University of Southern California Dissertations and Theses

Placental growth factor mediated transcriptional and post-transcriptional regulation of hemeoxygenase-1

(USC Thesis Other)

Placental growth factor mediated transcriptional and post-transcriptional regulation of hemeoxygenase-1

PDF

Download a page range

Download transcript

Copy asset link

Request this asset

Transcript (if available)

Content
i

PLACENTAL GROWTH FACTOR MEDIATED
TRANSCRIPTIONAL AND POST-
TRANSCRIPTIONAL REGULATION OF
HEMEOXYGENASE-1

BY
PRANALI TASKAR

A Thesis Presented to the
FACULTY OF THE USC GRADUATE SCHOOL
UNIVERSITY OF SOUTHERN CALIFORNIA

In Partial Fulfillment of the
Requirements for the Degree

MASTER OF SCIENCE
(MOLECULAR MICROBIOLOGY AND IMMUNOLOGY)

MAY 2013

Copyright 2013 PRANALI TASKAR

ii

Acknowledgements

I am extremely thankful to Dr. Kalra, my mentor for giving me the
opportunity to work and be a part of his lab and to Dr. Tahara for his
support, teaching and advice.
Furthermore, my sincere thanks to Dr. Machida for serving as a committee
member.
I would like to like to extend my appreciation and sincere thanks to Dr.
Caryn Gonsalves for being a constant source of support and encouragement.
I would also like to thank my lab members Chen Li, Ruchika Jaisinghani for
their support and assistance.

iii

CONTENTS

Table of Figures............................................................................................................. iv
List of Abbreviations .......................................................................................................v
Abstract ....................................................................................................................... viii
Chapter 1: Introduction ....................................................................................................1
A. Sickle cell disease: ................................................................................................1
B. Placental Growth Factor (PlGF) ...............................................................................3
C. Hemeoxygenase-1 (HO-1) .......................................................................................4
D. HIF Family of transcription factors ..........................................................................5
E. Micro RNAs ............................................................................................................8
F. Mechanism of Action of the miRNAs .................................................................... 10
Chapter 2: Materials and methods .................................................................................. 11
Chapter 3: Results......................................................................................................... 16
A.Intracellular signaling pathway mediated by binding of PlGF to VEGFR1. ............. 17
B. HO-1 expression involves the transcription factor, PPARα. ................................... 20
C. PlGF increases binding of HIF-1α to HRE sites within the HO-1 promoter as
determined by chromatin immunoprecipitation (ChIP) analysis. ................................. 23
D. Post-transcriptional regulation of HO-1. ................................................................ 26
E. Effect of microRNAs on HO-1 protein expression. ................................................ 29
Chapter 4: Discussion .................................................................................................... 30
References ..................................................................................................................... 32

iv

Table of Figures

Figure 1: Pathophysiology of vaso-occlusions in sickle cell disease. ................................1
Figure 2 : Role of PlGF in the patho-physiology of sickle cell disease. ...........................3
Figure 3: The HIF Family of transcription factors. ...........................................................6
Figure 4: Regulation of HIF-1α. .......................................................................................7
Figure 5 : Biogenesis of miRNAs. ...................................................................................9
Figure 6: Cellular signaling mechanism for PlGF-mediated HO-1 expression ................ 19
Figure 7: Effect of agonists and antagonists for PPARα and PPARγ in mediating HO-1
mRNA expression under basal condition. ...................................................................... 21
Figure 8: HO-1 Promoter analysis. ................................................................................. 22
Figure 9: ChIP for HIF-1α occupancy on promoter of HO-1 .......................................... 24
Figure 10: Proposed PlGF mediated signaling pathway. ................................................ 25
Figure 11: Post-translational regulation of HO-1 by microRNA 518 .............................. 28
Figure 12: The effect of transfected miRNAs and anti miRNAs on HO-1 protein
expression...................................................................................................................... 29

v

List of Abbreviations
3' UTR 3' untranslated region
5-LO 5- lipoxygenase
AA arachidonic acid
ACS acute chest syndrome
AP-1 activator protein-1
ARNT aryl hydrocarbon receptor nuclear
translocator
ATP adenosine triphosphate
C/EBP CCAAT box-enhancer-binding protein
CBP CREB- binding protein
CCR5 chemokine (C-C motif) receptor 5
CCR8 Chemokine (C-C motif) receptor 8
CD31 + Cluster of differentiation 31
ChIP chromatin immunoprecipitation assay
C-TAD C-terminal transactivation domain
DGCR8 DiGeorges syndrome critical region gene
DPI diphenyleneiodonium chloride
EPAS1 Endothelial PAS domain protein 1
Epo Erythropoietin
EXP5 Exportin 5

vi

ET-1 endothelin-1
GAPDH glyceraldehyde 3-phosphate
dehydrogenase
GLUT1 Glucose transporter 1
HbAS sickle cell trait
HbS sickle hemoglobin
HIF hypoxia inducible factor
HLH helix-loop-helix
HRE hypoxia response element
ICAM-1 inter-cellular adhesion molecule-1
IL-3 interleukin-3
IL-8 interleukin-8
IL-10 Interleukin -10
JNK c-jun N-terminal kinase
LPS Lipopolysaccharide
MAP kinase mitogen-activated protein kinase
miRNA microRNA
mTOR mammalian target of rapamycin
NADPH nicotinamide adenine dinucleotide
phosphate
NF-κB nuclear factor κB
NC Negative control
NO nitric oxide
N-TAD N-terminal transactivation domain
ODD oxygen degradation domain
PAS domain PER-ARNT-SIM domain

vii

PHD prolyl hydroxylase
PHT pulmonary hypertension
PI3K phosphoinositide 3-kinase
PlGF placenta growth factor
PMN polymorphonuclear neutrophils
PPAR Peroxisome proliferator activated
receptor
qRT-PCR quantitative real time
polymerase chain reaction
RBCs red blood cells
RISC RNA-induced silencing complex
RPA RNase Protection assay
SCD sickle cell disease
siRNA small interfering RNA
scRNA Scrambled RNA
SSRBCs sickle red blood cells
TRBP Trans-activation-responsive
RNA-binding protein
TNF-α tissue necrosis factor-α
VCAM-1 vascular cell adhesion molecule-1
VEGF vascular endothelial growth factor
VEGF-R1 Vascular endothelial growth factor receptor 1
VHL von Hippel Lindau protein
WBCs white blood cells

viii

Abstract

Hemeoxygenase-1 (HO-1) is a detoxifying enzyme produced by cells in response to
oxidative stress. It is up-regulated in Sickle Cell Disease patients due to RBC lysis and
release of free heme from hemoglobin (I. T. Lee et al., 2009).In SCD patients, the level of
the Placental Growth factor (PlGF) is elevated (Perelman et al., 2003). However, there
was no direct link between levels of PlGF to expression of cytoprotective enzymes such
as hemeoxygenase-1.
Our studies showed PlGF augmented HO-1 mRNA and protein expression. Also,
our studies showed PlGF induced signaling involved activation of PI-3- kinase, JNK
kinase, p38MAP kinase, NADPH-oxidase and HIF-1α, as demonstrated by use of
pharmacological inhibitors specific for each kinase and others in the signaling pathway.
We studied the role of HIF-1 in the regulation of HO-1 expression, as most
inducers up-regulate the expression of HO-1 by activation of Nrf2. Our studies showed
that shRNA for HIF-1α attenuated the expression of HO-1 mRNA. Furthermore,
transfection of shRNA for HIF-1 attenuated HO-1 promoter luciferase activity.
Additionally, mutation of HRE sites in HO-1 promoter (~4.5Kb) reduced PlGF mediated
luciferase activity. These results showed that PlGF mediated HO-1 expression involved
HIF-1. The role of HIF-1 in HO-1 expression was further supported by chromatin
immunoprecipitation analysis (ChIP), wherein chromatin immunoprecipitated with HIF-
1α antibody showed increased recruitment of HIF-1α to HRE-2 and HRE-3 sites in the
HO-1 promoter, utilizing primers spanning across these HRE sites i.e. -669/-666 and -
862/-859. Next we examined the post-transcriptional regulation of HO-1 mediated by
miRNAs. Our studies showed that levels of miR-518, among other miRNAs, were
significantly reduced in response to PlGF treatment. Transfection of miR-518 reduced the
mRNA level of HO-1. Conversely, anti-miR-518 increased HO-1 mRNA level,

ix

indicating miR518 regulated HO-1 mRNA levels. Next, we determined whether miR-518
bound to the 3’UTR of HO-1 mRNA to exert its effect. We observed that miR-518
reduced 3’UTR-HO-1 luciferase reporter activity in response to PlGF. Our studies
showed that PlGF-mediated HO-1 transcription is mediated by HIF-1α, and post-
transcriptionally regulated by miR-518

1

Chapter 1: INTRODUCTION
A. Sickle cell disease:
Sickle cell disease (SCD) is an inherited hemoglobinopathy, caused by a single base
mutation in the sixth codon for the beta globin chain (Bains et al., 2010). This mutation
results in the formation of mutant sickle hemoglobin (HbS). People homozygous for HbS
develop the phenotype for sickle cell anemia. Heterozygous individuals exhibit sickle
trait. Sickle cell anemia is characterized by hemolytic anemia, vaso-occlusive episodes
and chronic organ damage.

