University of Southern California Dissertations and Theses

Determinination of the causal potential of histone modifications on transcription and chromatin structure

(USC Thesis Other)

Determinination of the causal potential of histone modifications on transcription and chromatin structure

PDF

Download a page range

Download transcript

Copy asset link

Request this asset

Transcript (if available)

Content DETERMINATION OF THE CAUSAL POTENTIAL OF HISTONE MODIFICATIONS
ON TRANSCRIPTION AND CHROMATIN STRUCTURE

by
Yuchen Si

A Thesis Presented to the
FACULTY OF THE USC GRADUATE SCHOOL
UNIVERSITY OF SOUTHERN CALIFORNIA
In Partial Fulfillment of the
Requirements for the Degree
MASTER OF SCIENCE
(BIOCHEMISTRY AND MOLECULAR BIOLOGY)

August 2012

Copyright 2012 Yuchen Si

ii
ACKNOWLEDGEMENTS
I would like to express my deepest gratitude to my advisor Dr. Peter W. Laird, for his
invaluable support, assistance, and guidance. I would also like to extend my sincerest
appreciation to Dr. KwangHo Lee, who offered me tremendous support, and advice
throughout my project and thesis with great patience and competence. I attribute my
accomplishments during the Masters degree program to his encouragements and efforts
to guide me, without which this thesis would not have been completed. My deepest
gratitude goes also to the members of my committee Dr. Ite Laird-Offringa and Dr.
Zoltan Tokes, without whose advice and assistance this study would not have been
successful. Special thanks also to all my friends and colleagues, especially Dr. Shirley
Oghamian, Jina Park, Dr. Mihaela Campan and members of Dr. Laird-Offringa’s lab, for
their invaluable assistance. Finally, I wish to express my love and gratitude to my family
for their unconditional support through the duration of my studies.

iii

TABLE OF CONTENTS
ACKNOWLEDGEMENTS ii
LIST OF FIGURES iv
LIST OF TABLES v
ABBREVIATIONS vi
ABSTRACT vii
CHAPTER 1: INTRODUCTION 1
1.1 Histone methylation 1
1.2 Histone acetylation 4
1.3 Histone phosphorylation 5
1.4 Histone ubiquitination 6
1.5 The causal function of histone modifications 7
CHAPTER 2: MATERIALS AND METHODS 9
2.1 Plasmid constructions 9
2.2 Cell culture and transfection 11
2.3 Generation of GFP expression stable NIH/3T3 cell lines 12
CHAPTER 3: RESULTS 14
3.1 Generation of an in vitro reporter system for determining the causal effects
of histone modifications 14
3.2 Effects of the targeted recruitment of histone modifying enzymes to the
EF1α promoter 16
3.3 Effects of the targeted recruitment of histone modifying enzymes to the
Ubc promoter 18
3.4 The catalytic SET domain of G9a is required for the G9a-initiated
transcriptional repression 25
3.5 Development of a transient assay system to determine shRNA efficiency 27
3.6 Determining the causal potential of histone modifications in stable cell
lines 30
CHAPTER 4 : CONCLUSION AND DISCUSSION 35
REFERENCES 39

iv
LIST OF FIGURES
Figure 1 Development of an in vitro reporter system for determining the 15
causal potential of histone modifications.

Figure 2 Effects of the targeted recruitment of histone modifying enzymes to the 19
EF1α promoter.

Figure 3 Effects of the targeted recruitment of histone modifying enzymes to the 20
Ubc promoter.

Figure 4 Testing increased amounts of histone methylatrasferases on the EF1α 21
promoter.

Figure 5 Effects of the targeted recruitment of histone modifying enzymes to an 23
EF1α promoter with reduced strength.

Figure 6 Testing the hyperactive Suv39h1 on the EF1α promoter. 24

Figure 7 Effects of the targeted recruitment of G9a deletion mutants to the 26
EF1α promoter.

Figure 8 Swapping the SET domains between histone methyltransferases. 28

Figure 9 Testing a catalytic mutant (H1166K) of G9a. 29

Figure 10 Development of a transient assay system to determine shRNA efficiency. 32

Figure 11 Development of stable cell lines and conditional recruitments of G9a. 34

v
LIST OF TABLES
Table 1 Primers for PCR. 10

Table 1 shRNA oligos. 13

Table 1 Repressive histone modifying enzymes and their funcion. 17

Table 2 Histone readers of H3K9me3/2 histone modifiations. 31

vi
ABBREVIATIONS
PMT post-translational modifications

HKMT histone lysine methyltransferase

HKDM histone lysine demethylases

DNMT DNA methyltransferase

HAT histone acetyltransferases

HDAC histone deacetylases

DBD DNA-binding domain

DBS DNA-binding sequence

vii
ABSTRACT
Histone modification is a major epigenetic regulatory mechanism that controls chromatin
structure and gene expression potential. However, the causal potential of individual
histone modifications remains largely unknown. Here, we report that G9a is able to
initiate transcriptional repression when targeted to a robust mammalian promoter, the
human EF1α promoter, in a transient reporter assay, while other histone
methyltransferases, Suv39h1, Suv39h2, and PR-set7 fail to do so. We observed the same
G9a-specific transcriptional repression from the human ubiquitin C promoter, suggesting
that the G9a-initiated transcriptional repression might not be a promoter-dependent
phenomenon. We found that the G9a catalytic SET domain is both necessary and
sufficient to initiate repression. In addition, we found that the G9a SET domain is able to
confer a repressive capability to a non-repressive histone methyltransferase, Suv39h1,
when replacing the SET domain of Suv39h1. Further, a null mutation (H1166K) in the
G9a SET domain completely abolished the repressive function, suggesting H3K9 di-
methylation is mediating the repression. Our results provide evidence for a causal
repressive function for H3K9 di-methylation and for the existence of potential functional
differences among the histone methylations that have been uniformly considered as
repressive mark.

1

CHAPTER 1: INTRODUCTION
The studies of Vincent Allfrey in the early 1960s introduced the knowledge that histones
are post-translationally modified (Allfrey et al. 1964). With the recent discovery of
tyrosine hydroxylation and lysine crotonylation, there exist at least 15 types histone post-
translational modifications (PMTs) at over 80 different amino acid residues on histones.
Histone PMTs include methylation, acetylation, propionylation, butyrylation,
formylation, phosphorylation, ubiquitination, sumoylation, citrullination, proline
isomerization, ADP ribosylation, malonylation, and succinylation (Tan M et al. 2011).
Histone modifications occur extensively on the N-terminal tails of histone and have
diverse functions and modes of action in regulating chromatin structure and gene
expression potential.
1.1 Histone methylation
Histone methylation occurs at lysine and arginine residues of histones (at more than 40
sites). Unlike acetylation and phosphorylation it does not alter the charge of the histone
protein. There are different levels of complexity of this form of histone modification:
lysines could be mono-, di- or tri-methylated, whereas arginines may be mono-,
symmetrically or asymmetrically di- methylated (Nf SS et al. 2009; Bedford MT et al.
2009). Many lysine methylations such as H3K9, H3K27, and H4K20, are found to be
associated with gene silencing, whereas H3K4 and H3K36 methylations are found at
active genes (Martin C et al. 2005). Arginine methylations generally associate with gene
activation (Bedford MT et al. 2009).

