University of Southern California Dissertations and Theses

Genetic manipulation of receptor interacting protein (RIP140) uncovers its critical role in the regulation of metabolism, gene expression and insulin signaling in skeletal muscle cells

(USC Thesis Other)

Genetic manipulation of receptor interacting protein (RIP140) uncovers its critical role in the regulation of metabolism, gene expression and insulin signaling in skeletal muscle cells

PDF

Download a page range

Download transcript

Copy asset link

Request this asset

Transcript (if available)

Content

GENETIC MANIPULATION OF RECEPTOR INTERACTING PROTEIN (RIP140)
UNCOVERS ITS CRITICAL ROLE IN THE REGULATION OF METABOLISM,
GENE EXPRESSION AND INSULIN SIGNALING IN SKELETAL MUSCLE CELLS

by
Silvana Constantinescu

A Dissertation Presented to the
FACULTY OF THE USC GRADUATE SCHOOL
UNIVERSITY OF SOUTHERN CALIFORNIA
In Partial Fulfillment of the
Requirements for the Degree
DOCTOR OF PHILOSOPHY
(INTEGRATIVE AND EVOLUTIONARY BIOLOGY)

May 2012

Copyright 2012 Silvana Constantinescu

ii

DEDICATION

I dedicate this thesis in memory of my grandmother, Evdochia who taught me the real
values of life and to never give up my dreams

iii

ACKNOWLEDGMENTS

It is my greatest pleasure to thank the many people who have helped and inspired
me during my doctoral study.
Foremost, I would like to express my sincere gratitude to my advisor Dr Lorraine
Turcotte for her continuous support, inspiration, patience and knowledge. Without your
immense help, I would have not succeeded. I wish every graduate student to be so lucky
to have an advisor, mentor and, friend as Dr Turcotte. You are the best and I could not
have asked for anybody else.
My sincere thanks go to all members of the Integrative and Biology Department
of the University of Southern California for offering me the opportunity to do research
here. My warm thanks go to my committee for helping and assisting me in many different
ways throughout my doctoral study.
I wish to thank my parents, Angelica and Alexandru Constantinescu. Their
unconditional love and support allowed me to travel so far from home and to fulfill my
dreams. Although my father is no longer with us, he is forever remembered. I am sure he
would have been very proud and would have shared my joy today. To them I also
dedicate this thesis.
Last but not least, I am greatly indebted to my devoted husband, Vicentiu Grosu. I
find it difficult to express my appreciation because it is so boundless. Thank you so much
for your faithful love and endless understanding during these long years. I know that it

iv

was not always easy for you. I am so lucky to have you beside me, in the past, present,
and future. So it only seems right that I also dedicate this dissertation to you.

v

TABLE OF CONTENTS

DEDICATION .................................................................................................................... ii
ACKNOWLEDGMENTS ................................................................................................. iii
LIST OF TABLES ............................................................................................................ vii
LIST OF FIGURES ......................................................................................................... viii
ABBREVIATIONS ........................................................................................................... ix
ABSTRACT ....................................................................................................................... xi
CHAPTER I: INTRODUCTION ........................................................................................ 1
CHAPTER II: BACKGROUND AND SIGNIFICANCE .................................................. 6
CHAPTER III: EXPERIMENT 1 ..................................................................................... 36
ABSTRACT ............................................................................................................ 36
INTRODUCTION ................................................................................................... 37
MATERIALS AND METHODS ............................................................................ 39
RESULTS................................................................................................................ 46
DISCUSSION ......................................................................................................... 49
FIGURES ................................................................................................................ 56
CHAPTER IV: EXPERIMENT 2 ..................................................................................... 62
ABSTRACT ............................................................................................................ 62
INTRODUCTION ................................................................................................... 63
MATERIALS AND METHODS ............................................................................ 66
RESULTS................................................................................................................ 73
DISCUSSION ......................................................................................................... 76
FIGURES ................................................................................................................ 83
CHAPTER V: LIMITATIONS AND SOLUTIONS ........................................................ 94
CHAPTER VII: SUMMARY ........................................................................................... 96
CHAPTER VIII: CONCLUSION................................................................................... 100

vi

REFERENCES ............................................................................................................... 102
APPENDICES ................................................................................................................ 125
APPENDIX A: TABLES ...................................................................................... 125
APPENDIX B: POWERPOINT PRESENTATION ............................................. 127

vii

LIST OF TABLES

Table 1. Primers Sequences used in RT-PCR ................................................................. 125
Table 2. Primers Conditions ........................................................................................... 126

viii

LIST OF FIGURES

Figure 1. Schematic of nuclear receptor mechanism of function. ...................................... 5
Figure 2. Schematic representation of LCFA uptake in skeletal muscle. ......................... 11
Figure 3: Schematic Representation of FA transport. ....................................................... 16
Figure 4. Schematic representation of the insulin signaling pathway. ............................. 20
Figure 5. Schematic of nuclear receptor classification. .................................................... 27
Figure 6. RIP140 down-regulation in L6 muscle cells. .................................................... 56
Figure 7. Effects of RIP140 down-regulation on metabolism .......................................... 57
Figure 8. Effects of RIP140 down-regulation on mRNA expression in L6 muscle cells. 59
Figure 9. Effects of RIP140 down-regulation on protein content in L6 muscle cells. ..... 61
Figure 10. Effects of RIP140 down-regulation (high FA) ................................................ 83
Figure 11. Effects of RIP140 down-regulation on metabolism (high FA) ....................... 85
Figure 12. Effects of RIP140 down-regulation on mRNA expression (high FA) ............ 89
Figure 13. Effects of RIP140 down-regulation on protein content (high FA) .................. 93

ix

ABBREVIATIONS

AcetylCoA = Acetylcoenzyme A
Akt/PKB = Akt/Protein Kinase B (acute transforming retrovirus thymoma)
ATP = Adenosine Triphosphate
COX4 = cytochrome c oxidase subunit 4 isoform 1
CPT1 = carnitine palmytoiltransferase 1
ER = Estrogen Receptor
ETC = Electron Transport Chain
FA = Fatty Acid
FABP
C
= Fatty Acid Binding Protein Cytosolic
FADH
2
= Flavin Adenine Dinucleotide
FAT/CD36 = Fatty Acid Translocase/Cluster of Differentiation 36
FATP1 = Fatty Acid Transport Protein 1
FGF21 = Fibroblast Growth Factor 21
GAPDH = Glyceraldehyde 3-phosphate dehydrogenase
GLUT4 = Glucose Transporter 4
IMTG = Intramyocellular Triglycerides
IR = Insulin Receptor
IRS1 = Insulin Receptor Substrate 1
LCFA = Long Chain Fatty Acid

x

MCAD = Medium Chain AcylCoA Dehydrogenase
NADH+H
+
= Nicotine Adenine Dehydrogenase
NF-κB = Nuclear Factor-kappa B
Nur77 = Nerve Growth Factor IB (NGFIB, also known as Nur77)
PDK1 = Pyruvate Dehydrogenase Kinase 1
PGC-1α α α α = Peroxisome Proliferator-activated Receptor Gamma Aoactivator-1 alpha
PI3-K = Phosphatidylinositol 3-kinase
PI-3,4-P2 = Phosphatidylinositol (3,4)-bisphosphate
PI-3,4,5-P3 = Phosphatidylinositol (3,4,5)-trisphosphate
PI-4,5-P2 = Phosphatidylinositol (4,5)-bisphosphate
PKC-ζ ζ ζ ζ = Atypical Protein Kinase-ζ
PPAR = Peroxisome Proliferator-Activated Receptor
PTEN = Phosphatase and Tensin Homolog
PTP1B = Protein Tyrosine Phosphatase 1B
RIP140 = Receptor Interacting Protein 140
RT-PCR = Reverse transcription polymerase chain reaction
SHIP2 = SH2-containing Inositol Phosphatase 2
siRNA = Small interfering RNA
TAG = Triacylglycerol
T2DM = Type 2 diabetes

xi

ABSTRACT

Oxidative capacity is commonly assessed by measuring the content and the
activity of key mitochondrial enzymes and there is evidence suggesting that oxidative
capacity is regulated by multiple regulatory factors which include among others, the
actions of positive and negative nuclear factors on the transcriptional regulation of
oxidative enzymes. Of specific interest is the role played by the nuclear co-repressor
identified as Receptor Interacting Protein 140 (RIP140). RIP140 has been shown to be
highly expressed in skeletal muscle and to inhibit mitochondrial biogenesis and oxidative
capacity. In line with its role as a negative regulator of oxidative capacity, there is
evidence suggesting that in adipose tissue RIP140 deletion increases cellular respiration
and protein expression of cytochrome c. However, the role of RIP140 on fatty acid (FA)
metabolism had not been fully delineated, especially as it relates to insulin sensitivity in
skeletal muscle cells.
Thus this dissertation project contains two experiments aimed at determining the
role of low RIP140 expression in the regulation of basal and insulin-mediated FA
metabolism in skeletal muscle cells under normal or short-term high FA treatment. Given
the putative role of RIP140 as a negative regulator of oxidative capacity, the purpose of
these studies was to determine in skeletal muscle cells 1) whether genetic down-
regulation of RIP140 expression would increase oxidative capacity and improve insulin
sensitivity in normal cells and cells exposed to short-term high FA treatment and 2)

xii

whether metabolic alterations would be associated with alterations in the mRNA and/or
protein content of enzymes and proteins involved in metabolic regulation and signaling
under both conditions. To accomplish our aims, we used L6 rat skeletal muscle cells and
assessed insulin sensitivity by measuring the effects of insulin on glucose uptake and FA
uptake and oxidation under normal and short-term high FA treatment.
The findings in the first study provide novel information regarding the role of
RIP140 in the regulation of FA metabolism and implicate the AKT-PKC-ζ axis of the
insulin signaling pathway in the high rates of insulin-mediated FA oxidation observed in
L6 cells with low RIP140 expression. Multiple studies have shown that a rise in the
activity of mitochondrial oxidative enzymes is often, though not always, accompanied by
an increase in FA oxidation. However, our data showed that, under control conditions in
skeletal muscle cells, while the protein or mRNA content of some oxidative enzymes
(COX4) was increased, the content of other important FA oxidative enzymes (MCAD,
CPT1) was reduced. Conversely, the activity of proximal insulin signaling intermediates
was reduced. Given that the inhibitory action of insulin on FA oxidation was similarly
reduced in RIP140-treated cells, our data suggest that proximal insulin signaling is
critical for proper regulation of FA metabolism and that low RIP140 expression affects
the activation of these signaling intermediates.
Data from the second study provide further evidence for the involvement of
RIP140 in the regulation of FA metabolism and metabolic signaling. In this study, L6

xiii

cells with or without low RIP140 expression were incubated with high FA for 36 h. Our
results showed that high FA exposure alone affected the mRNA and/or protein expression
of several proteins involved in the regulation of FA metabolism including FA transport
proteins and oxidative enzymes. In muscle cells incubated with high FA, low RIP140
expression rescued basal FA uptake and basal and insulin-mediated glucose uptake, but it
did not affect basal or insulin-mediated FA oxidation. In line with these metabolic
alterations, low RIP140 expression was able to rescue some of the changes induced by
high FA exposure via alterations in the activation state of signaling intermediates (e.g.:
AKT) or changes in mRNA and/or protein expression of specific FA transporter proteins
(e.g.: FAT/CD36) or oxidative enzymes (e.g.: CPT1). Taken together, our data suggest
that low RIP140 expression may partially mitigate the negative impact of short-term FA
exposure on metabolic regulation and cellular signaling.
In summary, our results provide additional information regarding the role of
RIP140 in the regulation of FA metabolism, gene expression and most importantly in
metabolic signaling in skeletal muscle cells. More studies will be needed in order to
decipher the cellular mechanisms that regulate the RIP140-mediated cellular changes
observed in our experiments.

1

CHAPTER I: INTRODUCTION

Type 2 diabetes (T2DM) is a disease that has spread worldwide and that is in
continuous growth and associated with high morbidity and mortality (Hogan et al., 2003).
It has been suggested that worldwide, 366 million people will have become diabetic by
2030 and that 30.3 million of these patients will reside in the United States (Wild et al.,
2004). T2DM is one of the most expensive diseases in developed nations and worldwide
(Sabetsky & Ekblom, 2010). The International Federation of Diabetes estimates that in
developed countries approximately 6% of health care costs is spent on T2DM treatment
(Sabetsky & Ekblom, 2010). In the United States, data show that health care costs for
patients with T2DM increases by 100 billion dollars every year (Wild et al., 2004;
Sabetsky & Ekblom, 2010). Given that in the United States, approximately 66% of the
population is either obese or overweight and that this percentage is increasing every year
especially in teenagers (Ogden et al., 2010), the health care costs associated with the
treatment of T2DM will continue to go up for many years to come. Because the rise in
obesity and T2DM has taken epidemic proportions, research efforts are under way to
determine the factors that led to this rise.
It has been suggested by some that the pathogenesis of obesity is linked to our
evolution (Neel, 1962; Zimmet & Thomas, 2003; Lev-Ran, 2001).

2

The evolution of hominids and of our own species has been profoundly shaped by
diet and fluctuations in energy balance (Neel, 1962). As such, it has been suggested that
T2DM is due to a response of metabolic efficiency to fluctuating food supply; an
adaptation that was beneficial to our ancestors (Campell & Cajigal, 2001). In contrast, the
modern lifestyle is characterized by an abundance of food and a reduction in energy
expenditure. Given our gene pool, these two factors have facilitated the development of
obesity and T2DM. Because of the amplitude of the disease worldwide and the high
health care costs associated with the treatment of T2DM, it is important to determine the
molecular mechanisms behind this disease.
T2DM is characterized by the presence of insulin resistance and it is well
accepted that the pathogenesis of insulin resistance is multifactorial. These factors have
been shown to include among others dysfunctional regulation of metabolism, impaired
insulin signaling, and altered activity of transcription factors. There is some evidence
suggesting that transcription factors are molecules that play important roles in the
regulation of homeostatic systems including those systems associated with the regulation
of metabolic processes (Mangelsdorf & Evans, 1995). However, very few studies have
investigated the role of inappropriate regulation by transcription factors in the
development of insulin resistance. Transcription factors are molecules that bind to
specific DNA sequences and thus they can control the transfer of genetic information
from DNA to mRNA. Transcription factors can activate (coactivators) or repress
(corepressors) target genes. Transcription factors do not work alone in activating or

3

repressing the target gene and their function is dependent on the type of coregulator
present at the promoter site. Coactivators such as PGC-1α open the chromatin allowing
the transcriptional machinery to transcribe the gene into mRNA while corepressors have
opposite function, blocking the transcription. Figure 1 shows the schematic representation
of how coactivators and corepressors affect gene transcription.
Of specific interest to the development of insulin resistance is the corepressor
identified as receptor interacting protein 140 (RIP140). RIP140 has been implicated in
the regulation of multiple metabolic processes (Fritah, 2009) and as such it is highly
expressed in metabolic tissues (Leonardsson et al., 2004). Because RIP140 plays a
significant role in adipogenesis, RIP140 function has been studied extensively in this type
of cells where it has been shown to affect the expression of genes that regulate adipose
cell formation (Leonardsson et al., 2004). A better understanding of RIP140 function also
comes from studies done in RIP140-null mice (Steel et al., 2005). Results from these
studies suggest that RIP140 improves insulin sensitivity (Fritah, 2009) by increasing
mitochondrial biogenesis, FA oxidation and oxidative phosphorylation (Catalán et al.,
2009). Most of the data related to RIP140, however, comes from studies done in 3T3L1
adipocytes and to the best of our knowledge, very little is known about RIP140’s role in
the regulation of metabolism in L6 myotubes. Given that in skeletal muscle, insulin
resistance is associated with a reduction in oxidative capacity and that a reduction in

4

RIP140 expression could lead to an improvement in insulin sensitivity, we propose to
investigate the role of RIP140 in the regulation of metabolism in rat skeletal muscle cells.
The main goals of this dissertation were 1) to provide evidence for the role of
RIP140 in the regulation of muscle metabolism and, 2) to elucidate the pathways by
which RIP140 may improve insulin sensitivity in skeletal muscle. For my experiments,
the L6 cell line will be used. This cell line was established by chemical transformation of
neonatal rat thigh skeletal muscle (Yaffe, 1968) and it had been used extensively by us
and others (Klip et al., 1982; Kelly et al., 2005). L6 muscle cells express all the necessary
glucose and FA transporter proteins and these cells have many of the morphological,
biochemical and metabolic properties of skeletal muscle (Yaffe, 1968). Lastly, and most
importantly for our studies, muscle cells are easier to manipulate genetically making this
cell line an excellent model to determine RIP140’s effect in the regulation of muscle
metabolism and the expression of signaling intermediates. In my studies, I will inhibit
RIP140 mRNA expression by genetically inhibiting its translation. This will be done via
incubation of L6 cells with an inhibitory oligonucleotide sequence called siRNA.

5

Figure 1. Schematic of nuclear receptor mechanism of function.
A corepressor (RIP140) binds to specific response elements on a nuclear receptor. This binding
blocks gene transcription. A coactivator (PGC1) binds to specific response elements on a nuclear
receptor and this binding facilitates gene transcription. Adapted from (Benkoussa et al., 2002).

6

CHAPTER II: BACKGROUND AND SIGNIFICANCE

The nutritional requirements of modern humans are significantly different from
those of our ancestors and these differences have had great evolutionary impact over time
(Eaton & Konner, 1997). In early times, our human ancestors consumed mostly
vegetables and animal matters depending on the availability of food sources (Gordon,
1987). About 2.5 million years ago a major global cooling began which led to an increase
in grassland environments in Africa causing a change in the density and distribution of
high quality plant foods. This climate change attracted to the region more animals. At that
time, hominids started to eat more animal foods. Because consuming more meat increases
the intake of proteins and FA, such as long-chain polyunsaturated fatty acids (PUFA)
(Leonard & Robertson, 1994), some have suggested that this change in food intake
patterns favored a reduction in molar size and cranial size and changes in incisor shape
(Leonard & Robertson, 1994). However, early human-gathers’ food intake pattern was
such that they would eat a large number of calories when food was available but only a
small number of calories when food was not plentiful. Evolution-wise survival advantage
was given to individuals who possessed a genome with “thrifty genes” (Lazar, 2005;
Zimmet & Thomas, 2003). The “thrifty” genes that were incorporated into the human
genome provided for an efficient utilization of food and conversion of extra calories as
stored fat (Wendorf & Goldfine, 1991). Together, these genes have been called “thrifty
genes”, because an individual with “thrifty genes” was able to gain weight during periods

7

of plenty, and the stored substrates were used during periods of starvation. Taking into
account that modern times are characterized by a sedentary lifestyle and high availability
of high caloric foods, it has been hypothesized that the presence of “thrifty genes” in our
genome may have become deleterious to our health and has led to the epidemic of T2DM
in developed nations (Zimmet & Thomas, 2003).
Numerous studies show that T2DM is characterized by the presence of insulin
resistance (Chandalia & Abate, 2003). Insulin resistance is generally defined as the
inability of an individual to adequately respond to insulin’s cellular signals (Schenk et al.,
2008) and, in research is often assessed by measuring individual’s glycemic response to
an insulin load. As such an individual’s response to an insulin load can be viewed as an
index of metabolic flexibility (Kelley, 2005). However insulin resistance is not caused by
the derangement of one physiological factor. Rather, it is well accepted that insulin
resistance is a multifactorial disease. Factors that have been shown to impair insulin
action include among others dysfunctional regulation of metabolism, impaired insulin
signaling and altered activity of transcription factors. In line with this, my research will
focus on the role played by one specific transcription factor in the pathogenesis of insulin
resistance. I chose to focus on the receptor interacting protein (RIP140) for two reasons.
First, in general, the roles of transcriptional factors in the development of insulin
resistance have not been well delineated and my studies will yield novel data that will
help unravel their mechanism of action. Secondly, and more specifically, I chose to focus
on RIP140 because it has been shown to be a negative regulator of oxidative capacity.

8

Given that low oxidative capacity has been described as a critical metabolic factor in the
development of insulin resistance (Kelley, 2005), inhibition of RIP140 expression in
skeletal muscle cells should yield an improvement in insulin sensitivity. Several
experimental models exist to mimic high fat-induced insulin-resistance state. In my
studies, insulin resistance will be induced by exposing skeletal muscle cells to high FA
availability. When using L6 skeletal muscle cells, treatment of cells with high
concentrations of palmitic acid for 8-48 hours has been shown to be a predictable way to
reduce insulin-stimulated glucose uptake and perturb the activity of insulin signaling
intermediates (Sinha et al., 2004).
Given that in developed nations high fat diets are the most prevalent mechanisms
by which insulin resistance is induced, this model of insulin resistance seemed the most
appropriate mechanistically. Furthermore, I will manipulate the levels of RIP140 by
incubating the cells with an mRNA product (RNA
i
) that will produce an inactive RIP140.

Insulin resistance (IR) and dysfunctional regulation of metabolism
Skeletal muscle represents the largest tissue in the human body which comprises
40% of the body’s mass and it is a key tissue for glucose and fat utilization (Benton et al.,
2008). In recent

years, data have shown that dysregulated lipid metabolism is associated
with insulin resistance (Boden, 1997). Data have shown that there is a negative

relationship between insulin-stimulated glucose uptake and intramuscular

lipid
accumulation, including tri-and diacylglycerols, long-chain

fatty acyl-CoAs, and

9

ceramide (Itani et al., 2002). Metabolically, in skeletal muscle, the role of insulin is to
stimulate the uptake of glucose (Gottesman et al., 1983; Schultz et al., 1977) and FA and
to inhibit FA oxidation (Dyck et al., 2001).
In normal cells, insulin stimulates glucose uptake via facilitated diffusion.
Glucose uptake requires the presence of glucose transporters (GLUT4) which are
translocated from the cytosol to the plasma membrane to facilitate glucose transport (Bell
et al., 1993) and the insulin-stimulated glucose transport

can be reduced by altering the
intrinsic activity of cell surface

GLUT4 (Moon et al., 2003). In contrast, in insulin-
resistant conditions characterized by an impairment in insulin action, skeletal muscle and
other tissues fail to properly respond to circulating levels of insulin (Le Marchand-Brustel
et al., 2003). The insulin action impairment leads to suboptimal insulin-induced GLUT4
translocation (Saltiel & Kahn, 2001) and, therefore glucose is not efficiently cleared from
the circulation (Benton et al., 2008). In addition, high-fat feeding which potentially lead
to insulin resistance appears to lower

the intrinsic activity of GLUT4 (Tremblay et al.,
2001) and therefore the glucose uptake, basally and in insulin-mediated conditions.
In skeletal muscle, as mentioned before, insulin stimulates FA uptake, reduces FA
oxidation and increases FA esterification leading to an accumulation of TAG (Dyck et
al., 2001; Dyck et al., 2001). A prolonged insulin-resistant states such as obesity and
T2DM can be associated with an increase in plasma long-chain FA and an accumulation
of IMTG derivatives such as DAG, ceramides and long-chain acyl-CoA (Boden et al.,

10

2001). The accumulation of these intermediates decrease the activity of the insulin
signaling cascade (Boden et al., 2001).
FAs are important substrates for most mammalian tissues. Because FA have a
hydrophobic structure, it has been suggested that FA can be sequestered by cells through
passive diffusion across the plasma membrane (Hamilton, 1998) or via a protein-
mediated mechanism (Abumrad et al., 1998) (Fig. 2). Several FA transport proteins have
been identified: FA-binding protein (FABPpm) (Luiken et al., 2001), FA translocase
FAT/CD36) (Ibrahimi et al., 1996) and FA transport protein (FATP1) (Hirsch et al.,
1998). FATP1 correlates inversely with FA transport in muscle and heart (Luiken et al.,
2001). In vivo and in vitro evidence has shown that insulin facilitates the translocation of
the intracellular FAT/CD36 to the plasma membrane, thereby promoting FA uptake
(Luiken et al., 2002) (Fig. 2). There is evidence suggesting that under basal conditions a
mutation in FAT/CD36 can lead to reduction in FA uptake in heart, skeletal muscle and
adipose tissue and that the effect of insulin on FA uptake is significant impaired in
FAT/CD36 null-mice (Glatz et al., 2010).

11

Figure 2. Schematic representation of LCFA uptake in skeletal muscle.
Alb: (albumin); CD36: FA translocase; FABP
C
: cytoplasmic FA binding protein; LCFA: (long
chain fatty acid). Adapted from (Zhang et al., 2010; Turcotte, 2006).

LCFA uptake across the plasma membrane has two steps: 1) uptake across the endothelium to the
interstitial space (transendothelial transport) and 2) transport across the plasma membrane
(transsarcolemmal) to the cytosol via proteins FAT/CD36 and FATP1. LCFA circulates in blood
bound to Alb; each albumin molecule can bind 8-10 LCFA molecules and the sites present on
albumin fill as plasma LCFA increases. LCFA dissociates from albumin and passes the
endothelium after which it binds to albumin in the interstitial space. At the sarcolemmal level, FA
dissociated from albumin binds to FA transport proteins such as FAT/CD36 and FATP1 and it is
transported into the cytosol. In the cytosol, FA binds then to a FABP
C
.

12

In addition, basal FA uptake is increased in skeletal muscle giant vesicles and
cardiac myoctes from obese, pre-diabetic Zucker rats (Luiken et al., 2001), but the
increase in FA transport is not associated with an increase in total expression of
FAT/CD36, but rather with an increase in FAT/CD36 at the cell surface (Luiken et al.,
2001). During transition from insulin resistance to T2DM as in high fat fed rats and
diabetic Zucker rats, CD36 translocation and the increase in basal FA uptake are
accompanied by a reduction in basal and insulin-stimulated glucose uptake (Glatz et al.,
2010).
In fact, the permanent relocation of FAT/CD36 at the plasma membrane leads to a
high FA uptake and it represents an early event in the development of insulin resistance
(Glatz et al., 2010).
There is some evidence from studies done in cultured cells that FATP1 is also a
FA transporter that converts FA to FA acyl-CoA, due to its acyl CoA synthase activity
(Hirsch et al., 1998). Under hyperinsulinemic conditions, high-fat diet causes an
elevation in FATP1 protein content

in soleus muscle, and a reduction in the
gastrocnemius muscle (Kiens, 2006). Insulin induces FATP1 translocation from an
intracellular compartment and this event is coincidental with an increase in FA uptake,
suggesting that FATP1 may be involved in FA uptake (Wu et al., 2006) Studies done in
rats and humans (Boden, 1997) suggest that FAT/CD36 and FATP1 are present at the
plasma membrane and mitochondrion and because FAT/CD36 can co-immunoprecipitate

13

with CPT1 (Stremmel, 1988), it has been suggested that FAT/CD36, FATP1 and CPT1
are involved in the regulation of FA oxidation (Glatz et al., 2010).
Oxidative capacity is commonly assessed by measuring the content and activity of
key mitochondrial enzymes (Turcotte, 2006). The insulin-resistant muscle is
characterized by low oxidative capacity that is associated with reduced basal rates for FA
oxidation, and increased insulin-mediated FA oxidation (Turcotte, 2006). Beta-oxidation
of FA occurs in mitochondria, where LCFA are transported as long-chain fatty acyl CoA
(LCFA-CoA). LCFA-CoAs are transported by the carnitine shuttle across the inner and
outer mitochondrial membranes. First, acyl-CoA is converted into acyl-carnitine which
can then cross the outer mitochondrial membrane via the acyl carnitine/carnitine
translocase system (CPT-I) (Hopkins et al., 2003) (Fig. 3). This step catalyzed by CPT1
is considered to be a critical regulatory step for FA oxidation (Turcotte, 2006). CPT1 is
highly regulated by malonyl-CoA levels. Given that malonyl-CoA is a potent inhibitor of
CPT1 (McGarry et al., 1983), high malonyl-CoA levels have been shown to be associated
with low rates of FA oxidation. By lowering malonyl-CoA, the inhibitory effect on CPT1
is diminished and FA can enter the mitochondria. Because malonyl-CoA levels are
elevated during hyperglycemia, it was suggested that malonyl-CoA might be responsible
for high FA oxidation under such conditions (Turcotte & Fisher, 2008).
Additionally, because oxidative capacity is low in insulin resistance, it was
suggested that the muscle activity of CPT1 is reduced in association with obesity (Kiens,
2006) and thus CPT1 is often measured in experiments (Pimenta et al., 2008).