Figure 1: Pathophysiology of vaso-occlusions in sickle cell disease.
The diagram illustrates the causes of vaso-occlusions in sickle cell disease. HbS polymerization
acts as a trigger for the development of vaso-occlusions. Localized tissue hypoxia can cause sickling of
RBCs. Sickle RBCs also exhibit impaired ion transport causing cellular dehydration, contributing to HbS
polymerization. The resulting hemolysis of sickle RBCs results in anemia and indirectly reduces levels of
NO. Hypoxia develops due to adherence of SS RBCs in the small capillaries.
Tissue hypoxia can activate both the endothelium and leukocytes. The activation of the
endothelium may occur as a direct result of tissue hypoxia and possibly due to release of cytokines from the
activated leukocytes. This leads to increased adherence of PMN and sickle RBCs to the endothelium
causing vaso-occlusions. The schematic was adapted from (Madigan C, 2006).

2

The mutant hemoglobin exhibits reversible sickling, and causes distortion of
RBCs. At low oxygen tension, hemoglobin S undergoes polymerization and can cause
sickling of RBCs. Repeated sickling, because of oscillating levels of oxygen, damages
the RBC membrane and causes them to ultimately lyse (Platt OS et al, 1995).
Patients with SCD display increased leukocyte counts and abnormal activation of
granulocytes, monocytes and endothelial cells. Activation of endothelial cells causes
leukocytes to adhere to the endothelium which in turn causes enhanced expression of cell
adhesion molecules, such as selectins, laminins, VCAM-1 and ICAM-1 (Belcher et al.,
2006). Increased thrombin and fibrin generation increases tissue factor procoagulant
activity. There is increased platelet activation even in steady state (Brittain et al., 2010).
Overall, adhesion of SSRBCs and leukocytes to endothelium contributes to vaso-
occlusion, the major cause of mortality in SCD patients.

3

B. Placental Growth Factor (PlGF):

Figure 2 : Role of PlGF in the pathophysiology of sickle cell disease.
PlGF plays an important role in activation of white blood cells (WBCs) and endothelial cells, and thereby
affecting the release of cyto-chemokines. (Adapted from Perelman et al, Blood 2003)

The factors that might cause increased production of PlGF in SCD patients may
be hypoxia, increased erythropoiesis and increased erythropoietin concentrations that
follow anemia, caused by increased red blood cell (RBC) lysis (Green et al., 2001).
Placenta growth factor or PlGF is an angiogenic growth factor that belongs to the
vascular endothelial growth factor (VEGF) family of proteins (Persico, Vincenti, &
DiPalma, 1999). PlGF is primarily expressed by placental trophoblasts and umbilical vein
endothelial cells, as well as erythroid cells(Hauser & Weich, 1993; Tordjman et al.,
2001).PlGF works synergistically with VEGF and is found as PlGF-VEGF heterodimers
at sites of inflammation (Bottomley et al., 2000). VEGF is a member of angiogenic
family (Frantz, 2005). PlGF binds to the fms-like tyrosine kinase (Flt-1) (VEGF receptor-
1) (Perelman et al., 2003) and activates downstream signaling. In vitro, this leads to the
activation of monocytes and promotes the release of interleukin-1β, interleukin 8,

4

monocyte chemoattractant protein-1 and VEGF from monocytes ( Perelman et al, 2003;
Selvaraj et al, 2003)
C. Hemeoxygenase-1 (HO-1):

Hemeoxygenase-1 or HO-1 is a phase II detoxifying enzyme that enables the cell
to counter the harmful effect of oxidant stress. There are three iso-forms of HO-1, which
are encoded by three separate genes (Willis, Moore, Frederick, & Willoughby, 1996).
HO-1 is a 33 kDa protein, that is inducible by stressors such as oxidant stress or
inflammation, whereas HO-2 and HO-3 are constitutively active (Paine, Eiz-Vesper,
Blasczyk, & Immenschuh, 2010; Willis et al., 1996). HO-1 catalyzes the degradation of
heme, producing carbon monoxide, iron and biliverdin (Beckman et al., 2011; Maines,
1997; Ryter, Alam, & Choi, 2006). Both HO-1 and HO-2 have catalytic activity in their
respective C-terminal hydrophobic regions, and are bound to the microsomal membranes
(Maines, 1997).
The ability of HO-1 to metabolize free heme plays an important role in SCD. Due
to the high erythropoetic turnover seen in SCD, the level of free heme in the blood rises.
The iron core of the heme structure acts as a potent cytotoxic agent and may cause
oxidative stress, which is responsible for the induction of cell adhesion molecules and
pro- inflammatory cytokines (I.-T. Lee, 2009; I. T. Lee et al., 2009). HO-1 plays an
important role by either regulating the cellular levels of free heme, by catalyzing its
degradation or by the production of biliverdin, which functions as an anti-oxidant (Bauer
& Bauer, 2002). HO-1 is upregulated in patients with SCD to cope with the increased
levels of heme in the bloodstream (Belcher et al., 2006). The anti-oxidant and anti-
inflammatory effects of HO-1 have been well characterized both in vivo and in
vitro(Rushworth, MacEwan, & O'Connell, 2008).HO-1 expression can be induced by
various factors such as oxidant stress, growth factors and cytokines (Paine et al., 2010).
VEGF has been identified as an effective up-regulator of HO-1 expression (Bussolati et

5

al, Blood, 2003). However, the molecular mechanisms that are involved in the
transcriptional regulation of HO-1 expression, by VEGF or PlGF are not well understood.

D. HIF Family of transcription factors:

Hypoxia inducible factors (HIFs) are oxygen labile, heterodimeric transcription
factors, which consist of α and β components, and belong to the basic helix-loop-helix
PAS family. There are three recognized HIF-α subunits, HIF-1α, HIF-2α and HIF-3α
(Figure 3). HIF-1α has been well studied and identified as a crucial player in cell survival
during hypoxic stress. HIF-2α was initially identified as the endothelial PAS domain
protein (EPAS1), as an HIF-α isoform specific to the endothelium and hence thought to
have a more specialized function than HIF-1α (Tian, McKnight, & Russell, 1997). Later
it was observed that HIF-2α is expressed in many other tissues such as brain, heart, lung,
kidney, liver, pancreas and intestine indicating that it may have a more widespread
function (Wiesener et al., 2002). HIF-3α is similar to HIF1α and HIF-2α in the basic
helix-loop-helix structure, but lacks the C-terminal transactivation domain (Figure 3).
The main role of the HIF-3α is to negatively regulate HIF-1α due to the presence of an
inhibitory PAS domain, which encodes a truncated protein that acts as a dominant
inhibitor of HIF-1α (Koh & Powis, 2012).

6

Figure 3: The HIF Family of transcription factors.
The HIF-1α subunit primarily localizes to the cytoplasm under basal conditions
and its expression is tightly regulated by the oxygen tension in the cell. The HIF-1α
subunit is most active during short periods of intense hypoxia(Koh & Powis, 2012). The
β subunit is constitutively expressed in the nucleus and acts in response to translocation
of the α subunit into the nucleus. HIF-1α and HIF-1 form heterodimers in the nucleus
and mediate their binding to hypoxia response elements (HRE) in the gene promotersto
upregulate gene transcription. In conditions of normoxia, the HIF-α subunit is
hydroxylated at specific conserved prolyl residues situated within the oxygen dependent
degradation domain (ODD) by the action of prolyl hydroxylase (PHD-2) and requires
oxygen, 2-oxoglutarate, ascorbate and iron (Fe
2+
) as cofactor (Figure 4). This post-
translational modification of HIF-1α facilitates the binding of the Von Hippel-Lindau
(VHL) protein to the ODD of the HIF-1α and HIF-2α transcription factors (Figure 4)
(Koh & Powis, 2012). This is followed by ubiquitination by E3 ubiquitin ligase followed
by proteasome dependent degradation of HIF-1α subunits.