2
Methylation status of histone lysines is dynamically regulated by activities of histone
lysine methyltransferase (HKMTs) and histone lysine demethylases (HKDMs). Since the
discovery of the first histone lysine methyltransferase (HKMT), Suv39h1, more than 30
HKMTs have been identified. The vast majority of HKMTs has the SET domain, which
harbors the enzymatic activity, with an exception of DOT1L. The HKMTs tend to be
relatively specific enzymes. For instance, Suv39h1 specifically methylates H3K9, while
Pr-set7 targets H4K20. HKMT enzymes also modify the appropriate lysine to a specific
degree. For example, G9a is responsible for H3K9 mono- and di-methylation, whereas
Suv39h1 methylates H3K9 tri-methylation.
In our study, we tested four different histone lysine methyltransferases; G9a, Suv39h1,
Suv39h2 and Pr-set7. G9a was reported as the second HKMT and can methylate histone
H1 and H3 in vitro (Collins R et al. 2005; Tachibana M et al. 2005). G9a, also known as
EHMT2, is mainly responsible for mono- and di- methylation of H3K9 in euchromatin.
G9a plays an essential role in regulating early embryonic development and is involved in
the transcriptional silencing of developmentally regulated genes (Tachibana M et al.
2002). Previous studies have found that G9a functions as a corepressor, targeted to
specific genes by associating with transcriptional repressors and corepressors such as
CDP/cut, Blimp-1/PRDI-BF1, and REST/NRSF (Nishio H et al. 2004; Gy ry I et al.
2004; Roopra A et al. 2004). It has also been reported that direct cooperation between
G9a and DNMT1 underlies a mechanism of coordinated DNA and H3K9 methylation
during cell division (Estève P et al. 2006).
The most-studied H3K9 HKMT is Suv39h1, which is the human homolog of the
Drosophila Su(var)3-9 histone methyltransferase. Suv39h1 specifically mediates tri-

3
methylation and contributes to heterochromatin establishment. At the enzymatic level,
Suv39h1 prefers mono- and di- methylated H3K9 as a primary substrate, which indicates
cooperation with a mono- or di-methyltransferase. Suv39h1 has been found to interact
with the de novo DNA methyltransferase DNMT3B and is involved in de novo gene
silencing (Fuks F et al. 2003). A mouse study indicated that in heterochrmatin regions
Suv39h1 and its testis-specific homolog, Suv39h2, are required for most H3K9
methylation. Additionally, another study showed that Suv39h1/h2 double-null mice have
decreased viability during embryonic development and reduced growth, as adult animals.
These mice are infertile because of abnormal chromosome segregation during
spermatogenesis (Peters AH et al. 2001; Nielsen SJ et al. 2001). Suv39h1 has also been
shown to form a complex with SirT1, which is a nicotinamide adenine dinucleotide
(NAD)-dependent histone deacetylase. Further, the activity of Suv39h1 is stimulated by
SirT1 binding (Vaquero A et al. 2007; Zhenyu Li et al. 2009). It has been reported that
SirT1 has an important role in transcriptional regulation and in a variety of physiological
processes, such as stress responses, metabolism, apoptosis, and calorie restriction and
aging (Brooks CL et al. 2009). Other studies have shown that DBC1 (deleted in breast
cancer 1) may be an important regulator of heterochromatin formation and genomic
stability by disrupting the Suv39h1-SirT1 complex and inactivating both enzymes
(Zhenyu Li et al. 2009).
The last histone methyltransferase we initially chose to study is Pr-set7, which was
identified as a H4K20 mono-methyltransferase (Xiao B et al. 2005). Pr-set7 has a strong
enzymatic activity toward nucleosomal substrates, but not histone octamers or histone H4
alone. The combination of nuclear magnetic resonance, mass spectroscopy, and in vitro

4
experiments indicated that Pr-set7 is strictly responsible for H4K20 mono-methylation
(Xiao B et al. 2005; Couture J et al. 2005). Crystallographic studies demonstrated that the
substrate recognition channel of Pr-set7 is too narrow to accommodate a tri-methylated
species, which provided further support for its specificity as H4K20 mono-
methyltransferase (Beck DB et al. 2012). Pr-set7 catalytic activity is essential for
Drosophila survival at the third instar larval stage (Karachentsev D et al. 2005). Pr-set7
has also been shown to play an important role in mouse embryonic development (Oda H
et al. 2009). Additionally, studies have reported that the lack of Pr-set7 catalytic activity
leads to a growth arrest due to increased DNA damage and defects in cell cycle
progression in embryonic stem cells (Oda H et al. 2009).
1.2 Histone acetylation
Another major histone modification is acetylation, which is catalyzed by histone
acetyltransferases (HATs). The HATs utilize acetyl-coenzyme A (CoA) as a cofactor and
catalyze the transfer of an acetyl group to the lysine chains. Histone acetylation could
neutralize the positive charge of lysine and has the potential to weaken the interactions
between histones and DNA (Bannister AJ et al. 2011). Histone acetylation is a reversible
reaction with rapid kinetics by histone deacetylases (HDACs). HDACs oppose the effects
of HATs and reverse lysine acetylation. This reaction could restore the positive charge of
the lysine and potentially stabilizes the local chromatin architecture. There are two major
classes of HATs, namely, type-A and type-B. The type-A HATs are a more diverse
family of enzymes than the type-Bs. They can be classified into at least three separate
groups, depending on amino acid sequence homology and conformational structure. Their
ability to neutralize positive charges correlates well with their function as a

5
transcriptional coactivator. Besides the N-terminal tails, there are additional sites of
acetylation present within the globular histone core, such as H3K56 (Tjeertes JV et al.
2009). Similar to histone methyltransferase, type-A HATs are often found to be
associated with large multiprotein complexes (Yang XJ et al. 2007). The type-B HATs
are predominantly cytoplasmic and acetylating free histones but not those already
deposited into chromatin. Type-B HATs are highly conserved and all type-B HATs share
sequence homology with scHat1, the founding member of this type of HAT. It has been
shown that type-B HATs acetylate newly synthesized histone H4K5 and H4K12 (Parthun
MR. 2007). The acetylations driven by type-B HATs are essential for deposition of the
histones after the marks are removed (Parthun MR. 2007).
1.3 Histone phosphorylation
Histone phosphorylation tends to be very site-specific and there are far more sites,
compared with acetylated sites. It is highly dynamic and predominantly takes place on
serines, threonies and tyrosines, in the N-terminal histone tails. The levels of
phosphorylation of histone are controlled by kinases and phosphatases that add and
remove the modification, respectively. The phosphate group is transferred from ATP to
the hydroxyl group of the target amino acid chain by the histone kinases. Histone
phosphorylation adds significant negative charge to the histone, which reduces the net
positive charge of histone, causing changes in chromatin structure. It is largely unclear
how kinases are accurately recruited to their site of action on chromatin. Only a few cases
have been determined. For instance, the mammalian MAPK1, the kinase possesses an
intrinsic DNA-binding domain. MAPK1 could get tethered to the DNA by this DNA-
binding domain and this might be sufficient for specific recruitment (Hu S et al. 2009).

6
Even though the majority of histone phosphorylation sites lie within the N-terminal tails,
histone phosphorylation sites within the core regions do exist, such as the
phosphorylation of H3Y41, deposited by the non-receptor tyrosine kinase JAK2 (Dawson
MA et al. 2009).
1.4 Histone ubiquitination
Histone methylation, histone acetylation and histone phosphorylation result in relatively
small molecular changes to amino acid side chains. Different from these histone
modifications, ubiquitination contributes to a much larger covalent modification. Protein
ubiquitination is a chemical reaction with three sequential steps. In this action, a 76
amino acid polypeptide is attached to histone lysines, through the sequential action of
three enzymes: ubiquitin E1, E2, and E3, which are responsible for activating,
conjugating and ligating, respectively. After the first ubiquitination substate, H2A, which
was reported by Goldknopf and Busch in 1977 (Goldknopf IL et al. 1977), histone H2B
has been identified as being ubiquitinated as well (West MH et al. 1980). Like other
protein ubiquitinations, histone ubiquitination is catalyzed by the formation of an
isopeptide bond between the carboxy-terminal glycine of ubiquitin and lysine residues on
H2A and H2B. There are two well-characterized ubiquitination sites that lie within H2A
and H2B: H2AK119ub1 and H2BK123ub1. It has been discovered that these two
ubiquitinations are both involved in gene regulation. H2AK119ub1 is involved in gene
silencing (Wang H et al. 2004), whereas H2BK123ub1 plays an important role in
transcriptional initiation and elongation (Lee JS et al. 2007; Kim J, et al. 2009). The
substrate specificity is determined by the enzyme complexes. The enzyme complexes
also determine the degree of ubiquitination, such as mono- or poly- ubiquitination. Even

