University of Southern California Dissertations and Theses

Blockade of CXCR2 as a novel approach for cancer chemotherapy

(USC Thesis Other)

Blockade of CXCR2 as a novel approach for cancer chemotherapy

PDF

Download a page range

Download transcript

Copy asset link

Request this asset

Transcript (if available)

Content BLOCKADE OF CXCR2 AS A NOVEL APPROACH FOR CANCER
CHEMOTHERAPY

by

Nidhi Sharda

A Thesis Presented to the
FACULTY OF THE USC GRADUATE SCHOOL
UNIVERSITY OF SOUTHERN CALIFORNIA
In Partial Fulfillment of the
Requirements for the Degree
MASTER OF SCIENCE
(PHARMACEUTICAL SCIENCES)

May 2012

Copyright 2012 Nidhi Sharda

ii

DEDICATION
I dedicate this thesis to my parents, family and friends who have been with me
through all highs and lows. Thank you!

iii

ACKNOWLEDGEMENTS
I would like to acknowledge my mentor Dr. Stan Louie for his immense support in
developing this thesis. I am thankful to all faculty and staff for sharing their
knowledge. Lastly, I am grateful to my lab members and colleagues who helped
me in every manner possible to develop me as a researcher, as well as grow as
an individual. Thank you very much!

iv

TABLE OF CONTENTS
DEDICATION .................................................................................................................. ii
ACKNOWLEDGEMENTS ............................................................................................... iii
LIST OF TABLES ........................................................................................................... vi
LIST OF FIGURES ........................................................................................................ vii
ABBREVIATIONS ........................................................................................................ viii
ABSTRACT .................................................................................................................... xi
1. CHAPTER 1 ............................................................................................................. 1
1.1. Introduction ................................................................................................... 1
1.1.1. Cancer Its Microenvironment ......................................................... 1
1.1.2. Cancer and Inflammation ............................................................... 5
1.1.3. Cancer “A Wound that Does Not Heal” .......................................... 6
1.2. Role of Chemokine in Tumor Proliferation ..................................................... 8
1.2.1. Types of Inflammation .................................................................... 9
1.2.1.1. Chronic Inflammation .................................................. 13
1.3. Role of Angiogenesis and Tumor Proliferation ............................................ 13
1.3.1. Chemokines in Cancer Proliferation ............................................. 14
1.3.2. Role of Interleukin-8 (CXCL-8) ..................................................... 15
1.4. Breast Cancer: A highly aggressive tumor .................................................. 16
1.5. Hypothesis .................................................................................................. 17
2. CHAPTER 2 ........................................................................................................... 18
2.1. Introduction ................................................................................................. 18
2.1.1. Cell Lines and Culturing ............................................................... 19
2.1.2. Chemicals .................................................................................... 20
2.1.3. Growth Inhibition MTT Assays ..................................................... 20
2.1.4. Colony Forming Assays ............................................................... 21
2.1.5. Serum Sensitivity Assay ............................................................... 21
2.1.6. Wound Healing Scratch Assay: .................................................... 21
2.1.7. Tube Formation Assay ................................................................. 22
2.1.8. Imaging and Quantification .......................................................... 23
2.1.9. Gene Expression Analysis ........................................................... 23
2.1.10. Statistics ...................................................................................... 24
2.2. Result ......................................................................................................... 25
2.2.1. Effect on SCH-527123 on Cellular Viability .................................. 25
2.2.1.1. Effect of Serum IC50 .................................................. 27
2.2.1.2. Effect on SCH-527123 on Migration ........................... 28
2.2.1.3. Effect of SCH527123 on Angiogenesis ....................... 29
2.2.1.4. Effect of SCH527123 on Gene Expression ................. 31
2.3. Discussion .................................................................................................. 32
2.4. Conclusion .................................................................................................. 35

v

3. CHAPTER 3: CONCLUSION .................................................................................. 37
3.1. Introduction ................................................................................................. 37
3.1.1. Structural Details and Binding Properties of CXCR1 and
CXCR2 ........................................................................................ 38
3.1.2. SCH-527123 has Potential Anti-angiogenic and Anti-
migration Effects .......................................................................... 40
3.1.3. SCH-527123 has potential anti-cancer effects ............................. 40
BIBLIOGRAPHY ............................................................................................................ 43

vi

LIST OF TABLES
Table 1 Primer sequences of all genes analyzed 24
Table 2 IC
50
of various breast cancer cells treated with SCH-527123. 27
Table 3 Effect of serum on IC
50
27
Table 4 Genotype of breast cancer cell lines. 33
Table 5 Classification of CXC family based on ELR domain. 37

vii

LIST OF FIGURES
Figure 1 Six essential alterations in normal physiology 1
Figure 2 Complex interactions of the tumor microenvironment. 3
Figure 3 Yin-Yang model of inflammation. 11
Figure 4 Growth inhibition assay in breast cancer cell lines. 26
Figure 5 SCH-527123 treatment decreases cell migration in MDA-MB-
231 and MDA-MB-468 cell lines.
28
Figure 6 SCH-527123 inhibits tube formation in HMEC cells. 30
Figure 7 Changes in gene expression of CXC ligands, receptors and
PLD-1 following SCH-527123 treatment in MDA-MB-231 and
SKBR-3 cells.
31
Figure 8 Chemical structure of SCH-527123 32
Figure 9 Combination of SCH-527123 and Doxorubicin causes growth
inhibition in MDA-MB-231 cells.
41

viii

ABBREVIATIONS
ATCC American Tissue Culture Collection
ATL Aspirin triggered lipoxins
BRC1 Breast cancer repair 1
Ca
2+
Calcium ion
CFA Colony forming units assay
COPD Chronic obstructive pulmonary disease
COX-2 Cyclooxygenase-2
CXC CXC Chemokine family
CXCL CXC Ligand
CXCR CXC Receptor
DMEM Dulbecco’s modified eagle medium
DNA Deoxyribonucleic acid
EC Endothelial cell
ECM Extracellular Matrix
ELR Glutamic Acid-Leucine-Arginine
ERCC1 Excision repair protein 1
FAK Focal adhesion kinase
FBS Foetal bovine serum
FCS Foetal calf serum
FPR2 Formyl peptide receptor 2
GPCR G-Protein coupled receptor
GROα Growth related oncogene α

ix

HMEC Human microvascular endothelial cell
IC50 Inhibitory concentration decreasing a response by 50%
IL-8 Interleukin-8
LX Lipoxins
LXA4 Lipoxin A4
M 200 Medium 200
MAPK Mitogen activating protein kinase
NAP2 Neutrophil activating peptide 2
NCI National Cancer Institute
NER Nucleotide excision repair
PBS Phosphate buffer saline
PBS Phosphate balance saline
PDGF Platelet derived growth factor
PI3K Phosphatidyl-inositol-3-kinase
PKC Protein kinase C
PLD-1 Phospholipase-D1
PMN Polymorphonuclear leukocytes
PTEN Phosphatase and tensin homologue deleted on chromosome 10
ROS Reactive Oxygen Species
SDF1α Stromal derived factor 1α
T
1/2
Half-life
TAF Tumor associated fibroblast
TGFβ Transforming growth factor β

x

TNBC Triple Negative Breast Cancer
VEGF Vascular endothelial growth factor

xi

ABSTRACT
There is interplay between the malignant tumor cells and their non-malignant
counterparts found in the microenvironment. This active bi-directional cross-talk
between cancer cells and normal host cells has profound implications for tumor
survival, proliferation and progression. Chemokines play a key role in cancer
related inflammation and angiogenesis. Several evidences in chemokine system
reveal that they affect multiple pathways of tumor progression including:
leukocyte recruitment, neo-angiogenesis, tumor cell proliferation and survival,
invasion and metastasis. Interleukin-8 or IL-8 is the prototype of the angiogenic
chemokine family. IL-8 signaling plays a key role in development of tumor
microenvironment and cancer progression. Angiogenesis, migration and chronic
inflammation are key determinants of the process of tumorigenesis and tumor
proliferation. We have used SCH-527123, an anti-inflammatory agent used for
the treatment of asthma, as a prototype compound to determine whether this is a
good target for anticancer drug development. We assessed growth inhibition and
migration by MTT and colony formation assay and wound healing scratch assay
in breast cancer cellular model. We studied effect on angiogenesis by tube
formation assay on HMEC endothelial cells. We have confirmed anti-angiogenic
and anti-migration activity as a consequence of CXCR1/2 receptor blockade, as
seen from gene expression data.

xii

In conclusion, our data in the breast cancer model showed that SCH-527123 has
potential anti-cancer properties. The cytotoxic activity may be not being linked to
its anti-activity since higher concentrations are necessary to achieve IC50.
These findings need to be verified in xenograft tumor bearing models.. Future
studies in co-culture experiments with neutrophils, condition media, which
simulate tumor microenvironment may provide information as to the role of tumor
microenvironment in cancer proliferation.

1
1. CHAPTER 1
1.1. Introduction
1.1.1. Cancer Its Microenvironment
National Cancer Institute (NCI) defines cancer as a disease in which
abnormal cells divide without control or regulation, where these cells are able to
expand and invade non-malignant tissues.(cancer.gov/what-is-cancer) Cancer
development, or tumorigenesis, is a multistep process reflecting genetic
alterations driving progressive transformation from normal cells into neoplastic
growth. Hanahan and Weinberg initially describe these defects in regulatory
circuit(s) important in dictating normal cell proliferation and homoeostasis, as the
‘hallmarks’ of cancer development. Figure 1 summarizes this model where

Figure 1: Six essential Alterations in normal physiology: Hanahan et al. describe
the pre-requisite alterations in basic cellular physiology essential for tumor growth
(Hanahan & Weinberg, 2000).

2

cancer proliferation involves the six essential alterations from normal cell
physiology: (1) Self sufficiency in growth signals; (2) Insensitivity to growth-
inhibitory signals; (3) Evasion of programmed cell death; (4) Limitless replicative
potential; (5) Sustained angiogenesis; and (6) Tissue invasion and metastasis.
(Hanahan & Weinberg, 2000)
Functionally, cancer development comprise of the three phases of (1)
Initiation, (2) Promotion, (3) Progression. Genoomic changes initiated within the
cancer cell, where non-lethal mutations promoting survival and clonal expansion.
The tumor mass may proliferate in its environment without metastasizing,
however when the tumor volume exceeds capacity for continual proliferation, it
will spread into the circulation and localized into uninvolved tissue. (Kinzler &
Vogelstein, 1996)
It is now clear that a tumor is not only a complex hyperproliferating cells.
Rather, the tumor is a conglomeration of cells that interact with each other to
form the cellular mass [Figure 2]. As a result, the tumor microenvironment
becomes an integral part of the tumor progression and metastasis. The complex
nature of this tumor microenvironment due in part the host of cells that makes up
the tumor. Found in the tumor mass including stroma cells, fibroblasts,
myofibroblasts, endothelial cells, smooth muscle cells and immune inflammatory
cells. Also found in the tumor matrix include neutrophils, T and B lymphocytes,
and natural killer cells. All of these cells play a role in the facilitative environment
promoting efficient tumor progression (Noonan, et al.).