7

Under hypoxic conditions, VHL does recognize the HIF-α subunits due to absent
PHD activity, as a result of which they are saved from proteosomal degradation (Figure
4). In some cases, recruitment of the transcriptional co-activator p300/CREB binding
protein (CBP) along with HIF-1α is critical for transactivation of numerous genes,
including vascular endothelial growth factor (VEGF) and erythropoietin (Gobble,
Groesch, Chang, Torry, & Torry, 2009).

The HIF-1α subunits translocate to the nucleus where it forms heterodimers with
the HIF-1β subunits. These heterodimers bind specifically to hypoxia response elements
(HREs) in the promoters of various target genes (Temes et al., 2005). In our study, we
have considered the binding of these heterodimers to the HREs present in the promoter
region of the HO-1 gene.

Figure 4: Regulation of HIF-1α.
In the presence of oxygen, the ubiquitination of HIF-1α subunit in the cytoplasm by VHL protein causes its
proteasomal degradation. In the absence of oxygen, the VHL is unable to hydroxylate the proline residue(s)
on HIF-1α.

8

Activated HIF-1α has been shown to induce genes encoding glycolytic enzymes
such as phosphofructokinase, lactate dehydrogenase 1, monocarboxylate transporter 4,
VEGF and genes involved in apoptosis. Furthermore, HIF-2α has been shown to
activate genes for matrix metalloproteinases (MMPs) and stem cell factor OCT-3/4.
HIF-1α and HIF-2α also have common targets such as VEGF-A and GLUT1(Keith,
Johnson, & Simon, 2012).

E. Micro RNAs:

Micro RNAs or miRNAs are 20 to 30 nucleotide RNA molecules. They can
influence genome functions like chromatin structure, chromosome segregation,
transcription, RNA processing, RNA stability and translation. The effects of these micro
RNAs on RNA function have been generally observed to be inhibitory (Carthew &
Sontheimer, 2009). miRNAs are generated from hairpin structures by the action of two
RNase III type proteins Drosha and Dicer. The mode of action of miRNAs is to target
specific mRNAs in the cell and act as post-transcriptional regulators.
In humans because of the phenomenon of gene duplication, the many miRNAs
are found as isoforms. These isoforms differ from each other in the composition of the
nucleotides located at their 3’end. The 5’end seed sequences (from nucleotide 2 to 7) are
usually conserved. The difference of a few nucleotides can confer different roles to the
isoforms in vivo by slight alterations in their affinity/selectivity. Their transcription is
brought about by RNA Polymerase II (Pol II). miRNA processing is divided into two
phases- nuclear and cytoplasmic(Yi, Doehle, Qin, Macara, & Cullen, 2005; Zeng &
Cullen, 2004).
Within the nucleus, RNA Pol II generates primary miRNAs or pri-miRNA which
have a characteristic stem loop structure and undergo further processing. The pri-miRNA
then goes undergoes further processing in the nucleus, which is cleavage at the stem of

9

the hairpin structure. This cleavage is brought about by nuclear RNAse III type protein
named Drosha resulting in a product of 80-100 nts (Gibbings et al., 2012).

Figure 5 : Biogenesis of miRNAs.
miRNA processing involves the cleavage of the pri-miRNA by Drosha, to generate the pre-miRNA. The
pre-miRNA is exported into the cytoplasm where it undergoes further processing to generate the mature
miRNA (Kim, Han, & Siomi, 2009).

After nuclear processing is completed, the pre-miRNAs are translocated to the cytoplasm
with the help of exportin 5 (EXP5). EXP5 is a member of the nuclear transport receptor
family (Y. R. Doehle et al). In the cytoplasm Dicer cleaves the pre-miRNAs exported
from the nucleus to produce the 21 to 22 nucleotide miRNAs (Figure 5).

10

Following Dicer cleavage, the miRNA duplex is loaded onto an Ago protein to generate
the RISC complex. Proteins that constitute the RISC complex along with the Ago protein
are Dicer and TRBP. To separate the two strands of the miRNA, RNA helicase activity is
required as the Ago proteins alone cannot unwind the two strands of the miRNA duplex
(Han et al., 2009; Yeom, Lee, Han, Suh, & Kim, 2006).

F. Mechanism of Action of the miRNAs:

miRNAs can be considered as an additional post-transcriptional gene regulatory
mechanism. This is brought about when the miRNA base-pairs to the target mRNA in the
3’ untranslated region (3'UTR). The binding can cause exonucleolytic mRNA cleavage if
the base-pairing is weak. If the binding is through highly complementary sequences, the
degradation of mRNA takes place (Boon, 2012).
Objective: PlGF has been shown to mediate the expression of cytokines, endothelin-1
and PAI-1 in both monocytes and endothelial cells. Moreover, it has been shown that
PlGF-/- knockout mice have lower or undetectable levels of PlGF and lower levels of ET-
1, showing a correlation of plasma PlGF levels to ET-1 and pulmonary hypertension. We
examined whether PlGF protected the endothelium by upregulating the expression of
cytoprotective enzymes, such as HO-1. In our present study, we examined the effect of
PlGF on the expression of HO-1 in cultured human endothelial cells. We determined the
role of the transcription factors HIF-1α, in mediating the expression of HO-1, under non-
hypoxic conditions. We also studied the role of miRNAs in the post-transcriptional
regulation of HO-1 expression.

11

Chapter 2: MATERIALS AND METHODS

Endothelial cell culture
The immortalized human dermal microvascular endothelial cell line (HMEC-1),
originally developed by Dr. Edwin Ades and Francisco J. Candall of the CDC and Dr.
Thomas Lawley of Emory University, was obtained from Centers for Disease Control
and Prevention (CDC, Atlanta). These cells were cultured in RPMI-1640 supplemented
with10% FBS, 5 mM HEPES buffer, 1 mM sodium pyruvate, 1 mM glutamine, MEM
vitamins and non-essential amino acids (1X), heparin (20 units/mL), and 50 μg/mL
endothelial cell mitogen (Biomedical Technologies, Stoughton, MA) in flasks coated
with 1% gelatin. Cells were incubated in serum-free media for three hours prior to
stimulation.

Reagents
Primary antibodies for HO-1, HIF-1α and HRP conjugated secondary antibodies
were purchased from Santa Cruz Biotechnology, Inc (Santa Cruz, CA). The β-actin
conjugated HRP antibody was purchased from Sigma-Aldrich (St. Louis, MO). Unless
otherwise specified, all other reagents were purchased from Sigma-Aldrich (St. Louis,
MO). MicroRNA mimics and anti-microRNAs were purchased from GenePharma
(Shanghai, China). The human -4.5kb- HO-1-pGL3 and the -4.5kb-HO-1-pGL3 promoter
wild type plasmids and with the ARE enhancer region deletions (E1 and E2) were
generously provided by Dr. Anupam Agarwal (University of Alabama, Birmingham).
PlGF was purchased from Peprotech (Rocky Hill, NJ)

Isolation of RNA and qRT-PCR
HMEC-1 cells were treated with PlGF for indicated time periods followed by total
RNA extraction using TriZol (Invitrogen, Carlsbad, CA). Real-time quantitative PCR of

12

HO-1 and GAPDH was performed using the iScript SYBR Green One-Step RT-PCR Kit
(Bio-Rad, Hercules,CA), using specific primers as indicated in Table 1. Real time PCR
analyses were performed at the Analytical-Metabolic-Instrumentation Core of the USC
Research Center for Liver Disease (NIH grant P30 DK048522). PCR amplification was
performed using 100 ng of RNA under the following conditions: cDNA synthesis at
50°C for 10 min, iScript reverse transcriptase inactivation at 95°C for 5 min, PCR cycling
and detection at 95°C for 10s, and followed by elongation at 60°C for 45s, utilizing the
ABI 7900 HT sequencing detection system (Life Technologies, Carlsbad, CA). Values
were expressed as relative expression levels of mRNA normalized to housekeeping
GAPDH or β-actin mRNA levels. Relative quantitative (RQ) levels of mRNA expression
were calculated by the comparative Ct or the 2
-ΔΔCt
method, where -ΔΔCt = (Ct (target
mRNA of treated sample) – Ct (reference gene of treated sample)) – (Ct (target mRNA of
control sample) – Ct( reference gene of control sample).