7
though ubiquitination is larger than other histone modification, it is still a highly dynamic
one, like histone acetylation and phosphorylation. This modification is removed by the
action of isopeptidases called de-ubiquitin enzymes and this activity is important for both
gene activity and silencing (Bannister AJ et al. 2011).
1.5 The causal function of histone modifications
The total number of histone modifications presently exceeds 160 and continues to grow.
Many of these modifications have been labeled as either a euchromatic or
heterochromatic modification based upon in situ fluorescence microscopy, and the
chromatin structure and gene expression status that they have been associated with.
However, most studies have been limited to documentation of an association between a
particular histone modification and the chromatin structure, and have failed to
demonstrate the necessity or sufficiency of the modification for the observed chromatin
state. The effect of histone modifications on chromatin structure and gene expression has
been appreciated only as a collective effect, without clear insight into the relative
contribution and role of each modification. In order to understand the relative
contribution and distinct role of each histone modification in establishing and regulating
chromatin structure, one needs to determine the causal effect of individual histone
modifications. However, testing the causal effect of a specific modification has proved
technically challenging. Knockdown and overexpression approaches are poorly suited for
such types of study because these approaches will induce a global decrease or increase of
a particular histone modification, which would in turn trigger a cascade of secondary
effects.

8
In this study, we investigated the causal potential of individual histone modifications by
selectively introducing a specific histone modification to a predetermined locus, using a
reporter cassette system. This reporter cassette is designed to recruit any histone
modification of choice and to produce a quantitative optical readout of the effect of the
introduced histone modification on transcription. This localized introduction, achieved by
the sequence-specific recruitment of a histone-modifying enzyme, reduces the possible
influence of secondary effects on the outcome. The quantitative optical readout produced
by a fluorescence-luminescence fusion reporter permits both visual monitoring and
quantification of the induced transcriptional changes, without employing invasive or
labor-intensive analysis tools such as, Taqman based real-time RT PCR or Western blot
assay.
From our study, we found that G9a is capable of initiating transcriptional repression
when targeted to strong mammalian promoters (EF1α and Ubc), in a transient assay
system, while Suv39h1, Suv39h2, Pr-set7 are not. The catalytic domain of G9a (SET)
was found to be sufficient for the G9a-mediated repression. Further, we found that the
catalytic activity of G9a is essential for the repression. These results provide evidence for
a causal repressive function of H3K9 di-methylation and suggest that there might exist a
functional difference between H3K9 di-methylation and tri-methylation.
Our system can be expanded to study most types of epigenetic marks, including DNA
methylation and chromatin-remodeling proteins. The characterization of the causal
potential of individual epigenetic modifications could provide important insights to
understand how chromatin structure is established and regulated in a native context. Such
knowledge could also be useful in identifying potential targets for epigenetic therapy.

9
CHAPTER 2: MATERIALS AND METHODS
2.1 Plasmid constructions
Plasmids containing 5’ and 3’ EF1α promoter deletion mutants were generated by PCR
amplification of the promoter deletion fragments using forward primers with a SacI and a
SpeI site, and reverse primers with an AvrII and a HindIII site. Amplicons were digested
with SacI and HindIII and ligated into the pGL3 Basic vector backbone (Promega)
prepared by SacI and HindIII digestion. The Gal4DBSs were introduced into EF1α
promoter mutant constructs using a special strategy. The Gal4DBSs plasmids were
digested with SpeI and BsaI and ligated into the EF1α deletion mutant plasmids prepared
via AvrII and BsaI digestion. The luciferase reporter plasmids containing the Gal4DBSs
modified EF1α promoter were constructed by ligating Gal4DBSs modified EF1α deletion
mutants using the same strategy as inserting Gal4DBSs to EF1α deletion mutant
plasmids. A PCR-amplified HindIII-EcoRI insert encoding the EGFP was inserted into
the HindIII-EcoRI sites of the modified EF1α promoter plasmid. Plasmids encoding the
following histone methyltransferases were preciously constructed in the pM vector,
which has the Gal4 DNA-binding domain under the control of SV40 promoter: G9a,
Suv39h2, and Pr-set7. A PCR-amplified EcoRI-BamHI insert encoding the mouse
Suv39h1 was inserted into the EcoRI-BamHI sites of the pM vector. The Ubc promoter
deletion mutants were generated by PCR amplifying the promoter deletion fragments
using the forward and revers primers with an NheI and a HindIII sites, respectively.
Amplicons was digested with NheI and HindIII and ligated into the pGL3 Basic vector
backbone (Promega) prepared through NheI and HindIII digestion. The Gal4DBSs

10
plasmids were digested with SpeI and BsaI and ligated into the Ubc promoter deletion
mutant plasmids prepared using NheI and Bsa1 digestion. The Suv39h1H320R (Suv39h1
with hyperactivity) was made by replacing the 320 amino acid of Suv39h1 with an
arginine. This was done by inserting a DNA oligo containing this arginine by BsaAI and
SbfI sites into the pM vector. PCR-amplified EcoRI-BamHI and BamHI-MluI inserts of
G9aΔSET, G9aΔUHRF1 (G9a deletion mutant without UHRF1 binding domain),
G9aΔANK, Suv39h1ΔSET, Suv39h1SET, Suv39h2SET were cloned into the sites of the
vector pM for Gal4DBD fusions. These deletion mutants were digested by EcoRI-BamHI
and BamHI-MluI and ligated one another to generate swapping domain constructs:
G9aΔSETSuv39h1SET, G9aΔSETSuv39h2SET, and Suv39h1SETG9aΔSET. The
primers sequence and restriction sites were listed below:
Table 1. Primers for PCR.
Primer name Sequence Restriction sites
EF1α FW-3 AAAAAGAGCTCCCTAGGCTCCGGTGCCCGTCAGT
G
SacI , AvrII
EF1α FW-3 AAAAACCTAGGCTCCGGTGCCCGTCAGTG AvrII
EF1α FW-97 AAAAACCTAGGAAGGTGGCGCGGGGTAAAC AvrII
EF1α FW-288 AAAAACCTAGGCCTTGCGTGCCTTGAATTAC AvrII
EF1α FW-500 AAAAACCTAGGTAGCCATTTAAAATTTTTGATGA AvrII
EF1α FW-572 AAAAACCTAGGAGATCTGCACACTGGTATTTC AvrII
EF1α FW-704 AAAGACCTAGGTGGCCGGCCTGCTCTGGT AvrII
EF1α FW-869 AAAAACCTAGGGTGAGTCACCCACACAAAGG AvrII
EF1α FW-950 AAAAACCTAGGGTCCAGGCACCTCGATTAG AvrII
EF1α FW-1104 AAAAACCTAGGCTTTTTGAGTTTGGATCTTGGTT
C
AvrII
EF1α BW-96 AAAAAACTAGTCTCTAGGCACCGGTTCAATTG SpeI
EF1α BW-291 AAAAAACTAGTAAGGGCCATAACCCGTAAAG SpeI
EF1α BW-505 AAAAAACTAGTATGGCTAGAGACTTATCGAAAG SpeI