3

The presence of the immune cells signals the ability of the immunity to
differentiate between normal and abnormal growth. The collaboration between
malignant cells with infiltrated immune cells suggests that tumor cells are able to
adapt to immune response. Some have characterized this collaboration as the
ability of tumor cells to hijack immune response to the presence of malignant

Figure 2: Complex Interaction of the Tumor. (A) Tumor cells attract/activate non-
tumor cells- blood and lymphatic endothelial cells and pericytes, carcinoma
associated fibroblast, bone marrow derived cells, immune and inflammatory cells.
They also modify the extracellular matrix. (B) In turn, tumor microenvironment
components contribute to the growth, dormancy, invasion and metastasis of the
tumor. These interactions further encourage its resistance to therapy.
Abbreviations: B B lymphocyte; BMDC bone marrow-derived cells; BV blood
vessel; CAF carcinoma associated Fibroblast; EC endothelial cell; ECM
extracellular matrix; EMT epithelial to mesenchymal transition; Gr granulocyte; LEC
lymphatic endothelial cell; LV lymphatic vessel; Mo monocyte; MSC mesenchymal
stem cell; PC pericyte; T T lymphocyte; TAM tumor associated
monocyte/macrophage; TC tumor cells (Noonan, Pennesl, & Albini)

4

proliferation, where the immune cells suggest immunological containment and
eradication this abnormal proliferation. In turn, the tumor microenvironment
utilizes the immune response to promote its own growth, which further enhances
the recruitment of more immune cells such as neutrophils
Neutrophils have been reported to provide the inflammatory mediators
blocking apoptotic signals and even promoting tumor progression. The immune
cells elaborate cytokines and reactive oxygen species (ROS) in an effort to
eradicate the tumor. ROS will contain tumor proliferation, however the bystander
effect will promote wound healing, which elaborates more cytokines promoting
the tumor proliferation. This result in a vicious cycle of host response to the
presence of the tumor leading to tissue injury, and thus activating angiogenesis
and other wound repair mechanisms-where residual tumor cells can use to
promote its own growth.
Further, there is interplay between the malignant tumor cells and their
non-malignant counterparts found in the microenvironment (Lorusso & Rüegg,
2008). This active bi-directional cross talk between cancer cells and normal host
cells has profound implications for tumor survival, proliferation and progression
(Figure 2) (Chouaib et al., 2010; Polyak, Haviv, & Campbell, 2009). By their
inherent nature, tumor cells exist within the extracellular matrix (ECM) and
release growth factors promoting angiogenesis, release of proteolytic enzymes
that alter the ECM structure, and accelerate the immune cell proliferation
(Petrulio, Kim-Schulze, & Kaufman, 2006; Polyak, et al., 2009). In solid tumors,

5

malignant cells are capable of regulating and altering gene expression in non-
tumor cells residing in or infiltrating into the microenvironment. They exert
selective pressures, influencing the recruitment and shaping the phenotype of the
infiltrating cells (Chouaib, et al., 2010). Components found in the
microenvironment, particularly endothelial cells and inflammatory mediators also
regulate gene expression in tumor cells, directing the tumor into aggressiveness,
promoting angiogenesis initiation and metastasis (Chouaib, et al., 2010).
Therefore, a complicated symbiosis between tumor cells and the components
found in the microenvironment.
As a result, from the point of view of development of novel cancer
therapeutics, studies not only on the tumor cells and their uncontrolled
proliferation, but also investigations on this dynamic tumor microenvironment
play an equally important role in assessing as well as controlling the growth of
tumor.(Chouaib, et al., 2010; Lorusso & Rüegg, 2008)
1.1.2. Cancer and Inflammation
The link between cancer and inflammation is neither new nor novel. In
1863, Rudolf Virchow described leukocyte infiltration in neoplastic tissue (Balkwill
& Mantovani, 2001). The precise nature and role of these immune cells residing
in the tumor microenvironment was not clearly delineated. However, their
presence has been taken as evidence that the host is not ignorant of the evolving
malignant proliferation, but rather attempts to interfere with tumor progression, a
process referred to as immuneosurveillance. In this context, inflammatory

6

infiltrates in tumors are considered to be host attempt at detection and
elimination of the emerging tumor mass (Balkwill & Mantovani, 2001; Zitvogel,
Tesniere, & Kroemer, 2006).
To further define the hallmarks of cancer, a seventh hallmark, avoidance
of immunosurveillance was recently proposed and discussed by Schreiber and
colleagues (Dunn, Old, & Schreiber, 2004; Zitvogel, et al., 2006). According to
this model, there are two ways by which cancer cells can escape innate and
adaptive immune responses (1) Immunoselection: selection or edition of the
tumor cell to a variant that is non-immunogenic or not sensitive to immunological
response; (2) Immunosubversion: Active suppression of the immune response
probing it to be inadequate and inefficient. It is this property of the cancer cells, or
more specifically, of the growing tumor microenvironment, that is both
controversial as well as highly preferential in assessing promising tumor targets
to discover potential anti-cancer therapeutics.
1.1.3. Cancer “A Wound that Does Not Heal”
Approximately a quarter of a century ago, H.F. Dworak studied the
composition of the cancer stroma and compared it to the wound healing process.
From his observations, he introduce a new concept defining cancer as “a wound
that never heals (Nelson & Ganss, 2006).”
The ‘wound’ or the injury of the local environment of the cancer cell is
largely attributed to the ‘reactive oxygen species’ (ROS) that are derived from
molecular oxygen. ROS is generated from metabolizing cancer cells, recruited

7

inflammatory cytokines, as well as an extraneous infection from a carcinogen
such as tobacco smoke. In all normal aerobic cells, these are balanced by
biological anti-oxidants as they are important metabolites, which also play a role
in signaling cascades. However, when this balance is disrupted, as in cancer cell,
the deleterious effects of ROS appear. This oxidative stress damages nucleic
acids, proteins, lipids, leading to mutations, chromosomal instability, membrane
damage and finally tumor growth and progression (Klaunig, Kamendulis, &
Hocevar, 2010; Waris & Ahsan, 2006).
Tissue injury found in the tumor follows the same wound healing process:
overlapping phases of hemostasis, inflammation, proliferation and remodeling. It
begins with blood components crowding the site of injury. Platelets release
clotting factors, essential growth factors and cytokines such as platelet-derived
growth factor (PDGF) and transforming growth factor beta (TGF-ß). This
hemostasis is followed by inflammatory phase wherein neutrophils enter and
undertake phagocytosis to remove non-self and damaged tissue. Macrophages
also appear to phagocytose; as well as release more PDGF and TGF-ß. Next,
fibroblasts migrate to begin the proliferative phase and deposit new extracellular
matrix and organize the final remodeling phase. It should be noted that, healing
proceeds only after the inflammation is controlled. In pathologic conditions or
cancer growth, this efficient and orderly process is lost and the cells are locked
into a state of chronic inflammation characterized by abundant neutrophil
infiltration with associated ROS and destructive enzymes, which further worsen

8

the condition (Diegelmann & Evans, 2004). As a result, a vicious cycle is created
where inflammatory immune response triggers production of ROS; causing
cellular and DNA damage and elaborating additional inflammation cytokines and
angiogenic signals; inducing the recruitment of immune cells; thereby promoting
tumor expansion and invasion into other tissues, become aggressive and add on
to the stressed injured state.
1.2. Role of Chemokine in Tumor Proliferation
Another important link is displayed by the regulatory control by
chemokines in both the processes. Several chemokines, including CXCL8,
CXCL1, CXCL5, and CXCL12, and their receptors CXCR1, CXCR2 and CXCR4,
are shown to have preferential upregulated expression at the time of wound
healing (Gillitzer & Goebeler, 2001) as well as play a definitive role in cancer
progression (Hembruff & Cheng, 2009). More details on this process of chronic
inflammation, as well as chemokines, would follow in subsequent sections:
Inflammation and its different types; Angiogenesis and tumor growth. To
reiterate, evidence of changes occurring in the microenvironment of the
progressing tumor resemble the process of chronic inflammation, which begins
with ischemia followed by interstitial and cellular edema, appearance of immune
cells and, finally, growth of blood vessels and tissue repair (Dvorak, 1986; Nelson
& Ganss, 2006; Whiteside, 2008). Thus, a conclusive connection of inflammation
and cancer, which has been elaborated in a myriad of reviews followed.

9

(Balkwill & Mantovani, 2001; Chouaib, et al., 2010; Lorusso & Rüegg, 2008;
Petrulio, et al., 2006; Polyak, et al., 2009; Zitvogel, et al., 2006).
1.2.1. Types of Inflammation
Inflammation is an adaptive response that is triggered by noxious stimuli
and conditions such as infection and tissue injury (Dvorak, 1986). The
pathological inflammatory state is also assumed to have a physiological
counterpart. Regardless of the cause, inflammation presumably evolved as an
adaptive response for restoring homeostasis.
A typical inflammatory response can be either an acute or chronic
response. Acute inflammation, triggered by infection by antigenic intrusion or
tissue injury involves the coordinated delivery of blood components (plasma and
leukocytes) to the site of infection or injury (Medzhitov, 2008) This initial
recognition of infection is mediated by macrophages and mast cells, leading to
the production of a variety of inflammatory mediators, including chemokines,
cytokines, eicosanoids and products of proteolytic cascades. The immediate
effect of local exudation of plasma proteins and leukocytes to the extravascular
tissues at the site of infection (or injury) is followed by the activation of
endothelium allowing selective extravasation of neutrophils, which, attempt to kill
the invading agents by releasing the toxic contents of their granules such as
reactive oxygen species (ROS) and reactive nitrogen species (RNS) which can
induce cytotoxic damaged (Nathan, 2002). However, successful elimination of
the infection is followed by a resolution and repair phase.