Isolation and quantification of microRNAs (miRNAs)

Total miRNA was isolated from HMEC-1 using the miRVana miRNA isolation
kit (Ambion/Applied Biosystems by Life Technologies, Carlsbad, CA). miRNA levels
were determined and quantified utilizing specific miRNAs primers (Ambion-Applied
Biosystems by Life Technologies, Carlsbad, CA). cDNA was prepared from 50 ng of
isolated miRNA using the TaqMan microRNA assay kit (Life Technologies, Carlsbad,
CA), according to the manufacturer's protocol. Isolated miRNA was reverse transcribed
at 16°C for 30 min, 42°C for 30 min and 85°C for 5 min. qRT-PCR was performed
using the following conditions: 95°C for 15s and 60°C for 60s, utilizing ABI 7900 HT
sequencing detection system (Life Technologies, Carlsbad, CA). miRNA expression was
normalized to reference gene U6 small nuclear RNA (snU6).

13

Transient transfections with luciferase promoter constructs, miRNA mimics and
inhibitors.
HMEC-1 (approximately 2 x 10
6
cells) were re-suspended in 100 µl of
Transfection medium (RPMI 1640 with L-Glutamine), containing 1 µg of HO-1 3’UTR
luciferase construct, 90 pmol/1 million cells of miRNA mimic or inhibitors and 0.5 µg of
beta-galactosidase constructs. Cells were transfected using the Y-001 program (Amaxa
Nucleofector II). The transfected cells were incubated for 24 hours in RPMI-1640 with
10% FBS, followed by over-night incubation in serum free media and treatment with
PlGF for the indicated time periods. The cells were lysed and analyzed for luciferase
activity using a luminometer (Lumat LB 950, Berthold, Badwildbad, Germany).

Chromatin Immunoprecipitation (ChIP) assay

HMECs (10
7
cells) were kept overnight in serum-free RPMI-1640, followed by
treatment with PlGF for the indicated time points. ChIP analysis was performed utilizing
HIF-1α antibody as previously described (75). Briefly, cells were fixed with
formaldehyde, lysed and chromatin was sheared by sonication (6 pulses at 15sec each,
40% potency). The lysate was centrifuged at 12,000 rpm() for 10 min at 4
o
C. The
supernatants were pre-cleared for 2 hr at 4
o
C with Protein A-Sepharose beads (Sigma-
Aldrich, St.Louis, MO). Precleared supernatants were immunoprecipitated with HIF-1α
antibody or control normal rabbit IgG antibody at 4
o
C overnight. The immune
complexes, with protein A beads were collected and washed sequentially with low salt
buffer, high salt buffer and TE buffer. DNA cross-links were reversed at 65°C overnight,
and DNA was extracted by phenol/chloroform/isoamyl alcohol followed by ethanol
precipitation. Immunoprecipitated DNA was air- dried and re- suspended in 100 μl of
nuclease free water. DNA was subjected to PCR amplification for 30 cycles under the
following conditions; 95
o
C for 30s, 60
o
C for 60s and 72
o
C for 120s, using primers listed

14

in Table 1. The PCR products were subjected to agarose gel electrophoresis followed by
densitometric analysis. The values were normalized to input DNA.

Table 1: List of oligonucleotide primers used.

Site Method
Forward Sequence
(5’-3’)
Reverse Sequence
(5’-3’)
HO-1(HRE
at -42/-39)
ChIP TGGCCAGACTTTGTTTCCA AAATCCTGGGGATGCTGTC
HO-1
(HRE at -
669/-666)
ChIP TCTCCTCCCTGGGTTTGGAC TGTCACCTGCTGGAATCCTC
HO-1
(HRE at -
862/-859)
ChIP TGACCCTATTTCCCCCGAGT CTCTGGCAGCACCTGGTATC
HO-1
qRT-
PCR
CGACAGTTGCTGTAGGGCTT ACCGGACAAAGTTCATGGC
GAPDH
qRT-
PCR
GTGCTGAGTATGTCGTGGA ACAGTCTTCTGGGTGGCAGT
HO-1(HRE
at -42/-39)
SDM
GTTCCGCCTGGCCCACATAACC
CGCCGAGC
GCTCGGCGGGTTATGTGGGCCAGG
CGGAAC
SDM: Site Directed Mutagenesis

Site Directed Mutagenesis of HO-1 promoter:

HIF-1α binding site mutants were generated using the Quik-Change site directed
mutagenesis kit (Stratagene, Cedar Creek, TX). The wild type 4.5 Kb HO-1 was used as a
template. Mutations were confirmed by DNA sequencing. The primers used for the
mutagenesis are listed in Table 1.

15

Protein Extraction and Western Blot analysis
Total protein was extracted as previously described (Patel, Gonsalves, Yang,
Malik, & Kalra, 2009). Protein concentrations were determined using the Bradford
method (Bradford, 1976). 25 ug of the protein lysates were subjected to SDS-PAGE gel
electrophoresis, followed by transfer to nitrocellulose membranes. The membranes were
probed with antibodies to HO-1 (1:250), followed by incubation with a HRP-conjugated
goat secondary antibody (1:500). The membranes were stripped and re-probed with a
HRP-conjugated β-actin antibody (1:25,000), to demonstrate equal loading.

Statistical Analysis:
Data are presented as means (±SE) for PlGF treated vs untreated samples.

16

Chapter 3: RESULTS
Placenta growth factor mediated expression of cytoprotective enzyme ,
hemeoxygenase -1 , is transcriptionally regulated by HIF-1α and post-
transcriptionally regulated by miR-518

Hypothesis: Previous studies have shown that placenta growth factor upregulates
expression of cytokines ET-1 and PAI-1 by activation of HIF-1α, independently of
hypoxia. Moreover, studies in vivo showed correlation of plasma levels of PlGF to ET-1,
and pulmonary artery pressure, an indicator of pulmonary hypertension (PHT). However,
less is known whether PlGF-mediated signaling via HIF-1α affects the expression of
cytoprotective enzymes such as HO-1. Since PlGF mediated signaling causes activation
of ROS and HIF-1α in endothelial cells, we hypothesize that this pathway may be
involved in HO-1 expression, as there is continuous need of cytoprotection in response to
excessive ROS generation in the vasculature. To address this we developed the following
aims:

Aim 1: To determine the effect of PlGF on the expression of HO-1 in endothelial cells.

Aim 2: To determine the cellular signaling mechanism for PlGF-mediated HO-1
expression. We will use pharmacological inhibitors for specific kinases and shRNA to
determine the cell signaling pathway.

Aim 3: To determine the role of specific transcription factors in the transcription of HO-1
mRNA. We will examine the role of HIF-1α in the transcription of HO-1, utilizing
promoter analysis and chromatin immunoprecipitation (ChIP) analysis.

Aim 4: To determine a role for miRNAs in the post-transcriptional regulation of HO-1.
Specifically, we will determine whether miR-518 binds to 3’UTR of HO-1 mRNA and
modulates the expression of HO-1 mRNA.

17

A .Intracellular signaling pathway mediated by binding of PlGF to VEGFR1.

Aim 1: To determine the effect of PlGF on the expression of HO-1 in endothelial cells.

The expression of HO-1 is induced by various stressors including VEGF and
ethanol (Belcher et al., 2009). As shown in Figure 6A, PlGF (250 ng/ml) in a time-
dependent manner, increased expression of HO-1 in human dermal microvascular
endothelial cell line (HMEC-1), with maximum expression observed at 2 hours post-
treatment. These data showed PlGF induced the expression of HO-1 in cultured
endothelial cells.

Aim 2. To determine the cellular signaling mechanism for PlGF-mediated HO-1
expression. We will use pharmacological inhibitors for specific kinases and shRNA to
determine the cell signaling pathway.

In in effort to determine the signaling pathways that may be involved in PlGF -
mediated HO-1 expression, we utilized pharmacological inhibitors, which have
previously been shown to affect specific kinases and other mediators, such as HIF-1α.
Pre-treatment of HMEC-1 with inhibitors for PI3Kinase (LY294002) and JNK
(SP600125) significantly inhibited HO-1 expression mediated by PlGF (Figure 6B).
Additionally, DPI, an inhibitor of NAPDH oxidase, also significantly attenuated HO-1
expression (Figure 6B). R59949, an inhibitor of transcription factor, HIF-1α also reduced
HO-1 expression. PlGF is known to exert its effect via binding to the VEGFR-1 or Flt-1
receptor. An antibody to Flt-1 (Anti-Flt-1) also inhibited PlGF mediated HO-1 expression
(Figure 6B). Taken together, these data showed that PlGF mediated signaling for the
upregulation of HO-1 involved VEGFR1, NADPH-oxidase, PI-3kinase, JNKinase and
HIF-1α. Since pharmacological inhibitors can be non-specific, we utilized knockdown of
specific genes e.g. HIF-1α by shRNAs.