11
Table 1. Continued.

Primer name Sequence Restriction sites
EF1α BW-591 AAAAAACTAGTAAATACCAGTGTGCAGATCTTG SpeI
EF1α BW-591 AAAAAAAGCTTACTAGTAAATACCAGTGTGCAG
ATC
HindIII, SpeI
EF1α BW-697 AAAAAACTAGTGACTACCCCCGTCCGATTC SpeI
EF1α BW-697 AAAAAAAGCTTACTAGTGACTACCCCCGTCCGAT
TC
HindIII, SpeI
EF1α BW-854 TACGTACTAGTGCCGCGTCCTCCATTTTG SpeI
EF1α BW-941 AAAAAACTAGTGTACTCCGTGGAGTCACATG SpeI
EF1α BW-1103 AAAAAACTAGTGGCAAATTCCAAGGAGAATTAC SpeI
EF1α BW-1184 AAAAAACTAGTTCGCGACACCTGAAATGGAAG SpeI
EGFP FW AAAAAAAGCTTGCCACCATGGTGAGCAAGGGCG
AGGAG
HindIII
EGFP BW AAAAAAGAATTCCTTGTACAGCTCGTCCATG EcoRI
UbC FW 287 AAAAAGCTAGCGATTCTGCGGAGGGATCTC NheI
UbC FW AAAAAGCTAGCACATCCTAGGCTCGAGATC NheI
UbC BW AAAAAAAGCTTTGGACTAGTTCAACACGGTC HindIII
mSuv39h1 FW AAAAAGAATTCGCGGAAAATTTAAAAGGTT EcoRI
mSuv39h1SET FW AAAAAGGATCCAACACCTGGGGCGGATCACCG BamH1
mSuv39h1 BW AAAAAGGATCCGAAGAGGTATTTTCGGCAAG BamH1
mSuv39h1 BW AAAAAACGCGTGAAGAGGTATTTTCGGCAAG MluI
mSuv39h1ΔSET
BW
AAAAAGGATCCGGTGGCTGCGCTTGGCATTGAG BamHI
G9a FW AAAAAGAATTCCGGGGTCTGCCGAGAGGGA EcoRI
G9aUHRF1 BW AAAAAACGCGTCATTGGAGACCCCAGCGT MluI
G9aΔUHRF1 AAAAAGGATCCAAACGTCTTCACTGGAGACAGA BamHI
G9a FW AAAAAGGATCCAACGGGGTCTGCCGAGAGGGA BamHI
G9aSET FW AAAAAGGATCCAAATCATCTGCCGGGACGTAG BamHI
G9a BW AAAAAACGCGTTCAGGTGTTGATGGGGGGC MluI
G9a BW AAAAAGGATCCTCAGGTGTTGATGGGGGGC BamHI
G9a ΔSET AAAAAGGATCCAAATGATCTTCTCGGTGCGGA BamHI

12
2.2 Cell culture and transfection
NIH/3T3 cells were maintained in DMEM supplemented with 10% fetal bovine serum,
1% penicillin (or 1% streptomycin), and 1% non-essential amino acid. Lipofectamine
2000 (Invitrogen, 0.2 µg each well) was used for transfection. Firefly luciferase reporter
plasmids (50 ng/well in 96-well plate) and equal molar amount of epigenetic modifying
enzymes containing plasmids were co-transfected. 10 ng of renilla luciferase plasmid was
co-transfected as a normalizing control. Luciferase activity was measured at two time
points (24 h and 48 h) after transfection. Each experiment was done in at least three
biological replicates. The results shown are the means of triplicate points. The Dual
Luciferase Reporter Assay Kit (Promega) was used to determine luciferase expression.
The ratio of firefly to renilla luminescence intensity was calculated and used as a measure
of promoter activity.
2.3 Generation of GFP expression stable NIH/3T3 cell lines
Mouse NIH/3T3 cells were maintained in a HEPES-buffered DMEM medium (USC
tissue culture core facility) supplemented by 10% FBS (Hyclone), 1% nonessential amino
acid (invitrogen), and 1% penicillin (Irvine Scientific). NIH/3T3 cells were transfected
with 20ug of linearized DNA in water using Lipofectamine 2000 (Invitrogen, 60ul per
10cm dish). G418 (Genimi, 50mg/ml) was applied to the culture medium at a
concentration of 160 ug/ml one day after transfection and changed to 140ug/m, three days
later. The drug selection was continued for 10 days, before picking. Colonies having
different GFP expression levels were picked up into a 48-well plate after drug selection.

13
Selected colonies were cultured in G418 containing media contained continued and split
into 6-well plate.
2.4 Design of plasmids for shRNA expression.
A set of 10 different shRNAs targeting HP1, CBX, and CHP1 was designed using the
Thermo (San Diego, CA) “siDesign-Center” online tool
(www.dharmacon.com/desighcenterpage.aspx). Design criteria were: (i) 19 or 21
nucleotide (nt) stem lengths, (ii) sense strand (beginning with a G) located before the
antisense strand, (iii) both strands separated by a seven nt loop (5′ TCA AGA G 3′), and
(iv) no significant homology to the mouse genome. The following sequences were
designed: HP1 5′ GATCCGGGAGAAATCAGAAGGAAATTCAA
GAGATTTCCTTCTGATTTCTCCCTTTTTTGGAAA 3′, CBX 5′ GATCCGAAAACA
GCTCATGAGACATTCAAGAGATGTCTCATGAGCTGTTTTCTTTTTTGGAAA 3′,
CHP1 5′ GATCCGCAAATAGCACATTGTTAATTCAAGAGATTAACAATGTGCTA
TTTGCTTTTTTGGAAA 3′. These oligos were ordered from the IDT. XbaI and HindIII
sites were added to 5’ and 3’ end respectively. In the resulting constructs, the shRNAs
were expressed by the U6 promoter and terminated by a stretch of five thymines. shRNA
efficiency was obtained by co-transfecting an shRNA target sequence containing
luciferase plasmids (driven by EF1α promoter) and shRNA containing plasmids.
Table 2. shRNA oligos.
Target Gene

Oligo sequence (5’ to 3’)
HP1 CTAGGGGAGAAATCAGAAGGAAAAGAAGATGAAGGAGGGTGACAACA
GCGCTGATGATATTGAATTCA
CBX CTAGGAAAACAGCTCATGAGACATGAAGATAAAGGAGAGGAACCAAG
GAAGCCAATGTCAAGAATTCA
CHP1 CTAGGCAAATAGCACATTGTTAAGGGAAACACATGTGGACTACAGATG
AACCAATGACAAAGAATTCA

14
CHAPTER 3: RESULTS
3.1 Generation of an in vitro reporter system for determining the causal effects of
histone modifications
With the defined goal of determining the causal potential of individual histone
modifications on transcription and chromatin structure, we developed a reporter assay
system designed to achieve the selective introduction of a specific histone modification
and the production of a quantitative optical readout of the effect of the histone
modification on transcription and chromatin structure. The cassette contains a reporter
gene downstream of the human EF1α promoter (Fig 1A). The reporter is a fusion gene
encoding enhanced green fluorescent protein (EGFP) and luciferase, which enables us to
visually monitor and to quantitatively measure the effects of introduced histone
modifications on transcription. To ensure that potential functional interference between
the EGFP and luciferase in the fusion protein, we inserted the T2A sequence at the
junction of the two genes, which will be co-translationally cleaved, resulting in two
separate proteins (Fig 1A). In order to introduce desired histone modifications to the
EF1alpha promoter, we modified the promoter with Gal4 DNA Binding Sequences (Gal4
DBS) and inserted the Gal4 DNA binding domain Gal4DBD to the N-terminal of
histone modifying enzymes (Fig 1A). Our EF1α promoter contains a 1kb intron, in
addition to the 200-bp promoter region. This intron has been shown to contain four Sp1
and one Ap1 binding sites, contributing to the activity of the EF1α promoter (Fig 1B)
(Wakabayashi-Ito N et al. 1994). We performed two bio-informatic analyses: a
transcription factor binding site search (TFSEARCH) and a homology comparison among

15

Figure 1. Development of an in vitro reporter system for determining the causal potential of histone modifications.
(A) A schematic representation of the reporter assay system. Histone modifying enzymes are recruited to the
fluorescence-luminescence fusion reporter cassette in a sequence-specific manner through the Gal4 DBS-DBD
interaction. (B) Characterization of the EF1 α promoter by 5’ and 3’ nested deletion. TFSEARCH: transcription factor
binding site search. Homology1: Homology comparison between the human EF1α with the mouse EF1α promoters.
Homology 2: between the human EF1α with the rat EF1α promoters. (C) Effects of Gal4 DBS insertion on EF1α
promoter efficacy. Error bars represent the SEM of biological replicates, n=3.