10

The repair phase of inflammation, involves the switching off the production
of pro-inflammatory prostaglandins to trigger the synthesis of lipid mediators
lipoxins. These endogenous anti-inflammatory agents are crucial for the
transition from inflammation to resolution. They inhibit the recruitment of
neutrophils and, instead, promote the recruitment of monocytes, which remove
dead cells and initiate tissue remodeling. Other lipid mediators such as resolvins
and protectins, also transforming growth factor-β and growth factors produced by
macrophages play a crucial role in the resolution and initiation of tissue repair.
(Serhan, 2007; Serhan & Savill, 2005) This process is summarized by Serhan et
al (Serhan, 2007; Serhan & Savill, 2005) and Petasis et al. (Figure 3) (Petasis, et
al., 2005) where they segregate the lipid mediators of inflammation as pro- and
anti-inflammatory agents. Prostaglandins, thromboxanes, and leukotrienes are
pro-inflammatory, whereas lipoxins, protectins and resolvins are classified as
anti-inflammatory. The recently investigated resolution phase of inflammation is
governed by lipoxins (LX). These are trihydroxytetraene-containing eicosanoids
typically generated through transcellular biosynthetic pathways involving either 5-
and 15-lipoxygenases or 5- and 12-lipoxygenases (Chen et al., 2010; Serhan,
1997). Endogenously, they are triggered by Aspirin dependent inflammation
(Aspirin triggered Lipoxins: ATL). Lipoxin A4 (LXA4) has been shown to play a
role in affect many chronic inflammatory stages, including cancer (Bonnans et al.,
2002; Chen, et al., 2010; Serhan, 1997). However, being particularly susceptible
to enzymatic degradation, their synthetic analogues ATLa, have been now

11

introduced and investigated as potential anti-inflammatory agents in various
domains of acute and chronic inflammation.(Clària & Planagumà, 2005; Machado
et al., 2006; Petasis, et al., 2005; Serhan, 1997; Svensson, Zattoni, & Serhan,
2007; Yacoubian & Serhan, 2007)
The specific binding sites for LXA
4
and ATLa were first characterized on
human PMN. An orphan G-protein couple receptor (GPCR) from myeloid
lineages FPR2 (formyl peptide receptor2) demonstrated high specific binding.
This recombinant receptor transmits signal with LXA
4
, activates both GTPase
and the release of arachidonic acid (C20:4) from membrane phospholipid,
indicating that this cDNA encodes a functional receptor for LXA
4
in myeloid cells.

Figure 3: Yin-Yang Model of Inflammation: Cell mediated Regulation and Activity of
Polysaturated Oxygenated Lipid Mediators (Petasis et al., 2005).

12

This receptor is thus accepted as FPR2 or specifically lipoxin A4 receptor (ALXR)
(Chiang, Arita, & Serhan, 2005).
As with all the other physiological check points, if the inflammation
resolving agents fail to curb the tissue damage, a stage of chronic inflammation
develops, involving the formation of granulomas and tertiary lymphoid tissues.
This stage of chronic inflammation has been researched to be extremely close to
the environment of the local tumor stroma, which begins with ischemia, interstitial
and cellular edema, appearance of immune cells and finally growth of blood
vessels and tissue repair. The involvement of cytokines and other mediators
follow suit with the acute inflammation, just that it does not get resolve Thus
chronic inflammation, which began as the ‘host’s immune reaction’ against the
cancer progression, progresses into a ‘tumor promoting reaction’ (Rakoff-
Nahoum, 2006; Serhan, 2007; Whiteside, 2008).
Most recently, after successful evaluation and study of the six hallmarks of
cancer, and the acceptance of Inflammation as the seventh important hallmark,
Cavallo et al. in a recent publication have discussed the ‘immune hallmarks of
cancer’. (Cavallo, De Giovanni, Nanni, Forni, & Lollini, 2011) They assert that for
a cancer cell to acquire skills to become a tumor, both exploitation of immune
mechanism and evasion of immunosurveillance are required. These three
hallmarks: (1) Ability to thrive in a chronically inflamed environment; (2) Ability to
evade immune recognition; and (3) Ability to suppress immune reactivity; are
found to be the strength of a growing cancer.

13

Thus, investigations on these hallmarks of cancer would open new arenas
cancer immunotherapy and novel anti-tumor agents.
1.2.1.1. Chronic Inflammation
Chronic inflammation usually is a result of the failure of the resolution of
the acute inflammatory response. Consequently, there is an extended wounding
process with immune cell infiltration and proliferation; ROS mediated damage,
angiogenic trigger and the resultant unhealed tissue. Due to the lack of the
resolution phase, chronic inflammation is both the cause and the effect of more
inflammatory and immune damage. It has been shown that many diseases
including rheumatoid arthritis, heart diseases, Alzheimer’s Disease, and cancer
are characterized by such an extended inflammatory phase.
1.3. Role of Angiogenesis and Tumor Proliferation
All biological tissues are dependent on their interspersing vasculature for
nutrients and oxygen. Therefore, had tumor mass been just a lump of cells,
without any vascular supply, it would theoretically succumb to the lack of
nutrients and hypoxia. However, it is these wound repair signals, along with
hypoxia-inducible factor-1 for latter, that are responsible to trigger the angiogenic
switch on, and sustain the tumor proliferation. As a result, as for all the other
tissues, the newly formed blood vessels provide nourishment as well as waste-
elimination channel to the tumor cells. Further, apart from the resistance to the
apoptotic signals of the tumor cell mass, hypoxic conditions present in the tumor
interior trigger the involvement of the endothelial cells and its precursors to

14

induce neovascularization- angiogenesis, vasculogenesis, and intussusceptions.
(Chouaib, et al., 2010) Tumor cell factors are established to recruit precursor
cells and circulating endothelial cells, which may differentiate into tumor
associated fibroblasts (TAFs) that release the Stromal Derived Factor 1α
(SDF1α) and CXCL12. These and other similar factors enhance the recruitment
of bone marrow-derived cells and consequently endothelial precursors that
promotes angiogenesis.(Chouaib, et al., 2010; Orimo et al., 2005)
In general, most agree that it is not the primary tumor; but the
characteristic developmental properties of invasion, angiogenesis, leading to
tumor metastasis, which is responsible for the difficult treatment of cancer root. A
simple observation made by Stephen Paget, describing the ‘seed and soil’
hypothesis for tumor metastasis; provides an easy answer to why a tumor cell
would enter the circulation and build home in a new environment. (Ribatti,
Mangialardi, & Vacca, 2006) Thus, the role of the tumor microenvironment is
assisting this process of invasion, migration and angiogenesis; is being
investigated critically to discover novel anti-cancer therapeutics. (Carmeliet &
Jain, 2011; Noonan, et al.)
1.3.1. Chemokines in Cancer Proliferation
Chemokines play a key role in cancer related inflammation. Several
evidences in chemokine system reveal that they affect multiple pathways of
tumor progression including: leukocyte recruitment, neo-angiogenesis, tumor cell
proliferation and survival, invasion and metastasis. Directly, or indirectly, almost

15

all the chemokines affect the process of cancer development. Particularly,
inflammatory chemokines known to be up regulated in cancer have included
CCL2, CCL5, CXCL1 and CXCL12 (Hembruff & Cheng, 2009; P, G, F, & A,
2010).
Furthermore, chemokines have been shown to have important
implications in the regulation of the angiogenic switch in tumors, either directly
(through receptors expressed on endothelial cells) or indirectly by recruiting
leukocytes that provide angiogenic factors (Strieter et al., 2006). Endothelial cells
have been found to express CXCR4, which is triggered by CXCL12 inducing
endothelial cell migration and proliferation. CXCL12 also acts synergistically with
VEGF to become a target to HIF-1α; and participate efficiently in building of
vascular network that is essential for tumor progression (Hembruff & Cheng,
2009; P, et al., 2010; Strieter, et al., 2006). Other studies have also shown that
CXCL1 and CXCR2 may play a role in regulating replicative senescence in
fibroblasts through a p53 dependent mechanism as a possible means to
suppress tumor formation. Gene mutations in components of the CXCL1
signalling pathway may allow tumor cells to escape this tumor suppressive
mechanism (Hembruff & Cheng, 2009).
1.3.2. Role of Interleukin-8 (CXCL-8)
A particular member of the CXC chemokine family, interleukin-8 (IL-8),
also known as CXCL-8, has been shown to significantly regulate pathological
angiogenesis, tumor growth, and metastasis. The receptors for IL-8, CXCR1 and

16

CXCR2, are widely expressed on normal and various tumor cells and bind IL-8
with high affinity. However, the mechanism(s) regulating IL-8-mediated
angiogenesis is not well understood (Heidemann et al., 2003; Hembruff & Cheng,
2009; Li, Dubey, Varney, Dave, & Singh, 2003). They have been studied in
several cellular models, particularly in breast cancer cells- which are accepted to
be one of the most aggressive tumors
("http://www.cancer.org/acs/groups/content/@epidemiologysurveilance/document
s/document/acspc-029771.pdf," ; Naldini et al., 2010) and links have been
established accepting them as one of the prime determinants in breast cancer
spread and metastasis. (Heidemann, et al., 2003; Li, et al., 2003)
1.4. Breast Cancer: A highly aggressive tumor
Breast Cancer can be a highly invasive and metastatic cancer.
Undoubtedly, it is one of the leading causes of cancer deaths all over the world,
especially North America.( American Cancer Society; 2011; Naldini, et al., 2010;
Peyri et al., 2009; Weigelt, Peterse, & van 't Veer, 2005) From a molecular point
of view, it is a highly heterogenous and malignant type of cancer. The most
common sites for metastasis are bone, lung and liver. (Weigelt, et al., 2005)
With the inherent nature of this invasive disease, there have been links of
breast cancer tumor progression and inflammation. Chronic inflammation has
been shown to increase its risk and metastatic potential. (Atlanta: American
Cancer Society; 2011) Mediators of inflammation in all the aspects: recruitment
and proliferation of endothelial cells (Peyri, et al., 2009), neutrophils (Queen,

17

Ryan, Holzer, Keller-Peck, & Jorcyk, 2005), macrophages (Joimel et al., 2010),
and chemokines or interleukins (Chen et al., 2011; Li, et al., 2003; Naldini, et al.,
2010), have been shown to play an important role in mediating breast cancer
proliferation. (DeNardo & Coussens, 2007)
It is to this regard, that breast cancer has been accepted as a good model
to study tumor related inflammation and invasion. Cellular models for breast
cancer classified on the basis of their expressing receptors: Estrogen (ER),
Progesterone (PR) and HER-2; are extensively studied as invasive simulations
for both in-vitro and in-vivo investigations on the tumor microenvironment. (Ford,
Al-Bader, Al-Ayadhi, & Francis, 2011; Lacroix & Leclercq, 2004)
1.5. Hypothesis
In summary remarks for this chapter, as inflammation plays such an important
role in contributing to the development of microenvironment for tumor growth; in
this project, we hypothesize the targeting of chronic inflammation will lead to anti-
cancer effects. We formulate the following two specific aims to test our
hypothesis.
1. Determine whether blockade of CXCR1/2 receptor by small molecule
SCH-527123 can be an effective anticancer strategy.
2. Determine the mechanism(s) driving the anticancer properties of
SCH-527123.