18

19

Figure 6: Cellular signaling mechanism for PlGF-mediated HO-1 expression
(A) Time-dependent expression of HO-1 in HMEC-1 in response to PlGF. The data shows maximum
expression of HO-1 was observed at 2 hr. Data is mean ± SEM , n=3.
(B) : Effect of pharmacological inhibitors on PlGF-mediated HO-1 mRNA expression. The data showed
inhibitors of PI-3Kinase (LY), JNkinase (SP), NADPH-oxidase (DPI), HIF-1α (R59949) and VEGFR1
(Ab-VEGFR1) completely abrogated PlGF mediated HO-1 expression
(C): To verify the involvement of HIF-1α subunit, we inhibited HIF-1 mRNA by siRNA. The data
showed siRNA for HIF-1α but not scrambled (sc) RNA completely reduced PlGF-mediated HO-1
expression below the basal level.

Since the inhibitory effect on HO-1 expression was observed using
pharmacological inhibitor R59949, we utilized siRNA to validate the data. Addition of
siRNA specific for HIF-1α to HMEC cells significantly attenuated HO-1 mRNA
expression, when compared to HMEC-1 cells treated with PlGF alone. A control,
scrambled siRNA (scRNA) which is not specific for any human mRNA, did not show
any change in HO-1 mRNA expression (Figure 6C)

20

B. HO-1 expression involves the transcription factor, PPARα.

Recent studies showed that adiponectin mediated HO-1 expression was regulated
by peroxisone proliferator- activated receptor (PPARα) dependent pathway (Cheng,
2012). The PPAR families of proteins are nuclear receptors that serve as transcription
factors. Thus, we investigated the role of PPARα in the induction of HO-1 expression in
response to PlGF treatment. HMEC-1 cells were treated with PPARα agonist fenofibrate
and clofibrate, which function as an agonist for PPARα. Cells were also treated with the
agonist for PPARγ, Troglitazone. Additionally, cells were also simultaneously treated
with antagonist for PPARα, GW 6471 and antagonist for PPARγ, GW9662.
As shown in Figure 7, clofibrate, a PPARα agonist increased HO-1 expression in
the absence of PlGF. Cells treated with clofibrate and GW6471 reduced HO-1 expression
levels, when compared to untreated cells. Fenofibrate, another agonist for PPARα , did
not show an increase in HO-1 mRNA levels. Furthermore, troglitazone, an agonist for
PPARγ did not significantly change HO-1 mRNA expression levels. Taken together these
data showed that PPARα but not PPAR , was involved in transcription of HO-1 under
basal conditions. Further studies are warranted to determine the role of PPARα in HO-1
gene expression.

21

Figure 7: Effects of agonists and antagonists for PPARα and PPARγ in mediating HO-1 mRNA expression
under basal condition.
The data showed clofibrate increases HO-1 expression while antagonist, GW6471 reduces clofibrate
induced HO-1 expression.

Aim 3: To determine the role of specific transcription factors in the transcription of HO-
1 mRNA. We will determine the role of HIF-1α in the transcription of HO-1, utilizing
promoter analysis and chromatin immunoprecipitation (ChIP) analysis.

Previous studies have shown that ethanol augmented HO-1 promoter activity via
the binding of the transcription factor HIF-1α and nuclear erythroid 2- related factor
(Nrf2) (Yeligar, Machida, & Kalra, 2010) to its promoter. Nrf2 binds the cis-acting
antioxidant response element (ARE) sites within the HO-1 promoter (Hill-Kapturczak et
al., 2003; Yeligar et al., 2010).

As shown in the schematic of the HO-1 promoter (Figure 8A), there are five HRE sites
(RCGTG or RGCAC), that bind HIF-1α and a single ARE site within the 5’-flanking, 4.5
kb region upstream of the HO-1 transcription start site (TSS). A second ARE site is
located ca. 9.5 kb upstream of the TSS (Hill-Kapturczak et al., 2003; Yeligar et al.,
2010).

22

Figure 8: HO-1 Promoter analysis.
(A) Schematic of 4.5 ,kb HO-1 promoter.
(B)Transfection of HMEC-1 cells with HO-1 promoter (wt) 4.5Kb, and deletion constructs of ARE1 and
ARE2 (HO-1 promoter 9Kb), and mutation in HRE -1 (-42 to -39bp)(HO-1 promoter 4.5Kb), followed by
treatment with PlGF. Cells were co-transfected with β-galactosidase plasmid to normalize the data for
transfection efficiency.

To determine the role of the HREs and the ARE sites of the HO-1 promoter, in
response to PlGF, HMEC-1 cells were transfected with the wild type -4.5 kb HO-1
promoter reporter construct containing the HRE sites and a -9kb HO-1 promoter reporter
construct containing the ARE sites. Upon addition of PlGF there was an approximate,
two-fold increase in luciferase activity compared to the untreated promoter-less pGL3
vector in cells transfected with the wild type -4.5 kb HO-1 promoter and treated with
PlGF (Figure 8B).
Analysis of the ARE site within the -4.5 kb HO-1 promoter was examine by
assaying activity of the promoter mutant lacking this element, designated as ΔE1. When

23

this muant was assayed in HMEC, we observed attenuation of luciferase activity, when
compared to the wt promoter (Figure 8B). Deletion of the second ARE site (ΔE2) within
the longer -9.5 kb HO-1 promoter construct also showed inhibition of luciferase activity.
Cells transfected with a -9.5 kb construct with deletions of both ARE sites (ΔE1E2), had
negligible HO-1 promoter activity. A mutation within the HRE site at -42/-39 bp
attenuated PlGF mediated HO-1 promoter activity. The sum of these results indicated that
both the ARE sites and the HRE site at nts -42 to -39 from the transcription start site are
necessary for the maximal transcription of the HO-1 gene.

C. PlGF increases binding of HIF-1α to HRE sites within the HO-1 promoter as
determined by chromatin immunoprecipitation (ChIP) analysis.

The binding of HIF-1α to the HRE sites within the HO-1 promoter was supported
by ChIP analysis. Chromatin samples from PlGF treated HMEC-1 cells were immuno-
precipitated with the HIF-1α antibody. PlGF treatment showed an increase in the
expected PCR product size of 200 bp corresponding to the HRE site at nts -669 to -666
(Figure 9A, top panel) and to the HRE site at nts -862 to -859 relative to the start site
(Figure 9B, top panel). Amplification of the input DNA before immunoprecipitation was
equal in both samples (Figure 9A and B, lower panel). IgG samples also showed
amplification of the expected product. Thus additional studies are needed. Taken
together with the luciferase data, we can conclude that the HRE sites at -42/-30 bp, -669/-
666 and -862/-859 bp are required for HO-1 promoter activity and therefore, HO-1
expression.

24

Figure 9: Chromatin immunoprecipitation ( ChiP) for HIF-1α occupancy in the promoter of HO-1
Determined in the chromatin samples immunoprecipitated with HIF-1α antibody and control IgG antibody
for HRE-2site (A) and HRE-3 site (B), utilized primers spanning these regions.

25

Figure 10: Proposed model for PlGF mediated signaling pathway of HO-1 expression.
Based on our data, we propose that PlGF mediated signaling pathway involves
binding of PlGF to the VEGF-R1, followed by activation of JNK and PI3K independently
(Figure 10). PlGF also activates NAPDH oxidase and ROS production as treatment with
DPI( an inhibitor of NADPH-oxidase) inhibited HO-1 mRNA expression. These
pathways may converge leading to the activation of the HIF-1α family of transcription
factors, which bind to the HRE sites within the HO-1 promoter and up regulate HO-1
expression. Based on our data, we conclude that the HRE sites closest to the transcription
start site as well as the ARE sites are required for HO-1 promoter activity.

26

D. Post-transcriptional regulation of HO-1.

Aim 4: To determine the role of miRNAs in the post-transcriptional regulation of HO-1.
Specifically, we will determine whether miR-518 binds to the 3’UTR of HO-1 mRNA and
modulates the expression of HO-1 mRNA.