A

C

B

A
B

C

16
three different species (human, rat, and mouse), to minimize the possibility of destroying
putative cis-elements in the EF1α promoter upon insertions (Fig 1B). Based on the maps
of transcription factor binding sites and evolutionarily conserved regions, we generated
modified EF1α promoters with Gal4 DBSs at various locations (Fig 1C). We performed a
transient luciferase assay of these modified EF1a promoters to assess the effects of
Gal4DBS insertion. We observed promoter activities comparable to the unmodified EF1a
promoter (Fig 1C).
3.2 Effects of the targeted recruitment of histone modifying enzymes to the EF1α
promoter
We first tested whether the histone methyltransferase G9a, Suv39h1, Suv39h2, and Pr-
set7 could repress the transcriptional activity of the transiently transfected reporter
plasmids. We chose these four enzymes as our initial test set since their genomic
distribution and association with gene silencing are relatively well established (Table 1).
G9a catalyzes the mono- and di- methylation of H3K9 and H3K27 and is involved in
transcriptional silencing (Makoto Tachibana et al. 2001; Collins RE et al. 2005).
Suv39h1, the heterochromatic histone methyltransferase, is responsible for H3K9 tri-
methylation of H3K9. Suv39h2 could catalyze H3K9 di-and tri-methylation using
monomethylated H3K9 as substrate. Pr-Set7 is the enzyme responsible for the
monomethylation of H4K20 and may function as a key cell cycle regulator. We co-
transfected the reporters and Gal4DBD fused histone methyltransferases into NIH/3T3
cells. After transfection, luciferase values were measured at two different time points,
24h and 48h. Similar results were obtained at both time points (data not shown).
Gal4DBD fused G9a (GalDBDG9a) resulted in 40-60% repression of transcription in

17
Table 3. Repressive histone modifying enzymes and their function.
Enzyme Function
Pr-set 7 H4K20 mono-methylation
G9a H3K9, H3K27 mono- and di- methylation
Suv39h1 H3K9 tri-methylation
Suv39h2 H3K9 di- and tri-methylation

18
comparison to unregulated expression of the reporter, whereas Suv39h1, Suv39h2 and Pr-
set7 failed to repress both Gal4DBS_EF1α (M1) and Gal4DBS_EF1α (M6) reporters
under the given experimental conditions (Fig. 2). Similar results were obtained from four
other reporters (Gal4DBS_EF1α M2-M5) (data not shown).
3.3 Effects of the targeted recruitment of histone modifying enzymes to the Ubc
promoter
We applied these four histone methyltransferases to another mammalian promoter, the
ubiquitin C promoter (hUbc), to test whether the G9a-specific transcriptional repression
is a promoter-dependent phenomenon. The Ubc promoter is a ubiquitous promoter,
consists of a 200-bp promoter region and an intron (1 Kb), similar to the EF1α promoter.
We inserted four copies of Gal4DBSs to the 5’ end of the UbC promoter and transiently
introduced the modified reporter (Gal4DBS_UbC M1) and constructs expressing
Gal4DBD fused histone methyltransferases into the NIH/3T3 cells. As observed with the
EF1α promoters, the transcription of the reporter gene was substantially repressed by
G9a, but not by Suv39h1, Suv39h2, and Pr-set7 (Fig 3). This result suggests that the
initiation of transcriptional repression by G9a may not be promoter dependent.
We tested the possibility that other enzymes failed to initiate repression due to their
insufficient protein levels by applying increased amounts of the enzymes, bringing the
molar ratio between the reporter and histone modifying enzyme constructs up to one to
four. We found that at all four experimental conditions Suv39h1, Suv39h2, and Pr-set7
failed to induce repression (Fig 4). We then reduced the strength of the promoters by

19

Figure 2. Effects of the targeted recruitment of histone modifying enzymes to the EF1α promoter. Reporter
constructs Gal4DBS_EF1α(M1) (p≤0.018) and Gal4DBS_EF1α(M6) (p≤0.025) and histone methyltransferase
containing plasmids were transiently introduced into NIH/3T3 cells at an equal molar ratio. Gal4DBD: empty pM
vector. ΔGal4DBD: empty pM vector without the Gal4DBD. Gal4G9a, Gal4Suv39h1, Gal4Suv39h2, Gal4DBDPr-set7:
Gal4DBD fused histone methyltransferases. Luciferase activities were measured 24h after the transfection. Error bars
represent the SEM of biological replicates, n=3. * p≤0.05.

Gal4DBD ΔGal4DBD Gal4DBD Gal4DBD Gal4DBD Gal4DBD
G9a Suv39h1 Suv39h2 Pr-set7

Gal4DBD ΔGal4DBD Gal4DBD Gal4DBD Gal4DBD Gal4DBD
G9a Suv39h1 Suv39h2 Pr-set7

*
*

20

Figure 3. Effects of the targeted recruitment of histone modifying enzymes to the Ubc promoter. The human Ubc
promoter was modified with four copies of Gal4DBSs. The reporter with the Ubc promoter ((Gal4DBS_Ubc(M1)) and
histone methyltransferase containing plasmids were transiently introduced into NIH/3T3 cells at an equal molar ratio
(p≤0.0006). Luciferase activities were measured 24h after the transfection. Error bars represent the SEM of biological
replicates, n=3, * p≤0.05.

Gal4DBD ΔGal4DBD Gal4DBD Gal4DBD Gal4DBD Gal4DBD
G9a Suv39h1 Suv39h2 Pr-set7

Gal4DBD Gal4DBD Gal4DBD Gal4DBD Gal4DBD
G9a Suv39h1 Suv39h2 Pr-set7

*

21

Figure 4. Testing increased amounts of histone methylatrasferases on the EF1α promoter. Increased amounts of
histone methyltansferases were tested. Molar rations are indicated on top of each graph. Error bars represent the SEM
of biological replicates, n=3, * p≤0.01.

Gal4DBD Gal4DBD Gal4DBD Gal4DBD
G9a Suv39h2 Pr-set7

Gal4DBD Gal4DBD Gal4DBD Gal4DBD
G9a Suv39h2 Pr-set7

Gal4DBD Gal4DBD Gal4DBD Gal4DBD
G9a Suv39h2 Pr-set7

Gal4DBD Gal4DBD Gal4DBD Gal4DBD
G9a Suv39h2 Pr-set7

*

*

*

*

*

22
deleting critical cis-elements to test the possibility that they failed to repress due to
strength of the two tested promoters exceeding their repression capacity, rather than their
inherent lack of repression capability (Fig 5A). We generated six EF1α promoter deletion
mutants: EF1αΔ307-1081 (From 307 bp to 1081 bp was deleted), EF1αΔ521-1081,
EF1αΔ607-1081, EF1αΔ713-1081, EF1αΔ868-1081, and EF1αΔ957-1081 (Fig 5A). We
performed a transient luciferase assay of each deletion mutant in the NIH/3T3 cell to
determine the promoter strength of each mutant. Compared with the wild-type EF1α
promoter, the EF1αΔ307-1081 mutant showed the lowest promoter activity (20%) (Fig
5A). We inserted four copies of Gal4DBSs at the 5’ end of the mutant promoter
(Gal4DBS_EF1αΔ307-1081) (Fig 5A). We applied two molar ratios between the reporter
and histone methyltransferase containing constructs (1:1 and 1:4). G9a resulted in 60-
70% repression of transcription of Gal4DBS_EF1αΔ307-1081, while Suv39h2 and Pr-
SET7 failed to repress, consistent with the results obtained the wild-type EF1α promoter
(Fig 5B). These results suggest that qualitative differences, not quantitative differences
between G9a and other histone modifying enzymes might underlie the different results
obtained.
It has been shown that the catalytic activity of G9a is approximately 20 times that of
Suv39h1 in in vitro histone methylatransferase (HMT) assays (Makoto Tachibana et al.
2001). We thus tested a hyperactive mutant Suv39h1 (Rea S et al. 2000). This mutant
Suv39h1 contains a point mutation in the SET domain (H320R) and has been shown to
display more than 20 times higher enzymatic activity in vitro, as compared to the WT
Suv39h1 (Rea S et al. 2000). This hyperactive mutant did not show any repression (Fig 6)
although its catalytic activity is comparable to that of G9a. This suggests that insufficient