18

2. CHAPTER 2
2.1. Introduction
As discussed in chapter 1, the 7
th
hallmark of cancer inflammation plays a
very important role in maneuvering the microenvironment of the tumor to assess
its growth. The characteristic nature of chronic inflammation in the tumor
microenvironment is particularly expressed by prolonged neutrophil recruitment.
Growth factors such as platelet derived growth factor (PDGF), neutrophil-
activating peptide-2 (NAP-2; CXCL7), growth-related oncogene (GRO-
(CXCL1), and IL-8 (CXCL8) are specifically involved in the chemotaxis of
neutrophils, primarily via the CXC chemokine receptor 2 (CXCR2).(Gillitzer &
Goebeler, 2001)
Chronic chemokine signaling is associated with macrophage and T cell
accumulation at the inflammatory site which may lead to alterations in normal
tissue architecture, abnormal angiogenesis and DNA damage due to excess
secretion of ROS (Hembruff & Cheng, 2009; Moll et al., 2009). All these factors
characteristically hold true for cancer microenvironment. CCL2, CCL5, CXCL1
and CXCL12 have been seen to play a significant role in contributing to this
microenvironment of the tumor stroma. All chemokines from CXCL1-8 have
moderate to high affinity for CXCR2. Specifically in breast cancers, microarray
analysis has revealed increased expression of CXCL1 in tumor stroma, where
there is a correlation between CXCL1 expression with lymph node metastases,
invasiveness and poor patient survival. Further, this CXCL1/CXCR2 pathway is

19

also known to play a role in p53 dependent mechanism of regulating replication
of fibroblasts in breast cancers. (Hembruff & Cheng, 2009) CXCL-8, or IL-8 has
been specifically shown to have high affinity for these neutrophil receptors
CXCR1 and CXCR2, along with a direct link to angiogenesis, by recruiting and
proliferating endothelial cells.(Charo & Ransohoff, 2006; Heidemann, et al.,
2003) and enhanced production of matrix metalloproteinases (Li, et al., 2003).
Moreover, there have been studies which establish the link of increased
expression of IL-8 and invasion of breast cancer cells.(Chen, et al., 2011)
The critical role of CXCR1/CXCR2 in tumor proliferation, we investigated
the impact of blocking this pathway in relations to its antitumor properties. To
evaluate this hypothesis, we utilized small molecule CXCR1/CXCR2 antagonist:
SCH-527123 as the prototype compound. SCH527123 was found to be active
anticancer agent in melanoma model, and was found to be three times more
specific for CXCR2 than CXCR1 (Singh et al., 2009). We hypothesize the
blockade of IL-8 and CXCR1/CXCR2 axis may inhibit breast cancer proliferation,
progression and metastasis. Furthermore, IL-8 has been shown to be promoter
of angiogenesis that is independent of VEGF. Materials and Method
2.1.1. Cell Lines and Culturing
Human breast cancer cell lines MDA MB 231, MDA MB 468 and T47D
were obtained from American Tissue Culture Collection (ATCC, Manassas, VA).
All, but one, breast cancer cell lines were propagated in DMEM (Invitrogen)
supplemented with 10% Fetal Bovine Serum (FBS) (Invitrogen) and 100 U/ml of

20

penicillin and 0.1 mg/ml of streptomycin (Invitrogen). SKBR-3 were grown in
McCoy’s medium supplemented with 10% Fetal Calf Serum (FCS). The
immortalized human microvascular endothelial cells (HMEC) were kindly
provided by Dr. Florence Hofman and grown in Medium 200 (Invitrogen)
supplemented with Low Serum Growth Supplement (Invitrogen). All cells were
grown and maintained in a humidified atmosphere at 37°C and 5% CO
2
.
2.1.2. Chemicals
SCH-527123 was synthesized and kindly provided by Dr. Nicos Petasis.
SCH527123 was dissolved in 100 mM stock solution using DMSO and stored at -
80
o
C till use. The compounds were diluted in medium to the designated
concentrations.
2.1.3. Growth Inhibition MTT Assays
Into a 96 well plate, 3.0 X 10
3
cells/well of MDA-MB-231, MDA-MB-468,
MCF-7, T-47 or SKBR-3 were seeded in the respective mediums and allowed to
adhere overnight under humidified conditions at 37°C and 5% CO
2
. Drug
dilutions were prepared in medium from stocks and cells were treated. 10µL of
5mg/mL of MTT Dye (Sigma) in PBS was added after 72 h time point and cells
lysed after 3-5 h by using lyses buffer (10% SDS and 0.01% HCl). The plate was
covered in foil and read at 492 nm next day. The data was processed by
analyzing percent proliferation of treated cells with respect to the
control/untreated cells.

21

2.1.4. Colony Forming Assays
Cells were seeded into six-well plates at a density of 200 cells per well.
After overnight incubation, the cells were exposed to the drug treatment for 48
hours. Thereafter, the drug was removed by replacing the medium with fresh
growth medium; and the cells were kept in culture undisturbed for 12-14 days,
during which time the surviving cells produced colonies. The colonies were
visualized by staining for 4 hours with 1% methylene blue (in 100% methanol)
and were counted.
2.1.5. Serum Sensitivity Assay
An aliquot of 5.0 X 10
3
cells/well T-47D and MCF-7 cells were seeded in
regular DMEM (containing 10% FBS). Medium was replaced with fresh medium
containing gradient serum percents (0%, 1.25% and 2.5%) and treated with drug
dilution of SCH-527123 from a 100mM stock in DMSO. The assay was stopped
after 48 h by addition of MTT and cell lyses. The data was analyzed by
comparing the growth curve of percent control treated cells, at different serum
gradients. Untreated wells in regular DMEM and 10% FBS were also assessed
as a control.
2.1.6. Wound Healing Scratch Assay:
Cells were seeded to create a confluent monolayer in a 12 well plate
(MDA-MB-231 cells: 5.0 X 10
5
cells/well and MDA-MB-468

cells: 6.0 X 10
5
cells/well). Once attached, the monolayer was scraped with a p10 pipette tip to
create a wound. The wells were washed with PBS, and medium replaced with

22

fresh medium/drug dilution and images taken immediately after addition of drug
(0 h) and at the respective time points (0-48 h). Results were analyzed
qualitatively and quantitatively by measuring the wound area on the images at
different time points using ImageJ (1.44p Wayne Rasband NIH USA).
Formula used:
F
1
= (A
0
– A
t
)/A
0
F
2
= (1 – F
1
), where
A
0
= wound area at 0 h; A
t
= wound area at ‘t’ hours
F
1
= Wound area migrated by the cells in‘t’ hours.
F
2
= Wound area left unhealed. (Expressed for different concentrations in percent
form and plotted on the graph)
2.1.7. Tube Formation Assay
Each well found in 96 well plates were coated with 30µL of Geltrex
TM

(Reduced growth factor basement membrane matrix, Invitrogen) and incubated
at 37ºC for 20-30 min to allow the gel to solidify. Cell Seeding: About 1.0 x 10
5

cells/well of HMEC were seeded in 100µL of medium over the Geltrex coat and
incubated at 37ºC for 20-30 min. Drug Treatment: Drug dilutions were prepared
in the medium from stock and put in the wells to make the final volume of 200µL
per well. The plate was then kept in the incubator at 37ºC for 10-12 h and formed
tubes observed. Staining of the tubes: (optional) Media was replaced by 100-
500µL of 2µM Calcein AM stain in PBS for 1 h or longer. Imaging: The images
were taken using a fluorescent microscope (Excitation: 485nm and Emission:

23

530nm wavelength) if stained; or using a regular phase contrast microscope. The
images were then analyzed for qualitative and quantitative estimation of tubes
usings using ImageJ (1.44p Wayne Rasband NIH USA), and the fold change in
number, area and circumference of tubes analyzed.
2.1.8. Imaging and Quantification
The resultant bands were quantified using densitometry using ImageJ
version 1.45l (National Institutes of Health, USA). The results were expressed as
the ratio of target protein band to β-actin band intensity.
2.1.9. Gene Expression Analysis
Basal level gene expression of CXCL-1, CXCL-2, IL-8, CXCR-1, CXCR-2
and PLD-1 were assessed in all the breast cancer cells. MDA-MB-231 and
SKBR-3 cells were treated with IC
50
values of 150µM and 50µM of SCH-527123
respectively for 48h. Total RNA was extracted with TRIzol Reagent (Invitrogen),
and cDNA was generated from 500 ng of sample RNA using SuperScript III First-
Strand Synthesis Supermix kit (Invitrogen) according to the supplier’s
instructions. qPCR was conducted using SYBR GreenER qPCR Supermix for
iCycler (Invitrogen) in the Bio-Rad IQ5 system. The primer sequence for all
abovementioned and house-keeping β-actin genes are as follows:

24

Gene Name F/R Sequence
CXCL-1
F GCAGCAGGAGCGTCCGTGGC
R CAGTTGGATTTGTCACTGTTCAGCAT
CXCL-2
F TCACCTCAAGAACATCCAAAGTGTG
R CTTCAGGAACAGCCACCAATAAGC
IL-8
F CTTCCTGATTTCTGCAGCTCTGT
R CACTCTCAATCACTCTCAGTTCTTTGAT
CXCR-1
F ACCTGGCCGGTGCTTCAGTTAGA
R AGGGCATAGGCGATGATCACAACA
CXCR-2
F TCTGCCTAGAGCTCTGACTACCACC
R CTGACTGGGTCGCTGGGCTTT
PLD-1
F AAGGCGGCTCGTGATGTGG
R ATGGGCTGTTGTTTGAGACTTTGG
β-ACTIN
F CGTACCACTGGCATCGTGAT
R GTGTTGGCGTACAGGTCTTTG
Table 1: Primer sequences of all genes analyzed.
Threshold cycle values (CT) were determined from two independently isolated
RNA samples and performed in triplicates. All mRNA expression levels were
determined by normalizing against β-actin expression.
2.1.10. Statistics
Data are presented as mean ± SD. Comparisons were made between
different treatments using two-way ANOVA, and a p-value of less than 0.05 was

25

considered significant. GraphPad Prism version 5.0d for Mac OS X (GraphPad
Software, San Diego, CA, USA) was used to analyze the data. One-way analysis
of variance (ANOVA) followed by Tukey’s test was used to compare data from
more than two groups, and linear regression was used to determine the
relationship between bone marrow nitrite levels and percentage of bone marrow
tyrosine nitration. The level of statistical significance was set at 5%. Data are
expressed as mean value ± standard error of the mean (SEM).
2.2. Result
2.2.1. Effect on SCH-527123 on Cellular Viability
The impact of SCH-527123 on cellular viability was studied in five breast
cancer, where the data is summarized in Table 1. The comparative IC
50
values
for all cell lines reveal the drug to be most sensitive for SKBR-3 cells with an
IC50 of 60 µM after 72 hours of exposure. The IC50 between the various breast
cancer cells ranged from 60 to 100 µM. In these studies, SCH527123
demonstrated both a concentration and time of exposure relationship and
cytotoxic activity.