14

Medium chain acyl-CoA dehydrogenase (MCAD) is another enzyme important
for FA metabolism. MCAD is a mitochondrial flavoenzyme which catalyzes the rate-
limiting initial reaction in FA β-oxidation (Kelly et al., 1989). The enzyme is regulated
by energy substrate supply (Nagao et al., 1993) and a reduction in MCAD expression is
associated with a reduction in β-oxidation (Rodriguez-Calvo et al., 2006). MCAD
deficiency is one of the most common defect in FA oxidation (Wang et al., 2002) and it
has been shown that the enzyme activity is controlled by the nuclear receptor estrogen
related receptor (ERR) (Sladek et al., 2001) and coactivated by PGC-1α, an important
regulator involved in oxidative phosphorylation in skeletal muscle (Rodriguez-Calvo et
al., 2006).
On the other hand, ERR is able to activate the transcription of RIP140 gene (Seth
et al., 2007). A reduction in the expression of RIP140 increases MCAD expression in
myoblasts (Seth et al., 2007) and therefore is associated with an increase in FA oxidation,
suggesting a putative role of RIP140 in the regulation of FA oxidation.
In summary, high FA availability causes a reduction in insulin-stimulated glucose
uptake and an increase in insulin-stimulated FA oxidation. Because of their roles
mediating these processes FAT/CD36, FATP1 and MCAD represent important molecules
in the regulation of glucose and FA metabolism and changes in their expression will be
measured.

15

Once FAs are taken up across the plasma membrane via CD36/FATP1 they bind
to FABP
C
. Once inside the cytosolic compartment of the cells and before entering the
mitochondria where FA are oxidized, long-chain FA are activated to fatty acyl-CoA by
appropriate acetyl-CoA synthetase. The acyl group of long-chain acyl CoA is then
transferred to carnitine via CPT1 located on the outer mitochondrial membrane. On the
inner membrane of the mitochondria there is a translocase that facilitates the transport of
fatty acyl carnitine into the mitochondrial matrix. In concert with the translocase, CPT-2
also located on the inner mitochondrial membrane catalyzes the transfer of fatty acyl
from fatty acid-carnitine back to fatty acyl-CoA. Fatty acyl-CoA are oxidized via β-
oxidation pathway. The end product of this pathway, acetyl-CoA, is further metabolized
via the Krebs cycle whose main end-products are reduced equivalents (FADH
2
and
NADH+H
+
). The reduced equivalents are oxidized via the electron transport chain whose
final products are ATP and CO
2
.
AcetylCoA: Acetylcoenzyme A; ATP: adenosine triphosphate; ETC: electron
transport chain; FABP
C
: fatty acid binding protein cytosolic; FADH
2
: flavin adenine
dinucleotide; FAT/CD36: fatty acid translocase/cluster of differentiation 36; FATP1:
fatty caid transport protein 1; MCAD: medium chain AcylCoA dehydrogenase;
NADH+H
+
: nicotine adenine dehydrogenase. Adapted from (Zhang et al., 2010;
Holloway et al., 1997).

16

Figure 3: Schematic Representation of FA transport.

17

Insulin Resistance and Insulin Signaling Pathway
As mentioned above, impairment in the insulin signaling pathway is another main
factor contributing to the development of insulin resistance. In skeletal muscle, insulin
stimulates glucose uptake and FA uptake and decreases FA oxidation (Dyck et al., 2001).
Some studies suggest that the effects of insulin on FA metabolism occur via activation of
the phosphatidylinositol 3-kinase (PI3-K)-dependent insulin signaling pathway (Luiken et
al., 2002) and this is a highly regulated and complex process.
The insulin receptor (IR) is a cell-surface receptor with intrinsic tyrosine kinase
activity (Marchand-Brustel et al., 2003). Physiologically, the activation of the IR leads to
the phosphorylation of some key tyrosine residues located on insulin receptor substrate
(IRS) proteins, such as IRS-1 (Khan & Pessin, 2002). IR contains two extracellular α-
subunits and two transmembrane β-subunits linked by disulphide bonds (Marchand-
Brustel et al., 2003) (Fig. 4). Those tyrosine residues are recognized by proteins that have
phosphotyrosine-binding domains (PTB), such as members of IRS family (Saltiel &
Kahn, 2001).
IRS-1 links the activated insulin receptor to the downstream signaling proteins.
IRS-1 contains two functional regions, the NH
2
-terminal and the COOH-terminal, which
binds to the Src-homology 2 (SH2) domain of various signaling proteins. The NH
2
-
terminal domain contains a pleckstrin homology domain (PH) followed by a
phosphotyrosine domain (PTB), which together mediate interactions with activated

18

receptors (Myers et al., 1995). Phosphorylation of IRS-1 facilitates its interaction with the
p85 subunit of phosphatidylinositol 3-kinase (PI3-K) (Farese, 1996). The interaction of
IRS-1 with the p85 subunit of PI3-K leads to the activation of the p110 subunit of PI3-K,
thereby causing an increase in the conversion of PI-4,5-P2 to PI-3,4,5-P3 within the
plasma membrane (Farese, 2001). PI3-K in turn activates phosphoinositide-dependent
kinase-1 (PDK1), which activates protein kinase B (Akt/PKB), (Kirwan & Del Aguila,
2003) and atypical protein kinase C zeta/lambda (PKCζ/λ) (Chou et al., 1998). PI3-K
activation is crucial and it may transmit multiple signals to other downstream molecules.
For many years, PI3-kinase’s role in the regulation of FA uptake was uncertain.
Following the interaction of insulin with its receptor, the insulin receptor becomes
phosphorylated. The phosphorylated receptor facilitates the phosphorylation of IRS-1 at
which time it becomes a better substrate for PI3-K. Active PI3-K phosphorylates PI-4,5-
P2 to form PI-3,4,5-P3. PTEN is an enzyme that facilitates the conversion of PIP3 to PI-
4,5-P2. SHIP2 catalyzes the conversion of PIP
3
to PI-3,4-P2. Once produced, PIP3
interacts with PDK1, increasing the activity of PDK1 and leading to the phosphorylation
of Akt and aPKC-ζ. Activated/phosphorylated aPKC-ζ and Akt stimulate GLUT4
translocation to the plasma membrane, facilitating glucose uptake in response to insulin
binding to its receptor. Akt/PKB: protein kinase B; GLUT4: Glucose transporter 4; IRS-
1: Insulin receptor substrate-1; PDK1: Pyruvate dehydrogenase kinase; PI3-K:
Phosphatidylinositol 3-kinase; PI-3,4-P2: Phosphatidylinositol (3,4)-bisphosphate; PI-

19

4,5-P2: Phosphatidylinositol (4,5)-bisphosphate; PI-3,4,5-P3: Phosphatidylinositol
(3,4,5)-trisphosphate; aPKC-ζ ζ ζ ζ: atypical protein kinase-ζ; PTEN: Phosphatase and tensin
homolog; PTP1B: protein tyrosine phosphatase; SHIP2: SH2-containing inositol
phosphatase-2. Adapted from (Giri et al., 2004).

20

Figure 4. Schematic representation of the insulin signaling pathway.

21

However, recently Karen Kelley a graduate student in our lab showed that when
PI3-K was inhibited with wortmannin, insulin-stimulated FA uptake was reduced (Kelly
et al., 2008). However, while her data showed that aPKC-ζ regulates FA uptake, it also
suggested that aPKC-ζ does not regulate FA oxidation (Kelly et al., 2008). At the
molecular level, insulin resistance is associated with a reduction in glucose uptake due to
a reduction in phosphorylation of the tyrosine residues on IRS-1 and to a reduced
activation of PI3-K. Akt and PKC-ζ are two intermediates from the insulin signaling
known to play a role in insulin resistance. There is evidence suggesting that the Ser 307
residue of the IRS-1 molecule plays a role in the desensitization of insulin action
(Draznin, 2008). This residue is located at the end of phosphotyrosine binding domain.
Ser 307 phosphorylation could be a possible hallmark of insulin resistance (Le
Marchand-Brustel et al., 2003). According to this notion, elevated levels of FA would
increase phosphorylation of Ser 307 on IRS-1and this would be accompanied by a
reduction in the phosphorylation of the tyrosine residues of IRS-1. High FA availability
has been linked to an increase in the phosphorylation of Ser 307 on IRS-1 (Berti et al.,
1997). High FA availability can perturb any intermediate from the insulin signaling
pathway. Two of such known intermediates are extensively studied. They are Akt/PKB
and more recently, aPKC-ζ. Akt/PKB is a serine/threonine protein kinase and in this
paper is referred as Akt.

22

Akt is a downstream target of IRS-1 and PI3-K and it plays numerous roles in
cellular signaling (Farese, 2001). Data have shown that in both 3T3L1 and L6 cells,
insulin activates Akt and this in turn, facilitates GLUT4 translocation and hence glucose
transport (Kohn et al., 1996; Hajduch et al., 1998). Numerous studies have been
suggested that Akt is essential for skeletal muscle GLUT4 -mediated transport (Ueki et
al., 1998). Akt is a serine/threonine kinase and several members have been described:
Akt1, Akt2, and Akt3 and of those only Akt1 and Akt2 are expressed in skeletal muscle
(Cho et al., 2001). Furthermore, Akt1 appears to play a more important role in the
regulation of lipid metabolism, while Akt2 appears to be mostly involved in the
regulation of glucose metabolism (Sakamoto & Holman, 2008). To support this
observation, (Jiang et al., 2003) deleted Akt1 and/ or Akt2 using RNA silencing
technology in 3T3L1 cells. The results provided additional data suggesting a less
important role of Akt1 in glucose transport. Some findings suggest that in obese and
T2DM individuals the activity of Akt2 and Akt3 are defective, while Akt1 shows only an
impairment of Ser473 phopshorylation. Other Akt1 residues, such as threonine 308
(Thr308) are important for normal Akt1 functionality (Brozinick Jr et al., 2003).
Akt activation in response to physiological insulin concentrations is normal in
T2DM individuals (Krook et al., 1998), but the activation is blunted at higher (60nmol/l)
insulin concentrations. Reduced insulin-stimulated Akt activity in skeletal muscle from
individuals with T2DM was explained by a reduction in phosphorylation of Thr308, and
it was associated with a decrease in Akt-mediated AS160 phoshorylation (Karlsson et al.,

23

2005). Akt/PKB activation can also be impaired following incubation with high
concentrations of palmitate (Dimopoulos et al., 2006).
In mammals, PKC isoforms are classified as follows: classical PKC (α, βI, βII),
novel PKC (δ, ε, θ, η) and atypical PKC (ζ, λ, τ) and they may be all involved in the
development of insulin resistance and T2DM. The classical PKCs can lead to insulin
receptor (IR) degradation and then inhibition of the kinase activity of IR through
serine/threonine phosphorylation of the β-subunit of IR or IRS-1(Newton, 1995). A
reduction in the expression of conventional PKCs has been associated with insulin
resistance and T2DM as well (Schmitz-Peiffer et al., 1997). Additionally, there is some
evidence suggesting that the downregulation of atypical protein kinase C isoforms
(aPKCs) is also involved in the etiology of skeletal muscle insulin resistance (Farese,
2002). Defective insulin-stimulated PKCζ/λ activity had been found in insulin-resistant
and diabetic individuals (Beeson et al., 2003), as well as in rodent models of insulin
resistance (Kanoh et al., 2003). aPKC is ubiquitously expressed and its role in the
regulation of insulin–stimulated glucose transport in myocytes and adipocytes is still
controversial. It is suggested that aPKC-ζ is a ceramide-activated protein kinase and that
DAG is not responsible for its activation (Arkan et al., 2005). Ceramides are elevated in
the skeletal muscle of insulin resistant rodents (Bourbon et al., 2002) and humans
(Holness et al., 2007) and ceramides have a negative effect on Akt through the activation
of aPKC-ζ (Bourbon et al., 2002), being responsible for the translocation of Akt at the

24

plasma membrane (Randle et al., 1963). It appears that ceramides dephosphorylate Akt at
Ser 473 site via activation of ceramide activated protein phosphatase (Begum et al.,
1996). Pimenta (2008) showed that preincubation of cells with palmitic acid can lead to
increased levels of DAG, LC-CoA and ceramides (Roden, 2004) and a deterioration in
cell muscle capacity to oxidize long-chain FA. These metabolites in turn interfere with
the insulin signaling pathway and thus, impairs insulin-stimulated glucose uptake in
skeletal muscle cells (Sinha et al., 2004). There is evidence suggesting that aPKC-ζ may
be involved in the regulation of FA metabolism. Our lab has shown that inhibition of
aPKC-ζ abolishes insulin-induced FA uptake, but the inhibition does not affect FA
oxidation (Kelly et al., 2005). Given that high FA availability has been shown to reduce
insulin-stimulated aPKC-ζ activity (Kim et al., 2003), this may be part of the cellular
mechanisms causing insulin resistance.
In summary, high FA availability impairs the functionality of some important
intermediates of insulin signaling pathway and such dysfunction is associated with
perturbation in glucose and FA metabolism. Because of their roles in the regulation of
glucose and FA metabolism, Akt and PKC-ζ will be measured under our experimental
conditions.

25

Insulin resistance and altered activity of transcription factors
Transcription factors and nuclear receptors can bind to specific DNA sequences
and thus they modulate the transcription of genes into RNA. Nuclear receptors are a
family of transcription factors that, in response to small lipophilic ligands, specifically
regulate the expression of target genes with role in development, differentiation,
metabolism, homeostasis, and reproduction (Jiang et al., 2010). Transcription factors
recruit the coregulators to genes promoters, thus activating (coactivators) or repressing
(corepressors) transcription. The nuclear receptor superfamily has been divided into three
groups of nuclear factors. They include the classic endocrine receptors that mediate the
actions of hormones and the orphan nuclear receptors that mediate the effects of various
disparate ligands (Fig. 5). The orphan nuclear receptors have been subdivided into 2
subgroups: the adopted orphan nuclear receptors for whom ligands have been identified
and the orphan nuclear receptors for whom ligands have yet to be clearly identified. The
last group includes the estrogen-related receptors (ERRs)-α,-β,-γ. Ligands are molecules
that bind to the ligand-binding-domain located at the COOH-terminal region of each
nuclear receptor and affect its function. Following ligand binding, the transcription
factors

undergo a conformational change that facilitates the recruitment of coactivator
proteins

to enable transcriptional activation (Chawla et al., 2001) hence gene expression.
Many of transcription factors and nuclear receptors regulate metabolic processes
(Mogenstein & Parker, 2007). In the following paragraph I will discuss about different

26

types of transcription and nuclear factors and how they can affect the regulation of
glucose and FA metabolism. In the end, I will introduce the fibroblast growth factor
(FGF), a family of factors known to contain members with important functions in the
regulation of different metabolic processes.

27

Figure 5. Schematic of nuclear receptor classification.
Androgen (AR), bile acids (FXR), vitamin D (VDR), estrogen (ER), glucocorticoid (GR),
hepatocyte nuclear factor-4 (HNF-4), liver X receptors (LXRs), mineralocorticoid (MR),
peroxisome proliferator activated receptors (PPARs), progesterone (PR), receptor interacting
protein 140 (RIP140), retinoic acid receptor (RAR), thyroid hormone receptor (TR). Adapted
from (Chawla et al., 2001).

28

RIP140
RIP140, also known as nuclear receptor interacting protein 1 (Nrip1) is a
transcription factor and a co-repressor for nuclear receptors (NR). This transcription
factor is a protein with a molecular weight of 140kDa, highly expressed in adipose tissue,
muscle and liver. RIP140 plays essential roles not only in female fertility, but in energy
homeostasis as well (Leonardsson et al., 2004). RIP140 was identified as a ligand-
dependent nuclear coactivator (Cavaillès et al., 1995). Nine typical receptor interacting
motifs (LXXLL) (Heery et al., 1997) (where L is leucine and X is any aminoacid) are
spread throughout the entire molecule and at the C-terminus end there is one atypical
receptor motif (LXXML) (Chen et al., 2002). LxxLL motif allows the protein to interact
with other nuclear receptors in a manner ligand dependent interaction. RIP140 expression
is regulated by estrogens (Thenot et al., 1999), retinoic acid (Kerley et al., 2001)
progestin (Graham et al., 2005), and vitamin D (Lim et al., 2004). This transcription
factor has numerous physiological roles (White et al., 2000). From knockout studies, we
learned that RIP140 knockout mice are lean and resistant to diet induced-obesity, because
these mice are characterized by elevated mitochondrial biogenesis, FA oxidation and
oxidative phosphorylation (Catalán et al., 2009). In fact, in a microarray study, (White et
al., 2004) showed that RIP140 knockout mice have numerous genes highly expressed.
Such genes are involved in the catabolism of carbohydrate and lipid metabolism, and thus
in different metabolic pathways such as lipogenesis, glycolysis, gluconeogenesis. Protein

29

kinase Cε (PKCε) can phosphorylate RIP140 on Ser 102 and Ser 1003. Phosphorylation
of RIP140 facilitate the interaction of RIP140 with 14-3-3, followed by RIP140
translocation to the cytoplasm (Gupta et al., 2005). Some studies suggest that RIP140
interacts directly with PPAR γ coativator 1-α suppressing its activity. This interaction
suggests a possible interplay of these two proteins in gene regulation (Hallberg et al.,
2008). RIP140 is also a coactivator of the nuclear factor-κB (NF-κB) and by this RIP140
is connected to inflammation processes (Zschiedrich et al., 2008). In 2006, Powelka
showed that silencing RIP140 in adipocytes can lead to an improvement in glucose
uptake. This observation was confirmed by Ho et al. in 2009. His group suggested that
RIP140 is involved in the negative regulation of basal and insulin-stimulated GLUT4
trafficking to the plasma membrane. In addition, same group suggested (Ho et al., 2008)
that adipocytes exposed to high FA availability will have elevated levels of total RIP140,
mainly due to an increase in the level of mRNA RIP140. The possible role of RIP140 in
the regulation of insulin signaling pathway was tested by Powelka in 2006. Using 3T3L1
cell line, the group found that silencing RIP140 did not significantly affect Akt
phosphorylation. This observation allows us to suggest that may be RIP140 is not
involved in the glucose metabolism, at least in 3T3L1.
In another study, mice were fed on high fat diet for 5 weeks, and at the end,
RIP140 levels were measured. The results showed elevated levels of RIP140, suggesting
a possible role for RIP140 in insulin resistance. Result from other studies, suggest that,

30

RIP140 null-mice have reduced weight gain when fed with high fat diet (Christian et al.,
2006) and these mice have significant improved glucose tolerance. Additionally, RIP140
null-mice have elevated levels of succinate dehydrogenase activity, suggesting that these
mice might have elevated number and/ or mitochondria activity and a higher number of
oxidative fibers(Seth et al., 2007). Most of the information about RIP140 comes from
studies conducted in adipocytes, but in 2007 (Seth et al., 2007) was able to provide
evidence for the role of RIP140 in the regulation of metabolism in skeletal muscle. The
author found that RIP140 mRNA levels were higher in glycolytic muscles such as
extensor digitorum longus (EDL) and gastronecmius (Seth et al., 2007) than in myotubes
generated from oxidative muscles (Morgan et al., 1994) such as EDL. Same group also
noticed that RIP140 null-mice have elevated levels of MCAD and FABP3 suggesting that
the upregulation of these two gene can be accompanied by an increase in FA uptake and
in FA oxidation levels (Fritah, 2009).

PGC-1α α α α
Another transcription factor is peroxisome-proliferator-activated receptor-gamma
co-activator 1 alpha (PGC-1α) which belongs to PGC1 family. PGC1-α is a coactivator
playing multiple roles in metabolic tissues (Morganstein & Parker, 2007). PGC-1α
transcription factor is highly responsive to a variety of environmental cues, from
temperature to nutritional status to physical activity and it coordinately regulates

31

metabolic pathways and biological processes in a tissue-specific manner. PGC-1
coactivator family includes peroxisome proliferator-activated receptor-γ coactivator
(PGC)-1α (PGC-1α), PGC-1β and PGC-1 related to co-activator (PRC) (Lin et al., 2002).
PGC-1α expression and function is tissue dependent and it is preponderantly expressed in
tissues with intense metabolic activity such as brown adipose tissue, liver, brain, heart
and skeletal muscle. PGC-1α is more abundant in slow-twitch type I fibers such as
soleus, rather than in EDL, a type II fiber muscle (Knutti et al., 2000). PGC1-α plays
roles in transcription of other receptors, such as ERRα, known to promote mitochondrial
biogenesis and in expression of genes involved in FA oxidation, such as MCAD (Huss et
al., 2002). (Lin et al., 2005) suggested that PGC1 family act as master regulators of
metabolism. These transcription factors are recruited by numerous nuclear receptors and
upregulate the expression of different genes, thus contributing to an increase in oxidative
metabolism. In individuals with T2DM, the expression of genes involved in oxidative
metabolism is reduced, and thus, the muscle of these individuals has low expression of
PGC1-α (Patti et al., 2003). PGC1-α and RIP140 play antagonistic roles in different
metabolic processes and these two factors appear to target similar genes (Morganstein &
Parker, 2007). PGC-1α is transcriptional regulated by diet and exercise (Benton et al.,
2008). In human skeletal muscle, six weeks of exercise training lead to an increase in
PGC1-α mRNA (Terada et al., 2002; Russell et al., 2003; Wright et al., 2007).
Furthermore, in humans, severe caloric restriction increases PGC-1α gene expression in

32

skeletal muscle of obese, but not in lean individuals (Benton et al., 2008). PGC-1α
protein levels are elevated in FAT/CD36 null-mice exhibiting reduced TG levels, but it
decreases in obese Zucker rats with elevated levels of TG (Benton et al., 2006). Recent
data suggest that PGC-1α protein levels are elevated in animals fed high fat diet (Turner
et al., 2007). The effects of high FA availability on PGC-1α are contradictory. In one
study, the reduction of FA, increased PGC-1α mRNA (Watt et al., 2004), whereas
(Russell et al., 2005) found that the reductions in circulating FA did not altered the
expression of PGC-1α. (Wende et al., 2007) reported that PGC-1α can interfere in
carbohydrate usage. The overexpression of PGC-1α increases basal glucose transport and
thus, PGC-1α is a contributing factor to glycogen storage (Wende et al., 2007).

Nur77
The nuclear hormone receptor (NR) 4A is a subgroup of orphan receptors
involved in different biological processes, such as the DNA repair (Pols & de Vries,
2008), cell apoptosis (Li et al., 2006) and metabolism The NR4A group contains three
members, Nur77 (also known as NR4A1, TR3, or NGF1-B), Nurr1 (also known as
NR4A2 or NOT) and NOR-1 (also known as NR4A3 or MINOR) (Myers et al., 2009;
Pols et al., 2007). These nuclear receptors have an activating function-1 (AF-1) domain
located at the N-terminal end, a central region containing two-zinc finger DNA domains
and a C-terminal domain containing the ligand-binding domain (LBD) (Mangelsdorf et

33

al., 1995). In cultured mouse hepatocytes, NR4A (Pols et al., 2007; Pearen et al., 2008;
Kanzleiter et al., 2005; Chao et al., 2007; Chao et al., 2007; Chao et al., 2007) receptors
are induced by glucagon (Pei et al., 2006). NR4A can induce gluconeogenesis in mice
through induction of several target genes (Pei et al., 2006). Nur77 is expressed in skeletal
muscle (Law et al., 1992) and mouse myoblasts (Yang & Lim, 1997). This factor is
responsive to β-adrenergic stimulation (Yang & Lim, 1997) and it is expressed
preferentially in glycolytic fiber types. In skeletal muscle denervated, Nur77 expression
is impaired and, thus it affects numerous genes linked to glucose metabolism. Evidence
from experiments in which Nur77 was genetically silenced suggest that Nur77 deletion is
accompanied by a reduction in expression of genes involved in glucose and glycogen
metabolism and in glycerophosphate shuttle (Chao et al., 2007; Zschiedrich et al., 2008).

FGF21
Fibroblast growth factor (FGF) include a group of peptide, known to be involved
in cell regulation, cells growth and other biological functions (Bottcher & Niehrs, 2005).
While, most of the members of this family have functions associated with mitosis,
development, survival, there is recent data suggesting that some members may modulate
various metabolic processes (Kharitonenkov et al., 2005). FGF21 is one of the 22
members of the FGF superfamily (Itoh & Ornitz, 2004). It is a protein expressed mainly
in liver. It is also present in adipose tissue, pancreas and muscle. Recent studies suggest a

34

novel role for FGF21 in the regulation of glucose homeostasis and lipid metabolism
(Kharitonenkov et al., 2005), but the mechanism of its action is not fully understood. The
expression of FGF21 is highly regulated by the nutrient availability. The protein is highly
expressed during the fasting periods (Inagaki et al., 2010). Recent studies suggest that in
adipocytes, FGF21 stimulate GLUT1 expression and glucose uptake (Inagaki et al., 2010;
Kharitonenkov et al., 2005). FGF21 also activates ERK pathway known to regulate the
activity of other transcriptional factors and genes (Kyosseva, 2004). Administration of
FGF21 improves metabolic parameters and reverses obesity. In addition, FGF21
increases energy expenditure and decreases the circulating glucose and lipid levels,
leading to an increase in insulin sensitivity (Kharitonenkov et al., 2005). FGF21 affects
are possible insulin independent and additive to insulin activity. FGF21 transgenic mice
fed high fat diet consume more food without gaining to much weight compared to the
control (Kharitonenkov et al., 2005). FGF21 is expressed in human skeletal muscle in
response to insulin (Hojman et al., 2009), but whether FGF21 and insulin signaling
pathway are working together or independently in regulating the glucose metabolism and
fat metabolism needs further investigation (Xu et al., 2009).
In summary, there is some evidence suggesting that some transcription factors and
nuclear receptors are involved in the regulation of metabolic processes in skeletal muscle.
Some of these factors are RIP140, PGC-1α, Nur77, FGF21. Given that their important
role in cell functionality, it is important to accumulate more data about these molecules

35

and to understand their mechanism of action in the regulation of glucose and FA
metabolism.
To conclude the Specific Aims for this thesis were 1) receptor interacting protein
140 (RIP140) expression is a important factor in the regulation of FA and glucose
metabolism and, 2) RIP140 expression is a contributing factor in the development of high
FA-induced insulin resistance.

