucl. Acids. Res. 14: 7705-
7711.
64
Leslie ND, Im m erm an EB, Flach JE, Florez M, F ridovich-
Keil JL, Elsas LJ (1992) The hum an galactose-1-phosphate
uridyltransferase gene. Genomics. 14: 474-480.
Levy HL, H am m ersen G (1978) Newborn screening for
galactosem ia and other galactose m etabolic defect. J. Pediatr.
92: 871-877.
Lin H-C, K irby LT, Ng WG, R eichardt JKV (1994) On the
m olecular n atu re of the D uarte variant of galactose-1-
phosphate uridyltransferase (GALT). Hum. Genet. 93: 167-169.
O kano Y, E isensm ith RC, G uttler F, Lichter-K onechi U,
K onechi DS, Trefz FK, D asovich M, W ang T, H enriksen K,
Lou H, W oo SLC (1991) Molecular basis of phenotypic
heterogeneity in phenylketonuria. N. Eng. J. Med. 324: 1232-
1238.
O kano Y, Hase Y, Lee D-H, F uruyam a J-I, S hintaku H,
O ura T, Isshiki G (1992) Frequency of distribution of
phenylketonuric m utations in Orientals. Hum. Mu tat. 1: 216-
220.
R eich ard t JKV, Berg P (1988) Cloning and characterization of
a cDNA encoding hum an galactose-1-phosphate
uridyltransferase. Mol. Biol. Med. 5: 107-122.
R eich ard t JKV, Packm an S, Woo SLC (1991a) M olecular
characterization of two galactosem ia m utations: C orrelation of
m utations with highly conserved dom ains in galactose-1-
phosphate uridyltransferase. Am. J. Hum. Genet. 49: 860-867.
65
R eich ard t JKV, Woo SLC (1991b) M olecular basis of
galactosem ia: M utations and polym orphism s in the gene
encoding hum an galactose-1-phosphate uridyltransferase. Proc.
Natl. Acad. Sci. USA. 88: 2633-2637.
R eich ard t JKV (1992a) Genetic basis of galactosem ia. Hum.
M utat. 1: 190-196.
R eich ard t JKV, Belm ont JW, Levy HL, Woo SLC (1992b)
C haracterization of two missense m utations in hum an
galactose-1-phosphate uridyltransferase: D ifferent m olecular
m echanism s in galactosemia. Genomics 12: 596-600.
R eich ard t JKV, Levy HL, Woo SLC (1992c) M olecular
characterization of two galactosemia m utations an d one
polym orphism : Im plications for structure-function analysis of
hu m an galactose-1-phosphate uridyltransferase. Biochemistry.
31: 5430-5433.
Segal S (1989) Disorders of galactose m etabolism . In: Scriver
CR, Beaudet AL, Sly WS, Valle D (eds) The m etabolic basis of
inherited disease. McGraw-Hill Co., New York,: 453-480.
S hapio MB, S en ap ath y P (1987) RNA splicing junctions of
different classes of eukaryotes: sequence statistics and
functional im plications in gene expression. Nucl. Acids. Res. 15:
7155-7174.
T ajim a M, Nogi Y, Fukasaw a T (1985) Prim ary structure of
the Saccharom yces cerevisiae GAL 7 gene. Yeast 1: 67-77.
66
C h ap ter 5
C onclusion an d D iscussion
67
CONCLUSION AND DISCUSSION
5.1 W ork in Progress
This thesis described m y research work in the study of
m olecular characterization of GALT at the m olecular genetic
level. I have sum m arized the knowledge obtained from the
experim ental d ata described in the previous chapters
concerning GALT, including the m olecular n atu re of the D uarte
v ariant of GALT, linkage disequilibrium betw een a Sac I RFLP
and two galactosem ia m utations, and identified novel
m utations in Japanese patients.
A "candidate m utation", N314D, was chosen because the
substitution of aspartate for asparagine-314 increases the net
negative charge of the enzyme. Hence, the increased
electrophoretic m obility of the D variant of GALT in native gels
could account for this polym orphic enzyme. On the basis of the
experim ental data, 34 of 35 different D alleles presented
N314D polym orphism . Furtherm ore, N314D never p resented on
biochem ically and electrophoretically norm al alleles. This led
m e to propose that the D variant of GALT is encoded by a
p rotein polym orphism , N314D. This hypothesis is consistent
w ith the following observations. First, the D variant is a