26

Figure 4 Growth Inhibition Assays in Breast Cancer Cell lines. Growth inhibition was
determined by MTT assay at 24, 48 and 72 H post-treatment with SCH-527123 in (A)
MCF-7, (B) MDA-MB-231, (C) MDA-MB-468, (D) SKBR3, and (E) T47D. Cells were
treated with media containing 10% FBS. Data points represent mean ± SD percent
untreated time-matched controls, set at 100%. (Left) graph represents untransformed X-
axis data and (Right) graph represents X-log transformed data.
MCF-7
0.8 1.2 1.6 2.0
0
25
50
75
100
Log mM SCH-527123
% Control
24 H
48 H
72 H
SKBR3
0.8 1.2 1.6 2.0
0
25
50
75
100
% Control
Log mM SCH-527123
24 H
48 H
72 H
MDA-MB-231
0.8 1.2 1.6 2.0
0
25
50
75
100
% Control
Log mM SCH-527123
24 H
48 H
72 H
MDA-MB-468
0.8 1.2 1.6 2.0
0
25
50
75
100
Log mM SCH-527123
% Control
24 H
48 H
72 H
T47D
0.8 1.2 1.6 2.0
0
25
50
75
100
% Control
Log mM SCH-527123
24 H
48 H
72 H
Figure 1
Figure 1. Growth Inhibition Assays in Breast Cancer Cell lines. Growth inhibition was determined by MTT assay at
24, 48 and 72 H post-treatment with SCH-527123 in (A) MCF-7, (B) MDA-MB-231, (C) MDA-MB-468, (D) SKBR3, and
(E) T47D. Cells were treated with media containing 10% FBS. Data points represent mean ± SD percent untreated
time-matched controls, set at 100%. (Left) graph represents untransformed X-axis data and (Right) graph represents
X-log transformed data.
A
B
C
D
E
MCF-7
0 20 40 60 80 100 120 140 160
0
25
50
75
100 24 H
48 H
72 H
M SCH-527123
% Control
SKBR3
0 20 40 60 80 100 120 140 160
0
25
50
75
100 24 H
48 H
72 H
M SCH-527123
% Control
MDA-MB-231
0 20 40 60 80 100 120 140 160
0
25
50
75
100 24 H
48 H
72 H
M SCH-527123
% Control
MDA-MB-468
0 20 40 60 80 100 120 140 160
0
25
50
75
100 24 H
48 H
72 H
M SCH-527123
% Control
T47D
0 20 40 60 80 100 120 140 160
0
25
50
75
100 24 H
48 H
72 H
M SCH-527123
% Control

27

IC
50
(µM) Breast Cancer Cells
Cell Line 24h 48h 72h
MDA-MB-231 - - 100
MDA-MB-468 - 100 60
T-47D - 100 65
MCF-7 - - 80
SKBR-3 140 100 60
Table 2: IC50 of Various Breast Cancer Cells Treated with SCH527123

2.2.1.1. Effect of Serum IC50
IC
50
(µM) Fetal Bovine Serum (%)
Cell Line 1.25 2.5 5.0 10
T-47D 150 160 - -
MCF-7 10 30 60 60
Table 3: Effect of Serum on IC50
Since SCH527123 is a hydrophobic compound, it may have high level of
protein binding. We assessed the impact of cellular viability using various
concentration of serum. The concentration of serum impacted greatly on
SCH527123’s ability to mediate cytotoxic activity. No antitumor activity was
apparent at 5% and 10%, however IC50 was achieved when serum
concentration was lowered 1.25% and 2.5%. Similarly, the antitumor tumor
activity of MCF7 was at 60 µM for 5% and 10% where the IC50 was reduced to
10 and 20 µM when the serum was reduced to 1.25% and 2.5%, respectively

28

(Table 2). These findings suggest that there is significant protein blinding with
SCH527123 which may reduce its cytotoxic activity.
2.2.1.2. Effect on SCH-527123 on Migration
The ability of SCH527123 to inhibit tumor migration was evaluated using
wound-healing assays. Increasing concentrations of SCH527123 was able to

Figure 5: SCH-527123 treatment decreases cell migration in MDA-MB-231 and MDA-
MB-468 breast cancer cells. Cell migration was determined from wound healing scratch
assay. Cells were grown to confluency, scratched and photographed at 0, 6, 24, and 48
H. Cells (A)MDA-MB-231 and (B) MDA-MB-468 were treated with increasing
concentration (µM) of SCH-527123. Quantitative analysis of wound area was calculated
for (A.1) MDA-MB-231 and (B.1) MDA-MB-468 by determining the scratch area with
ImageJ. (Length units: Pixel) and presented as percent unhealed wound area over time
±SD relative to control area at 0 H.

10 20 50 100 150 200
6
24
0
0
-
SCH-527123 concentration (µM)
(A) MDA-MB-231
24
1 0 10 50 75 100 150 200
0
6
48
-
HOURS
SCH-527123 concentration (µM)
HOURS
(B) MDA-MB-468

29

inhibit the migration activity. The drug was able to delay migration at as low as
10 µM, however, significant delay was observed only at higher concentrations.
MDA-MB-468 cells were found to be slow in migration than MDA-MB-231 cells.
At 100 µM SCH527123, significant inhibition of wound healing was not at 6 and
24 hours after scratch introduction. This was shown in two different triple
negative breast cancer cell lines, MDA MB 231 and MDA MB 468.
2.2.1.3. Effect of SCH527123 on Angiogenesis
Since IL-8 plays an important role in angiogenesis, we evaluate the impact
of SCH527123 on endothelial tumor formation. At 15 µM SCH527123, significant
reduction on the number of tubes form were demonstrated. Although no
significant difference in the size or circumference of the tube areas were noted.
Our results from the Tube formation assay [Figure 6] show an inhibition in tube
formation of endothelial HMEC cells with increasing concentration of SCH27123.
There is a significant difference in the number of tubes formed, but the average
area or circumference of the tubes remains almost the same throughout the
concentration range. Further, our data asserts that the difference exists in the
angiogenic ability as predicted by the tube formation assay, and not due to any
cytotoxic effect of the drug at that concentration range; as no significant cell
death was assessed by growth inhibition MTT Assay. Therefore, based on our
results, SCH-527123 possibly inhibits the recruitment and organization or
morphogenesis of the endothelial cells, which are primary in wound healing
processes as well as building tumor vasculature. No significant inhibition on their

30

proliferation was seen for the time period (24H) chosen for the assay. However,
other data (not shown here) show that treatment with longer duration, SCH-
527123 affects proliferation of HMEC cells as well.

Figure 6: SCH-527123 inhibits tube formation in HMEC. (A) Growth inhibition assay
in HMEC cells at 24 H. (B) Tube formation in HMEC cells treated with increasing
concentration of SCH-527123 (μM). (C) Quantiation summary of results from HMEC
tube formation assay. Bars represent fold change in (a) number; (b) area ; and (c)
circumference of tubes with respect to vehicle from duplicate wells ± SD.
Figure 4 . SCH-527123 inhibits tube formation in HMEC. (A) Growth inhibition assay in HMEC cells at 24 H. (B) Tube
formation in HMEC cells treated with increasing doses of SCH-527123 (μM). (C) Quantiation summary of results from
HMEC tube formation assay. Histograms represent fold change in (a) number; (b) area ; and (c) circumference of tubes
with respect to vehicle from duplicate wells ± SD.
SCH 527123 10µM SCH 527123 15µM SCH 527123 20µM
No Geltrex
μM SCH-527123
0 10 15 20
A
B
C
(a) (b) (c)
Vehicle 10 15 20
0.0
0.5
1.0
1.5
SCH-527123 (uM)
Fold change from vehicle
(Tube number)
Vehicle 10 15 20
0
2
4
6
8
10
SCH-527123 (uM)
Fold change from vehicle
(Tube Area)
Vehicle 10 15 20
0
1
2
3
4
SCH-527123 (uM)
Fold change from vehicle
(Tube circumference)

31

2.2.1.4. Effect of SCH527123 on Gene Expression
The impact of CXCR2 inhibition on chemokine expression was evaluated
in breast cancer cell lines, MDA MB 231 and SKBR-3. SCH527123 was able to
reduce expression of CXCL1, CXL2 and IL-8 in MDA MB 231 (Figure 8) similar

Figure 7: Changes in gene expression of CXC ligands, receptors and
Phospholipase D1 following SCH 527-123 treatment in MDA MB 231 and SKBR-3
cells.
Figure 3
A
C
Figure:3 Changes in gene expression of CXC ligands, receptors and Phospholipase D1 following treatment of SCH-
527123 on MDA-MB-231 and SKBR-3 cells. mRNA levels of (A) CXCL1, (B) CXCL2, (C) IL-8, (D) CXCR1, (E) CXCR2, and
(F) PLD1 were determined by qRT-PCR. Bars represent mean ± SD fold change for each cell line normalized to β-Actin.
B
D
E
Untreated IC-50 Untreated IC-50
0.0
0.5
1.0
1.5
MDA-MB-231
SKBR-3
CXCL1 mRNA
SCH-527123 Concentration( M)
Fold Change
Untreated IC-50 Untreated IC-50
0.0
0.5
1.0
1.5
2.0
MDA-MB-231
SKBR-3
CXCL2 mRNA
SCH-527123 Concentration( M)
Fold Change
Untreated IC-50 Untreated IC-50
0.0
0.5
1.0
1.5
MDA-MB-231
SKBR-3
IL-8 mRNA
SCH-527123 Concentration( M)
Fold Change
Untreated IC-50 Untreated IC-50
0.0
0.5
1.0
1.5
2.0
MDA-MB-231
SKBR-3
CXCR1 mRNA
SCH-527123 Concentration( M)
Fold Change
Control IC
50
Control IC
50
0.0
1.0
2.0
3.0
4.0
5.0
MDA-MB-231
SKBR-3
CXCR2 mRNA
SCH-527123 Concentration( M)
Fold Change
Untreated IC-50 Untreated IC-50
0.0
1.0
2.0
3.0
4.0
MDA-MB-231
SKBR-3
PLD-1 mRNA
SCH-527123 Concentration( M)
Fold Change
F