36

CHAPTER III: EXPERIMENT 1

Genetic down-regulation of Receptor Interacting Protein 140 uncovers the
central role of AKT signaling in the regulation of fatty acid oxidation in skeletal
muscle cells
ABSTRACT
The role of the nuclear corepressor Receptor Interacting Protein 140 (RIP140) in
metabolic regulation, gene and protein expression and insulin signaling in skeletal muscle
cells remains to be delineated. To study this question, L6 myotubes were treated with or
without an RNAi oligonucleotide sequence to down-regulate RIP140 expression and
incubated with or without insulin (1 μM). RIP140 down-regulation increased (P<0.05)
basal palmitate uptake (20%) and decreased (P<0.05) basal palmitate oxidation (38%). In
control siRNA-treated cells, insulin increased (P<0.05) glucose (31%) and palmitate
(20%) uptake and decreased (P<0.05) palmitate oxidation (35%). However, in RIP140
siRNA-treated cells, insulin did not affect (P>0.05) palmitate uptake and increased
(P<0.05) palmitate oxidation (79%). As expected, RIP140 down-regulation was
accompanied by an increase (P<0.05) in COX4 and PGC-1α mRNA content. RIP140
down-regulation increased (P<0.05) FATP1 mRNA content and CPT1 protein content
and decreased (P<0.05) MCAD mRNA content under basal conditions. Under insulin-
mediated conditions, RIP140 down-regulation increased (P<0.05) CPT1, FAT/CD36,

37

FATP1mRNA content and decreased (P<0.05) MCAD mRNA content and plasma
membrane FAT/CD36 protein content. In line with the insulin-mediated changes in
palmitate uptake and oxidation, RIP140 down-regulation decreased (P<0.05) AKT
Ser473

and PKC-ζ
Thr403/410
phosphorylation but did not affect (P>0.05) AKT
Thr308

phosphorylation. Our data show that, in skeletal muscle cells, RIP140 expression
significantly impacts palmitate uptake and oxidation and that alterations in gene
expression and AKT-PKC-ζ signaling can partially explain these changes.

INTRODUCTION
In skeletal muscle, metabolic health is highly dependent on mitochondrial
function including the ability of the cell to oxidize fatty acids (FA) (Kim et al., 2008;
Muoio, 2010) and yet, much remains to be ascertained regarding the impact of various
intracellular factors on FA oxidation. It is generally accepted that oxidative capacity is
one of the more important factors regulating FA oxidative capacity in skeletal muscle
cells (Turcotte, 2006; Kiens, 2006). However, the impact of changes in oxidative capacity
on metabolic regulation is still highly debated (Lowell & Shulman, 2005; Simoneau &
Kelley, 1997; Rabol et al., 2006). While some studies have shown improvements in
metabolic regulation with increases in oxidative capacity (Bruce et al., 2003; Menshikova
et al., 2005; Simoneau & Kelley, 1997), other studies have shown that high oxidative
capacity does not correlate with metabolic health (Boushel et al., 2007; Irving et al.,

38

2011). Thus, the impact of changes in oxidative capacity on metabolic function in
skeletal muscle cells has yet to be fully elucidated.
Oxidative capacity is regulated by multiple regulatory factors which include
among others, the actions of positive and negative nuclear factors on the transcriptional
regulation of oxidative enzymes (Mogenstein & Parker, 2007; Scarpulla, 2006). Of
specific interest is the role played by the corepressor identified as Receptor Interacting
Protein 140 (RIP140). RIP140 has been shown to be highly expressed in differentiated
myotubes and in skeletal muscle, especially those composed of a high percentage of
glycolytic fibers (Fritah, 2009; Seth et al., 2007; Frier et al., 2011) and to inhibit
oxidative capacity (Seth et al., 2007). In line with its role as a negative regulator of
oxidative capacity, results have shown that RIP140 deletion increases cytochrome c
protein expression in 3T3-L1 adipocytes depleted of RIP140 and MCAD gene expression
in gastrocnemius muscle of mice devoid of RIP140 (Seth et al., 2007; Powelka et al.,
2006). Accordingly, low RIP140 expression might be expected by some to improve
metabolic function in skeletal muscle cells. However, the effects of RIP140 loss-of-
function on metabolic regulation in muscle cells during insulin stimulation remain to be
evaluated before a more exact determination of the metabolic role of RIP140 in skeletal
muscle can be elaborated.
Thus, the purpose of this study was to determine in skeletal muscle cells 1)
whether genetic down-regulation of RIP140 expression would increase oxidative capacity
and improve metabolic regulation and 2) whether changes in metabolic regulation would

39

be accompanied by changes in gene and/or protein expression of enzymes and proteins
involved in the regulation of FA metabolism and insulin signaling. Given the putative
role of RIP140 as a negative regulator of oxidative capacity, we hypothesized that
RIP140 down-regulation would increase markers of oxidative capacity and that this
would be associated with an improvement in metabolic regulation as well as with positive
changes in the expression of proteins involved in the regulation of FA metabolism and
insulin signaling. To accomplish our aims, we used the L6 skeletal muscle cell line and
disrupted RIP140 expression by delivering an adenovirus expressing a RIP140-specific
siRNA construct.

MATERIALS AND METHODS
Cell culture. L6 myotubes were cultured in α-minimal essential medium (α-
MEM)+ that was supplemented with 10% (v/v) fetal calf serum (FCS), 1% (v/v)
antimycotic antibiotic solution (Sigma Aldrich Ltd, St-Louis, MO) and 600 μM L-
carnitine hydrochloride (Sigma Aldrich Ltd, St-Louis, MO) in a humidified incubator at
37°C, 5% CO
2
. The α-MEM+ and FCS were purchased from Cell Culture Core Facility
(University of Southern California, Los Angeles, CA). Cells were grown in 75 cm2
sterile culture flasks, sub-cultured at 60-80% confluence and split at a ratio of 1:10 using
Trypsin-EDTA (Invitrogen Life Technologies, Grand Island, NY). For differentiation, the

40

myotubes were sub-cultured into six-well plates in the presence of supplemented α-
MEM+. By day 4, cells were 90-100% confluent and spontaneously differentiated into
myotubes. Media was replaced every 2-3 days. For experiments without siRNA
treatment, L6 myotubes were 7 days post-confluent on the day of the experiment. In
siRNA-treated L6 myotubes, siRNA treatment was initiated 2 days after sub-culturing
into six-well plates and experiments were performed 2 days later.
siRNA Transfection. Prior to transfection, cells were sub-cultured for 48 h in six-
well plates using antibiotics-free supplemented α-MEM+. Antibiotics were taken out
because they are toxic to cells during the transfection process (manufacturer’s protocol,
Invitrogen, Grand Island, NY). siRNA transfection was then initiated using
Lipofectamine™ 2000 reagent according to the manufacturer’s instructions (Invitrogen,
Grand Island, NY). Briefly (per well), Lipofectamine 2000 (100 pmol) and the siRNA
sequence (100 pmol; described below) were each combined with antibiotics-free
supplemented α-MEM+. The Lipofectamine/α-MEM+ and siRNA/α-MEM+ solutions
were mixed together. The antibiotics-free medium was removed from each well and
replaced by the freshly made siRNA/Lipofectamine/α-MEM+ cocktail. The cells were
incubated for 6 h after which time they were incubated for 24 h with antibiotics-free
supplemented α-MEM+. The cells were then treated for 12-14 h with fresh
supplementedα-MEM+. The custom-made sequence for RIP-140 was 5’-
3’GGAGUAACUCUGUCACC GATT and 3’-5’ UCGGUGACAGAGUUACUCCTG

41

(Applied BioSystems, Foster City, CA). The pre-designed siRNA sequences Silencer
Select (s155811) and Silencer Negative Control #1 were used as positive and negative
transfection controls (Applied BioSystems, Foster City, CA).
Cell Treatments. When required by the protocol, L6 myotubes (some of which
were previously transfected with siRNA; see above) were incubated for 12-14 h in
supplemented α-MEM+ and for 24 h in serum free supplemented α-MEM+. Immediately
prior to the measurement of palmitate uptake and oxidation or glucose uptake, the cells
were incubated (30 min, 37°C) in Krebs Ringer Hepes buffer (KRB) (1.47 mM K
2
HPO
4
,
140 mM NaCl, 1.7 mM KCl, 0.9 mM MgSO
4
, 20 mM Hepes, pH=7.4) with (1 μM) or
without (KRB vehicle) insulin (15 min; Novolin Insulin, University of Southern
California Pharmacy, Los Angeles, CA). The cells were harvested in lysis buffer for
Western Blot analysis (see below) or assayed for palmitate uptake and oxidation or
glucose uptake.
Palmitate uptake and oxidation. Following each treatment ± insulin, the
experimental medium was replaced with transport medium (100 μM albumin-bound
palmitate, 1:1, 30 min) containing 10 mM glucose and albumin-bound [1-14C]palmitic
acid (4 μCi/mL, Perkin Elmer, Boston, MA) to measure palmitate uptake and oxidation
(see below). Post-incubation, the media was removed and used to assay for 14C-labeled
oxidation products (see below). For the measurement of palmitate uptake, cells were
lysed by mixing with SDS (Bogachus & Turcotte, 2010). Duplicate lysate aliquots were

42

mixed with scintillation fluid (BudgetSolve, Research Product International Corp., Mount
Prospect, IL) and counted (Tri-carb 2100TR, Packard, Downers Grove, IL) or were used
for protein determination using the Bradford method (BioRad, Hercules, CA). For the
measurement of oxidation products,
14
CO
2
was released from duplicate aliquots of
recovered media and trapped on filter paper (Whatman) which was mixed with a
Toluene-based scintillation cocktail and analyzed for
14
CO
2
radioactivity (Bogachus &
Turcotte, 2010). To determine the acetate correction factor under our experimental
conditions, a subsample of cells was treated as above except that 4 μCi of [1-14C]acetic
acid (Perkin Elmer, Boston, MA) was added to the incubation medium (Bogachus &
Turcotte, 2010). Samples were treated as described above and analyzed for [
14
C]acetic
acid and
14
CO
2
radioactivities.
Glucose Uptake. Following each treatment ± insulin, the experimental medium
was replaced with transport medium (200 μM, 5 min) containing [2-
3
H] deoxyglucose (2-
DG) (0.5 μCi/mL, PerkinElmer, Boston, MA) to measure glucose uptake. Incubations
were terminated via removal of the media. Individual wells were washed after which cells
were lysed with SDS (Bogachus & Turcotte, 2010). As for palmitate uptake, duplicate
aliquots of lysate were taken for scintillation counting and for protein determination.
Protein sample preparation. Following treatment ± insulin, cells were used to
prepare homogenates or to isolate plasma membrane proteins. For homogenate
preparation, cells were washed with cold KRB, harvested in lysis buffer (20 mM Tris, 1%

43

(v/v) Np-40, 137 mM NaCl, 1 mM CaCl
2
, 1 mM MgCl
2
, 10% (v/v) glycerol, 1 mM DTT,
1 mM PMSF and 2 mM Na
3
VO
4
) and scrapped to one side of the well. Lysates were
gently pelleted and the supernatants were collected for protein analysis or for Western
blot analysis. For isolation of plasma membrane (PM) proteins, cells were washed and
centrifuged at 3,500 g (10 min; 4 °C) (Bogachus & Turcotte, 2010). The pellet was
resuspended in a Hepes (20 mM)-based buffer (5 mM NaN
3
, 2 mM EGTA, 200 μM
phenylmethylsulfonyl fluoride, 1 μM leupeptin, 1 μM pepstatin A, and 10 μM [trans-
epoxysuccinyl-l-leucylamido-(4-guanidino)butane] (E-64); pH 7.4) containing 250 mM
sucrose. The resulting homogenate was gently centrifuged to remove unbroken cells and
nuclei. The resulting supernatant was centrifuged at 31,000 g (60 min; 4 °C) to pellet the
PM proteins which were resuspended in homogenizing buffer and used for Western Blot
analysis to measure the protein content of fatty acid transporter FAT/CD36 under basal
and insulin-stimulated conditions.
Western Blot analysis. Western blot analysis (10 μg homogenate or 15 μg plasma
membrane protein) was performed using 6% (RIP140), 15% (FGF21), or 10% (all others)
SDS-PAGE. Proteins were transferred onto Immobilon P-polyvinylidene difluoride
(PVDF) membranes and blocked with 1% (v/v) BSA in Tween-Tris buffered saline
(TBS) (500 mM NaCl, 20 mM Tris, 0.05% (v/v) Tween-20, pH=7.5). The membranes
were then incubated with antibodies (1:1000) against either phosphoAKT1/2/3
Ser473
,
phosphoPKC-ζ/λ
Thr410/403
or phosphoAKT
Thr308
(Cell Signaling, Denver, MA), or

44

ACSVL5/FATP1 (M-100), AKT1/2/3 (H-136), CPT1-M (H-120), FAT/CD36 (H-300),
FGF21(S-14), GAPDH (FL-335), Nur77 (M-210), PKC-ζ (C-20), RIP140 (H-300),
(Santa Cruz Biotechnology, Santa Cruz, CA). Following appropriate incubation, the
membranes were probed with the appropriate secondary antibody (goat-anti-rabbit or
rabbit-anti-goat IgG, Pierce, Rockford, IL). Blots were subjected to enhanced
chemiluminescence buffer (Pierce, Rockford, IL) and transferred to CL-XPosure film
(Pierce, Rockford, IL) which was developed in a Konica Minolta processor. Films were
scanned using CanonScanLide100 and the density of the separated bands was quantified
using ScionImage (Scion, Frederic, MD). In all cases, multiple gels were analyzed and
compared to results obtained for control cells that had not been treated with either siRNA
and/or insulin. Protein content was normalized to GAPDH.
RNA Extraction and Reverse Transcriptase (RT) – Polymerase Chain (PCR)
Analysis. RT-PCR was used to measure mRNA expression of COX4, CPT1, FAT/CD36,
FATP1, FGF21, MCAD, Nur77, PGC-1α and RIP140using primer sequences designed
with OligoPerfect (Invitrogen Life Technologies, Carlsbad, CA) (COX4, FAT/CD36,
FATP1, PGC-1α, Rip140) or as referenced elsewhere (FGF21, CPT1, MCAD, Nur77,
and 18s) (Pei et al., 2006; Meng et al., 2009; Palou et al., 2008)(Table 1). Total RNA was
isolated using TRIzol reagent (Invitrogen Life Technologies, Carlsbad, CA) according to
the manufacturer’s instructions. RNA concentration and purity was determined
spectrophotometrically (Shimadzu UV-1601, Columbia, MD) using A260 and A280

45

measurements. Reverse transcription (RT) was performed using AccessQuick
TM
RT-PCR
kit (Promega, Madison, WI) according to the manufacture protocol. Reactions (25 μl)
consisted of 1 μg total RNA, 12.5 μl AccessQuickMaster Mix, 2 μl primers, and
corresponding volumes of RNase-free H
2
O. Thermal cycling was performed with
GeneAmpPCR System 9600 (PerkinElmer, Norwalk, CT).Thermal cycling parameters
were optimized for each primer. Specificity of PCR products was further confirmed by 1-
2% agarose gel electrophoresis stained with ethidium bromide (Sigma, St Louis, MO)
and visualized with a ChemiImager 4400 (Alpha Inotech, San Leandro, CA). The band
size for each PCR product was assessed using a 50bp DNA Step Ladder (Promega,
Madison, WI; New England BioLabs, Ipswich, MA). Target genes values were
normalized to their corresponding control which was 18s ribosomal RNA and the density
of the separated bands was quantified using ImageJ (NIH, Washington, DC).
Calculations and statistics. The rates of glucose and palmitate uptake and of
palmitate oxidation were calculated as described in details (Kelly et al., 2008). All
presented data are expressed as mean ± SE of three or more experiments and are
expressed as percent of control where control refers to cells that were not treated with any
agent or insulin (see figure legends for specific details). The percent control was
calculated using measured rates (nmol/g per min) for all experimental treatments. The
effects of RIP140 siRNA treatment ± insulin were analyzed using a one-way ANOVA
(Statview) followed by Fisher LSD post-hoc (P<0.05) test when appropriate. In all
instances, an α of 0.05 was used to determine significance.

46

RESULTS
RIP140 down-regulation in L6 cells. RIP140 down-regulation by siRNA
treatment was confirmed using RT-PCR and Western Blotting analysis as a marker of
end-point protein expression. As expected, the treatment of cells with the RIP140 siRNA
oligonucleotide sequence significantly decreased (P<0.05) total RIP140

mRNA (47%)
and protein (54%) content (Fig. 6A and 6B) as compared with control siRNA-treated
cells. Insulin had no effect on RIP140 mRNA or protein expression. To ensure that
siRNA treatment per se did not metabolically affect the cells’ response to insulin, we
measured basal and insulin-mediated glucose uptake and FA uptake and oxidation in cells
treated with the siRNA Silencer Negative sequence (control siRNA group) with those of
cells not treated with siRNA (untransfected control group). Neither basal nor insulin-
mediated glucose and palmitate uptake and oxidation was different (P>0.05) between
groups (data not shown). In line with published data (Dyck et al., 2001; Luiken et al.,
2002; Kelly et al., 2008), insulin significantly (P<0.05) increased glucose (30-40%) and
palmitate (20-30%) uptake and significantly (P<0.05) decreased palmitate oxidation (35-
43%) in both the control siRNA and untransfected control groups.
RIP140 down-regulation and insulin-mediated muscle metabolism in L6 cells.
To determine how RIP140 down-regulation would affect the sensitivity of muscle cells to
the metabolic actions of insulin, basal and insulin-mediated glucose uptake and palmitate
uptake and oxidation were measured in L6 cells with down-regulated expression of

47

RIP140 (RIP140 siRNA) and compared to the responses of cells treated with the siRNA
negative control (control siRNA) sequence (Fig. 7A, B, C). As expected, insulin
increased glucose (31%) and palmitate (20%) uptake and significantly (P<0.05)
decreased palmitate oxidation (35%) in the control siRNA group. RIP140 down-
regulation did not affect basal glucose uptake (P>0.05) but it significantly (P<0.05)
increased basal palmitate uptake (20%) and decreased basal palmitate oxidation (38%). In
the insulin-mediated condition, the effects of RIP140 down-regulation on insulin-
mediated metabolism were dependent on the substrate. While insulin-mediated glucose
uptake was not affected by RIP140 down-regulation, insulin-mediated palmitate
metabolism was affected. Thus, in both control siRNA- and RIP140 siRNA-treated cells,
insulin increased glucose uptake (30-31 %). However, while insulin increased palmitate
uptake in the control siRNA-treated cells (20%), it did not affect palmitate uptake in the
RIP140 siRNA-treated cells (P>0.05). Furthermore, while insulin significantly (P<0.05)
decreased (35%) palmitate oxidation in cells treated with control siRNA, it increased
(79%) palmitate oxidation in RIP140 siRNA-treated cells.
RIP140 down-regulation and mRNA expression in L6 cells. To provide
mechanistic insights for the metabolic changes induced by RIP140 down-expression, we
measured the mRNA expression and protein content (see in next section) of several genes
involved in metabolic regulation and insulin signaling including PGC-1α, COX4, CPT1,
FAT/CD36, FATP1, MCAD, AKT, PKC-ζ, FGF21 and Nur77. RIP140 down-regulation
increased COX4 (98%) and PGC-1α (77%) mRNA expression indicating that oxidative

48

capacity was increased in RIP140 siRNA-treated cells (Fig. 8A). RIP140 down-
regulation increased (P<0.05) FATP1 (67%) and Nur77 (67%) mRNA expression,
decreased (P<0.05) MCAD mRNA expression (25%) but did not affect (P>0.05) mRNA
expression of FAT/CD36, CPT1 and FGF21 (Fig. 8B & 8C). In control siRNA-treated
cells, insulin had no effect (P>0.05) on mRNA expression. In RIP140 siRNA-treated
cells, insulin had no effect (P>0.05) on mRNA expression of PGC-1α and FGF21.
However, insulin increased (P<0.05) mRNA expression of CPT1 (72%), FAT/CD36
(50%) and FATP1 (51%) and decreased (P<0.05) mRNA expression of COX4 (41%),
MCAD (28%) and Nur77 (58%).
RIP140 down-regulation and protein expression in L6 cells. RIP140 down-
regulation was associated with an increase (P<0.05) in the phosphorylation state of AKT
on Ser
473
(343%) and Thr
308
(96%) but no change (P>0.05) in PKC-ζ/λ
410/403
phosphorylation (Fig. 9A). As expected, insulin (P<0.05) increased the phosphorylation
state of AKT on Ser
473
(357%) and Thr
308
(93%) and of PKC-ζ/λ
410/403
(124%) in control
siRNA-treated cells. In RIP140 siRNA-treated cells, insulin decreased AKT Ser
473

phosphorylation by 51% (P<0.05) but had no effect (P>0.05) on the phosphorylation
state of PKC-ζ/λ
410/403
and AKT at Thr
308
. Total AKT and PKC-ζ protein content was not
affected (P>0.05) by either RIP140 down-regulation or insulin (Fig. 9A). RIP140 down-
regulation increased (P<0.05) CPT1 (64%) protein content but did not affect (P>0.05)
total FATP1 protein content or both total and plasma membrane FAT/CD36 protein

49

content (Fig. 9B). In control siRNA-treated cells, insulin increased the protein content of
CPT1 (60%) and total FAT/CD36 (54%) but did not change (P>0.05) the protein content
of FATP1 and plasma membrane CD36. In RIP140 siRNA-treated cells, insulin had no
effect (P>0.05) on the total protein content of CPT1, FAT/CD36 and FATP1 and on the
plasma membrane content of FAT/CD36. RIP140 down-regulation did not affect
(P>0.05) the total protein content of FGF21 and Nur77 (Fig. 9C). In control siRNA-
treated cells, insulin increased (P<0.05) FGF21 protein expression by 48% but had no
effect (P>0.05) on Nur77 protein expression. In RIP140 siRNA-treated cells, insulin did
not affect (P>0.05) the protein expression of either FGF21 or Nur77.

DISCUSSION
Our data provide new mechanistic insights regarding the role of RIP140 in
metabolic regulation in skeletal muscle cells and implicate the AKT-PKC-ζ axis of the
insulin signaling pathway in the regulation of FA oxidation. Significantly, our results
show that low RIP140 expression impacts not only mRNA and protein expression of
lipid-metabolizing genes but also basal and insulin-mediated muscle FA metabolism as
well as AKT-PKC-ζ signaling.
Given that RIP140 down-regulation was associated with an increase in the
expression of some of the genes and/or proteins known to regulate oxidative function and
FA oxidation (e.g.: COX4, CPT1), the low rates of basal FA oxidation that we observed

50

in cells with low RIP140 expression might seem contradictory. However, the present
results are in line with some but not all data reported by others (Fritah, 2009; Powelka et
al., 2006). Indeed, in adipocytes transfected with RIP140 siRNA higher protein
expression of cytochrome c and COX4 was accompanied by an increase in glucose
oxidation (Powelka et al., 2006). Given that the oxidation rate was measured in resting
and non-stimulated adipocytes, high glucose oxidation was probably accompanied by
lower rates of FA oxidation. On the other hand, our results are different from other data
reporting higher rates of FA oxidation in myoblasts isolated from RIP140-null mice
(Fritah, 2009). Because information about methodological procedures is limited in that
article, it is difficult to ascertain whether this discrepancy is due to procedural differences
(e.g. time of incubation) or experimental conditions (e.g. availability of other substrates,
hormonal milieu). Under insulin-stimulated conditions, we found that FA oxidation was
higher in myotubes with low RIP140 expression. Our insulin-mediated data are in line
with other results showing that mice lacking RIP140 exhibited lower respiratory
exchange ratio (RER) values (indicative of higher lipid oxidation) or higher serum levels
of ketone bodies (indirect measure of lipid oxidation) than their wild-type counterparts
(Seth et al., 2007; Diaz et al., 2008). Although both RER and serum ketone bodies levels
are indirect measures of lipid oxidation, both measurements reflect higher rates of lipid
oxidation under insulin-stimulated conditions.
To explain the changes in FA oxidation induced by low RIP140 expression, we
investigated the effects of our manipulations on regulatory proteins and enzymes of FA

51

uptake capacity, mitochondrial oxidative capacity and insulin signaling because these are
known regulatory factors of FA oxidation (Turcotte, 2006; Dyck et al., 1997; Kelly et al.,
2008; Holloway et al., 2008). In our study, FA uptake does not appear to have been a
critical mediator of the alterations in FA oxidation observed in low RIP140-expressing
cells under either basal or insulin-mediated conditions. We base this conclusion on the
fact that the changes in FA uptake were either minimal or directionally opposed to the
ones observed for FA oxidation. Thus, while basal FA oxidation was found to be lower in
low RIP140 expressing cells, basal FA uptake was found to be slightly higher in cells
with low RIP140 expression. Under insulin-mediated conditions, FA oxidation was found
to be higher in cells with low RIP140 expression despite the fact that FA uptake was not
affected by low RIP140 expression. Similarly, while some changes were observed in
gene and/or protein expression of FAT/CD36 and FATP1, two FA transporter proteins
known to be involved in the regulation of muscle FA uptake (Bonen et al., 2007), these
alterations were not associated with parallel changes in FA uptake. Thus, under basal
conditions, the small increase in FATP1 mRNA expression was not accompanied by an
increase in protein expression and under insulin-mediated conditions, the changes in
FATP1 and FAT/CD36 mRNA expression were accompanied by either reverse changes
in protein expression or no change. Overall, our results suggest that the increase in basal
FA uptake observed with low RIP140 expression was not mediated by changes in the
expression of FA transporter proteins and that FA uptake per se was probably not a

52

significant factor mediating the low rates of FA oxidation under basal conditions or the
high rates of FA oxidation under insulin-mediated conditions.
Multiple studies have shown that mitochondrial oxidative capacity is an important
determining factor of FA oxidation (Dyck et al., 1997; Turcotte, 2006). Given that
RIP140 is generally seen as a repressor of catabolic function (Seth et al., 2007), the
stimulatory effects of low RIP140 expression on the protein or mRNA content of several
enzymes or transcription factors involved in the regulation of oxidative metabolism (e.g.
PGC-1α, COX4 and CPT1) were expected. Interestingly, the mRNA content of the β-
oxidation enzyme MCAD was decreased in skeletal muscle cells expressing low levels of
RIP140. While the MCAD data reported here are somewhat different from those
observed in RIP140 knockout mice (Seth et al., 2007), data on the effects of RIP140
expression on oxidative and lipid-metabolizing gene expression are far from being
uniform. Thus, mRNA expression of CPT1 and/or MCAD was found to be unchanged in
liver of RIP140 shRNA-injected mice and in microphages isolated from RIP
-/-
mice
(Zschiedrich et al., 2008; Diaz et al., 2008). The differences observed between our
mRNA and protein data and those of others could be due to several factors including, but
not limited to, the cell type used (e.g. muscle vs. liver and/or organ tissue vs. cell line)
and the physiological state at the time of the experiment (e.g. fasted vs. insulin-
stimulated). While low MCAD gene expression may have played a role in the low rates
of FA oxidation under basal conditions, it is important to note that gene levels are not
always accompanied by low protein levels and/or low enzyme activity. Thus, we cannot