MicroRNAs play an important role in post-transcriptional gene regulation. The
microRNAs involved in the regulation of HO-1 have not been studied. In an effort to
determine whether HO-1 is subject to this type of regulation,a bio-informatics approach
was utilized, using the Microcosm Software, to identify potential microRNAs that may
regulate HO-1 expression. From this analysis microRNAs 518, 125a-5p, 642 and 671
were selected as candidates on the basis of their binding energy or ΔG for HO-1 mRNA
and the extent of species conservation of 3’UTR sequences.
miRNA levels for miRNA 518 were determined by quantitative RT-PCR in
HMEC cells. As seen in Figure 11A, PlGF treatment reduced the levels of miR518,
significantly, when compared to the untreated control. Levels of miRNA 125a-5p, 642
and 671 were also reduced in response to PlGF treatment.

To further determine the role of miRNAs in the regulation of HO-1 mRNA,
HMEC-1 cells were transfected with miR-518 mimics and inhibitors. Cells were also
transfected with an inhibitor for miRNA-125a-5p. Cells transfected with a mimic for
miR-518 showed significant reduction in HO-1 mRNA levels, in response to PlGF
(Figure 11B). Transfection with an inhibitor of miR-518, increased PlGF- mediated HO-1
levels. Similar results were also obtained with an inhibitor for miR-125a-5p. Taken
together, the data showed a role for miR-58 and miR-125a-5p in the post-transcriptional
regulation of HO-1.

27

As shown in Figure 11C, HMEC-1 co-transfected with the pCMV-luc 10-HO-1
3’ÚTR plasmid and miRNA 518 mimic, showed ~60% reduced luciferase activity.
However, anti-miR-518 augmented by ~40% the luciferase activity corresponding to its
control (NC inhibitor). . An inhibitor for miR-125a-5p did not show any significant
change in luciferase activity. Taken together, these data showed that miR518 binds to
3’UTR of HO-1 mRNA and affects HO-1 mRNA expression.

28

Figure 11: Post-translational regulation of HO-1 by microRNAs
(A) PlGF-mediated expression of selected miRNAs that bind to the 3’UTR of HO-1 mRNA. The data
showed that expression of miR-518 was maximally reduced, while expression of miR-125-1a-5p, miR-642
and miR-671 was reduced to the extent of ~40-50%.

29

(B) Effect of miRNAs (mimic) and anti-miRs (inhibitor of mimic) on PLGF-mediated HO-1 mRNA
expression.
(C) Effect of miR and anti-miR on the binding to 3’UTR of HO-1 luciferase promoter. The data show that
miR-518 attenuated luciferase reporter activity, while anti-miR-518 (inhibitor) antagonized endogenous
miR518, resulting in ~35% increase of luciferase reporter activity compared to cells transfected with
scrambled (NC) inhibitor.

E. Effect of microRNAs on HO-1 protein expression.

Figure 12: The effect of transfected miRNAs and anti miRNAs on HO-1 protein expression.

We examined the effect of miR- 518 mimic and inhibitor, as well as miR-125a-
5p inhibitor on the HO-1 protein levels in the cell. As shown in Figure 12, HO-1 protein
levels increased in response to PlGF. miR-518 mimic modestly reduced HO-1 protein
levels, while anti-miR-518 did not significantly affected HO-1 protein levels compasred
to PlGF treated samples. The inhibitor for miR-125a-5p showed an increase in PlGF
mediated HO-1 protein levels. Taken together, these data suggest a role for miR-518 in
the post-transcriptional regulation of HO-1.

30

Chapter 4: DISCUSSION

Sickle cell disease (SCD) patients in the absence of infection display an increased
inflammatory state as evident by increases in the plasma levels of cytokines and
leukocytosis. Also, both the endothelium and monocytes exhibit an activated state.
Studies from the Kalra and Malik laboratories identified placenta growth factor (PlGF)
as a link between development of inflammation and pulmonary hypertension in vitro and
in vivo. This observation was further validated in human SCD patients, wherein they
observed a strong positive correlation between the plasma levels of PlGF and endothelin-
1, a strong vasoconstrictor. Increased ET-1 expression was associated with increased
arterial pressure and pulmonary hypertension (Sundaram et al., 2010).
The Kalra laboratory showed that PlGF mediated upregulation of ET-1 and PAI-
1, involved activation of HIF-1α, independently of hypoxia (Patel et al., 2010). In the
present study, we showed that PlGF increased the expression of cytoprotective enzyme
hemeoxygenase-1. PlGF-mediated signaling involved VEGFR-1, PI3-kinase, JN Kinase,
NADPH-oxidase, and hypoxia-inducible factor. To study this, we used both
pharmacological inhibitors and shRNA for HIF-1α, and showed that HIF-1α was
involved in PlGF-mediated HO-1 mRNA expression.
The role of HIF-1 in regulating HO-1 mRNA expression was established from
promoter studies of HO-1. Transfection of wild type (4.5Kb) HO-1 promoter luciferase
construct followed by treatment with PlGF showed increased luciferase activity.
Deletion of anti-oxidant response element sites in the HO-1 promoter completely
abrogated HO-1 luciferase activity. These results indicated that ARE sites to which Nrf2
binds are involved in its regulation as has been previously shown for ethanol induced
HO-1 expression (Yeligar et al., 2010). However, mutation of HRE site 1 (-42 to -39) in
the wt promoter of HO-1 resulted in a significant decrease in luciferase activity,
indicating that at least one HRE1 site was involved in PlGF mediated HO-1 expression.

31

The role of HIF-1α in the regulation of HO-1 expression was further delineated by
chromatin immunoprecipitation (ChIP) analysis. Here, we showed that chromatin derived
from PlGF-treated cells and immunopreciptated with HIF-1α antibody, exhibited
increased HIF-1α occupancy on HRE-2 and HRE-3 sites in its promoter.
Thus our studies for the first time, to the best of our knowledge, showed that PlGF
mediated HO-1 expression involved HIF-1α, independent of hypoxia. Next, we
examined whether PlGF-mediated HO-1 expression was post-transcriptionally regulated.
As miRNAs are known to affect the post-transcriptional process, we examined putative
miRNAs that bind to the 3’UTR of HO-1 mRNA. Our studies showed that among five
miRNAs that bind to the 3’UTR of HO-1 mRNA, miR-518 was highly effective as
demonstrated by transfection with miR-518 and anti-miR518. Expression of miR-518
reduced HO-1 mRNA expression, and conversely anti-miR518 augmented HO-1
expression. Moreover, my studies showed that miR-518 binds to the 3’UTR of HO-1 as
demonstrated by luciferase reporter assay. In conclusion, our studies showed that PlGF
mediated HO-1 expression is transcriptionally regulated by HIF-1α and post-
transcriptionally regulated by miR518. Thus PlGF-mediated cytoprotection in the
endothelium is regulated by HIF-1α. Thus HIF-1α may act as a central link to
inflammation and cytoprotection.