32

findings were found with SKBR3, however an increase expression of CXCL2 was
seen. No real changes in CXCR1 and CXCR2 expression were noted when cells
were treated with SCH527123. A significant upregulation in PLD-1 expression in
SKBR-3 cells, whereas no change was seen in MDA-MB-231 cells after SCH-
527123 treatment.
2.3. Discussion
SCH-527123 is a small molecule cylobutanedione, (Structure shown
below Figure 8) which has already shown been shown to display good oral
bioavailability in rat as an anti-inflammatory agent. In this study, we have found
that at high concentrations of SCH527123, cytotoxicity against tumor was found
from 60 to 100 µM. Antitumor properties were found to be concentration and
time of exposure dependent. Since SCH527123 is a hydrophobic molecule, the
effect of serum concentration on antitumor potency was also evaluated. In this
study, the impact of serum concentration below 5% was found to significantly
increase the antitumor potency. Many drugs are highly bound to plasma proteins,
which restrict their availability to target tissues. Mostly, weakly acidic drugs bind

Figure 8: Chemical Structure of SCH-527123

33

to albumin, whereas weakly basic drugs bind to α-1-acid glycoprotein. However,
others and our present data suggests SCH-527123, does not belong to any of
these categories and is a potential orally bioavailable agent which has anti-
inflammatory as well as anti-cancer properties.
The growth inhibition profile of SCH-537123 on various breast cancer cells
is summarized in Table 1. Growth inhibition on SCH527123 was evaluated using
MTT (3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide), which is a
yellow tetrazole that is reduced to purple formazan metabolite in viable cells.
Cell Line Ras-
GTP
ERα Invasion P-HER2 P-ERK P-AKT
MCF-7 + ++ - - + +
SKBR-3 ++ - - ++ + +
MDA-MB-231 ++ - + - ++ +
MDA-MB-468 ++ - - - ++ ++
T-47D + ++ - - ++ +
Table 4: Genotype of Breast Cancer Cell Lines
SCH-527123 is able to inhibit cancer cells across a wide spectrum of
phenotypes and genotypes. MCF-7 and T-47D are breast cancer cells that
overexpress estrogen receptors (ERα); whereas SKBR-3 cells over express
HER-2 receptors. MDA-MB-231 and MDA-MB-468 cells are negative for HER-2,
ERα and Progesterone receptors and are more commonly called triple negative
breast cancer (TNBC). Due to the absence of these receptors, individuals with

34

this type of breast cancer are often more likely to encounter disease relapse or
resistance. Furthermore, MDA-MB-231 cells are invasive cells with high
metastatic potential.
In addition to its direct antitumor activity, it is hypothesized that SCH527123 also
can also interfere with the communication between tumor and its
microenvironment. The role of IL-8 in tumor migration and angiogenesis may
suggest that assays to verify their activity may be a better predictor of antitumor
activity.
To assess the ability to block cancer migration, wound healing scratch
assay on MDA-MB-231 and MDA-MB-468 cells were evaluated. Both of these
are TNBC, however, MDA-MB-231 is known to be PTEN mutated and more
invasive than the K-RAS mutated MDA-MB-468 cells. These mutations can also
affect the mTOR pathway to promote cancer survival and proliferation. However
the differences in their ability migrate may suggest involvement of other
pathways such as Akt and MAPK.
The role of IL-8 in VEGF independent angiogenesis has been linked to
chemotherapy resistance. Using tube formation assay in the presence of
SCH527123, at greater than 15 µM, significant inhibition of tube formation was
demonstrated. In this assay, considerable delay in the process of
‘morphogenesis’ or ‘aggregation’ of endothelial cells was apparent in cells treated
with SCH-527123. Untreated control cells were able to form tubes in the collagen
matrix. However at concentrations of above 15 µM, SCH527123 was able to

35

reduce the number and the size of tube formed. These findings suggest that the
primary antitumor activity may be inhibition of angiogenesis. They findings
suggest that SCH527123 is able to inhibit tumor migration and angiogenesis.
To determine how SCH527123 exert its antitumor activity, we treated
MDA MB 231 and SKBR3 at the IC50 for each cell line. The mRNA was
harvested and the level of chemokine and their respective receptors were
evaluated in comparisons to untreated cells. SCH527123 was able to repress
the expression of chemokines such as CXCL1, CXCL2 and CXCL8 (IL-8) in MDA
MB 231. Similar findings were seen in SKBR3 when treated with SCH527123,
however the expression of CXCL2 appeared to be increase in the presence of
CXCR2 blockaded. No statistically significant changes in CXCR1 expression
were seen. However, the expression of CXCR2 appears to increase in the
presence of SCH527123.
Evaluation of downstream expression of phospholipase D1 was also
evaluated, where no difference in the expression was seen in MDA MB 231.
However a significant increase in PLD1 was seen in SKBR3 cells treated with
SCH527123. This may suggest a compensatory response to CXCR2 blockade,
where longer treatments or dosage escalation studies may help dissect this
finding.
2.4. Conclusion
Based on our results, we would be able to conclude that SCH-527123 has
a potential antitumor activity. Although direct antitumor cytotoxicity was attained

36

at higher concentrations, it was found at physiologically achievable doses that
SCH527123 is able to block tumor migration. Moreover at 15 µM, SCH527123
was able to inhibit endothelial cells recruitment and tumor formation. To further
enhance the potency of SCH527123, chemical optimization by increase
hydrophilicity and reduce protein binding may increase free levels of
SCH527123-like compounds and enhance its antitumor properties.

37

3. CHAPTER 3: CONCLUSION
3.1. Introduction
Interleukin-8 or CXCL-8 is the prototype of the angiogenic chemokines in
Table 5: Classification of CXC Family based on ELR domain their N terminus.

ELR(+) chemokines ELR(-) chemokines
CXCL-1 or Growth Related Oncogene α
(GROα)

CXCL-2 or Growth Related Oncogene β
(GROβ)

CXCL-3 or Growth Related Oncogene γ
(GROγ)

CXCL-4
CXCL-5 or Epithelial derived neutrophil
attractant 78 (ENA-78)

CXCL-6 or Granulocyte chemotactic protein-2
(GCP-2)

CXCL-7 or Neutrophil activating peptide-2
(NAP-2)

CXCL-8 or Interleukin-8 (IL-8)
CXCL-9
CXCL-10
CXCL-11
CXCL-12 or Stroma derived
factor 1(SDF-1) (exception:
angiogenic)

38

the CXC chemokine family. These chemokines, called as ELR(+) chemokines,
have a characteristic three-amino-acid structural domains of Glu-Leu-Arg (ELR),
at Table 5 collates CXC chemokine family based on the presence of the
structural domain.(Snoussi et al., 2010)
Apart from being the prototype of the angiogenic signaling, IL-8 is a known
potent leukocyte chemoattractant. It is also shown to possess significant
mitogenic properties.
The biological effects of IL-8 are mediated by two G-protein coupled
receptors (GPCRs) CXCR-1 and CXCR-2. Pharmacologically, IL-8 and GCP-2
can activate CXCR-1 whereas CXCR-2 is activated by IL-8, GRO-α,β and γ,
NAP-2 and GCP-2. (Waugh & Wilson, 2008)
3.1.1. Structural Details and Binding Properties of CXCR1 and CXCR2
As was established from the table1, the two cytokine receptors CXCR1
and CXCR2 bind to different ligands, despite the similarity of over 75% in their
amino acid domains. This suggests a difference in the mechanism of activation of
these receptors. As mentioned earlier, CXCR1 and CXCR-2 belong to the GPCR
class of receptors which have seven transmembrane domains. Although the
structure of either one has not been established yet, studies utilizing the CXCR-4
receptor model and other GPCRs, along with site-directed mutagenesis and
other techniques coming up with a chimeric CXCR1/2 receptor have deduced
three possible divergent regions in these receptors: amino terminus, EC2 and
cytoplasmic terminus. Site directed mutagenesis show that the amino terminus

39

and EC1 (Glu7, Asp9 and Glu12) are critical for IL-8 binding on CXCR2. EC-2 is
critical for binding on CXCR-1. Additionally, Cys residues of CXCR2 are highly
associated with IL-8 binding, including Cys119, Cys196 and Cys 308 (Wu et al.,
1996).
Structural activity association of the ligand reveals that the amino terminus
of IL-8 is important for binding and affinity. Two residues, Tyr13 and Lys15 in the
amino terminus of CXCR1 were found to be critical for binding. Further, two N-
glycosylation sites were located on the CXCR2 receptors found in the
neutrophils. It has been suggested that Asn17 and Asn197 are these candidates
for glycosylation.(Nasser et al., 2009; Nasser et al., 2007)
While activation of most of the GPCRs, after phosphorylation or activation
of the G-protein, it gets internalized via the Clathrin coated vesicles mediated
pathway. Another difference in the functionality of CXCR1 and CXCR2 is their
rate of internalization after activation from IL-8. CXCR2 internalises faster- 2-5
min after activation and recovers much slower than the CXCR1. This implies
although IL-8 binds to CXCR1 and CXCR2, it binds to CXCR2 for considerably
longer duration.(Wu, et al., 1996)
Literature shows that the stressed tumor microenvironment increases the
production and release of IL-8, which triggers many signaling pathways directly
or indirectly. This activity assists the tumor cells to grow and flourish. (Li, et al.,
2003; Murphy, 1994; Waugh & Wilson, 2008; Yao et al., 2007; Yao et al., 2006)