53

definitely determine whether MCAD activity was indeed lower in cells expressing low
levels of RIP140 protein. Ultimately, high CPT1 protein levels in the face of low MCAD
expression may have been sufficient to lead to an accumulation of long-chain fatty acyl-
CoA intermediates and limit FA oxidation under our basal conditions. Oxidative capacity
has been hypothesized by some to be an important determining factor of insulin
action(Lowell & Shulman, 2005; Bruce et al., 2003). Given that insulin is known to
decrease FA oxidation (Dyck et al., 2001; Kelly et al., 2008), the rise in several markers
of oxidative capacity observed with low RIP140 might be expected to associate with
lower rates of insulin-mediated FA oxidation. In contrast to those expectations but in line
with data obtained by others, our FA oxidation results indicate that a general
improvement in oxidative capacity does not necessarily associate with a larger insulin
response (Rimbert et al., 2009; Hancock et al., 2008; Irving et al., 2011).
Conversely, our results indicate that alterations in the activity of important
signaling intermediates induced by RIP140 down-regulation mediated the observed
changes in FA oxidation. AKT and PKC-ζ are two of the several signaling intermediates
that have been shown to modulate FA uptake and oxidation in skeletal muscle cells and
cardiac myocytes(Bouzakri et al., 2006; Luiken et al., 2009; Kelly et al., 2008). Indeed,
accumulated evidence demonstrates that insulin decreases FA oxidation via activation of
AKT1 and/or PKC-ζ signaling (Kelly et al., 2008; Bouzakri et al., 2006; Luiken et al.,
2009). Our analyses of the phosphorylation state of these signaling intermediates showed
that cells with low RIP140 expression had higher AKT
Ser473
and

54

AKT
Thr308
phosphorylation in the basal state and lower AKT
Ser473
and PKC-
ζ
Thr410/403
phosphorylation in the insulin-stimulated state. Thus, our results indicate that the
activation of proximal insulin signaling was negatively affected by the change in RIP140
expression. In line with this notion, the low activation state of AKT
Ser473
and PKC-
ζ
Thr410/403
under insulin-mediated conditions is in line with the high rates of FA oxidation
observed with insulin. Our results obtained under basal conditions extend this association
and demonstrate that insulin-independent AKT activation can down-regulate FA
oxidation. Thus, our data suggest that the higher than normal AKT activation observed in
RIP140 siRNA-treated cells may have played a role in orchestrating the measured
changes in FA oxidation under basal conditions. This suggestion is in line with data
demonstrating that in differentiated primary human skeletal muscle myotubes silencing of
AKT1 was associated with high basal rates of FA oxidation and that in skeletal muscle
high basal AKT phosphorylation was associated with high triglyceride levels (Bouzakri
et al., 2006; Liu et al., 2009).
In summary, our data show that alterations in FA uptake capacity and/or oxidative
capacity could not fully explain the changes in FA oxidation induced by low RIP140
expression. This suggests that under our experimental conditions the regulatory potential
of these two cellular factors was minimal. Conversely, our data indicate that RIP140
down-regulation significantly impacts the activation state of AKT and PKC-ζ not only
during insulin stimulation but also at rest. This extends the assigned regulatory role of

55

these signaling intermediates during insulin stimulation and suggests that AKT may also
be an important regulator of FA oxidation under basal conditions. Further studies will be
needed to evaluate the specific role of RIP140 in the regulation of FA metabolism and
metabolic regulation.
Acknowledgments: PCR studies were carried out in the NanoBiophysics Core
Facility at University of Southern California, Los Angeles. The authors would like to
thank Dr Nickolas Chelyapov for his technical suggestions and for allowing us to use the
GenAmpPCR System 9600 and to Chris Vetter for technical help. This study was
supported, by grants from the University of Southern California Women in Science and
Engineering (WiSE) Program and by fellowships from the Integrative and Evolutionary
Biology Program.

56

FIGURES

A. B.

Figure 6. RIP140 down-regulation in L6 muscle cells.
Total RIP140 mRNA (A) and protein (B) content were assessed in L6 cells transfected with
Control or RIP140 siRNA. L6 cells were 7 days post-confluent. Values are mean ± SE for all
treatment groups (n=4-6 per condition) and are expressed as “% of Control” where Control refers
to untreated basal L6 cells. Cell treatments include: siRNA (24 h), Insulin (1000 nM, 15 min).
White bars () represent data for Control siRNA-treated cells; Black bars () represent data for
RIP140 siRNA-treated cells. & P<0.05 vs. respective Control siRNA.

57

A. B.

C.

Figure 7. Effects of RIP140 down-regulation on metabolism

Glucose uptake (A), palmitate uptake (B) and palmitate oxidation (C) were measured in L6 cells
transfected with Control or RIP140 siRNA. L6 cells were 7 days post-confluent. Values are mean
± SE for all treatment groups (n=4-6 per condition) and are expressed as “% of Control” where
Control refers to untreated basal L6 cells. Cell treatments include: siRNA (24 h), Insulin (1000
nM, 15 min). White bars () represent data for Control siRNA-treated cells; Black bars ()
represent data for RIP140 siRNA-treated cells. # P<0.05 vs. respective basal; & P<0.05 vs.
respective Control siRNA.

58

A. Oxidative capacity

B. Fatty acid metabolism

59

C. Insulin action

Figure 8. Effects of RIP140 down-regulation on mRNA expression in L6 muscle cells.

mRNA expression was measured for genes regulating (A) oxidative capacity (COX4 and PGC-
1α), (B) fatty acid metabolism (CPT1, FAT/CD36, FATP1 and MCAD) and (C) insulin action
(FGF21 and Nur77) in L6 cells transfected with Control or RIP140 siRNA. L6 cells were 7 days
post-confluent. Values are mean ± SE for all treatment groups (n=4-6 per condition) and are
expressed as “% of Control” where Control refers to untreated basal L6 cells. Cell treatments
include: siRNA (24 h), Insulin (1000 nM, 15 min). White bars () represent data for Control
siRNA-treated cells; Black bars () represent data for RIP140 siRNA-treated cells. # P<0.05 vs.
respective basal; & P<0.05 vs. respective Control siRNA.

60

A. Insulin signaling

B. Fatty acid metabolism

61

C. Insulin Action

Figure 9. Effects of RIP140 down-regulation on protein content in L6 muscle cells.
Content of proteins regulating (A) insulin signaling (phosphoAkt
Ser473
, phosphoAkt
Thr 308
and
aPKC-ζ/λ
Thr410/403
), (B) fatty acid metabolism (CPT1, FAT/CD36, FATP1 and plasma membrane
FAT/CD36) and (C) insulin action (FGF21 and Nur77) were measured in L6 cells transfected
with Control or RIP140 siRNA. L6 cells were 7 days post-confluent. Values are mean ± SE for
all treatment groups (n=4-6 per condition) and are expressed as “% of Control” where Control
refers to untreated basal L6 cells. Cell treatments include: siRNA (24 h), Insulin (1000 nM, 15
min). White bars () represent data for Control siRNA-treated cells; Black bars () represent
data for RIP140 siRNA-treated cells. Membranes were stripped and re-probed with GAPDH as
described in Methods. # P<0.05 vs. respective basal; & P<0.05 vs. respective Control siRNA.

62

CHAPTER IV: EXPERIMENT 2

The effect of short-term fatty acid treatment on regulation of metabolism,
gene expression and insulin signaling in L6 skeletal muscle cells expressing reduced
levels of Receptor Interacting Protein 140 (RIP140)

ABSTRACT
Previously, we have shown that reduced expression of receptor interacting protein
140 (RIP140) alters the regulation of muscle fatty acid (FA) uptake and FA oxidation and
glucose uptake under basal and insulin-stimulated conditions. To provide additional
information about the role of RIP140 in the regulation of FA metabolism in cells exposed
to short-term high FA, L6 myotubes were transfected with RIP140 short interference
RNA (RIP140 siRNA) to genetically silence RIP140 and a control sequence. We
incubated the cells with palmitic acid for 36h. We measured the effects of low RIP140
expression on the mRNA and protein expression of proteins and signaling intermediates
implicated in the regulation of FA metabolism during short-term high FA treatment.
We found that low RIP140 expression partially restored (67%, P<0.05) basal FA
uptake. Short-term treatment with high FA reduced (P>0.05) basal and insulin-mediated
FA oxidation. In cells incubated with high FA, low RIP140 expression partially reduced

63

(19%; P<0.05) basal glucose uptake. Short-term high FA treatment differently affected
markers of oxidative capacity, FA uptake and insulin signaling.
Our data show that reduced RIP140 expression in high FA-treated muscle cells
rescues insulin-mediated glucose uptake and basal FA uptake, but it does not affect basal
or insulin-mediated FA oxidation. Our results indicate that AKT-PKC-ζ axis may be
playing an important role in the regulation of FA uptake during short-term high FA
treatment in cells expressing reduced levels of RIP140. Taken together, our results
indicate that low RIP140 expression may partially restore insulin sensitivity during short-
term high FA treatment.

INTRODUCTION
Skeletal muscle is the largest tissue in the human body and it represents
approximately 40% of the body’s mass in humans (Forbes, 1987). Metabolically, skeletal
muscle is a key tissue for glucose and fat utilization (Benton et al., 2008). Indeed, data
have shown that dysregulated muscle metabolism is associated with insulin resistance
(Boden, 1997), one of the most prevalent metabolic pathologies.
Metabolically, in skeletal muscle, the role of insulin is to stimulate glucose uptake
(Schultz et al., 1977; Gottesman et al., 1983)and fatty acid (FA) uptake and to inhibit FA
oxidation (Dyck et al., 2001). Normally, insulin induces FATP1 translocation from the
intracellular compartment and this event is coincidental with an increase in FA uptake,

64

suggesting that FATP1 may be involved in FA uptake (Wu et al., 2006). Studies done in
rats and humans (Boden, 1997) suggest that FAT/CD36 and FATP1 are present at the
plasma membrane and mitochondrion and because FAT/CD36 can co-immunoprecipitate
with CPT1 (Stremmel, 1988), it has been suggested that FAT/CD36, FATP1 and CPT1
are involved in the regulation of FA oxidation (Glatz et al., 2010).
Insulin resistance, a common characteristic of type 2 diabetes mellitus (T2DM)
(DeFronzo, 2004), is generally defined as the inability of an individual to adequately
respond to insulin’s cellular signals and, in research is often assessed by measuring the
response of a tissue to an insulin load (Kovacs & Stumvoll, 2005). Conversely, insulin
sensitivity is defined as the insulin concentration required for a half-maximal hormonal
response (Muniyappa et al., 2008). It is generally accepted that while insulin resistance
(or loss of insulin sensitivity) is a multifactorial disease, one of the cellular factors that
may be implicated in its development is low oxidative capacity (Lowell & Shulman,
2005). Indeed, muscle data collected using magnetic resonance spectroscopy, electron
microscopy, enzymatic assays or gene expression analysis have suggested that a strong
association exists between insulin resistance and skeletal muscle mitochondrial
dysfunction (Patti et al., 2003; Schrauwen-Hinderling et al., 2007; Kelley et al., 2002;
Petersen et al., 2004; Simoneau et al., 1999). Similarly, in line with these results, other
data have shown that skeletal muscle insulin sensitivity is typically quite low with obesity
(Felber et al., 1987; Ivy et al., 1989) and that regular exercise training can significantly

65

improve insulin sensitivity partly via an increase in mitochondrial oxidative capacity
(Befroy et al., 2008; Meex et al., 2010).
Oxidative capacity is commonly assessed by measuring the content and activity of
key mitochondrial enzymes such as carnitine palmitoyltransferase I (CPT1), medium
chain acyl CoA dehydrogenase (MCAD) and cytochrome-c oxidase 4 (COX4) (Turcotte,
2006).
Oxidative capacity itself is regulated by multiple cellular factors which include
among others, the actions of nuclear factors on the transcriptional regulation of oxidative
enzymes. Of specific interest to the development of insulin resistance is the co-repressor
identified as Receptor Interacting Protein 140 (RIP140), also known as Nuclear Receptor-
Interacting Protein 1 (NRIP1) (Fritah, 2009). Specifically, RIP140 has been implicated in
the regulation of multiple metabolic processes and is highly expressed in metabolically
active tissues such as skeletal muscle (Leonardsson et al., 2004; Fritah, 2009). RIP140
has been shown to inhibit mitochondrial biogenesis and oxidative capacity (Fritah, 2009).
In line with its role as a negative regulator of oxidative capacity, results have shown that
RIP140 deletion increases cellular respiration and protein expression of cytochrome c in
adipose tissue of null-mice (Powelka et al., 2006). Previous studies done in our lab
suggest that insulin-mediated FA oxidation is elevated in L6 skeletal muscle cells
expressing low levels of RIP140 (data not published). Because insulin is known to reduce
FA oxidation (Dyck et al., 2001; Kelly et al., 2008; Sidossis & Wolfe, 1996) and because
low levels of RIP140 has been shown to increase mitochondrial oxidative capacity

66

(Powelka et al., 2006) which is associated with an increase in insulin sensitivity (Rector
et al., 2007; Sirikul et al., 2006), we expected to measure a healthy reduction in insulin-
mediated FA oxidation in cells expressing low levels of RIP140 and exposed to short-
term FA treatment.
Given the putative role of RIP140 as a negative regulator of oxidative capacity,
the purpose of these studies was to determine in skeletal muscle cells 1) whether genetic
down-regulation of RIP140 expression would increase oxidative capacity and improve
insulin sensitivity in normal cells and cells exposed to short-term FA and 2) whether
these metabolic alterations would be associated with alterations in the mRNA and/or
protein content of enzymes and proteins involved in metabolic regulation and signaling,
under both conditions. To accomplish our aims, we used L6 rat skeletal muscle cells and
assessed the insulin sensitivity by measuring the effects of insulin on glucose uptake and
FA uptake and oxidation, under normal and short-term high FA treatment.

MATERIALS AND METHODS
Cell culture. L6 myotubes were cultured in α-minimal essential medium (α-
MEM)+ that was supplemented with 10% (v/v) fetal calf serum (FCS), 1% (v/v)
antimycotic antibiotic solution (Sigma Aldrich Ltd, St-Louis, MO) and 600 μM L-
carnitine hydrochloride (Sigma Aldrich Ltd, St-Louis, MO) in a humidified incubator at
37°C, 5% CO2. The α-MEM+ and FCS were purchased from Cell Culture Core Facility

67

(University of Southern California, Los Angeles, CA). Cells were grown in 75 cm2
sterile culture flasks, sub-cultured at 60-80% confluence and split at a ratio of 1:10 using
Trypsin-EDTA (Invitrogen Life Technologies, Grand Island, NY). For differentiation, the
myotubes were sub-cultured into six-well plates in the presence of supplemented α-
MEM+. By day 4, cells were 90-100% confluent and spontaneously differentiated into
myotubes. Media was replaced every 2-3 days. For experiments without siRNA
treatment, L6 myotubes were 7 days post-confluent on the day of the experiment. In
siRNA-treated L6 myotubes, siRNA treatment was initiated 2 days after sub-culturing
into six-well plates and experiments were performed 2 days later.
siRNA Transfection. Prior to transfection, cells were sub-cultured for 48 h in six-
well plates using antibiotics-free supplemented α-MEM+. Antibiotics were taken out
because they were toxic to cells during the transfection process (manufacturer’s protocol,
Invitrogen, Grand Island, NY). siRNA transfection was then initiated using
Lipofectamine™ 2000 reagent according to the manufacturer’s instructions (Invitrogen,
Grand Island, NY). Briefly (per well), Lipofectamine 2000 (100 pmol) and the siRNA
sequence (100 pmol; described below) were each combined with antibiotics-free
supplemented α-MEM+. The Lipofectamine/α-MEM+ and siRNA/α-MEM+ solutions
were mixed together. The antibiotics-free medium was removed from each well and
replaced by the freshly made siRNA/Lipofectamine/α-MEM+ cocktail. The cells were
incubated for 6 h after which time they were incubated for 24 h with antibiotics-free

68

supplemented α-MEM+. The cells were then treated for 12-14 h with fresh supplemented
α-MEM+. The custom-made sequence for RIP-140 was 5’-
3’GGAGUAACUCUGUCACC GATT and 3’-5’ UCGGUGACAGAGUUACUCCTG
(Applied BioSystems, Foster City, CA). The pre-designed siRNA sequences Silencer
Select (s155811) and Silencer Negative Control #1 were used as positive and negative
transfection controls (Applied BioSystems, Foster City, CA).
Cell Treatments. When required by the protocol, L6 myotubes (some of which
were previously transfected with siRNA; see above) were incubated for 12-14 h in 400
μM palmitic acid mixed with supplemented α-MEM+ and for 24 h in 400 μM palmitic
acid mixed with serum free supplemented α-MEM+. Palmitic acid was bound to bovine
serum albumin (Sigma, St Louis, MO). Immediately prior to the measurement of
palmitate uptake and oxidation or glucose uptake, the cells were incubated (30 min,
37°C) in Krebs Ringer Hepes buffer (KRB) (1.47 mM K
2
HPO
4
, 140 mM NaCl, 1.7 mM
KCl, 0.9 mM MgSO
4
, 20 mM Hepes, pH=7.4) with (1000 nM) or without (KRB vehicle)
insulin (15 min; Novolin Insulin, University of Southern California Pharmacy, Los
Angeles, CA). The cells were harvested in lysis buffer for Western Blot analysis (see
below) or assayed for palmitate uptake and oxidation or glucose uptake.
Palmitate uptake and oxidation. Following each treatment ± insulin, the
experimental medium was replaced with transport medium (100 μM albumin-bound
palmitate, 1:1, 30 min) containing 10 mM glucose and albumin-bound [1-
14
C]palmitic

69

acid (4 μCi/mL, Perkin Elmer, Boston, MA) to measure palmitate uptake and oxidation
(see below). Post-incubation, the media was removed and used to assay for
14
C-labeled
oxidation products (see below). For the measurement of palmitate uptake, cells were
lysed by mixing with SDS (Constantinescu & Turcotte, in preparation). Duplicate lysate
aliquots were mixed with scintillation fluid (BudgetSolve, Research Product International
Corp., Mount Prospect, IL) and counted (Tri-carb 2100TR, Packard, Downers Grove, IL)
or were used for protein determination using the Bradford method (BioRad, Hercules,
CA). For the measurement of oxidation products,
14
CO
2
was released from duplicate
aliquots of recovered media and trapped on filter paper (Whatman) which was mixed
with a Toluene-based scintillation cocktail and analyzed for
14
CO
2
radioactivity
(Constantinescu & Turcotte, in preparation). To determine the acetate correction factor
under our experimental conditions, a subsample of cells was treated as above except that
4 μCi of [1-
14
C]acetic acid (Perkin Elmer, Boston, MA) was added to the incubation
medium(Bogachus & Turcotte, 2010). Samples were treated as described above and
analyzed for [
14
C]acetic acid and
14
CO
2
radioactivities.
Glucose Uptake. Following each treatment ± insulin, the experimental medium
was replaced with transport medium (200 μM, 5 min) containing [2-
3
H] deoxyglucose (2-
DG) (0.5 μCi/mL, PerkinElmer, Boston, MA) to measure glucose uptake. Incubations
were terminated via removal of the media. Individual wells were washed after which cells
were lysed with SDS (Constantinescu & Turcotte, in preparation). As for palmitate

70

uptake, duplicate aliquots of lysate were taken for scintillation counting and for protein
determination.
Protein sample preparation. Following treatment ± insulin, cells were used to
prepare homogenates or to isolate plasma membrane proteins. For homogenate
preparation, cells were washed with cold KRB, harvested in lysis buffer (20 mM Tris, 1%
(v/v) Np-40, 137 mM NaCl, 1 mM CaCl
2
, 1 mM MgCl
2
, 10% (v/v) glycerol, 1 mM DTT,
1 mM PMSF and 2 mM Na
3
VO
4
) and scrapped to one side of the well. Lysates were
gently pelleted and the supernatants were collected for protein analysis or for Western
blot analysis. For isolation of plasma membrane (PM) proteins, cells were washed and
centrifuged at 3,500 g (10 min; 4 °C) (Constantinescu & Turcotte, in preparation). The
pellet was resuspended in a Hepes (20 mM)-based buffer (5 mM NaN
3
, 2 mM EGTA,
200 μM phenylmethylsulfonyl fluoride, 1 μM leupeptin, 1 μM pepstatin A, and 10 μM
[trans-epoxysuccinyl-l-leucylamido-(4-guanidino)butane] (E-64); pH 7.4) containing 250
mM sucrose. The resulting homogenate was gently centrifuged to remove unbroken cells
and nuclei. The resulting supernatant was centrifuged at 31,000 g (60 min; 4 °C) to pellet
the PM proteins which were resuspended in homogenizing buffer and used for Western
Blot analysis to measure the protein content of fatty acid transporter FAT/CD36 under
basal and insulin-stimulated conditions.
Western Blot analysis. Western blot analysis (10 μg homogenate or 15 μg plasma
membrane protein) was performed using 6% (RIP140), 15% (FGF21), or 10% (all others)

71

SDS-PAGE. Proteins were transferred onto Immobilon P-polyvinylidene difluoride
(PVDF) membranes and blocked with 1% (v/v) BSA in Tween-Tris buffered saline
(TBS) (500 mM NaCl, 20 mM Tris, 0.05% (v/v) Tween-20, pH=7.5). The membranes
were then incubated with antibodies (1:1000) against either acute transforming retrovirus
thymoma (AKT), phosphoAKT1/2/3
Ser473
, phosphoPKC-ζ/λ
Thr410/403
, phosphoAKT
Thr308

(Cell Signaling, Denver, MA), or ACSVL5/FATP1(M-100), AKT1/2/3 (H-136), CPT1-
M (H-120), FAT/CD36 (H-300), FGF21(S-14), GAPDH (FL-335), Nur77 (M-210),
PKC-ζ (C-20), RIP140 (H-300), (Santa Cruz Biotechnology, Santa Cruz, CA). Following
appropriate incubation, the membranes were probed with the appropriate secondary
antibody (goat-anti-rabbit or rabbit-anti-goat IgG, Pierce, Rockford, IL). Blots were
subjected to enhanced chemiluminescence buffer (Pierce, Rockford, IL) and transferred
to CL-XPosure film (Pierce, Rockford, IL) which was developed in a Konica Minolta
processor. Films were scanned using CanonScanLide100 and the density of the separated
bands was quantified using ScionImage (Scion, Frederic, MD). In all cases, multiple gels
were analyzed and compared to results obtained for control cells that had not been treated
with either siRNA and/or insulin. Protein content was normalized to GAPDH.
RNA Extraction and Reverse Transcriptase (RT) –Polymerase Chain (PCR)
Analysis. RT-PCR was used to measure mRNA expression of COX4, CPT1, FAT/CD36,
FATP1, FGF21, MCAD, Nur77, PGC-1α and RIP140 using primer sequences designed
with OligoPerfect (Invitrogen Life Technologies, Carlsbad, CA) (COX4, FAT/CD36,

72

FATP1, PGC-1α, Rip140) or as referenced elsewhere (FGF21, CPT1, MCAD, Nur77,
and 18s) (Pei et al., 2006; Meng et al., 2009; Palou et al., 2008) (Table 1). Total RNA
was isolated using TRIzol reagent (Invitrogen Life Technologies, Carlsbad, CA)
according to the manufacturer’s instructions. RNA concentration and purity was
determined spectrophotometrically (Shimadzu UV-1601, Columbia, MD) using A260
and A280 measurements. Reverse transcription (RT) was performed using
AccessQuick
TM
RT-PCR kit (Promega, Madison, WI) according to the manufacture
protocol. Reactions (25 μl) consisted of 1 μg total RNA, 12.5 μl AccessQuick

Master
Mix, 2 μl primers, and corresponding volumes of RNase-free H
2
O. Thermal cycling was
performed with GeneAmpPCR System 9600 (PerkinElmer, Norwalk, CT). Thermal
cycling parameters were optimized for each primer. Specificity of PCR products was
further confirmed by 1-2% agarose gel electrophoresis stained with ethidium bromide
(Sigma, St Louis, MO) and visualized with a ChemiImager 4400 (Alpha Inotech, San
Leandro, CA). The band size for each PCR product was assessed using a 50bp DNA Step
Ladder (Promega, Madison, WI; New England BioLabs, Ipswich, MA). Target genes
values were normalized to their corresponding control which was 18s ribosomal RNA
and the density of the separated bands was quantified using ImageJ (NIH, Washington,
DC).
Calculations and statistics. The rates of glucose and palmitate uptake and of
palmitate oxidation were calculated as described in details (Kelly et al., 2008). All

73

presented data are expressed as mean ± SE of three or more experiments and are
expressed as percent of control where control refers to cells that were not treated with any
agent or insulin (see figure legends for specific details). The percent control was
calculated using measured rates (nmol/g per min) for all experimental treatments. The
effects of RIP140 siRNA treatment ± insulin were analyzed using a one-way ANOVA
(Statview) followed by Fisher LSD post-hoc (P<0.05) test when appropriate. In all
instances, an α of 0.05 was used to determine significance.

RESULTS
RIP140 siRNA treatment reduces RIP140 mRNA and protein expression in L6
muscle cells incubated with high FA. RIP140 down-regulation by short interference RNA
(siRNA) treatment was confirmed using RT-PCR and Western Blotting analysis as a
marker of end-point protein expression. Under basal conditions, RIP140 mRNA and
protein content was reduced (P<0.05) by 59-61% with short-term FA treatment and
mRNA and protein content was further reduced (P<0.05) by 55-77% in RIP140 siRNA-
treated cells. While insulin increased (P<0.05) RIP140

mRNA content in cells exposed to
short-term FA, it did not affect RIP140 protein content (P>0.05) in any of the cells.
Under insulin-mediated conditions, RIP140 mRNA and protein content was significant
lower (P<0.05) in RIP140 siRNA-treated cells than in control cells (Fig. 10A and B).

74

RIP140 down-regulation and muscle metabolism in L6 muscle cells incubated
with high FA. Basal glucose uptake was increased (88%; P<0.05) by short-term
treatment with FA in control siRNA-treated cells (Fig. 11A). In cells incubated with high
FA, low RIP140 expression partially reduced (19%; P<0.05) basal glucose uptake. In
control siRNA-treated cells, short-term treatment with high FA prevented the stimulatory
actions of insulin on glucose uptake. While low RIP140 expression partially restored the
ability of insulin to increase glucose uptake in cells exposed to high FA (18%), this
increase was not significant (P=0.12). Basal (58%) and insulin-mediated (24%) FA
uptake was reduced (P<0.05) in control siRNA-treated cells incubated with high FA (Fig.
11B). In cells incubated with high FA, low RIP140 expression partially restored (67%,
P<0.05) basal FA uptake. However, it further decreased (P<0.05) FA uptake under
insulin-mediated conditions. Short-term treatment with high FA reduced (P>0.05) basal
(53%) and insulin-mediated (44%) FA oxidation (Fig. 11C). Low RIP140 expression did
not affect basal or insulin-mediated FA oxidation in cells incubated with high FA.
RIP140 down-regulation and mRNA expression in L6 cells incubated with high
FA. To provide mechanistic insights for the metabolic changes induced by RIP140 down-
expression in skeletal muscle cells incubated with high FA, we measured mRNA and/or
protein (see section 3.4) expression of several genes involved in the regulation of
oxidative capacity (COX4, PGC-1α), FA metabolism and uptake capacity [FAT/CD36,
FATP1, CPT1, MCAD] and insulin action (AKT, PKC-ζ, FGF21, Nur77).