structural m utation (Mathai and Beutler, 1966). Second, the
increased negative charge im parted by this protein
polym orphism is consistent with the increased electrophoretic
m obility of the D variant in native gels. Third, substantial
68
GALT activity is associated with N314D w hen it is
overexpressed in COS cells (Reichardt and Woo, 1991), which
m ay account for some of the activity observed for the D
variant. I also found that N314D is present on a few
galactosem ia alleles. Hence, the question is w hether
galactosem ia m utations m ay occur on an already polym orphic
background bearing N314D, or, alternatively, N314D m ay be
introduced by recom bination or gene conversion onto a
preexisting galactosemic chrom osom e. I addressed this
suggestion in chapter 3. Finally, a simple, m olecular genetic,
PCR-based detection system for N314D leads me to propose
th at N314D encodes the Duarte variant of GALT.
I have identified a novel Sac I RFLP in hum an GALT gene
(Leslie et al.. 1992). The recurring G to A transition located at
nucleotide 1391 of the GALT gene in intron E and abolished the
norm al Sac I restriction site. PCR-amplification p ro d u ct of exon
6 and its surrounding sequences is 185 bp long an d can be
typed easily for the Sac I RFLP. Frequency of the Sac I RFLP in
various chrom osom al backgrounds is found on about 11% of
norm al chrom osom es and linkage disequilibrium w ith the m ost
com m on m utations identified in GALT: Q188R an d N314D. The
Sac I RFLP was present on all 37 galactosemic chrom osom es
bearing Q188R while absent on all 24 chrom osom es bearing
N314D. This inform ation leads me to propose th at these two
m utations are linkage disequilibrium with presence or absence
69
of the Sac I RFLP respectively. Therefore, they arose
independently on different chrom osom al backgrounds and
probably only once in evolution. I also genotyped small
num ber sam ples from Asian individuals. Interestingly, the Sac
I- RFLP was n o t detected on any norm al Taiwanese, non-Q188R
galactosemic Japanese, and norm al Japanese alleles. However,
we do find th at the Sac I- RFLP on one D uarte allele encoded by
the N314D m utation in a Japanese patient (Ashino et al..
subm itted). This data set suggests that the D uarte and N314D
alleles arose on a single Sac I- chrom osom e before Asian and
Caucasian people diverged. Thus, both N314D GALT m utation
and the Sac I RFLP in the hum an GALT gene appear to be
ancient genetic variations. In sum m ary, the Q188R and N314D
GALT m utations are linkage disequilibrium w ith different Sac I
RFLP alleles and these two m utations arose independently in
evolution on different chrom osom al backgrounds.
During the identification of new m utations, a novel
m issense m utation, R231H, was located in a conserved dom ain
of the hom ologous enzymes from E. coli, yeast, an d hum ans
(Tajima et al.. 1985; Lemaire and Mueller-Hill, 1986). In COS
cell's expression system, the GALT activity of R231H m u tan t
protein was 15% of the norm al GALT protein. However, the
GALT activity of erythrocytes with the genotype of
R231H/R231H was less than 1% of healthy controls. The
reasons for the discrepancy betw een the COS cell expression
70
system an d the erythrocytes are unclear. It is m ost likely th at
there are some difference in the regulation of the GALT gene
and in posttranscriptional regulatory properties of the two
system s. We also have identified a novel splicing m utation,
318A--G, causes the 38 bp deletion in exon 3 by GALT cDNA
analysis and the A to G transition at nucleotide 38 in exon 3 by
genom ic DNA analysis. This m utation produced a cryptic splice
acceptor site (AG) an d caused the skipping of the first 38 bp in
exon 3. Furtherm ore, the splicing m utation of 318A--G
p roduced a fram e shift, which subsequently caused a stop