23

Figure 5. Effects of the targeted recruitment of histone modifying enzymes to an EF1α promoter with reduced
strength. (A) Promoter activities of EF1α deletion mutants. (B) The reporter containing the EF1α deletion mutant with
the lowest promoter strength (EF1αΔ307-1081) and histone methyltransferase containing plasmids were transiently
introduced into NIH/3T3 cells at molar ratios indicated above each graph. Error bars represent the SEM of biological
replicates, n=3, * p≤0.01.
A

B

Gal4DBD Gal4DBD Gal4DBD Gal4DBD
G9a Suv39h2 Pr-set7

Gal4DBD Gal4DBD Gal4DBD Gal4DBD
G9a Suv39h2 Pr-set7

Gal4DBD Gal4DBD Gal4DBD Gal4DBD
G9a Suv39h2 Pr-set7

Gal4DBD Gal4DBD Gal4DBD Gal4DBD
G9a Suv39h2 Pr-set7

*

*

*

*

24

Figure 6. Testing the hyperactive Suv39h1 on the EF1α promoter. The Suv39h1 hyperactive mutant (H320R) was
tested on the EF1α promoter. Error bars represent the SEM of biological replicates, n=3, P≤0.014,* p≤0.05.

Gal4DBD Gal4DBD Gal4DBD Gal4DBD
G9a Suv39h1 Suv39h1
H320R

*

25
catalytic activity of Suv39h1 might not account for its failure to initiate transcriptional
repression. Our data collectively suggest that there might exist a functional difference
between H3K9 di-methylation and tri-methylation.
3.4 The catalytic SET domain of G9a is required for the G9a-initiated transcriptional
repression
We next investigated the mechanism of the G9a-initiated transcriptional repression, to
understand the potential qualitative difference between G9a and other histone modifying
enzymes tested. We began our investigation by generating a series of G9a deletion
mutant constructs to map regions necessary for the G9a-mediated repression (Fig 7A).
We deleted the ankyrin repeats, UHRF1 interacting domain, and SHP interacting domain
(SET domain) from G9a (Fig 7A). UHRF1 and SHP have been shown to interact with
G9a and these interactions might contribute to the G9a-mediated repression (Kim JK et
al. 2009; Boulias K et al. 2004). The ankyrin repeat domain has been shown to interact
with DNA methyltransferases (DNMT1, 3A, and 3B) (Estève P et al. 2006; Epsztejn-
Litman S et al. 2008), and to recognize di-methylated H3K9 (Collins RE et al. 2008). We
found that G9a SET domain is both necessary and sufficient to initiate repression (Fig
7B). The SET domain of G9a has been shown to interact with SHP that mediates the
interaction between G9a and HDAC1 (Boulias K et al. 2004), a histone deacetylase
whose activity would be essential for G9a to catalyze H3K9 methylation when targeted to
active promoters.
To further demonstrate the necessity and sufficiency of G9a SET domain, we exchanged
catalytic domains (SET) between the enzymes. We swapped the G9a set

26

Figure 7. Effects of the targeted recruitment of G9a deletion mutants to the EF1α promoter. (A) G9a deletion
mutants. Proteins known to interact with G9a are indicated above the interacting regions of G9a. (B) The effects of
recruitment of G9a deletion mutants to the EF1α promoter. Error bars represent the SEM of biological replicates, n=3,
* p≤0.05.

A

B

*
*

27
domain with the Suv39h1 and Suv39h2 SET domains, including the Pre- and Post- SET
domains (Fig 8A). Pre-SET domains have been suggested to play an important role in
determining the target specificity of the SET domain containing enzymes (Wilson JR et
al. 2002). We generated four proteins, Suv39h1 and Suv39h2 proteins with the G9a SET
domain (Suv39h1ΔSET G9a SET, Suv39h2ΔSET G9a SET), the G9a protein with either
Suv39h1 or the Suv39h2 SET domain (G9aΔSET Suv39h1 SET, G9aΔSET
Suv39h2SET) (Fig 8A). The transient transfection assay showed that the recombinant
proteins with the G9a SET domain resulted in 40% repression of transcription. By
contrast, the G9a recombinant proteins with the Suv39h1, Suv39h2 SET domain could
not initiate repression (Fig 8B). These results further suggest that the SET domain of G9a
is sufficient for the G9a-initiated repression and that the catalytic activity of G9a, H3K9
di-methylation, might be mediating the repression. We tested this possibility, using a
mutant G9a (H1166K) that lacks the catalytic activity (Lee DY et al. 2006). We targeted
the Gal4-fused G9a mutant (Gal4G9aH1166K) to modified EF1α promoter. The
G9aH1166K did not show any repressive function (Fig 9). This result suggests that H3K9
di-methylation is mediating the repression.
3.5 Development of a transient assay system to determine shRNA efficiency
To further understand the mechanism of the G9a-initiated transcriptional repression, we
sought to identify the enzyme(s) that recognizes the H3K9 di-methylation by G9a and
translates this repressive signal. H3K9 could present four types of signals: unmethylation,
mono- methylation, di-methylation, and tri-methylation. It has been shown that histone
methyl-lysine readers play essential in controlling chromatin structure (Yun M et al.
2011). To identify the histone reader involved in the G9a-initiated

28

Figure 8. Swapping the SET domains between histone methyltransferases. (A) Domain maps of histone
methyltransferases and mutant proteins with swapped SET domains. (B) The effect of the SET domain swapping was
assessed with the EF1α and Ubc promoters. Error bars represent the SEM of biological replicates, n=3, * p≤0.05.

A

B

*
*
*
*

29

Figure 9. Testing a catalytic mutant (H1166K) of G9a. A catalytic mutant version of G9A (H1166K) was tested on
two EF1α promoters. Error bars represent the SEM of biological replicates, n=3, * p≤0.05.

*
*

30
repression, we employed the RNAi-mediated knockdown approach. Of the 14 known
H3K9 di/tri-methylation recognizing enzymes, we chose to knockdown HP1, MPP8,
CBX1, and CHP1 (Table 2). Higher eukaryotes have at least three different isoforms of
HP1 (HP1α, HP1β, and HP1γ). Their subnuclear localizations are different. HP1α and
HP1β are primarily found within centromeric heterochromatin, whereas HP1γ is enriched
at euchromatic sites (Eskeland Ret al. 2007). MPP8 has been shown to be involved in
G9a-mediated E-cadherin silencing (Kokura K et al. 2010). We first developed a
luciferase-based transient assay system to facilitate the assessment of RNAi efficiency
and tested three shRNAs for each histone reader (Fig 10A). shRNA target sequences
were introduced into 5’UTR of the firefly luciferase gene and shRNA were cloned into
the pSilencer vector (Ambion), under the control of the U6 pol III promoter (Fig 10A).
This assay system allows us to overcome the low transfection efficiency of NIH/3T3 cells
and enables a quantitative assessment of shRNA efficiency through luciferase assays.
Using this assay system, we identified shRNA sequences with 70~80% knockdown
efficiency for the HP1, CBX1, and CHP1 (Fig 10B).
3.6 Determining the causal potential of histone modifications in stable cell lines
Even though it has been shown that transiently introduced plasmids associate with
histones and acquire histone modifications (Reeves R et al. 1985; Shi Y et al. 2004), we
stably introduced our reporter cassette to validate our findings in a more native chromatin
structure. We established several stable cell lines with varying degrees of reporter
expression, using NIH/3T3 cells (Fig 11). We replaced the Gal4DBD with the tet
repressor proteins, tetR/rtetR, to achieve conditional recruitment of histone modifying
enzymes (Fig 11). Before using this tet-on system in stable cell lines, we tested the tet

31
Table 4. Histone readers of H3K9me3/2 histone modifiations
Gene name Responsible sites
HP1 H3K9me3/2 histone modification reader
MPP8 H3K9me3/2 histone modification reader
CBX H3K9me3/2 histone modification reader
CHP1 H3K9me3/2 histone modification reader

32

Figure 10. Development of a transient assay system to determine shRNA efficiency. (A) shRNA target sequences
were introduced at the 5’UTR of the firefly luciferase gene in the pGL3-EF1α vector as depicted. shRNA oligos were
introduced into the pSilencer using the restriction sites as indicated. (B) The efficiency of each shRNA was assessed in
transient lucifersase assays. Error bars represent the SEM of biological replicates, n=3.