75

Under basal conditions, mRNA expression of PGC-1α, COX4, CPT1, MCAD and
FAT/CD36 was reduced (48-64%; P<0.05) whereas that of FATP1 was increased (100%;
P<0.05) by short-term treatment with high FA (Figs 12A, B, C). In cells incubated with
high FA, low RIP140 expression restored mRNA expression of COX4 and FAT/CD36 up
to control levels but significantly decreased (P<0.05) FGF21 mRNA expression. In
control siRNA-treated cells, insulin had no effect (P>0.05) on mRNA expression. In cells
incubated with high FA, insulin increased (P<0.05) mRNA expression of COX4 (56%;
P=0.06), MCAD (58%), FAT/CD36 (75%) and Nur77 (57%). Under insulin-mediated
conditions, short-term incubation with high FA decreased (P<0.05) mRNA expression of
PGC-1α (258%) and CPT1 (83%) but increased (P<0.05) mRNA expression of
FAT/CD36 (41%), FATP1 (69%) and Nur77 (62%). In cells incubated with high FA, low
RIP140 expression further increased (P<0.05) mRNA expression of MCAD (80%) and
Nur77 (95%).
RIP140 down-regulation and protein expression in L6 cells incubated with high
FA. Under basal conditions, incubation with high FA increased (P<0.05) AKT
Ser473

(443%), AKT
Thr308
(126%), and PKC-ζ
Thr408/410
(96%) phosphorylation (Fig. 15A). In
cells incubated with high FA, low RIP140 expression restored AKT
Thr308
and PKC-
ζ
Thr408/410
phosphorylation back to control levels but did not affect AKT
Ser473

phosphorylation. Total protein content of AKT and PKC-ζ was not affected by either
short-term incubation with high FA or by low RIP140 expression. Under insulin-

76

mediated conditions, AKT
Ser473
phosphorylation in cells incubated with high FA was
reduced (P<0.05) and not further affected by low RIP140 expression. Conversely,
insulin-mediated AKT
Thr308
and PKC-ζ
Thr408/410
phosphorylation was not affected by
either short-term incubation with high FA or low RIP140 expression.
Under basal conditions, short-term incubation with high FA increased protein
content of CPT1 (56%), FAT/CD36 (95%) and FGF21 (78%), reduced protein content of
FATP1 (58%) 444444and did not affect (P>0.05) protein content of FAT/CD36 in
plasma membrane. Low RIP140 expression restored protein content of CPT1, FAT/CD36
and FGF21. Under insulin-mediated conditions, short-term incubation with high FA
decreased the protein content of FAT/CD36 (45%), FATP1 (213%) and plasma
membrane FAT/CD36 (143%). In cells incubated with high FA, low RIP140 expression
increased Nur77 protein content (31%) but did not have any effect on any of the other
proteins.

DISCUSSION
The connection between insulin resistance and lipids was described by Reaven in
1988 who suggested that in humans, elevated levels of plasma free FA (FFA) lead to
insulin resistance (Reaven, 1988). Since then numerous studies supported this notion, but
the cellular mechanisms by which exposure to high FA availability in skeletal muscle
cells induces insulin resistance are still unclear (Boden et al., 2001; Roden et al., 1996).

77

Fasting plasma FFA levels in healthy individuals range from 300 to 400 μmol/l, but the
levels of FFA are elevated in obese nondiabetic and type 2 diabetic individuals (600-800
μmol/l). An increase in plasma FFA levels of a healthy individual within the
physiological levels at the levels seen in obesity and type 2 diabetes may lead to insulin
resistance (Thiébaud et al., 1982; Boden et al., 1991). Additionally, it is well accepted
that saturated FA palmitate (C16:0) can induce insulin resistance in cultured skeletal
muscle cells and this among others is associated with perturbations in insulin signaling
pathway (Chavez & Summers, 2003; Powell et al., 2004; Schmitz-Peiffer et al., 1999).
Numerous factors are involved in the regulation of metabolism in skeletal muscle cells.
Among these factors, recently emerged that nuclear receptors play major roles in the
regulation of metabolic genes in key tissues (Morganstein & Parker, 2007). One of such
factors is nuclear receptor RIP140, a co-repressor whose functions were mainly studied in
adipose tissue in humans and mice and less extensively in skeletal muscle (Catalán et al.,
2009; Parker et al., 2006; Diaz et al., 2008; Leonardsson et al., 2004; Powelka et al.,
2006; Fritah, 2009; Seth et al., 2007). Previous work has established that RIP140-null
mice are lean, resistant to obesity and with high responsiveness to insulin when fed a high
fat diet (Leonardsson et al., 2004). However, the clear role of RIP140 in the regulation of
skeletal muscle metabolism in cells exposed to high FA availability had not been
delineated. In this regard, we used L6 skeletal muscle cells and to our knowledge we are
the first to reduce RIP140 expression in L6 cells exposed to saturated palmitic acid and to
measure markers of FA metabolism and glucose metabolism under such conditions. The

78

findings presented here demonstrate that the co-repressor RIP140 differently regulates the
expression of genes and proteins involved in pathways of FA metabolism, carbohydrate
metabolism and, oxidative capacity in cultured L6 skeletal muscle cells.
In this study, palmitate was administrated for 36 h post transfection to study the
effect of short-term FA in cells in which RIP140 was genetically reduced via short
interference RNA. Palmitate was found to basally reduce mRNA and protein expression
in Control siRNA and RIP siRNA cells. Not surprisingly RIP140 down-regulation did not
rescue the effect induced by palmitate on mRNA RIP140. Our studies show that basally,
RIP140 down-regulation in L6 cells treated with palmitate lead to high rates of FA uptake
suggesting that RIP140 can rescue the effect of palmitate exposure on FA uptake. In
addition, down-regulation of RIP140 brought insulin-mediated FA oxidation to a level
comparable to the one in Control siRNA. Interestingly, down-regulation of RIP140 did
not rescue the already high rates of insulin-mediated glucose uptake.
In addition, we examined the effect of palmitate on markers of oxidative capacity,
FA uptake and insulin signaling under basal and insulin-mediated conditions. We
observed that mRNA expression and protein content for these markers were partially or
fully rescued by RIP140 down-regulation under basal and insulin-stimulated conditions.
Numerous studies reported that high-fat diets may induce an increase in enzymes
involved in FA oxidation in skeletal muscle (Miller et al., 1984; Simi et al., 1991). Such
studies suggested that an increase in FA availability can lead to an increase in the ability
of muscle to oxidize fat (Garcia-Roves et al., 2007). There are however studies

79

suggesting the opposite, that raising plasma FA can lead to a reduction in muscle
mitochondria (Richardson et al., 2005). Thus in this study, we addressed several
questions. Firstly, we wanted to see whether the exposure of L6 skeletal muscle cells to
high concentrations of palmitate induces an increase in mRNA expression and protein
content of enzymes markers of oxidative capacity and whether RIP140 down-regulation
can rescue the effect induced by the palmitate in L6 skeletal muscle cells. PGC-1α is a
transcriptional co-activator and master regulator of mitochondrial biogenesis (Finck &
Kelly, 2006). Studies had shown that PGC-1α expression can be reduced in insulin-
resistant rodents (Valerio et al., 2006) and in obese (Bogacka et al., 2005; Sutherland et
al., 2008; Boyle et al., 2011). In accord with these findings, we found a decrease in PGC-
1α mRNA expression in Control siRNA and RIP siRNA, but we did not measure any
difference in PGC-1α mRNA expression between groups suggesting that RIP140 down-
regulation did not restore the effect of palmitate on PGC-1α. Furthermore, RIP140 down-
regulation did not restore the low levels of COX4 and MCAD induced by the treatment
with palmitate. There is some evidence suggesting the existence of a link between
skeletal muscle oxidative capacity and insulin action (Stump et al., 2003). For instance it
had been reported that insulin-resistant muscles are characterized by low activity of
oxidative enzymes (Simoneau & Kelley, 1997) and rates of FA oxidation (Simoneau et
al., 1999). As others reported (Halvatsiotis et al., 2002), we did not measure a change in
COX4 mRNA with insulin. We suggest that these changes in markers of oxidative

80

capacity can partially explain the reduction in FA oxidation measured in RIP140-treated
cells.
To investigate the possible mechanisms for the high basal rates of FA uptake in
L6 skeletal muscle cells, we examined markers of FA uptake. We chose to investigate the
early steps of FA metabolism. FAT/CD36 (also known as FA translocase) is a protein
membrane thought to function as a FA transporter (Abumrad et al., 1999). The
measurements of FAT/CD36 mRNA expression with high fat are contradictory. Some
suggested that high fat can lead to an increase in FAT/CD36 mRNA or no change
(Hegarty et al., 2002; McAinch et al., 2003; Cameron-Smith et al., 2003; Kitzmann et al.,
2011). It should be noted that the results from the present study were obtained from a
short-term high fat treatment from L6 skeletal muscle cells and may not apply to soleus,
EDL or gastronecmius rat muscle or humans. Previously it had been shown that an
increase in plasma insulin facilitates FAT/CD36 relocalisation to the plasma membrane
in healthy rats but not in obese (Luiken et al., 2000). In line with published data (Ouwens
et al., 2007), here we report that under insulin-mediated conditions in Control siRNA and
RIP siRNA the exposure to palmitic acid altered FAT/CD36 translocation to the plasma
membrane suggesting that down-regulation of RIP140 was not sufficient to counter act
the effect of palmitate on FAT/CD36 translocation. Our results indicate that exposure to
palmitate lead to a reduction in FAT/CD36 mRNA in Control siRNA and these
observations are in line with those published by others (Heilbronn et al., 2007). As others
noted, exposure to palmitate basally increased FAT/CD36 total protein content in Control

81

siRNA (Cameron-Smith et al., 2003). In this study we provide evidence that in cells
exposed to palmitate, basally RIP140 down-regulation restored FAT/CD36 mRNA,
FAT/CD36 protein content and CPT1 to levels comparable to the normal conditions. We
suggest that the high rates of FA uptake measured in cells exposed to palmitic acid can be
partially explained by the changes measured in mRNA and protein content of FAT/CD36
and CPT1.
To furthermore investigate the role of RIP140, we measured mRNA expression
and protein content of Nur77, an orphan nuclear receptor linked by others to glucose
metabolism (Chao et al., 2007). As others noted (Kanzleiter et al., 2009), exposure to
palmitate did not change basal mRNA or protein content. In our hands, contrary to other
studies (Kanzleiter et al., 2009), insulin lead to an increase in mRNA and protein content
and this in part may explain the increase in glucose uptake measured under our
experimental conditions. As others noted, we also reported basally an increase in the
phosphorylation of AKT at Ser and Thr and PKC-ζ (Tremblay et al., 2001; Nascimento et
al., 2006). Not surprisingly, in Control siRNA treatment with palmitate impaired the
insulin action on phosphorylation of AKT and PKC-ζ suggesting that the perturbations in
insulin signaling may partially explain the changes in FA metabolism in cells exposed to
high fat under our experimental conditions.
In summary, the present study provides an extensive characterization of different
markers of FA uptake, oxidative capacity and insulin signaling pathway in skeletal

82

muscle cells exposed to palmitate and characterized by low levels of RIP140. Although
RIP140 functions had been extensively studied in adipose tissue, more studies are
required to fully understand its role in skeletal muscle. Whether RIP140 plays
determinant roles on FA metabolism remains to be farther investigated.
Acknowledgments: PCR studies were carried out in the NanoBiophysics Core
Facility at University of Southern California, Los Angeles. The authors would like to
thank Dr Nickolas Chelyapov for his technical suggestions and for allowing us to use the
GenAmpPCR System 9600. This study was supported, by grants from the University of
Southern California Women in Science and Engineering (WiSE) Program and by
fellowships from the Integrative and Evolutionary Biology Program.

83

FIGURES

A.mRNA

B.Protein

Figure 10. Effects of RIP140 down-regulation (high FA)

Basal and insulin-mediated mRNA expression of RIP140 (A) and basal and insulin-mediated
protein content of RIP140 (B). RIP140 mRNA and protein content was assessed in L6 muscle
cells transfected with Control siRNA or RIP140 siRNA and incubated with or without high FA as
described in Methods. Values are mean ± SE for all treatment groups (n=4-6 per condition) and
are expressed as “% of Control” where Control refers to basal L6 muscle cells not treated with
either siRNA or FA. Cell treatments include: siRNA (24 h), palmitic acid (400 μM, 36 h), and/or
insulin (1000 nM, 15 min). &P<0.05 vs. respective Control siRNA; #P<0.05 vs. respective high
FA Control siRNA; *P<0.05 vs. respective basal cells.

84

A.

B.

85

C.

Figure 11. Effects of RIP140 down-regulation on metabolism (high FA)

Basal and insulin-mediated glucose uptake (A), palmitate uptake (B) and palmitate oxidation (C)
were measured in L6 muscle cells transfected with Control siRNA or RIP140 siRNA and
incubated with or without high FA as described in Methods. Values are mean ± SE for all
treatment groups (n=4-6 per condition) and are expressed as “% of Control” where Control refers
to basal L6 muscle cells not treated with either siRNA or FA. Cell treatments include: siRNA (24
h), palmitic acid (400 μM, 36 h) and/or insulin (1000 nM, 15 min). &P<0.05 vs. respective
Control siRNA; #P<0.05 vs. respective high FA Control siRNA; *P<0.05 vs. respective basal
cells.

86

A. Oxidative capacity

87

B. Fatty acid metabolism

88

89

C. Insulin action

Figure 12. Effects of RIP140 down-regulation on mRNA expression (high FA)

mRNA expression was measured for genes regulating (A) oxidative capacity (COX4 and PGC-
1α), (B) fatty acid metabolism [FAT/CD36, FATP1, CPT1 and MCAD] and (C) insulin action
(FGF21 and Nur77) in L6 muscle cells transfected with Control siRNA or RIP140 siRNA and
incubated with or without high FA as described in Methods. Values are mean ± SE for all
treatment groups (n=4-6 per condition) and are expressed as “% of Control” where Control refers
to basal L6 muscle cells not treated with either siRNA or FA. Cell treatments include: siRNA (24
h), palmitic acid (400 μM, 36 h) and/or insulin (1000 nM, 15 min). &P<0.05 vs. respective
Control siRNA; #P<0.05 vs. respective high FA Control siRNA; *P<0.05 vs. respective basal
cells.

90

A. Insulin signaling

91

B. Fatty acid metabolism

92

C. Insulin Action

93

Figure 13. Effects of RIP140 down-regulation on protein content (high FA)
Content of proteins regulating (A) insulin signaling (phosphoAkt
Ser473
, phosphoAkt
Thr 308
and
aPKC-ζ/λ
Thr410/403
), (B) fatty acid metabolism [FAT/CD36, plasma membrane FAT/CD36),
FATP1 and CPT1], (C) insulin action (FGF21 and Nur77) were measured in L6 muscle cells
transfected with Control siRNA or RIP140 siRNA and incubated with or without high FA as
described in Methods. Values are mean ± SE for all treatment groups (n=4-6 per condition) and
are expressed as “% of Control” where Control refers to basal L6 muscle cells not treated with
either siRNA or FA. Cell treatments include: siRNA (24 h), palmitic acid (400 μM, 36 h) and/or
insulin (1000 nM, 15 min). Membranes were stripped and re-probed with GAPDH as described in
Methods. &P<0.05 vs. respective Control siRNA; #P<0.05 vs. respective high FA Control
siRNA; *P<0.05 vs. respective basal cells.

94

CHAPTER V: LIMITATIONS AND SOLUTIONS

For our experiments we used a cell line (L6) derived from rat skeletal muscle
(Klip et al., 1984). We chose this cell line because it responds quickly to insulin and has
been extensively used to study muscle metabolism (Kelly et al., 2008; Palanivel &
Sweeney, 2005). This cell line represents an isolated system and this characteristic can
represent a limiting factor. However, because the cell line was derived from chemical
transformation of neonatal thigh skeletal muscle satellite cells, it retains many
morphological, biochemical and metabolic properties of skeletal muscle (Mitsumoto &
Klip, 1992; Tsakiridis et al., 1995). A great advantage of this line of enquiry is the lack of
hormones in the system allowing us to analyze the effects of insulin on FA metabolism
and insulin signaling without other interfering factors. In addition, because the cells grow
in monolayers, they are homogenous. Another limitation of my studies would be the
ologonucleotide and primer sequences used in various methodologies. Thus, the possible
oligonucleotide sequences used for the knock-down experiments could represent a
limiting factor if the sequences are not correctly chosen. To limit this negative aspect we
used commercially available sequences that have been tested. Similarly, to overcome
possible limitations due to the lack of primers specificity in RT-PCR, we used a well-
rated software from www.invitrogen.com to design our primers.
The experiments described herein utilized a relatively new molecular technique to
genetically reduce RIP140 expression in skeletal muscle cells. In contrast to the use of

95

metabolic agents, genetic manipulation allows for a quick down-regulation of expression
for a specific gene and limits the appearance of non-specific cellular side effects.

96

CHAPTER VII: SUMMARY

Evidence shows that RIP140 is a transcriptional co-regulator with multiple roles
in metabolic regulation (Parker et al., 2006). The biological actions of RIP140 in the
regulation of metabolic function and gene expression have been uncovered from loss-of-
function studies performed in mice. Such studies identified RIP140 as a determinant
factor in the control of lipid metabolism in adipose tissue and liver (Powelka et al., 2006).
However, because most of the studies delineating the role of RIP140 in metabolic and
gene regulation were performed in adipose tissue and liver, more data is needed on the
role of RIP140 in the regulation of FA and glucose metabolism in skeletal muscle cells.
The current experiments sought to fill this knowledge gap by studying the effects of
RIP140 down-regulation on markers of oxidative capacity, FA metabolism and insulin
signaling under normal and high FA treatment.
These studies were performed in cells expressing reduced levels of RIP140
mRNA and protein induced via the use of siRNA technology. L6 skeletal muscle cells
represented our experimental model. RT-PCR and Western Blotting were used to
measure changes in the expression of different genes and proteins of interest. These
experiments were performed under basal and insulin-stimulated conditions. For each
condition, some of the cells were also exposed to palmitate at high physiological
concentrations.

97

In our experiments, L6 skeletal muscle cells expressing reduced levels of RIP140
were used to examine the effect of low RIP140 expression on the regulation of FA and
glucose metabolism and on the expression of specific markers of oxidative capacity, FA
metabolism and insulin signaling. siRNA transfection was initiated in L6 skeletal muscle
cells using Lipofectamine™ 2000. We used a custom-made sequence for RIP140 and
Silencer Negative Control # 1 was our transfection control. RT-PCR was used to measure
mRNA expression of COX4, CPT1, FAT/CD36, FATP1, FGF21, MCAD, Nur77, PGC-
1α and RIP140 using carefully designed primer sequences. This study provided evidence
for the role of RIP140 in the regulation of FA metabolism and glucose uptake in skeletal
muscle. Given its putative role as a co-repressor of oxidative capacity, we hypothesized
that low RIP140 expression would raise oxidative potential and be associated with higher
rates of basal FA oxidation. Furthermore, because oxidative capacity has been
hypothesized by some to be an important determining factor of insulin action (Bruce et
al., 2003; Menshikova et al., 2005), we also hypothesized that low RIP140 expression
would be accompanied by lower rates of insulin-mediated FA oxidation.
Because low RIP140-containing cells were characterized by high rates of insulin-
mediated FA oxidation but no change in glucose uptake, our FA oxidation data challenge
the notion that oxidative capacity is a primary determining factor of metabolic health in
skeletal muscle cells. The present results indicate that changes in oxidative capacity do
not necessarily impact all aspects of metabolic regulation and that care must be taken in

98

drawing general conclusions about the impact of oxidative capacity on cellular
homeostasis. The data from study 1 also showed that while down-regulation of RIP140
increased the expression of some oxidative enzymes, it significantly impaired the
functionality of two major insulin signaling intermediates AKT and PKC-ζ. These
impairments in the insulin signaling pathway significantly impacted the regulation of
insulin-mediated FA oxidation. Together, our metabolic, gene expression and insulin
signaling data provide new mechanistic insights regarding the role of RIP140 in
metabolic regulation in skeletal muscle cells and implicate the AKT-PKC-ζ axis of the
insulin signaling pathway in the regulation of FA uptake and oxidation. Thus, it is clear
from this study that RIP140 plays an influential and diverse role partially explained by its
function as a co-repressor of gene expression.
Experiment 2 utilized the same cellular model system to study the impact of high
FA exposure in L6 skeletal muscle cells with reduced RIP140 expression. High FA
exposure was associated with an expected reduction in the ability of insulin to increase
glucose uptake and FA uptake and to reduce FA oxidation with several changes in gene
expression and cellular signaling. Low RIP140 expression partially restored the ability of
insulin to increase glucose uptake in cells exposed to high FA: however, this increase was
not significant. Low RIP140 expression partially restored basal FA uptake in cells
exposed to high FA but it did not affect basal or insulin-mediated FA oxidation. In line
with the metabolic changes associated with low RIP140 expression, mRNA expression

99

and protein content for markers of oxidative capacity, FA uptake and insulin signaling
were partially or fully rescued by RIP140 down-regulation in cells exposed to high FA.
Data from experiment 2 suggest that RIP140 is not a determining factor in the
regulation of FA uptake following short-term FA treatment. This study rather suggests
that RIP140 may play a more important role in the regulation of FA oxidation and
glucose uptake especially under insulin-mediated conditions. In cells exposed to high FA,
RIP140 down-regulation differently regulate markers of oxidative capacity, FA uptake
and insulin signaling and glucose metabolism. Thus, our data suggest that RIP140 down-
regulation can only partially restore metabolic health. From this study emerges the
possibility that there are other factors working in concert with RIP140 facilitating a full
rescue of skeletal muscle cells from the effects induced by high FA exposure.

100

CHAPTER VIII: CONCLUSION

Data collected in our experiments provide novel insight into the role of the
nuclear receptor RIP140 in the regulation of basal and insulin-mediated FA metabolism
in skeletal muscle cells incubated with or without high FA. More specifically, our data
implicate RIP140 in the regulation of the AKT-PKC-ζ axis of the insulin signaling
pathway and ultimately, its impact on the regulation of FA oxidation in skeletal muscle
cells. Significantly, our results show that low RIP140 expression impacts not only mRNA
and protein expression of lipid-metabolizing genes but also basal and insulin-mediated
muscle FA metabolism as well as AKT-PKC-ζ signaling, suggesting that impairments of
proximal insulin signaling significantly impact the regulation of FA oxidation.
In addition, our data suggest that in L6 skeletal muscle cells exposed to high FA
for a short duration, low RIP140 expression may rescue basal FA uptake and basal and
insulin-mediated glucose uptake but not basal or insulin-mediated FA oxidation. Indeed,
as expected, high FA exposure affected the mRNA and/or protein expression of several
proteins involved in the regulation of FA metabolism including FA transport proteins and
oxidative enzymes. However, by altering the activation state of signaling intermediates or
the expression of specific functional or oxidative proteins low RIP140 expression
mitigated only some of the changes induced by high FA exposure. Taken together, our
data suggest that low RIP140 expression may partially, but not fully, restore metabolic
regulation during short-term FA exposure.

101

Our studies illuminate the need for care when making general conclusions
regarding the role of oxidative capacity in metabolic regulation and insulin action. As
expected by our experimental design, markers of oxidative capacity were increased in
muscle cells with RIP140 down-regulation. However, this was not necessarily associated
with the generally accepted changes in FA and glucose metabolism and insulin signaling.
These observations suggested to us that while RIP140 may be an important factor in
metabolic regulation, factors other than oxidative capacity are necessary for a full rescue
of metabolic regulation and signaling in skeletal muscle cells.

102

REFERENCES

1. Abumrad, N., Coburn, C. T., & Ibrahimi, A. (1999). Membrane proteins
implicated in long-chain fatty acid uptake by mammalian cells: CD36, FATP and
FABPm. Biochimica et Biophysica Acta, 1441, 4-13.

2. Abumrad, N., Harmon, C. M., & Ibrahimi, A. (1998). Membrane transport of
long-chain fatty acids: evidence for a facilitated process. Journal of Lipid
Research, 39, 2309-2318.

3. Arkan, M. C., Hevener, A. L., Greten, F. R., Maeda, S., Li, Z. W., Long, J. M. et
al. (2005). IKK-β links inflammation to obesity-induced insulin resistance. Nature
Medicine, 11, 191-198.

4. Beeson, M., Sajan, M. P., Dizon, M., Grebenev, D., Gomez-Daspet, J., Miura, A.
et al. (2003). Activation of protein kinase C-ζ by insulin and phosphatidylinositol-
3,4,5-(PO4)3 is defective in muscle in type 2 diabetes and impaired glucose
tolerance. Diabetes, 52, 1926-1934.

5. Befroy, D. E., Petersen, K. F., Dufour, S., Mason, G. F., Rothman, D. L., &
Shulman, G. I. (2008). Increased substrate oxidation and mitochondrial
uncoupling in skeletal muscle of endurance-trained individuals. PNAS, 105,
16701-16706.

6. Begum, N., Ragolia, L., & Srinivasan, M. (1996). Effect of tumor necrosis factor-
α on insulin-stimulated mitogen-activated protein kinase cascade in cultured rat
skeletal muscle cells. Europ.J.Biochem., 238, 214-220.

7. Bell, G. I., Burant, C. F., Takeda, J., & Gould, G. W. (1993). Structure and
function of mammalian facilitative sugar transporters. Journal of Biological
Chemistry, 268, 19161-19164.

8. Benkoussa, M., Brand, C., Delmotte, M. H., Formstecher, P., & Lefebvre, P.
(2002). Retinoic acid receptors inhibit AP1 activation by regulating extracellular
signal-regulated kinase and CBP recruitment to an AP1-responsive promoter.
Molecular and Cellular Biology, 22, 4522-4534.

103

9. Benton, C. R., Han, X.-X., Febbraio, M., Graham, T. E., & Bonen, A. (2006).
Inverse relationship between PGC-1α protein expression and triacylglycerol
accumulation in rodent skeletal muscle. J Appl Physiol, 100, 377-383.

10. Benton, C. R., Wright, D. C., & Bonen, A. (2008). PGC1-α-mediated regulation
of gene expression and metabolism: implications for nutrition and exercise
prescriptions. Appl Physiol Nutr Metab, 33, 843-862.