codon (TGA) at the eighth am ino acid from the po in t of codon
shift. Hence, this GALT protein of 318A--G w ould be 92 am ino
acids long as com pared to the norm al 379 am ino acids.
Therefore, a patient with the genotype of 318A--G/318A— G
expressed less than 1% of erythrocyte GALT activity and
caused classic galactosemia. It has been generally rep o rted th at
m utations which cause in inherited m etabolic disorders are
different am ong different races. Indeed, the Q188R m utation is
n o t found in Japanese, despite Q188R being the m ost prevalent
m utation in Caucasian people. Experimental d ata of the N314D
an d R333W m utations also dem onstrated the concept we
described above. Therefore, it appears th at transferase
deficiency galactosem ia in Japan is caused by different
m utations than those in the US.
71
REFERENCES
A rab sh ah i A, B rody RS, Sm allw ood A, Tsai TC, Frey PA
(1986) G alactose-l-phosphate uridyltransferase purification of
the enzym e an d stereochem ical course of each step of the
double-displacem ent m echanism . Biochemistry 25: 5583-5589.
Aoki K, W ada Y (1988) Outcome of the patients detected by
new born screening in Japan. Acta. Paediatr. Jpn. !£}: 429-434.
Flach JE, R eichardt JKV, Elsas IJ (1990) Sequence of a
cDNA encoding hum an galactose-l-phosphate
uridyltransferase. Molec. Biol. Med. 2: 365-369.
Lem aire HG, M ueller-H ill B (1986) Nucleotide sequence for
the gal E and gal T of E. coli. Nucl. Acids. Res. 14: 7705-7711.
Leslie ND, Im m erm an EB, Flach JE, Florez M, Fridovich-
Keil JL, Elsas LJ (1992) The hum an galactose-l-phosphate
uridyltransferase gene. Genomics 14: 474-480.
Levy HL, H am m ersen G (1978) Newborn screening for
galactosem ia and other galactose m etabolic defect. J. Pediatr.
2 1 : 871-877.
Lin H-C, K irby LT, Ng WG, R eichardt JKV (1994) On the
m olecular natu re of the Duarte variant of galactose-l-
phosphate uridyltransferase (GALT). Hum. Genet. 2 3 - 167-169.
M athai CM, B eutler E (1966) Electrophoretic varian t of
galactose-l-phosphate uridyltransferase. Science 154: 1179-
1180.
72
Ng WG, Xu Y-K, W olf JA, Allen RA, R eichardt JKV (1994)
Biochemical and m olecular analysis of 132 galactosem ia
patients. Hum. Genet, in press.
R eich ard t JKV, Berg P (1988) Cloning and characterization of
a cDNA encoding hum an galactose-l-phosphate
uridyltransferase. Molec. Biol. Med. 5.: 107-122.
R eich ard t JKV, Woo SLC (1991) M olecular basis of
galactosemia: m utations an d polym orphism s in the gene
encoding hum an galactose-l-phosphate uridyltransferase. Proc.
Natl. Acad. Sci. USAM : 2633-2637.
R eich ard t JKV, Packm an S, Woo SLC (1991) M olecular
characterization of two galactosem ia m utations: correlation of
m utations w ith highly conserved dom ain in galactose-l-
phosphate uridyltransferase. Am. J. Hum. Genet. 42: 860-867.
R eich ard t JKV (1992) Genetic basis of galactosem ia. Hum.
Mut. 1: 190-196.
R eich ard t JKV, Belm ont JW, Levy HL, Woo SLC (1992)
C haracterization of two missense m utations in hum an
galactose-l-phosphate uridyltransferase: different m olecular
m echanism s in galactosemia. Genomics 12: 596-600.
Sheu R, Kwan F, R ichard JP, Frey PA (1979)
Stereochem ical courses of nucleotidyltransferase and
phosphotransferase action. Uridine diphosphate glucose
pyrophosphorylase, galactose-l-phosphate uridyltransferase,
adenylate kinase, and nucleoside diphosphate kinase.
Biochem istry 18: 5548-5556.
73
Segal S (1989) D isorder of galactose m etabolism in the
m etabolic basis of inherited disease. New York, NY: McGraw-
Hill, 453-480.
T ajim a M, Nogi Y, Fukasaw a T (1985) Prim ary stru ctu re of
the Saccharomyces cerevisiae GAL 7 gene. Yeast 1: 67-77.
W aggoner DD, Buist NRM, D onnell GN (1990) Long- term
prognosis in galactosemia: results of a survey of 350 cases. J.
Inher. Metabol. Dis. L2. : 802-818.