40

3.1.2. SCH-527123 has Potential Anti-angiogenic and Anti-migration
Effects
IL-8 signaling plays a key role in development of tumor microenvironment
and cancer progression. Angiogenesis, migration and chronic inflammation are
key determinants of the process of tumorigenesis and tumor proliferation. We
have used SCH-527123, an anti-inflammatory agent used for the treatment of
asthma, as a prototype compound to determine whether this is a good target for
anticancer drug development. We have confirmed anti-angiogenic and anti-
migration activity as a consequence of CXCR1/2 receptor blockade. Others who
have evaluated them as potential antitumor activity further support this data.
These finding suggest that blockade of CXCR2 and/or CXCR1 receptor may be
good targets for drug development. Future in-vitro and in-vivo studies to confirm
anti-angiogenesis and anti-migration activity will need to use Boyden chamber,
migration, invasion chamber assay would be helpful in further detailed
assessment. Moreover, it would be interesting to stimulate the cells with
extraneous administration of IL-8 and possibly block its signaling via SCH-
527123. Since neutrophil proliferation in the tumor microenvironment appears to
be critical in tumor progression and survival, co-culture assays may help define
the communication between tumor and neutrophils.
3.1.3. SCH-527123 has potential anti-cancer effects
Our data in the breast cancer model showed that SCH-527123 has
potential anti-cancer properties. The cytotoxic activity may be not be linked to its

41

anti-activity since higher concentrations are necessary to achieve IC50. These
findings need to be verified in xenograft tumor bearing models.. Future studies in
co-culture experiments with neutrophils, condition media, which simulate tumor
microenvironment may provide informative information as to the role of tumor
microenvironment in cancer proliferation. Our laboratory has data demonstrating
the in vivo activity of SCH527123, where the tumor from treated animals had
reduced number of neutrophils in the tumor parenchyma. This finding suggests

Figure 9: Combination of SCH-527123 and Doxorubicin causes growth inhibition in
MDA-MB-231 cells. Growth inhibition was determined by MTT assay at 48 H post-
treatment with increasing concentrations of (A) Doxorubicin (White histograms); (B)
SCH-527123 (White histograms); (C) Combination of varying concentrations of SCH-
527123 with Doxorubicin(10nM). Cells were treated with media containing 10% FBS.
Bars represent mean ± SD percent untreated time-matched controls, set at 100%.
.
MDA-MB-231 48h
1 5 10 100 500 1000
0
25
50
75
100
125
SCH
SCH+10nM Dox
Dox
Dox (nM)
1 10 50 100 250 500 SCH ( M)
Concentration
% Control

42

that SCH527123 is tolerable and able to inhibit tumor proliferation, which
coincides with its antitumor properties.
To further understand the role of CXCR2 inhibitor in cancer therapy, we
have explored its activity when combined with traditional anticancer
chemotherapy. Combination with Doxorubicin was shown to be providing
additive to synergistic activity. Our preliminary data in Figure 9 clearly shows
potent additive effects at SCH-527123 concentration 1µM, which become
significant at 50µM when combined with 10nM doxorubicin. Future studies on
tumor microenvironment as well as in-vivo animal studies in mice would be
required to analyze this. However, our data shows evidence of SCH-527123 as a
potential chemotherapeutic; which could be combined with other anti-cancer
agents for therapy. Our results also provide evidence that the axis of IL-8
signaling in tumor microenvironment could provide possible solutions in
conjugation with other known cancer therapeutics. Future studies would provide
more understanding in this respective.

43

BIBLIOGRAPHY
American Cancer Society. Cancer Facts & Figures 2011. Atlanta: American
Cancer Society; 2011.
Balkwill, F., & Mantovani, A. (2001). Inflammation and cancer: back to Virchow?
Lancet, 357(9255), 539-545.
Bonnans, C., Vachier, I., Chavis, C., Godard, P., Bousquet, J., & Chanez, P.
(2002). Lipoxins are potential endogenous antiinflammatory mediators in
asthma. Am J Respir Crit Care Med, 165(11), 1531-1535.
Carmeliet, P., & Jain, R. K. (2011). Molecular mechanisms and clinical
applications of angiogenesis. Nature, 473(7347), 298-307.
Cavallo, F., De Giovanni, C., Nanni, P., Forni, G., & Lollini, P. L. (2011). 2011:
the immune hallmarks of cancer. Cancer Immunol Immunother, 60(3),
319-326.
Charo, I. F., & Ransohoff, R. M. (2006). The many roles of chemokines and
chemokine receptors in inflammation. N Engl J Med, 354(6), 610-621.
Chen, Y., Chen, L., Li, J. Y., Mukaida, N., Wang, Q., Yang, C., et al. (2011). ERβ
and PEA3 co-activate IL-8 expression and promote the invasion of breast
cancer cells. Cancer Biol Ther, 11(5), 497-511.
Chen, Y., Hao, H., He, S., Cai, L., Li, Y., Hu, S., et al. (2010). Lipoxin A4 and its
analogue suppress the tumor growth of transplanted H22 in mice: the role
of antiangiogenesis. Mol Cancer Ther, 9(8), 2164-2174.
Chiang, N., Arita, M., & Serhan, C. N. (2005). Anti-inflammatory circuitry: lipoxin,
aspirin-triggered lipoxins and their receptor ALX. Prostaglandins Leukot
Essent Fatty Acids, 73(3-4), 163-177.
Chouaib, S., Kieda, C., Benlalam, H., Noman, M. Z., Mami-Chouaib, F., &
Rüegg, C. (2010). Endothelial cells as key determinants of the tumor
microenvironment: interaction with tumor cells, extracellular matrix and
immune killer cells. Crit Rev Immunol, 30(6), 529-545.
Clària, J., & Planagumà, A. (2005). Liver: the formation and actions of aspirin-
triggered lipoxins. Prostaglandins Leukot Essent Fatty Acids, 73(3-4), 277-
282.

44

DeNardo, D. G., & Coussens, L. M. (2007). Inflammation and breast cancer.
Balancing immune response: crosstalk between adaptive and innate
immune cells during breast cancer progression. Breast Cancer Res, 9(4),
212.
Diegelmann, R. F., & Evans, M. C. (2004). Wound healing: an overview of acute,
fibrotic and delayed healing. Front Biosci, 9, 283-289.
Dunn, G. P., Old, L. J., & Schreiber, R. D. (2004). The three Es of cancer
immunoediting. Annu Rev Immunol, 22, 329-360.
Dvorak, H. F. (1986). Tumors: wounds that do not heal. Similarities between
tumor stroma generation and wound healing. N Engl J Med, 315(26),
1650-1659.
Ford, C. H., Al-Bader, M., Al-Ayadhi, B., & Francis, I. (2011). Reassessment of
estrogen receptor expression in human breast cancer cell lines.
Anticancer Res, 31(2), 521-527.
Gillitzer, R., & Goebeler, M. (2001). Chemokines in cutaneous wound healing. J
Leukoc Biol, 69(4), 513-521.
Hanahan, D., & Weinberg, R. A. (2000). The hallmarks of cancer. Cell, 100(1),
57-70.
Heidemann, J., Ogawa, H., Dwinell, M. B., Rafiee, P., Maaser, C., Gockel, H. R.,
et al. (2003). Angiogenic effects of interleukin 8 (CXCL8) in human
intestinal microvascular endothelial cells are mediated by CXCR2. J Biol
Chem, 278(10), 8508-8515.
Hembruff, S. L., & Cheng, N. (2009). Chemokine signaling in cancer: Implications
on the tumor microenvironment and therapeutic targeting. Cancer Ther,
7(A), 254-267.
Joimel, U., Gest, C., Soria, J., Pritchard, L. L., Alexandre, J., Laurent, M., et al.
(2010). Stimulation of angiogenesis resulting from cooperation between
macrophages and MDA-MB-231 breast cancer cells: proposed molecular
mechanism and effect of tetrathiomolybdate. BMC Cancer, 10, 375.
Kinzler, K. W., & Vogelstein, B. (1996). Lessons from hereditary colorectal
cancer. Cell, 87(2), 159-170.
Klaunig, J. E., Kamendulis, L. M., & Hocevar, B. A. (2010). Oxidative stress and
oxidative damage in carcinogenesis. Toxicol Pathol, 38(1), 96-109.

45

Lacroix, M., & Leclercq, G. (2004). Relevance of breast cancer cell lines as
models for breast tumours: an update. Breast Cancer Res Treat, 83(3),
249-289.
Li, A., Dubey, S., Varney, M. L., Dave, B. J., & Singh, R. K. (2003). IL-8 directly
enhanced endothelial cell survival, proliferation, and matrix
metalloproteinases production and regulated angiogenesis. J Immunol,
170(6), 3369-3376.
Lorusso, G., & Rüegg, C. (2008). The tumor microenvironment and its
contribution to tumor evolution toward metastasis. Histochem Cell Biol,
130(6), 1091-1103.
Machado, F. S., Johndrow, J. E., Esper, L., Dias, A., Bafica, A., Serhan, C. N., et
al. (2006). Anti-inflammatory actions of lipoxin A4 and aspirin-triggered
lipoxin are SOCS-2 dependent. Nat Med, 12(3), 330-334.
Medzhitov, R. (2008). Origin and physiological roles of inflammation. Nature,
454(7203), 428-435.
Moll, N. M., Cossoy, M. B., Fisher, E., Staugaitis, S. M., Tucky, B. H., Rietsch, A.
M., et al. (2009). Imaging correlates of leukocyte accumulation and
CXCR4/CXCL12 in multiple sclerosis. Arch Neurol, 66(1), 44-53.
Murphy, P. M. (1994). The molecular biology of leukocyte chemoattractant
receptors. Annu Rev Immunol, 12, 593-633.
Naldini, A., Filippi, I., Miglietta, D., Moschetta, M., Giavazzi, R., & Carraro, F.
(2010). Interleukin-1β regulates the migratory potential of MDAMB231
breast cancer cells through the hypoxia-inducible factor-1α. Eur J Cancer,
46(18), 3400-3408.
Nasser, M. W., Raghuwanshi, S. K., Grant, D. J., Jala, V. R., Rajarathnam, K., &
Richardson, R. M. (2009). Differential activation and regulation of CXCR1
and CXCR2 by CXCL8 monomer and dimer. J Immunol, 183(5), 3425-
3432.
Nasser, M. W., Raghuwanshi, S. K., Malloy, K. M., Gangavarapu, P., Shim, J. Y.,
Rajarathnam, K., et al. (2007). CXCR1 and CXCR2 activation and
regulation. Role of aspartate 199 of the second extracellular loop of
CXCR2 in CXCL8-mediated rapid receptor internalization. J Biol Chem,
282(9), 6906-6915.
Nathan, C. (2002). Points of control in inflammation. Nature, 420(6917), 846-852.