11. Berti, L., Kellerer, M., Capp, E., & Haring, H.-U. (1997). Leptin stimulates
glucose transport and glycogen synthesis in C2C12 myotubes: evidence for PI3
kinase mediated effect. Diabetologia, 40, 606-609.

12. Boden, G. (1997). Role of fatty acids in the pathogenesis of insulin resistance and
NIDDM. Diabetes, 46, 3-10.

13. Boden, G., Jadali, F., White, J., Liang, Y., Mozzoli, M., Chen, X. et al. (1991).
Effects of fat on insulin-stimulated carbohydrate metabolism in normal men.
Journal of Clinical Investigation, 88, 960-966.

14. Boden, G., Lebed, B., Schatz, M., Homko, C., & Lemieux, S. (2001). Effects of
acute changes of plasma free fatty acids on intramyocellular fat content and
insulin resistance in healthy subjects. Diabetes, 50, 1612-1617.

15. Bogachus, L. D. & Turcotte, L. P. (2010). Genetic downregulation of AMPK-α
isoforms uncovers the mechanism by which metformin decreases FA uptake and
oxidation in skeletal muscle cells. Am J Physiol Cell Physiol, 299, C1549-C1561.

16. Bogacka, I., Xie, H., Bray, G. A., & Smith, S. R. (2005). Pioglitazone induces
mitochondrial biogenesis in human subcutaneous adipose tissue in vivo. Diabetes,
54, 1392-1399.

17. Bonen, A., Chabowski, A., Luiken, J. J. F. P., & Glatz, J. F. C. (2007).
Mechanisms and regulation of protein-mediated cellular fatty acid uptake:
molecular, biochemical, and physiological evidence. Physiology, 22, 15-28.

18. Bottcher, R. T. & Niehrs, C. (2005). Fibroblast growth factor signaling during
early vertebrate development. Endocrine Reviews, 26, 63-77.

104

19. Bourbon, N. A., Sandirasegarane, L., & Kester, M. (2002). Ceramide-induced
inhibition of Akt is mediated through protein kinase C-ζ. Implications for growth
arrest. Journal of Biological Chemistry, 277, 3286-3292.

20. Boushel, R., Gnaiger, E., Schjerling, P., Skovbro, M., Kraunsoe, R., & Dela, F.
(2007). Patients with type 2 diabetes have normal mitochondrial function in
skeletal muscle. Diabetologia, 50, 790-796.

21. Bouzakri, K., Zachrisson, A., Al-Khalili, L., Zhang, B. B., Koistinen, H. A.,
Krook, A. et al. (2006). siRNA-based gene silencing reveals specialized roles of
IRS-1/Akt2 and IRS-2/Akt1 in glucose and lipid metabolism in human skeletal
muscle. Cell Metabolism, 4, 89-96.

22. Boyle, K. E., Canham, J. P., Consitt, L. A., Zheng, D., Koves, T. R., Gavin, T. P.
et al. (2011). A High-fat diet elicits differential responses in genes coordinating
oxidative metabolism in skeletal muscle of lean and obese individuals. J Clin
Endo & Metab, 96, 775-781.

23. Brozinick Jr, J. T., Roberts, B. R., & Dohm, G. L. (2003). Defective signaling
through Akt-2 and -3 but not Akt-1 in insulin-resistant human skeletal muscle.
Diabetes, 52, 935-941.

24. Bruce, C. R., Anderson, M. J., Carey, A. L., Newman, D. G., Bonen, A., Kriketos,
A. D. et al. (2003). Muscle oxidative capacity is a better predictor of insulin
sensitivity than lipid status. J.Clin.Endocrinol.Metab., 88, 5444-5451.

25. Cameron-Smith, D., Burke, L. M., Angus, D. J., Tunstall, R. J., Cox, G. R.,
Bonen, A. et al. (2003). A short-term, high-fat diet up-regulates lipid metabolism
and gene expression in human skeletal muscle. Am J Clin Nutr, 77, 313-318.

26. Campell, B. C. & Cajigal, A. (2001). Diabetes: energetics, development and
human evolution. Medical Hypothesis, 57, 64-67.

27. Catalán, V., Gómez-Ambrosi, J., Lizanzu, A., Rodríguez, A., Silva, C., Rotellar,
F. et al. (2009). RIP140 gene and protein expression levels are downregulated in
visceral adipose tissue in human morbid obesity. Obesity Surgery, 19, 771-776.

28. Cavaillès, V., Dauvois, S., L'Horset, F., Lopez, G., Hoare, S., Kushner, P. J. et al.
(1995). Nuclear factor RIP140 modulates transcriptional activation by the
estrogen receptor. EMBO J., 14, 3741-3751.

105

29. Chandalia, M. & Abate, N. (2003). Metabolic complications of obesity: inflated
or inflamed? Journal of Diabetes and its Complications, 21, 128-136.

30. Chao, L. C., Zhang, Z., Pei, L., Saito, T., Tontonoz, P., & Pilch, P. F. (2007).
Nur77 coordinately regulates expression of genes linked to glucose metabolism in
skeletal muscle. Molecular Endocrinology, 21, 2152-2163.

31. Chavez, J. A. & Summers, S. A. (2003). Characterizing the effects of saturated
fatty acids on insulin signaling and ceramide and diacylglycerol accumulation in
3T3-L1 adipocytes and C2C12 myotubes. Archives of Biochemistry and
Biophysics, 419, 101-109.

32. Chawla, A., Repa, J. J., Evans, R. M., & Mangelsdorf, D. J. (2001). Nuclear
receptors and lipid physiology: Opening the X-files. Science, 294, 1866-1870.

33. Chen, Y., Kerimo, A., Khan, S., & Wei, L. N. (2002). Real-time analysis of
molecular interaction of retinoid receptors and receptor-interacting protein 140
(RIP140). Molecular Endocrinology, 16, 2528-2537.

34. Cho, H., Mu, J., Kim, J. K., Thorvaldsen, J. L., Chu, Q., Crenshaw, E. B., III et al.
(2001). Insulin resistance and a diabetes mellitus-like syndrome in mice lacking
the protein kinase Akt2 (PKBβ ). Science, 292, 1728-1731.

35. Chou, M. M., Hou, W., Johnson, J., Graham, L. K., Lee, M. H., Chen, C.-S. et al.
(1998). Regulation of protein kinase C ζ by PI 3-kinase and PDK-1. Current Bio,
8, 1069-1077.

36. Christian, M., White, R., & Parker, M. G. (2006). Metabolic regulation by the
nuclear receptor corepressor RIP140. Trends Endo Metab, 17, 243-250.

37. DeFronzo, R. A. (2004). Pathogenesis of type 2 diabetes mellitus. Medical Clinics
of North America, 88, 787-835.

38. Diaz, M. B., Herzig, K.-H., Metzger, D., Ziegler, A., Vegiopoulos, A.,
Klingenspor, M. et al. (2008). Nuclear receptor cofactor receptor interacting
protein 140 controls hepatic triglyceride metabolism during wasting in mice.
Hepatology, 48, 782-791.

106

39. Dimopoulos, N., Watson, M., Sakamoto, K., & Hundal, H. S. (2006). Differential
effects of palmitate and palmitoleate on insulin action and glucose utilization in
rat L6 skeletal muscle cells. Biochem J., 399, 473-481.

40. Draznin, B. (2008). Molecular mechanisms of insulin resistance. In P.S.Zeitler &
K. J. Nadeau (Eds.), Insulin Resistance: Childhood Precursors and Adult Disease
(pp. 95-108).

41. Dyck, D. J., Peters, S. J., Glatz, J. F. C., Gorski, J., Keizer, H., Kiens, B. et al.
(1997). Functional differences in lipid metabolism in resting skeletal muscle of
various fiber types. Am J Physiol Endocrinol Metab, 272, E340-E351.

42. Dyck, D. J., Steinberg, G., & Bonen, A. (2001). Insulin increases FA uptake and
esterification but reduces lipid utilization in isolated contracting muscle. Am J
Physiol Endocrinol Metab, 281, E600-E607.

43. Eaton, S. B. & Konner, M. J. (1997). Paleolithic nutrition revisited: A twelve-year
retrospective on its nature and implications. European Journal of Clinical
Nutrition, 51, 207-216.

44. Farese, R. V. (1996). Insulin-sensitive phospholipid signaling systems and
glucose transport: an update. Proceedings of the Society for Experimental Biology
and Medicine, 213, 1-12.

45. Farese, R. V. (2001). Insulin-sensitive phospholipid signaling systems and
glucose transport. update II. Proceedings of the Society for Experimental Biology
and Medicine, 226, 283-295.

46. Farese, R. V. (2002). Function and dysfunction of aPKC isoforms for glucose
transport in insulin-sensitive and insulin-resistant states. Am J Physiol Endocrinol
Metab, 283, E1-E11.

47. Felber, J.-P., Ferrannini, E., Golay, A., Meyer, H. U., Thiébaud, D., Curchod, B.
et al. (1987). Role of lipid oxidation in pathogenesis of insulin resistance of
obesity and type II diabetes. Diabetes, 36, 1341-1350.

48. Finck, B. N. & Kelly, D. P. (2006). PGC-1 coactivators: inducible regulators of
energy metabolism in health and disease. Journal of Clinical Investigation, 116,
615-622.

107

49. Forbes, G. B. (1987). Lean body mass-body fat interrelationships in humans.
Nutrition reviews, 45, 225-231.

50. Frier, B. C., Hancock, C. R., Little, J. P., Fillmore, N., Bliss, T. A., Thomson, D.
M. et al. (2011). Reductions in RIP140 are not required for exercise- and AICAR-
mediated increases in skeletal muscle mitochondrial content. J Appl Phy, 111,
688-695.

51. Fritah, A. (2009). Control of skeletal muscle metabolic properties by the nuclear
receptor corepressor RIP140. Appl.Physiol.Nutr.Metab, 34, 362-367.

52. Garcia-Roves, P., Huss, J. M., Han, D.-H., Hancock, C. R., Iglesias-Gutierrez, E.,
Chen, M. et al. (2007). Raising plasma fatty acid concentration induces increased
biogenesis of mitochondria in skeletal muscle. PNAS, 104, 10709-10713.

53. Giri, L., Mutalik, V., & Venkatesh, K. V. (2004). A steady state analysis indicates
that negative feedback regulation of PTP1B by Akt elicits bistability in insulin-
stimulated GLUT4 translocation. Theoretical Biology and Medical Modelling, 1,
2-6.

54. Glatz, J. F. C., Luiken, J. J. F. P., & Bonen, A. (2010). Membrane Fatty Acid
Transporters as Regulators of Lipid Metabolism: Implications for Metabolic
Disease. Physiol.Rev, 90, 367-417.

55. Gordon, K. D. (1987). Evolutionary perspectives on human diet. In Nutritional
Anthropology (F. E. Johnston ed., pp. 3-39). New York: Alan R. Liss.

56. Gottesman, I., Mandarino, L., & Gerich, J. (1983). Estimation and kinetic analysis
of insulin-independent glucose uptake in human subjects. American Journal of
Physiology - Endocrinology And Metabolism, 244, E632-E635.

57. Graham, J. D., Yager, M. L., Hill, H. D., Byth, K., O'Neill, G. M., & Clarke, C. L.
(2005). Altered Progesterone Receptor Isoform Expression Remodels Progestin
Responsiveness of Breast Cancer Cells. Molecular Endocrinology, 19, 2713-
2735.

58. Gupta, P., Huq, M. D. M., Khan, S. A., Tsai, N. P., & Wei, L. N. (2005).
Regulation of Co-repressive Activity of and HDAC Recruitment to RIP140 by
Site-specific Phosphorylation. Molecular & Cellular Proteomics, 4, 1776-1784.

108

59. Hajduch, E., Alessi, D. R., Hemmings, B. A., & Hundal, H. S. (1998).
Constitutive activation of protein kinase Bα by membrane targeting promotes
glucose and system A amino acid transport, protein synthesis, and inactivation of
glycogen synthase kinase 3 in L6 muscle cells. Diabetes, 47, 1006-1013.

60. Hallberg, M., Morganstein, D. L., Kiskinis, E., Shah, K., Kralli, A., Dilworth, S.
M. et al. (2008). A Functional Interaction between RIP140 and PGC-1α
Regulates the Expression of the Lipid Droplet Protein CIDEA. Mol.Cell.Biol., 28,
6785-6795.

61. Halvatsiotis, P., Short, K. R., Bigelow, M., & Nair, K. S. (2002). Synthesis rate of
muscle proteins, muscle functions, and amino acid kinetics in type 2 diabetes.
Diabetes, 51, 2395-2404.

62. Hamilton, J. A. (1998). Fatty acid transport: difficult or easy? Journal of Lipid
Research, 39, 467-481.

63. Hancock, C. R., Han, D. H., Terada, S., Yasuda, T., Wright, D. C., & Holloszy, J.
O. (2008). High-fat diets cause insulin resistance despite an increase in muscle
mitochondria. PNAS, 105, 7815-7820.

64. Heery, D. M., Kalkhoven, E., Hoare, S., & Parker, M. G. (1997). A signature
motif in transcriptional co-activators mediates binding to nuclear receptors.
Nature, 387, 733-736.

65. Hegarty, B., Cooney, G. J., Kraegen, E. W., & Furler, S. M. (2002). Increased
efficiency of fatty acid uptake contributes to lipid accumulation in skeletal muscle
of high fat-fed insulin-resistant rats. Diabetes, 51, 1477-1484.

66. Heilbronn, L. K., Gregersen, S., Shirkhedkar, D., Hu, D., & Campbell, L. V.
(2007). Impaired fat oxidation after a single high-fat meal in insulin-sensitive
nondiabetic individuals with a family history of type 2 diabetes. Diabetes, 56,
2046-2053.

67. Hirsch, D., Stahl, A., & Lodish, H. F. (1998). A family of fatty acid transporters
conserved from myobacterium to man. Proc.Natl.Acad.Sci.USA, 95, 8625-8629.

109

68. Ho, P.-C., Gupta, P., Tsui, Y.-C., Ha, S. G., Huq, M., & Wei, L.-N. (2008).
Modulation by lysine acetylation-stimulated repressive activity by Erk2-mediated
phosphorylation of RIP140 in adipocyte differentiation. Cell Signalling, 20, 1911-
1919.

69. Hogan, P., Dall, T., & Nikolov, P. (2003). Economic Costs of Diabetes in the U.S.
in 2002. Diabetes Care, 26, 917-932.

70. Hojman, P., Pedersen, M., Nielsen, A. R., Krogh-Madsen, R., Yfanti, C.,
+àkerstrom, T. et al. (2009). Fibroblast Growth Factor-21 Is Induced in Human
Skeletal Muscles by Hyperinsulinemia. Diabetes, 58, 2797-2801.

71. Holloway, G. P., Luiken, J. F. P., Glatz, J. F. C., Spriet, L. L., & Bonen, A.
(1997). Contribution of FAT/CD36 to the regulation of skeletal muscle fatty acid
oxidation: an overview. Acta Physiol, 194, 293-309.

72. Holloway, G. P., Luiken, J. F. P., Glatz, J. F. C., Spriet, L. L., & Bonen, A.
(2008). Contribution of FAT/CD36 to the regulation of skeletal muscle fatty acid
oxidation: an overview. Acta Physiol, 194, 293-309.

73. Holness, M. J., Smith, N. D., Greenwood, G. K., & Sugden, M. C. (2007).
PPAR{alpha} activation reverses adverse effects induced by high-saturated-fat
feeding on pancreatic beta-cell function in late pregnancy. Am J Physiol
Endocrinol Metab, 292, E1087-E1094.

74. Hopkins, T. A., Dyck, J. R. B., & Lopaschuk, G. D. (2003). AMP-activated
protein kinase regulation of fatty acid oxidation in the ischaemic heart.
Biochemical Society Transactions, 31, 207-212.

75. Huss, J. M., Kopp, R. P., & Kelly, D. P. (2002). Peroxisome proliferator-activated
receptor coactivator-1α (PGC-1α) coactivates the cardiac-enriched nuclear
receptors estrogen-related receptor-α and -γ. J Biol Chem, 277, 40265-40274.

76. Ibrahimi, A., Sfeir, Z., Magharaie, H., Amri, E., & Grimaldi, P. (1996).
Expression of the CD36 homolog (FAT) in fibroblast cells: effects on fatty acid
transport. Proceedings of the National Academy of Science USA, 93, 2646-2651.

77. Inagaki, T., Dutchak, P., Zhao, G., Ding, L., Gautron, L., Parameswara, V. et al.
(2010). Endocrine regulation of the fasting response by PPAR-mediated induction
of fibroblast growth factor 21. Cell Metabolism, 5, 415-425.

110

78. Irving, B. A., Short, K. R., Nair, K. S., & Stump, C. S. (2011). Nine days of
intensive exercise training improves mitochondrial function but not insulin action
in adult offspring of mothers with Type 2 diabetes. Journal of Clinical
Endocrinology & Metabolism, 96, E1137-E1141.

79. Itani, S. I., Ruderman, N. B., Schmieder, F., & Boden, G. (2002). Lipid-Induced
Insulin Resistance in Human Muscle Is Associated With Changes in
Diacylglycerol, Protein Kinase C, and I+¦B-+¦. Diabetes, 51, 2005-2011.

80. Itoh, N. & Ornitz, D. M. (2004). Evolution of the Fgf and Fgfr gene families.
Trends Genet., 20, 563-569.

81. Ivy, J. L., Brozinick, J. T., Torgan, C. E., & Kastello, G. M. (1989). Skeletal
muscle glucose transport in obese Zucker rats after exercise training. J Appl
Physiol, 66(6), 2635-2641.

82. Jiang, P., Hu, Q., Ito, M., Meyer, S., Waltz, S., Khan, S. et al. (2010). Key roles
for MED1 LxxLL motifs in pubertal mammary gland development and luminal-
cell differentiation. Proceedings of the National Academy of Sciences, 107, 6765-
6770.

83. Jiang, Z. Y., Zhou, Q. L., Coleman, K. A., Chouinard, M., Boese, Q., & Czech,
M. P. (2003). Insulin signaling through Akt/protein kinase B analyzed by small
interfering RNA-mediated gene silencing. PNAS, 100, 7569-7574.

84. Kanoh, Y., Sajan, M. P., Bandyopadhyay, G., Miura, A., Standaert, M. L., &
Farese, R. V. (2003). Defective activation of atypical protein kinase C ζ and λ by
insulin and phosphatidylinositol-3,4,5-(PO
4
)
3
in skeletal muscle of rats following
high-fat feeding and streptozotocin-induced diabetes. Endocrinology, 144, 947-
954.

85. Kanzleiter, T., Schneider, T., Walter, I., Bolze, F., Eickhorst, C., Heldmaier, G. et
al. (2005). Evidence for Nr4a1 as a cold-induced effector of brown fat
thermogenesis. Physiological Genomics, 24, 37-44.

86. Kanzleiter, T., Wilks, D., Preston, E., Ye, J., Frangioudakis, G., & Cooney, G. J.
(2009). Regulation of the nuclear hormone receptor Nur77 in muscle: Influence of
exercise-activated pathways in vitro and obesity in vivo. Biochimica et
Biophysica Acta (BBA) - Molecular Basis of Disease, 1792, 777-782.

111

87. Karlsson, H. K. R., Zierath, J. R., Kane, S., Krook, A., Lienhard, G. E., &
Wallberg-Henriksson, H. (2005). Insulin-stimulated phosphorylation of the Akt
substrate AS160 is impaired in skeletal muscle of type 2 diabetic subjects.
Diabetes, 54, 1692-1697.

88. Kelley, D. E. (2005). Skeletal muscle fat oxidation: timing and flexibility are
everything. Journal of Clinical Investigation, 115(7), 1699-1702.

89. Kelley, D. E., He, J., Menshikova, E. V., & Ritov, V. B. (2002). Dysfunction of
mitochondria in human skeletal muscle in type 2 Diabetes. Diabetes, 51, 2944-
2950.

90. Kelly, D. P., Gordon, J. I., Alpers, R., & Strauss, A. W. (1989). The tissue-
specific expression and developmental regulation of two nuclear genes encoding
rat mitochondrial proteins. Medium chain acyl-CoA dehydrogenase and
mitochondrial malate dehydrogenase. Journal of Biological Chemistry, 264,
18921-18925.

91. Kelly, K. R., Cheng, M. T., Sung, C. K., & Turcotte, L. P. (2005). aPKCζ
inhibition abolishes insulin-induced LCFA uptake but does not prevent the
insulin-induced decrease in LCFA oxidation. Medicine and Science in Sports and
Exercise, 37, S379.

92. Kelly, K. R., Sung, C. K., Abbott, M. J., & Turcotte, L. P. (2008).
Phosphatidylinositol 3-kinase-dependent insulin regulation of long-chain fatty
acid (LCFA) metabolism in L6 cells: involvement of atypical protein kinase C-ζ
in LCFA uptake but not oxidation. J.Endocrinology, 198, 375-384.

93. Kerley, J. S., Olsen, S. L., Freemantle, S. J., & Spinella, M. J. (2001).
Transcriptional activation of the nuclear receptor corepressor RIP140 by retinoic
acid: a potential negative-feedback regulatory mechanism. Biochemical and
Biophysical Research Communications, 285, 969-975.

94. Khan, A. H. & Pessin, J. E. (2002). Insulin regulation of glucose uptake: a
complex interplay of intracellular signaling pathways. Diabetologia, 45, 1475-
1483.

95. Kharitonenkov, A., Shiyanova, T. L., Koester, A., Ford, A. M., Micanovic, R.,
Galbreath, E. J. et al. (2005). FGF-21 as a novel metabolic regulator. The Journal
of Clinical Investigation, 115, 1627-1635.

112

96. Kiens, B. (2006). Skeletal muscle lipid metabolism in exercise and insulin
resistance. Physiolo Rev, 86, 243.

97. Kim, J., Wei, Y., & Sowers, J. R. (2008). Role of mitochondrial dysfunction in
insulin resistance. Circulation Research, 102, 401-414.

98. Kim, Y.-B., Kotani, K., Ciaraldi, T. P., Henry, R. R., & Kahn, B. B. (2003).
Insulin-stimulated protein kinase c λ/ζ activity is reduced in skeletal muscle of
humans with obesity and type 2 diabetes. Reversal with weight reduction.
Diabetes, 52, 1935-1942.

99. Kirwan, J. P. & Del Aguila, L. F. (2003). Insulin signalling, exercise and cellular
integrity. Biochem.Soc.Trans., 31, 1281-1285.

100. Kitzmann, M., Lantier, L., Hébrard, S., Mercier, J., Foretz, M., & Aguer, C.
(2011). Abnormal metabolism flexibility in response to high palmitate
concentrations in myotubes derived from obese type 2 diabetic patients.
Biochimica et Biophysica Acta (BBA) - Molecular Basis of Disease, 1812, 423-
430.

101. Klip, A., Li, G., & Logan, W. J. (1984). Induction of sugar uptake response to
insulin by serum depletion in fusing L6 myoblasts. Amercian Journal of
Physiology, 247, E291-E296.

102. Klip, A., Logan, W. J., & Li, G. (1982). Hexose transport in L6 muscle cells:
kinetic properties and the number of [
3
H]cytochalasin B binding sites. Biochimica
et Biophysica Acta, 687, 265-280.

103. Knutti, D., Kaul, A., & Kralli, A. (2000). A tissue-specific coactivator of steroid
receptors, identified in a functional genetic screen. Molecular and Cellular
Biology, 20, 2411-2422.

104. Kohn, A. D., Takeuchi, F., & Roth, R. A. (1996). Akt, a pleckstrin homology
domain containing kinase, is activated primarily by phosphorylation. J Biol Chem,
271, 21920-21926.

105. Kovacs, P. & Stumvoll, M. (2005). Fatty acids and insulin resistance in muscle
and liver. Best Practice & Research Clinical Endocrinology &
Metabolism, 19, 625-635.

113

106. Krook, A., Roth, R. A., Jiang, X. J., Zierath, J. R., & Wallberg-Henriksson, H.
(1998). Insulin-stimulated Akt kinase activity is reduced in skeletal muscle from
NIDDM subjects. Diabetes, 47, 1281-1286.

107. Kyosseva, S. V. (2004). Mitogen-activated protein kinase signaling. In S.John
(Ed.), International Review of Neurobiology Disorders of Synaptic Plasticity and
Schizophrenia (Volume 59 ed., pp. 201-220). Academic Press.

108. Law, S. W., Conneely, O. M., DeMayo, F. J., & O'Malley, B. W. (1992).
Identification of a new brain-specific transcription factor, NURR1. Molecular
Endocrinology, 6, 2129-2135.

109. Lazar, M. A. (2005). How obesity causes diabetes: not a tall tale. Science, 307,
373-375.

110. Le Marchand-Brustel, Y., Gual, P., Gremeaux, T., Gonzalez, T., Barres, R., &
Tanti, J.-F. (2003). Fatty acid-induced insulin resistance: role of insulin receptor
substrate 1 serine phosphorylation in the retroregulation of insulin signaling.
Biochem.Soc.Trans., 31, 1152-1156.

111. Leonard, W. R. & Robertson, M. L. (1994). Evolutionary perspectives on human
nutrition: The influence of brain and body size on diet and metabolism. American
Journal of Human Biology, 6, 77-88.

112. Leonardsson, G., Steel, J. H., Christian, M., Pocock, V., Milligan, S., Bell, J. et al.
(2004). Nuclear receptor corepressor RIP140 regulates fat accumulation. PNAS,
101, 8437-8442.

113. Lev-Ran, A. (2001). Human obesity: an evolutionary approach to understanding
our bulging waistline. Diabetes Metab Res Rev 2001; 17: 347-362., 2001, 347-
362.

114. Li, Q. X., Ke, N., Sundarma, R., Wong-Staal, F., & . (2006). NR4A1, 2, 3-an
orphan nuclear hormone receptor family involved in cell apoptosis and
carcinogenesis. Histol.Histopathol., 21, 533-540.

115. Lim, H. J., Moon, I., & Han, K. (2004). Transcriptional cofactors exhibit
differential preference toward peroxisome proliferator-activated receptors {alpha}
and {delta} in uterine cells. Endocrinology, 145, 2886-2895.

114

116. Lin, J., Puigserver, P., Donovan, J., Tarr, P., & Spiegelman, B. M. (2002).
Peroxisome proliferator-activated receptor γ coactivator 1β (PGC-1β), a novel
PGC-1-related transcription coactivator associated with host cell factor. J Biol
Chem, 277, 1645-1648.

117. Lin, J., Handschin, C., & Spiegelman, B. M. (2005). Metabolic control through
the PGC-1 family of transcription coactivators. Cell Metab, 1, 361-370.

118. Liu, H.-Y., Hong, T., Wen, G.-B., Han, J., Zuo, D., Liu, Z. et al. (2009). Increased
basal level if Akt-dependent insulin signaling may be responsible for the
development of insulin resistance. Am J Physiol Endocrinol Metab, 297, E898-
E906.

119. Lowell, B. B. & Shulman, G. I. (2005). Mitochondrial dysfunction and type 2
diabetes. Science, 307, 384-387.

120. Luiken, J. J. F. P., Arumugam, Y., Dyck, D. J., Bell, R. C., Pelsers, M. M. A. L.,
Turcotte, L. P. et al. (2001). Increased rates of fatty acid uptake and
plasmalemmal fatty acid transporters in obese Zucker rats. Journal of Biological
Chemistry, 276, 40567-40573.