32

REFERENCES

Bains, S. K., Foresti, R., Howard, J., Atwal, S., Green, C. J., & Motterlini, R. (2010). Human
Sickle Cell Blood Modulates Endothelial Heme Oxygenase Activity Effects on Vascular
Adhesion and Reactivity. Arteriosclerosis Thrombosis and Vascular Biology, 30(2), 305-
U331. doi: 10.1161/atvbaha.109.196360
Bauer, M., & Bauer, I. (2002). Heme oxygenase-1: Redox regulation and role in the hepatic
response to oxidative stress. Antioxidants & Redox Signaling, 4(5), 749-758. doi:
10.1089/152308602760598891
Beckman, J. D., Chen, C. S., Nguyen, J., Thayanithy, V., Subramanian, S., Steer, C. J., &
Vercellotti, G. M. (2011). Regulation of Heme Oxygenase-1 Protein Expression by miR-
377 in Combination with miR-217. Journal of Biological Chemistry, 286(5), 3194-3202.
doi: 10.1074/jbc.M110.148726
Belcher, J. D., Mahaseth, H., Welch, T. E., Otterbein, L. E., Hebbel, R. P., & Vercellotti, G. M.
(2006). Heme oxygenase-1 is a modulator of inflammation and vaso-occlusion in
transgenic sickle mice. Journal of Clinical Investigation, 116(3), 808-816. doi:
10.1172/jci26857
Belcher, J. D., Vineyard, J. V., Bruzzone, C. M., Chen, C. S., Beckman, J. D., Ngyuen, J., . . .
Vercellotti, G. M. (2009). Heme Oxygenase-1 Gene Therapy in a Murine Model of
Sickle Cell Disease. Blood, 114(22), 613-613.
Boon, R. A. (2012). MicroRNAs Control Vascular Endothelial Growth Factor Signaling.
Circulation Research, 111(11), 1388-1390. doi: 10.1161/circresaha.112.280529
Bottomley, M. J., Webb, N. J. A., Watson, C. J., Holt, L., Bukhari, M., Denton, J., . . . Brenchley,
P. E. C. (2000). Placenta growth factor (PlGF) induces vascular endothelial growth factor
(VEGF) secretion from mononuclear cells and is co-expressed with VEGF in synovial
fluid. Clinical and Experimental Immunology, 119(1), 182-188. doi: 10.1046/j.1365-
2249.2000.01097.x
Bradford, M. M. (1976). RAPID AND SENSITIVE METHOD FOR QUANTITATION OF
MICROGRAM QUANTITIES OF PROTEIN UTILIZING PRINCIPLE OF PROTEIN-
DYE BINDING. Analytical Biochemistry, 72(1-2), 248-254. doi:
10.1006/abio.1976.9999
Brittain, J. E., Hulkower, B., Jones, S. K., Strayhorn, D., De Castro, L., Telen, M. J., . . . Ataga,
K. I. (2010). Placenta growth factor in sickle cell disease: association with hemolysis and
inflammation. Blood, 115(10), 2014-2020. doi: 10.1182/blood-2009-04-217950
Carthew, R. W., & Sontheimer, E. J. (2009). Origins and Mechanisms of miRNAs and siRNAs.
Cell, 136(4), 642-655. doi: 10.1016/j.cell.2009.01.035
Cheng, C.-F. (2012). Protective Effects of Adiponectin against Renal Ischemia-Reperfusion
Injury via Prostaglandin-PPAR-heme oxygenase-1 Signaling Pathway.
Frantz, S. (2005). Innate immunity and angiogenesis (vol 96, pg 15, 2005). Circulation Research,
96(2), E7-E7.
Gibbings, D., Mostowy, S., Jay, F., Schwab, Y., Cossart, P., & Voinnet, O. (2012). Selective
autophagy degrades DICER and AGO2 and regulates miRNA activity. Nature Cell
Biology, 14(12), 1314-+. doi: 10.1038/ncb2611

33

Gobble, R. M., Groesch, K. A., Chang, M., Torry, R. J., & Torry, D. S. (2009). Differential
Regulation of Human PlGF Gene Expression in Trophoblast and Nontrophoblast Cells by
Oxygen Tension. Placenta, 30(10), 869-875. doi: 10.1016/j.placenta.2009.08.003
Green, C. J., Lichtlen, P., Huynh, N. T., Yanovsky, M., Laderoute, K. R., Schaffner, W., &
Murphy, B. J. (2001). Placenta growth factor gene expression is induced by hypoxia in
fibroblasts: A central role for metal transcription factor-1. Cancer Research, 61(6), 2696-
2703.
Han, J., Pedersen, J. S., Kwon, S. C., Belair, C. D., Kim, Y. K., Yeom, K. H., . . . Kim, V. N.
(2009). Posttranscriptional Crossregulation between Drosha and DGCR8. Cell, 136(1),
75-84. doi: 10.1016/j.cell.2008.10.053
Hauser, S., & Weich, H. A. (1993). A HEPARIN-BINDING FORM OF PLACENTA
GROWTH-FACTOR (PLGF-2) IS EXPRESSED IN HUMAN UMBILICAL VEIN
ENDOTHELIAL-CELLS AND IN PLACENTA. Growth Factors, 9(4), 259-268.
Hill-Kapturczak, N., Sikorski, E., Voakes, C., Garcia, J., Nick, H. S., & Agarwal, A. (2003). An
internal enhancer regulates heme- and cadmium-mediated induction of human heme
oxygenase-1. American Journal of Physiology-Renal Physiology, 285(3), F515-F523.
doi: 10.1152/ajprenal.00137.2003
Keith, B., Johnson, R. S., & Simon, M. C. (2012). HIF1 alpha and HIF2 alpha: sibling rivalry in
hypoxic tumour growth and progression. Nature Reviews Cancer, 12(1), 9-22. doi:
10.1038/nrc3183
Kim, V. N., Han, J., & Siomi, M. C. (2009). Biogenesis of small RNAs in animals. Nature
Reviews Molecular Cell Biology, 10(2), 126-139. doi: 10.1038/nrm2632
Koh, M. Y., & Powis, G. (2012). Passing the baton: the HIF switch. Trends in Biochemical
Sciences, 37(9), 364-372. doi: 10.1016/j.tibs.2012.06.004
Lee, I.-T. (2009).
Lee, I. T., Luo, S. F., Lee, C. W., Wang, S. W., Lin, C. C., Chang, C. C., . . . Yang, C. M. (2009).
Overexpression of HO-1 Protects against TNF-alpha-Mediated Airway Inflammation by
Down-Regulation of TNFR1-Dependent Oxidative Stress. American Journal of
Pathology, 175(2), 519-532. doi: 10.2353/ajpath.2009.090016
Maines, M. D. (1997). The heme oxygenase system: A regulator of second messenger gases.
Annual Review of Pharmacology and Toxicology, 37, 517-554. doi:
10.1146/annurev.pharmtox.37.1.517
Paine, A., Eiz-Vesper, B., Blasczyk, R., & Immenschuh, S. (2010). Signaling to heme oxygenase-
1 and its anti-inflammatory therapeutic potential. Biochemical Pharmacology, 80(12),
1895-1903. doi: 10.1016/j.bcp.2010.07.014
Patel, N., Gonsalves, C. S., Yang, M. Y., Malik, P., & Kalra, V. K. (2009). Placenta growth factor
induces 5-lipoxygenase-activating protein to increase leukotriene formation in sickle cell
disease. Blood, 113(5), 1129-1138. doi: 10.1182/blood-2008-07-169821
Patel, N., Sundaram, N., Yang, M. Y., Madigan, C., Kalra, V. K., & Malik, P. (2010). Placenta
Growth Factor (PlGF), a Novel Inducer of Plasminogen Activator Inhibitor-1 (PAI-1) in
Sickle Cell Disease (SCD). Journal of Biological Chemistry, 285(22), 16713-16722. doi:
10.1074/jbc.M110.101691
Perelman, N., Selvaraj, S. K., Batra, S., Luck, L. R., Erdreich-Epstein, A., Coates, T. D., . . .
Malik, P. (2003). Placenta growth factor activates monocytes and correlates with sickle
cell disease severity. Blood, 102(4), 1506-1514. doi: 10.1182/blood-2002-11-3422
Persico, M. G., Vincenti, V., & DiPalma, T. (1999). Structure, expression and receptor-binding
properties of placenta growth factor (PlGF). Vascular Growth Factors and Angiogenesis,
237, 31-40.