A

B

33
operator containing reporter cassette and TetR/rTetR fused G9a in transient luciferase
assay (Fig 11). In the absence of doxycycline, TetR fused G9a was able to initiate
transcription repression, while rTetR fused G9a repressed in the presence of doxycycline
as expected (Fig 11). This result indicates that the tet system can be used to allow for the
inducible targeting of histone modifying enzymes in stable cell lines.

34

Figure 11. Development of stable cell lines and conditional recruitments of G9a. (A) A reporter cassette for stable
cell line. The Gal4 DBSs were replaced with tet operator sequences to allow for a conditional targeting of histone
modifying enzymes. (B) Conditional transcriptional repression of the EF1α promoter using tetR/rtetR fused G9A and
doxycycline. Doxycycline was applied into media at 1µg/ml concentration one day prior to transfection. Error bars
represent the SEM of biological replicates, n=3, * p≤0.05. (c) EGFP expression from a stable cell line.

A

C

*
*

*
*

B

35
CHAPTER 4 : CONCLUSION AND DISCUSSION
In this study, we have tested the causal potential of individual histone modifications or
modifiers on transcription, using a reporter assay system designed to allow for the
selective recruitment of a histone-modifying enzyme of choice. We found that G9a could
initiate transcriptional repression from one of the strongest mammalian promoters (EF1α)
in transient reporter assays, while Suv39h1, Suv39h2, and Pr-set7 could not. In addition,
we found that G9a could initiate transcriptional repression from the hUbc promoter as
well. This indicated that the unique capability of G9a to initiate transcriptional repression
might not be promoter dependent. A number of experimental evidence that we obtained
suggests that qualitative differences between G9a and other tested histone
methyltransferases might underlie the repression capability difference among the
enzymes. First, we observed complete lack of repression even with increasing amount
Suv39h1, Suv39h2, and Pr-set7. Second, these non-repressive enzymes failed to initiate
repression when targeted to promoters with reduced promoter strength. Third, the
hyperactive mutant Suv39h1 (H320R) whose methyltransferase activity is comparable to
that of G9a showed no repression.
Although our results strongly support that there might exist a function difference between
H3K9 di-methylation and tri-methylation, there are several caveats in our study. First, we
cannot rule out the possibility that the fusion between the Gal4DBD and histone
modifying enzymes had abolished the catalytic activities of those enzymes found to be
non-repressive in our assays. This possibility could be tested in in vitro histone
methyltransferase assays, or in chromatin immunoprecipitation assays for the presence of

36
each modification at the promoter of our reporter, using the stable cell lines.
Alternatively, the fusion could have resulted in differences in binding efficiencies of
fusion proteins. Although these fusion proteins have been used in reporter assays by
others (Stewart MD et al. 2005), the successful targeting of each fusion protein should be
confirmed in stable cell lines. We have introduced a Flag tag into the N-terminus of the
tet/rtet repressor proteins to facilitate the confirmation of recruitment by ChIP assay.
Another caveat is that G9a catalyzes H3K27 mono- and di-methylation in addition to the
H3K9 methylations (Wu H et al. 2011). Thus, it is possible that H3K27 methylation, not
H3K9 di-methylation, is responsible for the observed repression although the level of
contribution of G9a to the global H3K27 mono- and di-methylation levels has been
shown to be very minimal and the H3K27 di-methylation catalyzed by G9a presented
together with an active histone modification, H3K36 methylation (Wu H et al. 2011). This
could also be tested in stable cell lines.
It should also be noted that the G9a-mediated transcriptional repression of active
promoters observed in our assay system does not necessarily reflect the silencing
mechanisms of G9a-regulated endogenous genes. In our assay system, G9a recruitment to
an active promoter is achieved by a forced targeting by fusing the enzyme with the
Gal4DBD. In the process of silencing endogenous genes, G9a recruitment to target genes
is achieved through protein-protein interactions (Fang S et al. 2007) and may not be the
initiating event. Although G9a recruitment is artificially achieved in our study, it is this
artificial recruitment that enables the introduction of a repressive histone modification
into an active chromatin as the initiating event and thereby allows for the assessment of
the causal potential of the introduced modification.

37
It has been reported that H3K9 di-methylation is enriched at inactive genes at much
higher levels than H3K9 tri-methylation (Barski A et al. 2007). H3K9 di-methylation has
also been found to constitute large organized chromatin K9 modifications, termed
LOCKs, that are associated with tissue-specific gene silencing (Wen B et al. 2009). Both
G9a and Suv39h1 have been shown to be involved in gene silencing (Ait-Si-Ali S et al.
2004; Gazzar ME et al. 2008), but the catalytic activity of Suv39h1 was found to be
dispensable for repression (Vaute O et al. 2002). The unique repressive capability of
G9a could be explained by differences in histone readers or in interacting proteins. Our
shRNA-mediated knockdown approach could result in the identification of the histone
reader that recognizes and translates the repressive mark introduced by G9a. This
approach could also be used to identify interacting proteins that play critical roles in the
silencing process. There have been at least 17 proteins identified as G9a interacting
proteins, many of which are transcriptional repressors (Shinkai Y et al. 2011). For example,
the small heterodimer partner (SHP), an orphan nuclear receptor, has been shown to
interact with G9a and HDAC1, and to silence CYP7A1, a key gene in bile acid
biosynthesis (Fang S et al. 2007). The ubiquitin-like, containing PHD and RING finger
domains 1 (UHRF1) has been reported to inhibit p21 transcription through interactions
with G9a and HDAC1 (Kim JK et al. 2009). We have designed shRNAs for UHRF1,
SHP, and HDAC1 to test the potential involvement of these proteins in the G9a-mediated
repression.
Our ability to control the timing of the G9a recruitment in stable cell lines, using the tet
system will be useful in studying the subsequent molecular events triggered by the
introduction of histone modification(s) by G9a, such as changes in nucleosome

38
occupancy, DNA methylation, other histone modifications, and chromatin remodeling
complex recruitment. Future work in stable cell lines should allow a detailed mechanistic
study of the causal potential of histone modifications. We will apply the RMCE
(Recombinase-Mediated Cassette Exchange) technology (Turan S et al. 2011) to
invariably control the integration location and the expression level of each enzyme. To
facilitate the adaptation of other modifying enzymes to our assay system, we will employ
the Gateway cloning strategy (Suzuki Y et al.2005), which will allow us to fuse any
histone modifying enzymes with the tetR/rtetR without the confinement of restriction
enzyme availability. Our system can be expanded to study the causal potential of active
histone modifications using stable cell lines with an inactive reporter cassette.

39
REFERENCES
Ait-Si-Ali S, Guasconi V, Fritsch L, et al. A Suv39h-dependent mechanism for silencing
S-phase genes in differentiating but not in cycling cells. The EMBO journal.
2004;23:605-615

Allfrey VG, Faulkner R, Mirsky AE. Acetylation and methylation of histones and their
possible role in the regulation of RNA synthesis. Proc Natl Acad Sci USA. 1964; 51: 786-
94.