121. Luiken, J. J. F. P., Dyck, D. J., Tandon, N. N., Glatz, J. F. C., & Bonen, A.
(2000). FAT/CD36 translocation to the plasma membrane increases fatty acid
transport during muscle contraction in healthy rats but not in obese Zucker rats.
FASEB Journal, 14, A200.

122. Luiken, J. J. F. P., Koonen, D. P. Y., Willems, J., Zorzano, A., Becker, C.,
Fischer, Y. et al. (2002). Insulin stimulates long-chain fatty acid utilization by rat
cardiac myocytes through cellular redistribution of FAT/CD36. Diabetes, 51,
3113-3119.

123. Luiken, J. J. F. P., Ouwens, D. M., Habets, D. D. J., van der Zon, G. C. M.,
Coumans, W. A., Schwenk, R. W. et al. (2009). Permissive action of protein
kinase C-ζ in insulin-induced CD36- and GLT4 translocation in cardiac
myocytes. J.Endocrinol., 201, 199-209.

124. Mangelsdorf, D. J., Thummel, C., Beato, M., Herrlich, P., Schutz, G., Umesono,
K. et al. (1995). The nuclear receptor superfamily: the second decade. Cell, 83,
835-839.

115

125. Mangelsdorf, D. J. & Evans, R. M. (1995). The RXR heterodimers and orphan
receptors. Cell, 83, 841-850.

126. Marchand-Brustel, Y. L., Gual, P., Gremeaux, T., Gonzalez, T., Barres, R., &
Tanti, F. J. (2003). Fatty acid-induced insulin resistance: role of insulin receptor
substrate 1 serine phosphorylation in the retroregulation of insulin signaling.
Biochemical Society Transactions, 31, 1152-1156.

127. McAinch, A. J., Lee, J. S., Bruce, C. R., Tunstall, R. J., Hawley, J. A., &
Cameron-Smith, D. (2003). Dietary regulation of fat oxidative gene expression in
different skeletal muscle fiber types. Obesity Research, 11, 1471-1479.

128. McGarry, J. D., Mills, S. E., Long, C. S., & Foster, D. W. (1983). Observations
on the affinity for carnitine, and malonyl-CoA sensitivity, of carnitine
palmitoyltransferase I in animal and human tissue. Biochemical Journal, 214, 21-
28.

129. Meex, R. C. R., Schrauwen-Hinderling, V. B., Moonen-Kornips, E., Schaart, G.,
Mensink, M., Phielix, E. et al. (2010). Restoration of muscle mitochondrial
function and metabolic flexibility in type 2 diabetes by exercise training is
paralleled by increased myocellular fat storage and improved insulin sensitivity.
Diabetes, 59, 572-579.

130. Meng, R. S., Pei, Z. H., Yin, R., Zhang, C. X., Chen, B. L., Zhang, Y. et al.
(2009). Adenosine monophosphate-activated protein kinase inhibits cardiac
hypertrophy through reactivating peroxisome proliferator-activated receptor-alpha
signaling pathway. Eur J Pharmacol., 620, 63-70.

131. Menshikova, E. V., Ritov, V. B., Toledo, F. G. S., Ferrell, R. E., Goodpaster, B.
H., & Kelley, D. E. (2005). Effects of weight loss and physical activity on skeletal
muscle mitochondrial function in obesity. Am J Physiol Endocrinol Metab, 288,
E818-E825.

132. Miller, W. C., Bryce, G. R., & Conlee, R. K. (1984). Adaptations to a high-fat
diet that increase exercise endurance in male rats. J Appl Physiol, 56, 78-83.

133. Mitsumoto, Y. & Klip, A. (1992). Developmental regulation of the subcellular
distribution and glycosylation of GLUT1 and GLUT4 glucose transporters during
myogenesis of L6 muscle cells. Journal of Biological Chemistry, 267, 4957-4962.

116

134. Mogenstein, D. L. & Parker, M. G. (2007). Role of nuclear receptor coregulators
in metabolism. Expert.Rev.Endocrinolo.Metab., 2, 797-807.

135. Moon, B., Kwan, J. J.-M., Duddy, N., Sweeney, G., & Begum, N. (2003). Resistin
inhibits glucose uptake in L6 cells independently of changes in insulin signaling
and GLUT4 translocation. Am J Physiol Endocrinol Metab, 285, E106-E115.

136. Morgan, J. E., Beauchamp, J. R., Pagel, C. N., Peckham, M., Ataliotis, P., Jat, P.
S. et al. (1994). Myogenic cell lines derived from transgenic mice carrying a
thermolabile T antigen: a model system for the derivation of tissue-specific and
mutation-specific cell lines. Developmental Biology, 162, 486-498.

137. Morganstein, D. L. & Parker, M. G. (2007). Role of nuclear receptor coregulators
in metabolism. Expert.Rev.Endocrinolo.Metab., 2, 797-807.

138. Muniyappa, R., Lee, S., Chen, H., & Quon, M. J. (2008). Current approaches for
assessing insulin sensitivity and resistance in vivo: advantages, limitations, and
appropriate usage. AJP - Endocrinology and Metabolism, 294, E15-E26.

139. Muoio, D. M. (2010). Intramuscular triacylglycerol and insulin resistance: Guilty
as charged or wrongly accused? Biochimica et Biophysica Acta (BBA) -
Molecular and Cell Biology of Lipids, 1801, 281-288.

140. Myers, M. G., Grammer, T. C., Brooks, J., Glasheen, E. M., Wang, L. M., Sun, X.
J. et al. (1995). The pleckstrin homology domain in insulin receptor substrate-1
sensitizes insulin signaling. Journal of Biological Chemistry, 270, 11715-11718.

141. Myers, S. A., Eriksson, N., Burow, R., Wang, S. C. M., & Muscat, G. E. O.
(2009). [beta]-Adrenergic signaling regulates NR4A nuclear receptor and
metabolic gene expression in multiple tissues. Molecular and Cellular
Endocrinology, 309, 101-108.

142. Nagao, M., Parimoo, B., & Tanaka, K. (1993). Developmental, nutritional, and
hormonal regulation of tissue-specific expression of the genes encoding various
acyl-CoA dehydrogenases and alpha-subunit of electron transfer flavoprotein in
rat. Journal of Biological Chemistry, 268, 24114-24124.

143. Nascimento, E. B. M., Fodor, M., van der Zon, G. C. M., Jazet, I. M., Meinders,
A. E., Voshol, P. J. et al. (2006). Insulin-mediated phosphorylation of the proline-
rich Akt substrate PRAS40 Is impaired in insulin target tissues of high-fat diet-fed
rats. Diabetes, 55, 3221-3228.

117

144. Neel, J. V. (1962). Diabetes mellitus: A thrifty genotype rendered detrimental by
progress. Am.J.Hum.Genet., 14, 353.

145. Newton, A. C. (1995). Protein kinase C: structure, function,and regulation.
Journal of Biological Chemistry, 270, 28495-28498.

146. Ogden, C. L., Carroll, M. D., Curtin, L. R., Lamb, M. M., & Flegal, K. M. (2010).
Prevalence of high body mass index in US children and adolescents, 2007-2008.
JAMA: The Journal of the American Medical Association, 303, 242-249.

147. Ouwens, D. M., Diamant, M., Fodor, M., Habets, D. D. J., Pelsers, M. M. A. L.,
El Hasnaoui, M. et al. (2007). Cardiac contractile dysfunction in insulin-resistant
rats fed a high-fat diet is associated with elevated CD36-mediated fatty acid
uptake and esterification. Diabetologia, 50, 1938-1948.

148. Palanivel, R. & Sweeney, G. (2005). Regulation of fatty acid uptake and
metabolism in L6 skeletal muscle cells by resistin. FEBS Letters, 579, 5049-5054.

149. Palou, M., Priego, T., Sánchez, Z., Villegas, E., Rodríguez, A. M., Palou, A. et al.
(2008). Sequential changes in the expression of genes involved in lipid
metabolism in adipose tissue and liver in response to fasting. Pflügers Archiv
European Journal of Physiology, 456, 825-836.

150. Parker, M. G., Christian, M., & White, R. (2006). The nuclear receptor co-
repressor RIP140 controls the expression of metabolic gene networks. Biochem
Society Transactions, 34, 1103-1106.

151. Patti, M. E., Butte, A. J., Crunkhorn, S., Cusi, K., Berria, R., Kashyap, S. et al.
(2003). Coordinated reduction of genes of oxidative metabolism in humans with
insulin resistance and diabetes: potential rol of PGC1 and NRF1. PNAS, 100,
8466-8471.

152. Pearen, M. A., Myers, S. A., Raichur, S., Ryall, J. G., Lynch, G. S., & Muscat, G.
E. O. (2008). The orphan nuclear receptor, NOR-1, a target of {beta}-adrenergic
signaling, regulates gene expression that controls oxidative metabolism in skeletal
muscle. Endocrinology, 149, 2853-2865.

153. Pei, L., Castrillo, A., & Tontonoz, P. (2006). Regulation of macrophage
inflammatory gene expression by the orphan nuclear receptor Nur77. Molecular
Endocrinology, 20, 786-794.

118

154. Petersen, K. F., Dufour, S., Befroy, D., Garcia, R., & Shulman, G. I. (2004).
Impaired mitochondrial activity in the insulin-resistant offspring of patients with
type 2 diabetes. N Engl J Med, 350, 664-671.

155. Pimenta, A. S., Gaidhu, M. P., Habib, S., So, M., Fediuc, S., Mirpourian, M. et al.
(2008). Prelonged exposure to palmitate impairs fatty acid oxidation despite
activation of AMP-activated protein kinase in skeletal muscle cells. Journal of
Cellular Physiology, 217, 478-485.

156. Pols, T. W. H., Bonta, P. I., & de Vries, C. J. M. (2007). NR4A nuclear orphan
receptors: protective in vascular disease? Curr Opin Lipidol., 18, 515-520.

157. Pols, T. W. H. & de Vries, C. J. M. (2008). A shining future for NR4A nuclear
receptors in DNA repair. Pigment Cell Melanoma Res., 21, 342-343.

158. Powelka, A. M., Seth, A., Virbasius, J. V., Kiskinis, E., Nicoloro, S. M.,
Guilherme, A. et al. (2006). Suppression of oxidative metabolism and
mitochondrial biogenesis by the transcriptional corepressor RIP140 in mouse
adipocytes. Journal of Clinical Investigation, 116, 125-136.

159. Powell, D. J., Turban, S., Gray, A., Hajduch, E., & Hundal, H. S. (2004).
Intracellular ceramide synthesis and protein kinase Cζ activation play an essential
role in palmitate-induced resistance in rat L6 skeletal muscle cells. Biochem J.,
382, 619-629.

160. Rabol, R., Boushel, R., & Dela, F. (2006). Mitochondrial oxidative function and
type 2 diabetes. Appl Physiol Nutr Metab, 31, 675-683.

161. Randle, P. J., Garland, P. B., Hales, C. N., & Newsholme, E. A. (1963). The
glucose fatty-acid cycle.Its role in insulin sensitivity and the metabolic
disturbances of diabetes mellitus. Lancet, 1, 785-789.

162. Reaven, R. M. (1988). Banting lecture 1988. Role of insulin resistance in human
disease. Diabetes, 37, 1595-1607.

163. Rector, R. S., Warner, S. O., Liu, Y., Hinton, P. S., Sun, G. Y., Cox, R. H. et al.
(2007). Exercise and diet induced weight loss improves measures of oxidative
stress and insulin sensitivity in adults with characteristics of the metabolic
syndrome. Am J Physiol Endocrinol Metab, 293, E500-E506.

119

164. Richardson, D. K., Kashyap, S., Bajaj, M., Cusi, K., Mandarino, S. J., Finlayson,
J. et al. (2005). Lipid infusion decreases the expression of nuclear encoded
mitochondrial genes and increases the expression of extracellular matrix genes in
human skeletal muscle. Journal of Biological Chemistry, 280(11), 10290-10297.

165. Rimbert, V., Vidal, H., Duché, P., Debard, C., Giraudet, C., Boirie, Y. et al.
(2009). Rapid down-regulation of mitochondrial fat metabolism in human muscle
after training cessation is dissociated from charges in insulin sensitivity. FEBS
Letters, 583, 2927-2933.

166. Roden, M. (2004). How free fatty acids inhibit glucose utilization in human
skeletal muscle. News Physiol.Sci., 19, 92-96.

167. Roden, M., Price, T. B., Perseghin, G., Petersen, K. F., Rothman, D. L., Cline, G.
W. et al. (1996). Mechanism of free fatty acid-induced insulin resistance in
humans. Journal of Clinical Investigation, 97, 2859-2865.

168. Rodriguez-Calvo, R., Jove, M., Coll, T., Camins, A., Sanchez, R. M., Alegret, M.
et al. (2006). PGC-1α down-regulation is associated with reduced ERRα activity
and MCAD expression in skeletal muscle of senescene-accelerated mice. Journal
of Gerontology: BIOLOGICAL SCIENCES, 61A, 773-780.

169. Russell, A. P., Feilchenfeldt, J., Schreiber, S., Praz, M., Crettenand, A., Gobelet,
C. et al. (2003). Endurance training in humans leads to fiber type-specific
increases in levels of peroxisome proliferator-activated receptor-γ coactivator-1
and peroxisome proliferator-activated receptor-α in skeletal muscle. Diabetes, 52,
2874-2881.

170. Russell, A. P., Hesselink, M. K. C., Lo, S. K., & Schrauwen, P. (2005).
Regulation of metabolic transcriptional co-activators and transcription factors
with acute exercise. FASEB Journal, 19, 986-988.

171. Sabetsky, V. & Ekblom, J. (2010). Insulin: A new era for an old hormone.
Pharmacological Research, 61, 1-4.

172. Sakamoto, K. & Holman, G. D. (2008). Emerging role for AS160/TBC1D4 and
TBC1D1 in the regulation of GLUT4 traffic. AJP - Endocrinology and
Metabolism, 295, E29-E37.

120

173. Saltiel, A. R. & Kahn, C. R. (2001). Insulin signalling and the regulation of
glucose and lipid metabolism. Nature, 414, 799-806.

174. Scarpulla, R. C. (2006). Nuclear control of respiratory gene expression in
mammalian cells. J Cell Bioch, 97, 673-683.

175. Schenk, S., Saberi, M., & Olefsky, J. M. (2008). Insulin sensitivity: modulation
by nutrients and inflammation. Journal of Clinical Investigation, 118, 2992-3002.

176. Schmitz-Peiffer, C., Craig, D. L., & Biden, T. J. (1999). Ceramide generation is
sufficient to account for the inhibition of the insulin-stuimulated PKB pathway in
C2C12 skeletal muscle cells pretreated with palmitate. Journal of Biological
Chemistry, 274, 24202-24210.

177. Schmitz-Peiffer, C., Oakes, N. D., Browne, C. L., Kraegen, E. W., & Biden, T. J.
(1997). Reversal of chronic alterations of skeletal muscle protein kinase C from
fat-fed rats by BRL-49653. Am J Physiol Endocrinol Metab, 273, E915-E921.

178. Schrauwen-Hinderling, V. B., Kooi, M. E., Hesselink, M. K. C., Jeneson, J. A. L.,
Backes, W. H., van Echteld, C. J. A. et al. (2007). Impaired in vivo mitochondrial
function but similar intramyocellular lipid content in patients with type 2 diabetes
mellitus and BMI-matched control subjects. Diabetologia, 50, 113-120.

179. Schultz, T. A., Lewis, S. B., Westbie, D. K., Wallin, J. D., & Gerich, J. E. (1977).
Glucose delivery: a modulator of glucose uptake in contracting skeletal muscle.
Amercian Journal of Physiology, 233(6), E514-E518.

180. Seth, A., Steel, J. H., Nichol, D., Pocock, V., Kumaran, M. K., Fritah, A. et al.
(2007). The transciptional corepressor RIP140 regulates oxidative metabolism in
skeletal muscle. Cell Metabolism, 6, 236-245.

181. Sidossis, L. S. & Wolfe, R. R. (1996). Glucose and insulin-induced inhibition of
fatty acid oxidation: the glucose-fatty acid cycle reversed. American Journal of
Physiology, 270, E733-E738.

182. Simi, B., Sempore, B., Mayet, M. H., & Favier, R. J. (1991). Additive effects of
training and high-fat diet on energy metabolism during exercise. J Appl Physiol,
71, 197-203.

121

183. Simoneau, J.-A., Veerkamp, J. H., Turcotte, L. P., & Kelley, D. E. (1999).
Markers of capacity to utilize fatty acids in human skeletal muscle:relation to
insulin resistance and obesity and effects of weight loss. FASEB Journal, 13,
2051-2060.

184. Simoneau, J. & Kelley, D. E. (1997). Altered glycolytic and oxidative capacities
of skeletal muscle contribute to insulin resistance in NIDDM. J Appl Physiol, 83,
166-171.

185. Sinha, S., Perdomo, G., Brown, N. F., & O'Doherty, R. M. (2004). Fatty acid-
induced insulin resistance in L6 myotubes is prevented by inhibition of activation
and nuclear localization of nuclear factor κB. Journal of Biological Chemistry,
279, 41294-41301.

186. Sirikul, B., Gower, B. A., Hunter, G. R., Larson-Meyer, D. E., & Newcomer, B.
R. (2006). Relationship between insulin sensitivity and in vivo mitochondrial
function in skeletal muscle. Am J Physiol Endocrinol Metab, 291, E724-E728.

187. Sladek, R., Bader, J.-A., & Giguére, V. (2001). The orphan nuclear receptor
estrogen-related receptor α is a transcriptional regulator of the human medium-
chain acyl coenzyme A dehydrogenase gene. Mol.Cell.Biol., 17, 5400-5409.

188. Steel, J. H., White, R., & Parker, M. G. (2005). Role of the RIP140 corepressor in
ovulation and adipose biology. Journal of Endocrinology, 185, 1-9.

189. Stremmel, W. (1988). Fatty acid uptake by isolated rat heart myocytes represents
a carrier-mediated transport process. Journal of Clinical Investigation, 81, 844-
852.

190. Stump, C. S., Short, K. R., Bigelow, M. L., Schimke, J. M., & Nair, K. S. (2003).
Effect of insulin on human skeletal muscle mitochondrial ATP production,
protein synthesis, and mRNA transcripts. PNAS, 100, 7996-8001.

191. Sutherland, L. N., Capozzi, L. C., Turchinsky, N. J., Bell, R. C., & Wright, D. C.
(2008). Time course of high-fat diet-induced reductions in adipose tissue
mitochondrial proteins: potential mechanisms and the relationship to glucose
intolerance. Am J Physiol Endocrinol Metab, 295, 1076-1083.

122

192. Terada, S., Goto, M., Kato, M., Kawanaka, K., Shimokawa, T., & Tabata, I.
(2002). Effects of low-intensity prolonged exercise on PGC-1 mRNA expression
in rat epitroclearis muscle. Biochemical and Biophysical Research
Communications, 296, 350-354.

193. Thenot, S., Charpin, M., Bonnet, S., & Cavailles, V. (1999). Estrogen receptor
cofactors expression in breast and endometrial human cancer cells. Molecular and
Cellular Endocrinology, 156, 85-93.

194. Thiébaud, D., DeFronzo, R. A., Jacot, E., Golay, A., Acheson, K., Maeder, E. et
al. (1982). Effect of long chain triglyceride infusion on glucose metabolism in
man. Metabolism, 31(11), 1128-1136.

195. Tremblay, F., Lavigne, L., Jacques, H., & Marette, A. (2001). Defective insulin-
induced Glut-4 translocation in skeletal muscle of high fat-fed rats is associated
with alterations in both Akt/Protein kinase B and atypical protein kinase C (ζ/λ)
activities. Diabetes, 50, 1901-1910.

196. Tsakiridis, T., McDowell, H. E., Walker, T., Downes, C. P., Hundal, H. S.,
Vranic, M. et al. (1995). Multiple roles of phosphatidylinositol 3-kinase in
regulation of glucose transport, amino acid transport, and glucose transporters in
L6 skeletal muscle cells. Endocrinology, 136, 4315-4322.

197. Turcotte, L. P. (2006). Skeletal muscle lipid metabolism during exercise. In
M.Hargreaves & L. Spriet (Eds.), Exercise Metabolism (2 ed., pp. 105-135).
Champaign, IL.: Human Kinetics, Inc.

198. Turcotte, L. P. & Fisher, J. S. (2008). Skeletal muscle insulin resistance: roles of
fatty acid metabolism and exercise. Physical Therapy, 88, 1279-1296.

199. Turner, N., Bruce, C. R., Beale, S. M., Hoehn, K. L., So, T., Rolph, M. S. et al.
(2007). Excess lipid availability increases mitochondrial fatty acid oxidative
capacity in muscle: Evidence against a role for reduced fatty acid oxidation in
lipid-induced insulin resistance in rodents. Diabetes, 56, 2085-2092.

200. Ueki, K., Yamamoto-Honda, R., Kaburagi, Y., Yamauchi, T., Tobe, K.,
Burgering, B. M. T. et al. (1998). Potential role of protein kinase B in insulin-
induced glucose transport, glycogen synthesis, and protein synthesis. Journal of
Biological Chemistry, 273, 5315-5322.

123

201. Valerio, A., Cardile, A., Cozzi, V., Bracale, R., Tedesco, L., Pisconti, A. et al.
(2006). TNF-α downregulates eNOS expression and mitochondrial biogenesis in
fat and muscle of obese rodents. Journal of Clinical Investigation, 116, 2791-
2798.

202. Wang, S. Y., Kannan, S., Shay, D., Segal, S., Datta, S., & Tsen, L. (2002).
Anesthetic Considerations for a Patient with Compound Heterozygous Medium-
Chain Acyl-CoA Dehydrogenase Deficiency. Anesthesia & Analgesia, 94, 1595-
1597.

203. Watt, M. J., Southgate, R. J., Holmes, A. G., & Febbraio, M. A. (2004).
Suppression of plasma free fatty acids upregulates peroxisome proliferator-
activated receptor (PPAR) α and δ and PPAR coactivator 1α in human skeletal
muscle, but not lipid regulatory genes. Journal of Molecular Endocrinology, 33,
533-544.

204. Wende, A. R., Schaeffer, P. J., Parker, G. J., Zechner, C., Han, D.-H., Chen, M.
M. et al. (2007). A role for the transcriptional coactivator PGC-1α in muscle
refueling. J Biol Chem, 282, 36642-36651.

205. Wendorf, R. S. & Goldfine, I. D. (1991). Archaeology of NIDDM. Excavation of
the thrifty"genotype. Diabetes, 40, 161-165.

206. White, J. H., Fernandes, I., Mader, S., & Yang, X. J. (2004). Corepressor
recruitment by agonist-bound nuclear receptors. In L.Gerald (Ed.), Vitamins &
Hormones Nuclear Receptor Coregulators (Volume 68 ed., pp. 123-143).
Academic Press.

207. White, R., Leonardsson, G., Rosewell, J., Jacobs, M. A., Milligan, S., & Parker,
M. (2000). The nuclear receptor co-repressor Nrip1 (RIP140) is essential for
female fertility. Nature Medicine, 6, 1368-1374.

208. Wild, S., Roglic, G., Green, A., Sicree, R., & King, H. (2004). Global prevalence
of diabetes. Diabetes Care, 27, 1047-1053.

209. Wright, D. C., Han, D.-H., Garcia-Roves, P. M., Geiger, P. C., Jones, T. E., &
Holloszy, J. O. (2007). Exercise-induced mitochondrial biogenesis begins before
the increase in muscle PGC-1α expression. Journal of Biological Chemistry, 282,
194-199.

124

210. Wu, Q., Ortegon, A. M., Tsang, B., Doege, H., Feingold, K. R., & Stahl, A.
(2006). FATP1 is an insulin-sensitive fatty acid transporter involved in diet-
induced obesity. Molecular and Cellular Biology, 26, 3455-3467.

211. Xu, J., Stanislaus, S., Chinookoswong, N., Lau, Y. Y., Hager, T., Patel, J. et al.
(2009). Acute glucose-lowering and insulin-sensitizing action of FGF21 in
insulin-resistant mouse models-association with liver and adipose tissue effects.
AJP - Endocrinology and Metabolism, 297, E1105-E1114.

212. Yaffe, D. (1968). Retention of differentiation potentialities during prolonged
cultivation of myogenic cells. Proceedings of the National Academy of Sciences
of the United States of America, 61, 477-483.

213. Yang, W. L. & Lim, R. W. (1997). Modulation of muscle creatine kinase
promoter activity by the inducible orphan nuclear receptor TIS1. Biochemical
Journal, 321, 281-287.

214. Zhang, L., Keung, W., Samokhvalov, V., Wang, W., & Lopaschuk, G. D. (2010).
Role of fatty acid uptake and fatty acid ß-oxidation in mediating insulin resistance
in heart and skeletal muscle. Biochimica et Biophysica Acta (BBA), 1801, 1-22.

215. Zimmet, P. & Thomas, C. R. (2003). Genotype, obesity and cardiovascular
disease-has technical and social advancement outstripped evolution?
J.Intern.Med., 254, 113-125.

216. Zschiedrich, I., Hardeland, U., Krones-Herzig, A., Diaz, M. B., Vegiopoulos, A.,
Müggenburg, J. et al. (2008). Coactivator function of RIP140 for NFkB/RelA-
dependent cytokine gene expression. Blood, 112, 264-276.