46

Nelson, D., & Ganss, R. (2006). Tumor growth or regression: powered by
inflammation. J Leukoc Biol, 80(4), 685-690.
Noonan, D. M., Pennesl, G., & Albini, A. R.G. Bagley (ed.), The Tumor
Microenvironment, Cancer Drug Discovery and Development, DOI
10.1007/978-1-4419-6615-5_10, © Springer Science+Business Media,
LLC 2010.
Orimo, A., Gupta, P. B., Sgroi, D. C., Arenzana-Seisdedos, F., Delaunay, T.,
Naeem, R., et al. (2005). Stromal fibroblasts present in invasive human
breast carcinomas promote tumor growth and angiogenesis through
elevated SDF-1/CXCL12 secretion. Cell, 121(3), 335-348.
P, A., G, G., F, M., & A, M. (2010). Chemokines in cancer related inflammation.
EXPERIMENTAL CELL RESEARCH 317 (2011) 664-673.
Petasis, N. A., Akritopoulou-Zanze, I., Fokin, V. V., Bernasconi, G., Keledjian, R.,
Yang, R., et al. (2005). Design, synthesis and bioactions of novel stable
mimetics of lipoxins and aspirin-triggered lipoxins. Prostaglandins Leukot
Essent Fatty Acids, 73(3-4), 301-321.
Petrulio, C. A., Kim-Schulze, S., & Kaufman, H. L. (2006). The tumour
microenvironment and implications for cancer immunotherapy. Expert
Opin Biol Ther, 6(7), 671-684.
Peyri, N., Berard, M., Fauvel-Lafeve, F., Trochon, V., Arbeille, B., Lu, H., et al.
(2009). Breast tumor cells transendothelial migration induces endothelial
cell anoikis through extracellular matrix degradation. Anticancer Res,
29(6), 2347-2355.
Polyak, K., Haviv, I., & Campbell, I. G. (2009). Co-evolution of tumor cells and
their microenvironment. Trends Genet, 25(1), 30-38.
Queen, M. M., Ryan, R. E., Holzer, R. G., Keller-Peck, C. R., & Jorcyk, C. L.
(2005). Breast cancer cells stimulate neutrophils to produce oncostatin M:
potential implications for tumor progression. Cancer Res, 65(19), 8896-
8904.
Rakoff-Nahoum, S. (2006). Why cancer and inflammation? Yale J Biol Med,
79(3-4), 123-130.
Ribatti, D., Mangialardi, G., & Vacca, A. (2006). Stephen Paget and the 'seed
and soil' theory of metastatic dissemination. Clin Exp Med, 6(4), 145-149.

47

Serhan, C. N. (1997). Lipoxins and novel aspirin-triggered 15-epi-lipoxins (ATL):
a jungle of cell-cell interactions or a therapeutic opportunity?
Prostaglandins, 53(2), 107-137.
Serhan, C. N. (2007). Resolution phase of inflammation: novel endogenous anti-
inflammatory and proresolving lipid mediators and pathways. Annu Rev
Immunol, 25, 101-137.
Serhan, C. N., & Savill, J. (2005). Resolution of inflammation: the beginning
programs the end. Nat Immunol, 6(12), 1191-1197.
Singh, S., Sadanandam, A., Nannuru, K. C., Varney, M. L., Mayer-Ezell, R.,
Bond, R., et al. (2009). Small-molecule antagonists for CXCR2 and
CXCR1 inhibit human melanoma growth by decreasing tumor cell
proliferation, survival, and angiogenesis. Clin Cancer Res, 15(7), 2380-
2386.
Snoussi, K., Mahfoudh, W., Bouaouina, N., Fekih, M., Khairi, H., Helal, A. N., et
al. (2010). Combined effects of IL-8 and CXCR2 gene polymorphisms on
breast cancer susceptibility and aggressiveness. BMC Cancer, 10, 283.
Strieter, R. M., Burdick, M. D., Mestas, J., Gomperts, B., Keane, M. P., &
Belperio, J. A. (2006). Cancer CXC chemokine networks and tumour
angiogenesis. Eur J Cancer, 42(6), 768-778.
Svensson, C. I., Zattoni, M., & Serhan, C. N. (2007). Lipoxins and aspirin-
triggered lipoxin inhibit inflammatory pain processing. J Exp Med, 204(2),
245-252.
Waris, G., & Ahsan, H. (2006). Reactive oxygen species: role in the development
of cancer and various chronic conditions. J Carcinog, 5, 14.
Waugh, D. J., & Wilson, C. (2008). The interleukin-8 pathway in cancer. Clin
Cancer Res, 14(21), 6735-6741.
Weigelt, B., Peterse, J. L., & van 't Veer, L. J. (2005). Breast cancer metastasis:
markers and models. Nat Rev Cancer, 5(8), 591-602.
Whiteside, T. L. (2008). The tumor microenvironment and its role in promoting
tumor growth. Oncogene, 27(45), 5904-5912.
Wu, L., Ruffing, N., Shi, X., Newman, W., Soler, D., Mackay, C. R., et al. (1996).
Discrete steps in binding and signaling of interleukin-8 with its receptor. J
Biol Chem, 271(49), 31202-31209.

48

Yacoubian, S., & Serhan, C. N. (2007). New endogenous anti-inflammatory and
proresolving lipid mediators: implications for rheumatic diseases. Nat Clin
Pract Rheumatol, 3(10), 570-579; quiz 571 p following 589.
Yao, C., Lin, Y., Chua, M. S., Ye, C. S., Bi, J., Li, W., et al. (2007). Interleukin-8
modulates growth and invasiveness of estrogen receptor-negative breast
cancer cells. Int J Cancer, 121(9), 1949-1957.
Yao, C., Wang, S. M., Xie, D., Wu, H. X., Chen, D. Y., & Lin, Y. (2006). [The
relationship between expression of interleukin-8 and prognosis of breast
cancer]. Zhonghua Wai Ke Za Zhi, 44(13), 900-903.
Zitvogel, L., Tesniere, A., & Kroemer, G. (2006). Cancer despite
immunosurveillance: immunoselection and immunosubversion. Nat Rev
Immunol, 6(10), 715-727.

Abstract (if available)

Abstract There is interplay between the malignant tumor cells and their non-malignant counterparts found in the microenvironment. This active bi-directional cross-talk between cancer cells and normal host cells has profound implications for tumor survival, proliferation and progression. Chemokines play a key role in cancer related inflammation and angiogenesis. Several evidences in chemokine system reveal that they affect multiple pathways of tumor progression including: leukocyte recruitment, neo-angiogenesis, tumor cell proliferation and survival, invasion and metastasis. Interleukin-8 or IL-8 is the prototype of the angiogenic chemokine family. IL-8 signaling plays a key role in development of tumor microenvironment and cancer progression. Angiogenesis, migration and chronic inflammation are key determinants of the process of tumorigenesis and tumor proliferation. We have used SCH-527123, an anti-inflammatory agent used for the treatment of asthma, as a prototype compound to determine whether this is a good target for anticancer drug development. We assessed growth inhibition and migration by MTT and colony formation assay and wound healing scratch assay in breast cancer cellular model. We studied effect on angiogenesis by tube formation assay on HMEC endothelial cells. We have confirmed anti-angiogenic and anti-migration activity as a consequence of CXCR1/2 receptor blockade, as seen from gene expression data. ❧ In conclusion, our data in the breast cancer model showed that SCH-527123 has potential anti-cancer properties. The cytotoxic activity may be not being linked to its anti-activity since higher concentrations are necessary to achieve IC50. These findings need to be verified in xenograft tumor bearing models.. Future studies in co-culture experiments with neutrophils, condition media, which simulate tumor microenvironment may provide information as to the role of tumor microenvironment in cancer proliferation.

Linked assets

University of Southern California Dissertations and Theses

Conceptually similar

PDF

Identification of small-molecules targeting CXCR2 function and signaling

PDF

Discovery of novel small molecules targeting cancer cell metabolism

PDF

Development of novel small molecules targeting mitochondrial and oxidative stress signaling pathways for pancreatic cancer therapy

PDF

Modulation of transcription and receptor function with synthetic small molecules and multi-finctional integrin ligands

PDF

Interleukin-11: a study of its effects in glioblastoma multiforme

PDF

Monoamine oxidase and cancer

PDF

Synthetic small molecules and protein secondary structure mimetics as modulators of hypoxia-inducible transcription and integrin receptors function

PDF

Design of novel anticancer agents targeting cellular stress response pathways

PDF

MAO a deficient mice exhibit an altered immune system in the brain and prostate

PDF

Discovery of novel small molecules for ovarian cancer treatment

PDF

Contribution of cancer associated fibroblasts to cancer progression

PDF

Understanding anti-angiogenic signaling and treatment for cancer through mechanistic modeling

PDF

Development of engineered antibodies as novel anti-cancer agents

PDF

Role of inflammation in prostate carcinogenesis and prostate cancer growth

PDF

APOC2 presents a viable therapeutic target in cancer

PDF

Mechanistic modeling of angiogenic factors network and cancer therapy

PDF

Targeting cellular redox modulations for pancreatic cancer treatment

PDF

Discovery of small molecules for brain cancer treatment

PDF

Mechanism of action of rapamycin and its applications in aging, cancer therapy and metabolism

PDF

Novel approaches of mobilizing human iNKT cells for cancer immunotherapies

Asset Metadata

Creator Sharda, Nidhi (author)

Core Title Blockade of CXCR2 as a novel approach for cancer chemotherapy

School School of Pharmacy

Degree Master of Science

Degree Program Pharmaceutical Sciences

Publication Date 05/09/2012

Defense Date 05/08/2012

Publisher University of Southern California (original), University of Southern California. Libraries (digital)

Tag angiogenesis,cancer,chemotherapy,CXCR2,IL8,Inflammation,OAI-PMH Harvest

Language English

Contributor Electronically uploaded by the author (provenance)

Advisor Louie, Stan G. (committee chair), Duncan, Roger (committee member), Olenyuk, Bogdan (committee member)

Creator Email ms.nidhisharda@gmail.com,sharda@usc.edu

Permanent Link (DOI) https://doi.org/10.25549/usctheses-c3-36653

Unique identifier UC11288347

Identifier usctheses-c3-36653 (legacy record id)

Legacy Identifier etd-ShardaNidh-823.pdf

Dmrecord 36653

Document Type Thesis

Rights Sharda, Nidhi

Type texts

Source University of Southern California (contributing entity), University of Southern California Dissertations and Theses (collection)

Access Conditions The author retains rights to his/her dissertation, thesis or other graduate work according to U.S. copyright law. Electronic access is being provided by the USC Libraries in agreement with the a...

Repository Name University of Southern California Digital Library

Repository Location USC Digital Library, University of Southern California, University Park Campus MC 2810, 3434 South Grand Avenue, 2nd Floor, Los Angeles, California 90089-2810, USA