34

Rushworth, S. A., MacEwan, D. J., & O'Connell, M. A. (2008). Lipopolysaccharide-Induced
Expression of NAD(P)H:Quinone Oxidoreductase 1 and Heme Oxygenase-1 Protects
against Excessive Inflammatory Responses in Human Monocytes. Journal of
Immunology, 181(10), 6730-6737.
Ryter, S. W., Alam, J., & Choi, A. M. K. (2006). Heme oxygenase-1/carbon monoxide: From
basic science to therapeutic applications. Physiological Reviews, 86(2), 583-650. doi:
10.1152/physrev.00011.2005
Sundaram, N., Tailor, A., Mendelsohn, L., Wansapura, J., Wang, X. D., Higashimoto, T., . . .
Malik, P. (2010). High levels of placenta growth factor in sickle cell disease promote
pulmonary hypertension. Blood, 116(1), 109-112. doi: 10.1182/blood-2009-09-244830
Temes, E., Martin-Puig, S., Acosta-Iborra, B., Castellanos, M. C., Feijoo-Cuaresma, M., Olmos,
G., . . . Landazuri, M. O. (2005). Activation of HIF-prolyl hydroxylases by R59949, an
inhibitor of the diacylglycerol kinase. Journal of Biological Chemistry, 280(25), 24238-
24244. doi: 10.1074/jbc.M414694200
Tian, H., McKnight, S. L., & Russell, D. W. (1997). Endothelial PAS domain protein 1 (EPAS1),
a transcription factor selectively expressed in endothelial cells. Genes & Development,
11(1), 72-82. doi: 10.1101/gad.11.1.72
Tordjman, R., Delaire, S., Plouet, J., Ting, S., Gaulard, P., Fichelson, S., . . . Lemarchandel, V.
(2001). Erythroblasts are a source of angiogenic factors. Blood, 97(7), 1968-1974. doi:
10.1182/blood.V97.7.1968
Wiesener, M. S., Jurgensen, J. S., Rosenberger, C., Scholze, C., Horstrup, J. H., Warnecke, C., . .
. Eckardt, K. U. (2002). Widespread, hypoxia-inducible expression of HIF-2 alpha in
distinct cell populations of different organs. Faseb Journal, 16(14), 271-+. doi:
10.1096/fj.02-0445fje
Willis, D., Moore, A. R., Frederick, R., & Willoughby, D. A. (1996). Heme oxygenase: A novel
target for the modulation of the inflammatory response. Nature Medicine, 2(1), 87-90.
doi: 10.1038/nm0196-87
Yeligar, S. M., Machida, K., & Kalra, V. K. (2010). Ethanol-induced HO-1 and NQO1 Are
Differentially Regulated by HIF-1 alpha and Nrf2 to Attenuate Inflammatory Cytokine
Expression. Journal of Biological Chemistry, 285(46), 35359-35373. doi:
10.1074/jbc.M110.138636
Yeom, K. H., Lee, Y., Han, J. J., Suh, M. R., & Kim, V. N. (2006). Characterization of
DGCR8/Pasha, the essential cofactor for Drosha in primary miRNA processing. Nucleic
Acids Research, 34(16), 4622-4629. doi: 10.1093/nar/gkl458
Yi, R., Doehle, B. P., Qin, Y., Macara, I. G., & Cullen, B. R. (2005). Overexpression of Exportin
5 enhances RNA interference mediated by short hairpin RNAs and microRNAs. Rna-a
Publication of the Rna Society, 11(2), 220-226. doi: 10.1261/rna.7233305
Zeng, Y., & Cullen, B. R. (2004). Structural requirements for pre-microRNA binding and nuclear
export by Exportin 5. Nucleic Acids Research, 32(16), 4776-4785. doi:
10.1093/nar/gkh824

Abstract (if available)

Abstract Hemeoxygenase-1 (HO-1) is a detoxifying enzyme produced by cells in response to oxidative stress. It is up-regulated in Sickle Cell Disease patients due to RBC lysis and release of free heme from hemoglobin (I. T. Lee et al., 2009). In SCD patients, the level of the Placental Growth factor (PlGF) is elevated (Perelman et al., 2003). However, there was no direct link between levels of PlGF to expression of cytoprotective enzymes such as hemeoxygenase-1. ❧ Our studies showed PlGF augmented HO-1 mRNA and protein expression. Also, our studies showed PlGF induced signaling involved activation of PI-3- kinase, JNK kinase, p38MAP kinase, NADPH-oxidase and HIF-1α, as demonstrated by use of pharmacological inhibitors specific for each kinase and others in the signaling pathway. ❧ We studied the role of HIF-1α in the regulation of HO-1 expression, as most inducers up-regulate the expression of HO-1 by activation of Nrf2. Our studies showed that shRNA for HIF-1α attenuated the expression of HO-1 mRNA. Furthermore, transfection of shRNA for HIF-1α attenuated HO-1 promoter luciferase activity. ❧ Additionally, mutation of HRE sites in HO-1 promoter (~4.5Kb) reduced PlGF mediated luciferase activity. These results showed that PlGF mediated HO-1 expression involved HIF-1α. The role of HIF-1α in HO-1 expression was further supported by chromatin immunoprecipitation analysis (ChIP), wherein chromatin immunoprecipitated with HIF-1α antibody showed increased recruitment of HIF-1α to HRE-2 and HRE-3 sites in the HO-1 promoter, utilizing primers spanning across these HRE sites i.e. -669/-666 and -862/-859. Next we examined the post-transcriptional regulation of HO-1 mediated by miRNAs. Our studies showed that levels of miR-518, among other miRNAs, were significantly reduced in response to PlGF treatment. Transfection of miR-518 reduced the mRNA level of HO-1. Conversely, anti-miR-518 increased HO-1 mRNA level, indicating miR518 regulated HO-1 mRNA levels. Next, we determined whether miR-518 bound to the 3’UTR of HO-1 mRNA to exert its effect. We observed that miR-518 reduced 3’UTR-HO-1 luciferase reporter activity in response to PlGF. Our studies showed that PlGF-mediated HO-1 transcription is mediated by HIF-1α, and post-transcriptionally regulated by miR-518.

Linked assets

University of Southern California Dissertations and Theses

Conceptually similar

PDF

Transcriptional regulation of IFN-γ and PlGF in response to Epo and VEGF in erythroid cells

PDF

The role of miRNA and its regulation in pulmonary hypertension in sickle cell disease

PDF

Placenta growth factor-miRNAs-lncRNAs axis in the regulation of ET-1 gene involved in pulmonary hypertension in sickle cell disease

PDF

A novel role for hypoxia-inducible factor-1alpha (HIF-1alpha) in the regulation of inflammatory chemokines and leukotriene expression in sickle cell disease

PDF

Alcohol mediated expression of cyto-protective enzyme - NQO-1 and its post translational regulation

PDF

MicroRNAs involved in the regulation of Endothelin-1 gene expression in endothelial cells

PDF

Differential effect of ethanol and r-sulforaphane on regulation of heme oxygenase-1 in endothelial cells

PDF

Mechanism of repression of RNA polymerase III-dependent transcription under hypoxia

PDF

Discovery of mature microRNA sequences within the protein- coding regions of global HIV-1 genomes: Predictions of novel mechanisms for viral infection and pathogenicity

PDF

RNA polymerase III-dependent transcription is repressed under prolonged hypoxic conditions

PDF

Lnc-RNA and WNT signal synergistically promotes self-renewal of tumor initiating stem-like cells via epigenetic regulation

PDF

Effects of Rab3D deficiency on Paneth cell morphology and function

PDF

TLR8-transferred miR-192 acts as a tumor suppressor in neuroblastoma by inhibiting CTCF

PDF

Hepatic c-Jun overexpression metabolically reprograms cancer cells through mTORC2/AKT pathway

PDF

c-JUN mediated alteration of SLC2A2 expression in hepatoma cell line HepG2

PDF

Single cell gene expression analysis of KSHV infection in three-dimensional oral epithelial tissue cultures

PDF

Hepatitis B virus X protein regulation of β-catenin and NANOG and co-regulatory role with YAP1 in HCC malignancy

PDF

SARS-CoV-2 suppression of CD1d expression and NKT cell function

PDF

Ethanol induced modulation of microglial P2X7 receptor expression and its role in neuroinflammation

PDF

Musashi-2 promotes c-MYC expression through IRES-dependent translation and self-renewal ability in hepatocellular carcinoma

Asset Metadata

Creator Taskar, Pranali (author)

Core Title Placental growth factor mediated transcriptional and post-transcriptional regulation of hemeoxygenase-1

School Keck School of Medicine

Degree Master of Science

Degree Program Molecular Microbiology and Immunology

Publication Date 05/02/2013

Defense Date 03/13/2013

Publisher University of Southern California (original), University of Southern California. Libraries (digital)

Tag hemeoxygenase-1,HIF-1,hypoxia,miRNA,OAI-PMH Harvest,PlGF,sickle cell disease

Language English

Contributor Electronically uploaded by the author (provenance)

Advisor Kalra, Vijay K. (committee chair), Tahara, Stanley M. (committee chair), Machida, Keigo (committee member)

Creator Email taskar.pranali@gmail.com

Permanent Link (DOI) https://doi.org/10.25549/usctheses-c3-249995

Unique identifier UC11287982

Identifier etd-TaskarPran-1643.pdf (filename),usctheses-c3-249995 (legacy record id)

Legacy Identifier etd-TaskarPran-1643.pdf

Dmrecord 249995

Document Type Thesis

Rights Taskar, Pranali

Type texts

Source University of Southern California (contributing entity), University of Southern California Dissertations and Theses (collection)

Access Conditions The author retains rights to his/her dissertation, thesis or other graduate work according to U.S. copyright law. Electronic access is being provided by the USC Libraries in agreement with the a...

Repository Name University of Southern California Digital Library

Repository Location USC Digital Library, University of Southern California, University Park Campus MC 2810, 3434 South Grand Avenue, 2nd Floor, Los Angeles, California 90089-2810, USA