125

APPENDICES
APPENDIX A: TABLES

Table 1. Primers Sequences used in RT-PCR
mRNA Primer Sequences
cox4 5’ – TTCGGGCACATGGAGTGTTGT – 3’
5’ – GCATGGCCACCCAGTCACGA – 3’

cpt1 5’ – GCCTGGGATGCGTGTAGTG – 3’
5’ – ATGTAAGTGACTGGTGGGAAG – 3’

fatp1 5’ – GGACCTTCGCACAGCTAGAC – 3’
5’ – AAATAGCCGATCATCCATGC – 3’

fat/cd36 5’ – CCAGAACCCAGACAACCACT – 3’
5’ – CGATGGTCCCAGTCTCATTT – 3’

fgf21

5' – AGGCTTTGACACCCAGGATT – 3'
5' – ACAGATGACGACCAGGACAC – 3'
mcad

5' – ACTCCAGGGTATTTCTCCATC – 3’
5' – GCACTGTTGCTGCTTCAGG – 3’
nur77

5’ – AAAGGCGGACTCTAGCAACA – 3’
5’ – GGCATGGTGAAGGAAGTTGT – 3’
pgc-1α

5’ – CACAGATTCAAGCCAGTGCT – 3’
5’ – TAAGGATTTCGGTGGTGACA – 3’
rip140

5’ – CACTGGTAAGGCCGCCGAGC – 3’
5’ – CAGCCTGCAGGGCCTGAACC – 3’

18s 5' – CGCGGTTCTATTTTGTTGGT – 3'
5' – AGTCGGCATCGTTTATGGTC – 3'

126

Table 2. Primers Conditions
Primers Conditions
cpt1

45 °C, 45 min; 94 °C, 4 min;
[40 cycles (94 °C, 45 sec; 64 °C, 30sec; 72 °C, 1 min)];
72 °C, 7 min
cox4

45 °C, 45 min; 94 °C, 4 min; [30 cycles (94 °C, 45 sec; 64 °C, 30sec; 72 °C,
1 min)];
72 °C, 7 min
fatp1

45 °C, 45 min; 94 °C, 5 min; [40 cycles (94 °C, 45 sec; 62 °C, 30 sec; 72°C, 1
min)];
72 °C, 7 min
fat/cd36

45 °C, 45 min; 94 °C, 4 min; [40 cycles (94 °C, 1 min; 62 °C, 30 sec; 72 °C, 1
min)];
72 °C, 7 min
fgf21

45 °C, 45 min; 95 °C, 5 min; [40 cycles (94 °C, 2 sec; 60 °C, 20 sec; 72 °C,
10 sec)];
72 °C, 7 min
mcad

45 °C, 45 min; 95 °C, 5 min; [40 cycles (94 °C, 45 sec; 56 °C, 30 sec; 72 °C,
1 min)];
72 °C, 7 min
nur77

45 °C, 45 min; 94 °C,10 min; [36 cycles (94 °C, 30 sec; 56 °C, 1 min; 74 °C,
1 min);
72 °C, 5 min
pgc-1α

45 °C, 45 min; 94 °C, 4 min; [36 cycles (94 °C, 45 sec; 55 °C, 30 sec; 72 °C,
1 min)];
72 °C, 7 min
rip140

45 °C, 45 min; 95 °C, 5 min; [40 cycles (94 °C, 1 min; 61 °C, 30 sec; 72 °C, 1
min);
72 °C, 7 min
18s

45 °C, 45 min; 95 °C, 5 min; [40 cycles (94 °C, 45 sec; 56 °C, 30 sec; 72 °C,
1 min)];
72 °C, 7 min

127

APPENDIX B: POWERPOINT PRESENTATION

University of Southern California
Genetic Manipulation of Receptor Genetic Manipulation of Receptor Genetic Manipulation of Receptor Genetic Manipulation of Receptor
Interacting Protein (RIP140) Uncovers Interacting Protein (RIP140) Uncovers Interacting Protein (RIP140) Uncovers Interacting Protein (RIP140) Uncovers
Its Critical Role in the Regulation of Its Critical Role in the Regulation of Its Critical Role in the Regulation of Its Critical Role in the Regulation of
Metabolism, Gene Expression and Insulin Metabolism, Gene Expression and Insulin Metabolism, Gene Expression and Insulin Metabolism, Gene Expression and Insulin
Signaling in Skeletal Muscle Cells Signaling in Skeletal Muscle Cells Signaling in Skeletal Muscle Cells Signaling in Skeletal Muscle Cells
Silvana Constantinescu Silvana Constantinescu Silvana Constantinescu Silvana Constantinescu
Department of Biological Sciences
University of Southern California, Los Angeles, CA
Spring 2012

0
100
200
% CONTROL
Glucose Uptake
Control
Proper Insulin Action
0
100
200
% CONTROL
FA Uptake
0
100
200
% CONTROL
FA Oxidation
Glucose Uptake Glucose Uptake Glucose Uptake Glucose Uptake
FA Uptake FA Uptake FA Uptake FA Uptake
FA Oxidation FA Oxidation FA Oxidation FA Oxidation
PROPER INSULIN ACTION
University of Southern California

128

University of Southern California
FA Uptake
0
100
200
0
100
200
Glucose Uptake
% CONTROL
IMPROPER INSULIN ACTION
0
100
200
FA Oxidation
Control
Proper Insulin Action
Improper Insulin Action

University of Southern California
Factors affecting proper insulin action
- Oxidative capacity which is affected by
the action of nuclear factors

129

P
P
A
R
PPRE
PGC-1α
P
P
A
R
+ + + +
- - - -
CONTROL
P
P
A
R
PPRE
PGC-1α
P
P
A
R
Low RIP140
+ + + +
University of Southern California
RIP140 – Co-Repressor
COX COX COX COX
COX COX COX COX

University of Southern California
Purpose Purpose Purpose Purpose
To elucidate whether a reduction in
RIP140 expression would impair:
1 regulation of insulin-sensitive FA
uptake, FA oxidation and glucose uptake
2 gene expression and insulin signaling
EXPERIMENT 1

130

University of Southern California
Identify the cellular Identify the cellular Identify the cellular Identify the cellular mechanisms mechanisms mechanisms mechanisms
we measured the expression of we measured the expression of we measured the expression of we measured the expression of
proteins proteins proteins proteins and and and and enzymes involved in enzymes involved in enzymes involved in enzymes involved in
metabolic regulation and insulin metabolic regulation and insulin metabolic regulation and insulin metabolic regulation and insulin
signaling signaling signaling signaling
Our Approach

University of Southern California
METHODS
Control
RIP140
24h 48h 24h 12h 30’ 15’
Antibiotic-free
Medium
siRNA
Medium
Serum-
free
Medium
KRB ±Insulin
(1μM)

131

University of Southern California
0
50
100
150
mRNA Protein
% CONTROL
&
&
RIP140
Basal Conditions
Control siRNA
RIP140 siRNA

University of Southern California
0
50
100
150
200
250
% CONTROL
FA Uptake FA Oxidation Glucose Uptake
&
&
KINETICS
Basal Conditions
Control siRNA
RIP140 siRNA

132

Adapted from Holloway et. al, 1997; Zhang et. al, 2010
University of Southern California
HOW DO WE METABOLIZE FA?
PGC-1α, COX4

aPKC aPKC Akt Akt
P
IRS-1
PI3-K
Insulin Action Insulin Action Insulin Action Insulin Action
Insulin
Plasma
Membrane
α
β β β β β β β β
α
University of Southern California
P
P

133

INSULIN INSULIN INSULIN INSULIN
SIGNALING SIGNALING SIGNALING SIGNALING
FA OXIDATION FA OXIDATION FA OXIDATION FA OXIDATION
University of Southern California
COX4, CPT1 COX4, CPT1 COX4, CPT1 COX4, CPT1
PGC PGC PGC PGC- - - -1 1 1 1α α α α, , , , MCAD MCAD MCAD MCAD
AKT AKT AKT AKT
PKC PKC PKC PKC- - - -ζ ζ ζ ζ
OXIDATIVE OXIDATIVE OXIDATIVE OXIDATIVE
CAPACITY CAPACITY CAPACITY CAPACITY
FA FA FA FA
UPTAKE UPTAKE UPTAKE UPTAKE
CD36 CD36 CD36 CD36
FATP1 FATP1 FATP1 FATP1

University of Southern California
HOW DO WE METABOLIZE FA?
Adapted from Holloway et. al, 1997; Zhang et. al, 2010

134

PM
0
50
100
150
mRNA Protein
% CONTROL
FA Uptake - CD36
Basal
University of Southern California
Control siRNA
RIP140 siRNA

0
100
200
mRNA
% CONTROL
&
Protein
University of Southern California
FA Uptake - FATP1
Basal
Control siRNA
RIP140 siRNA

135

Adapted from Holloway et. al, 1997; Zhang et. al, 2010
University of Southern California
HOW DO WE METABOLIZE FA?
PGC-1α, COX4

0
100
200
300
COX4
% CONTROL
&
PGC-1α
University of Southern California
&
Control siRNA
RIP140 siRNA
MCAD
&
OXIDATIVE CAPACITY
Basal

136

0
100
200
mRNA
% CONTROL
Protein
University of Southern California
&
CPT1
Basal
Control siRNA
RIP140 siRNA

aPKC aPKC Akt Akt
P
IRS-1
PI3-K
Insulin Action Insulin Action Insulin Action Insulin Action
Insulin
Plasma
Membrane
α
β β β β β β β β
α
University of Southern California
P
P

137

University of Southern California
0
100
200
% CONTROL
&
AKT PKC-ζ ζ ζ ζ
Control siRNA
RIP140 siRNA
Ser 473 Thr 308 Thr 410/403
&
INSULIN SIGNALING
Basal

University of Southern California
FAU FAU FAU FAU
= CD36 = CD36 = CD36 = CD36 FATP1 FATP1 FATP1 FATP1
FAO FAO FAO FAO

PGC1 PGC1 PGC1 PGC1α α α α
= CPT1 = CPT1 = CPT1 = CPT1 MCAD MCAD MCAD MCAD COX4 COX4 COX4 COX4
Signaling Signaling Signaling Signaling

AKT ( AKT ( AKT ( AKT (Thr Thr Thr Thr) ) ) )
= PKC = PKC = PKC = PKC- - - -ζ ζ ζ ζ AKT (Ser) AKT (Ser) AKT (Ser) AKT (Ser)
CONCLUSION

138

INSULIN INSULIN INSULIN INSULIN
SIGNALING SIGNALING SIGNALING SIGNALING
LOW LOW LOW LOW
FA OXIDATION FA OXIDATION FA OXIDATION FA OXIDATION
OXIDATIVE OXIDATIVE OXIDATIVE OXIDATIVE
CAPACITY CAPACITY CAPACITY CAPACITY
FA FA FA FA
UPTAKE UPTAKE UPTAKE UPTAKE
University of Southern California
BASAL - Low RIP140

University of Southern California
Basal conditions, l Basal conditions, l Basal conditions, l Basal conditions, low RIP140 ow RIP140 ow RIP140 ow RIP140
1 - - - - Increased FA Uptake Increased FA Uptake Increased FA Uptake Increased FA Uptake
2 2 2 2 - - - - Decreased FA Oxidation Decreased FA Oxidation Decreased FA Oxidation Decreased FA Oxidation
explained explained explained explained by the increase by the increase by the increase by the increase in basal AKT in basal AKT in basal AKT in basal AKT
phosphorylation phosphorylation phosphorylation phosphorylation
CONCLUSION

139

University of Southern California
INSULIN INSULIN INSULIN INSULIN- - - -MEDIATED MEDIATED MEDIATED MEDIATED
FA OXIDATION FA OXIDATION FA OXIDATION FA OXIDATION
INSULIN INSULIN INSULIN INSULIN
ACTION ACTION ACTION ACTION
OXIDATIVE OXIDATIVE OXIDATIVE OXIDATIVE
CAPACITY CAPACITY CAPACITY CAPACITY
0
50
100
150
Insulin Control
% CONTROL

University of Southern California
0
100
200
300
% CONTROL
FA Uptake FA Oxidation Glucose Uptake
&
KINETICS
Insulin-Mediated Conditions
Control siRNA
RIP140 siRNA

140

PM
&
0
100
200
mRNA Protein
% CONTROL
&
&
FA Uptake - CD36
Insulin-Mediated Conditions
University of Southern California
Control siRNA
RIP140 siRNA

0
100
200
mRNA
% CONTROL
&
Protein
FA Uptake - FATP1
Insulin-Mediated Conditions
University of Southern California
Control siRNA
RIP140 siRNA

141

0
100
200
300
mRNA
% CONTROL
&
Protein
University of Southern California
CPT1
Insulin-Mediated Conditions
Control siRNA
RIP140 siRNA

0
100
200
COX4
% CONTROL
PGC-1α
Control siRNA
RIP140 siRNA
MCAD
&
University of Southern California
OXIDATIVE CAPACITY
Insulin-Mediated Conditions

142

0
100
200
% CONTROL
&
&
AKT PKC-ζ ζ ζ ζ
Control siRNA
RIP140 siRNA
Ser 473 Thr 308 Thr 410/403
University of Southern California
Insulin Signaling
Insulin-Mediated Conditions

University of Southern California
= = = = FAU FAU FAU FAU
CD36 CD36 CD36 CD36 = = = = FATP1 FATP1 FATP1 FATP1
FAO FAO FAO FAO
= PGC1 = PGC1 = PGC1 = PGC1α α α α
CPT1 CPT1 CPT1 CPT1 MCAD MCAD MCAD MCAD = = = = COX4 COX4 COX4 COX4
Signaling Signaling Signaling Signaling
= AKT ( = AKT ( = AKT ( = AKT (Thr Thr Thr Thr) ) ) )
PKC PKC PKC PKC- - - -ζ ζ ζ ζ AKT (Ser) AKT (Ser) AKT (Ser) AKT (Ser)
CONCLUSION

143

INSULIN INSULIN INSULIN INSULIN
SIGNALING SIGNALING SIGNALING SIGNALING
High High High High
Insulin Insulin Insulin Insulin- - - -Mediated Mediated Mediated Mediated
FA OXIDATION FA OXIDATION FA OXIDATION FA OXIDATION
OXIDATIVE OXIDATIVE OXIDATIVE OXIDATIVE
CAPACITY CAPACITY CAPACITY CAPACITY
FA FA FA FA
UPTAKE UPTAKE UPTAKE UPTAKE
University of Southern California
Low RIP140
Insulin-Mediated Conditions

University of Southern California
Insulin Insulin Insulin Insulin- - - -mediated conditions, l mediated conditions, l mediated conditions, l mediated conditions, low RIP140 ow RIP140 ow RIP140 ow RIP140
• high rates of FA oxidation • high rates of FA oxidation • high rates of FA oxidation • high rates of FA oxidation
Explained Explained Explained Explained by by by by reduced insulin signaling reduced insulin signaling reduced insulin signaling reduced insulin signaling
CONCLUSION

144

University of Southern California
To challenge metabolic homeostasis and
determine whether an improvement in
oxidative capacity would restore proper
metabolic function
EXPERIMENT 2
Purpose

University of Southern California
To elucidate whether a reduction in
RIP140 expression would improve:
1 regulation of insulin-sensitive FA
uptake, FA oxidation and glucose uptake
2 gene expression and insulin signaling in
skeletal skeletal skeletal skeletal muscle muscle muscle muscle cells short cells short cells short cells short- - - -term incubated term incubated term incubated term incubated
with high FA with high FA with high FA with high FA
EXPERIMENT 2
Purpose

145

University of Southern California
METHODS
Control
RIP140
24h 48h 24h 12h 30’ 15’
Antibiotic-free
Medium
siRNA
HF
Serum-
free
Medium
+HF
KRB ±Insulin
(1μM)

0
50
100
150
mRNA
% CONTROL
Protein
&
&
& #
&
RIP140
HF - Basal Conditions
University of Southern California
Control siRNA
Control siRNA HF
RIP140 siRNA HF

146

University of Southern California
KINETICS
HF – Basal Conditions
0
100
200
300
% CONTROL
FA Uptake FA Oxidation
&
# &
Glucose Uptake
&
& & #
&
Control siRNA
Control siRNA HF
RIP140 siRNA HF

0
100
200
mRNA
% CONTROL
Protein
&
&
#
PM
#
University of Southern California
FA Uptake - CD36
HF - Basal
Control siRNA
Control siRNA HF
RIP140 siRNA HF

147

0
100
200
mRNA
% CONTROL
Protein
&
&
&
University of Southern California
FA Uptake - FATP1
HF - Basal
Control siRNA
Control siRNA HF
RIP140 siRNA HF
& (P=0.06)

0
100
200
COX4
% CONTROL
PGC-1α
&
&
MCAD
&
& &
University of Southern California
OXIDATIVE CAPACITY
HF - Basal
Control siRNA
Control siRNA HF
RIP140 siRNA HF

148

0
100
200
mRNA
% CONTROL
Protein
&
&
&
#
University of Southern California
CPT1
HF - Basal
Control siRNA
Control siRNA HF
RIP140 siRNA HF

0
100
200
% CONTROL
&
#
&
&
&
#
AKT PKC-ζ ζ ζ ζ
University of Southern California
INSULIN SIGNALING
HF - Basal
Control siRNA
Control siRNA HF
RIP140 siRNA HF
Ser 473 Thr 308 Thr 410/403

149

University of Southern California
FAU FAU FAU FAU
CD36 CD36 CD36 CD36
= FATP1 = FATP1 = FATP1 = FATP1
= = = = FAO FAO FAO FAO
= PGC1 = PGC1 = PGC1 = PGC1α α α α
CPT1 CPT1 CPT1 CPT1 = MCAD = MCAD = MCAD = MCAD COX4 COX4 COX4 COX4
Signaling Signaling Signaling Signaling

AKT AKT AKT AKT ( ( ( (Thr Thr Thr Thr) ) ) ) PKC PKC PKC PKC- - - -ζ ζ ζ ζ
= AKT = AKT = AKT = AKT (Ser) (Ser) (Ser) (Ser)
CONCLUSION

INSULIN INSULIN INSULIN INSULIN
SIGNALING SIGNALING SIGNALING SIGNALING
FA FA FA FA UPTAKE UPTAKE UPTAKE UPTAKE
OXIDATIVE OXIDATIVE OXIDATIVE OXIDATIVE
CAPACITY CAPACITY CAPACITY CAPACITY
FA FA FA FA
UPTAKE UPTAKE UPTAKE UPTAKE
University of Southern California
HF - Basal
Low RIP140

150

University of Southern California
Basal Basal Basal Basal HF HF HF HF, l , l , l , low ow ow ow RIP140 RIP140 RIP140 RIP140
1 High FA Uptake High FA Uptake High FA Uptake High FA Uptake
2 2 2 2 H H H High AKT serine 473 phosphorylation igh AKT serine 473 phosphorylation igh AKT serine 473 phosphorylation igh AKT serine 473 phosphorylation
CONCLUSION

0
100
200
300
FA Uptake
% CONTROL
FA Oxidation
&
& #
Glucose Uptake
# &
&
KINETICS
HF - Insulin-Mediated Conditions
University of Southern California
Control siRNA
Control siRNA HF
RIP140 siRNA HF

151

0
100
200
mRNA
% CONTROL
Protein
University of Southern California
&
&
&
PM
& &
&
FA Uptake - CD36
HF - Insulin-Mediated Conditions
Control siRNA
Control siRNA HF
RIP140 siRNA HF

0
50
100
150
200
250
mRNA
% CONTROL
Protein
FA Uptake - FATP1
HF - Insulin-Mediated Conditions
&
&
&
&
University of Southern California
Control siRNA
Control siRNA HF
RIP140 siRNA HF

152

0
100
200
300
COX4
% CONTROL
PGC-1α
&
MCAD
&
& #
University of Southern California
OXIDATIVE CAPACITY
HF - Insulin-Mediated Conditions
Control siRNA
Control siRNA HF
RIP140 siRNA HF

0
100
200
mRNA
% CONTROL
Protein
University of Southern California
&
&
CPT1
HF - Insulin-Mediated Conditions
Control siRNA
Control siRNA HF
RIP140 siRNA HF

153

0
100
200
Ser473
% CONTROL
Thr308
University of Southern California
Thr 410/403
&
&
INSULIN SIGNALING
HF - Insulin-Mediated Conditions
Control siRNA
Control siRNA HF
RIP140 siRNA HF

University of Southern California
FAU FAU FAU FAU
CD36 CD36 CD36 CD36 FATP1 FATP1 FATP1 FATP1
= = = = FAO FAO FAO FAO
= PGC1 = PGC1 = PGC1 = PGC1α α α α
= CPT1 = CPT1 = CPT1 = CPT1 MCAD MCAD MCAD MCAD = COX4 = COX4 = COX4 = COX4
Signaling Signaling Signaling Signaling
= = = = AKT AKT AKT AKT ( ( ( (Thr Thr Thr Thr) ) ) )
= = = = PKC PKC PKC PKC- - - -ζ ζ ζ ζ AKT AKT AKT AKT (Ser) (Ser) (Ser) (Ser)
CONCLUSION

154

University of Southern California
HF HF HF HF Insulin Insulin Insulin Insulin- - - -mediated conditions, l mediated conditions, l mediated conditions, l mediated conditions, low ow ow ow
RIP140 RIP140 RIP140 RIP140
R R R Reduced educed educed educed FA uptake FA uptake FA uptake FA uptake
CONCLUSION HF

University of Southern California
Low RIP140 Expression: Low RIP140 Expression: Low RIP140 Expression: Low RIP140 Expression:
- - - - Provide evidence for the role of AKT Provide evidence for the role of AKT Provide evidence for the role of AKT Provide evidence for the role of AKT
and PKC and PKC and PKC and PKC- - - - ζ ζ ζ ζ in the regulation of FA in the regulation of FA in the regulation of FA in the regulation of FA
metabolism metabolism metabolism metabolism
Final Conclusions

155

University of Southern California
• Dr Lorraine P • Dr Lorraine P • Dr Lorraine P • Dr Lorraine P Turcotte Turcotte Turcotte Turcotte
• • • • Funding: Funding: Funding: Funding:
- - - - Program Program Program Program for Women in Science for Women in Science for Women in Science for Women in Science
& Engineering & Engineering & Engineering & Engineering at USC at USC at USC at USC
- - - - Integrative Integrative Integrative Integrative & Evolutionary & Evolutionary & Evolutionary & Evolutionary
Biology Biology Biology Biology Graduate Program Graduate Program Graduate Program Graduate Program
ACKNOWLEDGMENTS

Abstract (if available)

Abstract Oxidative capacity is commonly assessed by measuring the content and the activity of key mitochondrial enzymes and there is evidence suggesting that oxidative capacity is regulated by multiple regulatory factors which include among others, the actions of positive and negative nuclear factors on the transcriptional regulation of oxidative enzymes. Of specific interest is the role played by the nuclear co-repressor identified as Receptor Interacting Protein 140 (RIP140). RIP140 has been shown to be highly expressed in skeletal muscle and to inhibit mitochondrial biogenesis and oxidative capacity. In line with its role as a negative regulator of oxidative capacity, there is evidence suggesting that in adipose tissue RIP140 deletion increases cellular respiration and protein expression of cytochrome c. However, the role of RIP140 on fatty acid (FA) metabolism had not been fully delineated, especially as it relates to insulin sensitivity in skeletal muscle cells. ❧ Thus this dissertation project contains two experiments aimed at determining the role of low RIP140 expression in the regulation of basal and insulin-mediated FA metabolism in skeletal muscle cells under normal or short-term high FA treatment. Given the putative role of RIP140 as a negative regulator of oxidative capacity, the purpose of these studies was to determine in skeletal muscle cells 1) whether genetic down-regulation of RIP140 expression would increase oxidative capacity and improve insulin sensitivity in normal cells and cells exposed to short-term high FA treatment and 2) whether metabolic alterations would be associated with alterations in the mRNA and/or protein content of enzymes and proteins involved in metabolic regulation and signaling under both conditions. To accomplish our aims, we used L6 rat skeletal muscle cells and assessed insulin sensitivity by measuring the effects of insulin on glucose uptake and FA uptake and oxidation under normal and short-term high FA treatment. ❧ The findings in the first study provide novel information regarding the role of RIP140 in the regulation of FA metabolism and implicate the AKT-PKC zeta axis of the insulin signaling pathway in the high rates of insulin-mediated FA oxidation observed in L6 cells with low RIP140 expression. Multiple studies have shown that a rise in the activity of mitochondrial oxidative enzymes is often, though not always, accompanied by an increase in FA oxidation. However, our data showed that, under control conditions in skeletal muscle cells, while the protein or mRNA content of some oxidative enzymes (COX4) was increased, the content of other important FA oxidative enzymes (MCAD, CPT1) was reduced. Conversely, the activity of proximal insulin signaling intermediates was reduced. Given that the inhibitory action of insulin on FA oxidation was similarly reduced in RIP140-treated cells, our data suggest that proximal insulin signaling is critical for proper regulation of FA metabolism and that low RIP140 expression affects the activation of these signaling intermediates. ❧ Data from the second study provide further evidence for the involvement of RIP140 in the regulation of FA metabolism and metabolic signaling. In this study, L6 cells with or without low RIP140 expression were incubated with high FA for 36 h. Our results showed that high FA exposure alone affected the mRNA and/or protein expression of several proteins involved in the regulation of FA metabolism including FA transport proteins and oxidative enzymes. In muscle cells incubated with high FA, low RIP140 expression rescued basal FA uptake and basal and insulin-mediated glucose uptake, but it did not affect basal or insulin-mediated FA oxidation. In line with these metabolic alterations, low RIP140 expression was able to rescue some of the changes induced by high FA exposure via alterations in the activation state of signaling intermediates (e.g.: AKT) or changes in mRNA and/or protein expression of specific FA transporter proteins (e.g.: FAT/CD36) or oxidative enzymes (e.g.: CPT1). Taken together, our data suggest that low RIP140 expression may partially mitigate the negative impact of short-term FA exposure on metabolic regulation and cellular signaling. ❧ In summary, our results provide additional information regarding the role of RIP140 in the regulation of FA metabolism, gene expression and most importantly in metabolic signaling in skeletal muscle cells. More studies will be needed in order to decipher the cellular mechanisms that regulate the RIP140-mediated cellular changes observed in our experiments.

Linked assets

University of Southern California Dissertations and Theses

Conceptually similar

PDF

The pivotal role of AMP-activated protein kinase in the regulation of fatty acid metabolism in skeletal muscle

PDF

Placental growth factor mediated transcriptional and post-transcriptional regulation of hemeoxygenase-1

PDF

The role of the proteasome & its regulators in adaptation to oxidative stress

PDF

A novel role for hypoxia-inducible factor-1alpha (HIF-1alpha) in the regulation of inflammatory chemokines and leukotriene expression in sickle cell disease

PDF

Ethanol induced modulation of microglial P2X7 receptor expression and its role in neuroinflammation

PDF

The regulation, roles, and mechanism of action of mitochondrial-derived-peptides (MDPs) in aging

PDF

Synthetic small molecules and protein secondary structure mimetics as modulators of hypoxia-inducible transcription and integrin receptors function

Asset Metadata

Creator Constantinescu, Silvana (author)

Core Title Genetic manipulation of receptor interacting protein (RIP140) uncovers its critical role in the regulation of metabolism, gene expression and insulin signaling in skeletal muscle cells

School College of Letters, Arts and Sciences

Degree Doctor of Philosophy

Degree Program Integrative and Evolutionary Biology

Publication Date 03/30/2014

Defense Date 01/10/2012

Publisher University of Southern California (original), University of Southern California. Libraries (digital)

Tag L6 cells,metabolism,OAI-PMH Harvest,RIP140,skeletal muscle

Language English

Contributor Electronically uploaded by the author (provenance)

Advisor Turcotte, Lorraine (committee chair), McNitt-Gray, Jill L. (committee member), Wong, Hung Leung (committee member)

Creator Email sconstan@usc.edu,sctinescu@gmail.com

Permanent Link (DOI) https://doi.org/10.25549/usctheses-c3-893

Unique identifier UC11287954

Identifier usctheses-c3-893 (legacy record id)

Legacy Identifier etd-Constantin-558.pdf

Dmrecord 893

Document Type Dissertation

Rights Constantinescu, Silvana

Type texts

Source University of Southern California (contributing entity), University of Southern California Dissertations and Theses (collection)

Access Conditions The author retains rights to his/her dissertation, thesis or other graduate work according to U.S. copyright law. Electronic access is being provided by the USC Libraries in agreement with the a...

Repository Name University of Southern California Digital Library

Repository Location USC Digital Library, University of Southern California, University Park Campus MC 2810, 3434 South Grand Avenue, 2nd Floor, Los Angeles, California 90089-2810, USA