Linked assets

University of Southern California Dissertations and Theses

Conceptually similar

PDF

Functional analysis of single nucleotide polymorphisms (SNPs) in the 5' regulatory region on the SRD5A2 gene

PDF

Analysis of the HSD3B2 gene in prostate cancer

PDF

Association between single nucleotide polymorphisms in the 3'untranslated region of the SRD5A2 gene and prostate cancer risk

PDF

Dna Methylation Patterns In Human Tumor Suppressor Genes

PDF

Analysis of the ALOX5 gene in atherosclerosis

PDF

A model for the mechanism of agonism and antagonism in steroid receptors

PDF

Development and secretions of salivary glands using mouse models

PDF

Biochemical analysis of somatic mutations in steroid 5alpha-reductase type II in prostate cancer

PDF

Roles of three domains of CCAR1 in transcription activation by nuclear receptors

PDF

Expression of matrix metalloproteinases and their inhibitors in the muscles of amyotrophic lateral sclerosis and control patients

PDF

Amelogenin domains in a self-assembly process

PDF

Construction and characterization of RRP6 deletion in Saccharomyces cerevisiae

PDF

Identification of the biochemical pathways affected by the anticancer agents Motexafin Gadolinium and Sapphyrin through gene expression profiling

PDF

Purification and sequence study of platelet aggregation inhibitor from snake venom

PDF

Studies Of Topoisomerase Ii As The Target Of Anti-Cancer Agents

PDF

A coactivator complex among GRIP1, CARM1, and TIF1alpha contributes to gene activation directed by androgen receptor

PDF

Clathrin associated protein (AP) binding motifs in AD5 penton

PDF

Molecular mechanism of genomic imprinting in somatic cell cultures

PDF

Roles of Klf4 in embryonic stem cells

PDF

Transcriptional induction of the 78 kiloDalton glucose regulated protein (grp78) gene through depletion of intracellular calcium ion from endoplasmic reticulum

Asset Metadata

Creator Lin, Hsien-Chin (author)

Core Title Molecular studies of the human galactose-1-phosphate uridyltransferase gene

Degree Master of Science

Degree Program Biochemistry

Publisher University of Southern California (original), University of Southern California. Libraries (digital)

Tag biology, genetics,OAI-PMH Harvest

Language English

Contributor Digitized by ProQuest (provenance)

Advisor Reichardt, Juergen K.V. (committee chair), Stellwagen, Robert H. (committee member), Tokes, Zoltan A. (committee member)

Permanent Link (DOI) https://doi.org/10.25549/usctheses-c20-297276

Unique identifier UC11260235

Identifier EP41363.pdf (filename),usctheses-c20-297276 (legacy record id)

Legacy Identifier EP41363.pdf

Dmrecord 297276

Document Type Thesis

Rights Lin, Hsien-Chin

Type texts

Source University of Southern California (contributing entity), University of Southern California Dissertations and Theses (collection)

Access Conditions The author retains rights to his/her dissertation, thesis or other graduate work according to U.S. copyright law. Electronic access is being provided by the USC Libraries in agreement with the au...

Repository Name University of Southern California Digital Library

Repository Location USC Digital Library, University of Southern California, University Park Campus, Los Angeles, California 90089, USA