Bannister AJ, Kouzarides T. Regulation of chromatin by histone modifications. Cell
research. 2011;21:381-395.

Barski A, Cuddapah S, Cui K, et al. High-resolution profiling of histone methylations in
the human genome. Cell. 2007;129:823-837.

Beck DB, Oda H, Shen SS, Reinberg D. Pr-set7 and H4K20me1: at the crossroads of
genome integrity, cell cycle, chromosome condensation, and transcription. Genes &
development. 2012;26:325.

Bedford MT, Clarke SG. Protein Arginine Methylation in Mammals: Who, What, and
Why. Molecular Cell. 2009;33:1-13.

Boulias K, Talianidis I. Functional role of G9a-induced histone methylation in small
heterodimer partner-mediated transcriptional repression. Nucleic acids research.
2004;32:6096-6103.

Brooks CL, Gu W. How does SIRT1 affect metabolism, senescence and cancer? Nature
reviews. Cancer. 2009;9:123-128.

Collins R, Cheng X. A case study in cross-talk: the histone lysine methyltransferases G9a
and GLP. Nucleic acids research. 2010;38:3503-3511.

Collins RE, Northrop JP, Horton JR, et al. The ankyrin repeats of G9a and GLP histone
methyltransferases are mono- and dimethyllysine binding modules. Nature structural &
molecular biology. 2008;15:245-250.

Collins RE, Tachibana M, Tamaru H, et al. In vitro and in vivo analyses of a Phe/Tyr
switch controlling product specificity of histone lysine methyltransferases. The Journal of
biological chemistry. 2005;280:5563-5570.

Couture J, Collazo E, Brunzelle JS, Trievel RC. Structural and functional analysis of
SET8, a histone H4 Lys-20 methyltransferase. Genes & development. 2005;19:1455-
1465.

40
Dawson MA, Bannister AJ, Göttgens B, Foster SD, Bartke T. JAK2 phosphorylates
histone H3Y41 and excludes HP1 from chromatin. Nature. 2009;461:819-822.

Epsztejn-Litman S, Feldman N, Abu-Remaileh M, et al. De novo DNA methylation
promoted by G9a prevents reprogramming of embryonically silenced genes. Nature
structural & molecular biology. 2008;15:1176-1183

Eskeland R, Eberharter A, Imhof A. HP1 binding to chromatin methylated at H3K9 is
enhanced by auxiliary factors. Molecular and cellular biology. 2007;27:453-465.

Estève P, Chin HG, Smallwood A, et al. Direct interaction between DNMT1 and G9a
coordinates DNA and histone methylation during replication. Genes & development.
2006;20:3089-3103.

Fang S, Miao J, Xiang L, Ponugoti B, Treuter E, Kemper JK. Coordinated Recruitment of
Histone Methyltransferase G9a and Other Chromatin-Modifying Enzymes in SHP-
Mediated Regulation of Hepatic Bile Acid Metabolism. Molecular and Cellular Biology.
2007;27:1407-1424.

Fuks F, Hurd PJ, Deplus R, Kouzarides T. The DNA methyltransferases associate with
HP1 and the Suv39h1 histone methyltransferase. Nucleic acids research. 2003;31:2305-
2312.

Gazzar ME, Yoza BK, Chen X, Hu J, Hawkins GA, McCall CE. G9a and HP1 Couple
Histone and DNA Methylation to TNFα Transcription Silencing during Endotoxin
Tolerance. The Journal of Biological Chemistry. 2008;283:32198-32208.

Gy ry I, Wu J, Fejér G, Seto E. PRDI-BF1 recruits the histone H3 methyltransferase G9a
in transcriptional silencing. Nature Immunology. 2004;5:299-308.

Huang J, Dorsey J, Chuikov S, et al. G9a and Glp methylate lysine 373 in the tumor
suppressor p53. Journal of Biological Chemistry. 2010;285:18122-18122.
Goldknopf IL, Busch H. Isopeptide linkage between nonhistone and histone 2A
polypeptides of chromosomal conjugate-protein A24. Proceedings of the National
Academy of Sciences of the United States of America. 1977;74:864-868.

Hu S, Xie Z, Onishi A, et al. Profiling the human protein-DNA interactome reveals
ERK2 as a transcriptional repressor of interferon signaling. Cell. 2009;139:610-622.

Karachentsev D, Sarma K, Reinberg D, Steward R. Pr-set7-dependent methylation of
histone H4 Lys 20 functions in repression of gene expression and is essential for mitosis.
Genes & development. 2005;19:431-435.

Kim J, Guermah M, McGinty RK, et al. RAD6-Mediated transcription-coupled H2B
ubiquitylation directly stimulates H3K4 methylation in human cells. Cell. 2009;137:459-
471.

41

Kim JK, Estève P, Jacobsen SE, Pradhan S. UHRF1 binds G9a and participates in p21
transcriptional regulation in mammalian cells. Nucleic Acids Research. 2009;37:493-505.

Kokura K, Sun L, Bedford MT. Methyl-H3K9-binding protein MPP8 mediates E-
cadherin gene silencing and promotes tumour cell motility and invasion. The EMBO
Journal. 2010;29:3673-3687.

Lee DY, Northrop JP, Kuo M, Stallcup MR. Histone H3 lysine 9 methyltransferase G9a
is a transcriptional coactivator for nuclear receptors. The Journal of biological chemistry.
2006;281:8476-8485.

Lee J, Shukla A, Schneider J, et al. Histone crosstalk between H2B monoubiquitination
and H3 methylation mediated by COMPASS. Cell. 2007;131:1084-1096.

Makoto Tachibana, Kenji Sugimoto, Tatsunobu Fukushima, Yoichi Shinkai. SET
Domain-containing Protein, G9a, Is a Novel Lysine-preferring Mammalian Histone
Methyltransferase with Hyperactivity and Specific Selectivity to Lysines 9 and 27 of
Histone H3. Journal of Biological Chemistry. 2001;276:25309-25317.

Martin C. The diverse functions of histone lysine methylation. Nature Reviews Molecular
Cell Biology. 2005;6:838-849.

Ng SS, Yue WW, Oppermann U, Klose RJ. Dynamic protein methylation in chromatin
biology. Cellular and molecular life sciences : CMLS. 2009;66:407-422.

Nielsen SJ, Schneider R, Bauer UM, et al. Rb targets histone H3 methylation and HP1 to
promoters. Nature. 2001;412:561-565.

Nishio H, Walsh MJ, Roeder RG. CCAAT Displacement Protein/cut Homolog Recruits
G9a Histone Lysine Methyltransferase to Repress Transcription. Proceedings of the
National Academy of Sciences of the United States of America. 2004;101:11257-11262.

Oda H, Okamoto I, Murphy N, et al. Monomethylation of histone H4-lysine 20 is
involved in chromosome structure and stability and is essential for mouse development.
Molecular and cellular biology. 2009;29:2278-2295.

Parthun MR. Hat1: the emerging cellular roles of a type B histone acetyltransferase.
Oncogene. 2007;26:5319-5328.

Peters AH, O'Carroll D, Scherthan H, et al. Loss of the Suv39h histone
methyltransferases impairs mammalian heterochromatin and genome stability. Cell.
2001;107:323.

Parthun MR. Hat1: the emerging cellular roles of a type B histone acetyltransferase.
Oncogene. 2007;26:5319-5328.

42

Rea S, Eisenhaber F, O'Carroll D, et al. Regulation of chromatin structure by site-specific
histone H3 methyltransferases. Nature. 2000;406:593-599.
Reeves R, Gorman CM, Howard B. Minichromosome assembly of non-integrated
plasmid DNA transfected into mammalian cells. Nucleic acids research. 1985;13:3599-
3615.

Roopra A, Qazi R, Schoenike B, Daley TJ, Morrison JF. Localized domains of G9a-
mediated histone methylation are required for silencing of neuronal genes. Molecular
cell. 2004;14:727.

Shinkai Y, Tachibana M. H3K9 methyltransferase G9a and the related molecule GLP.
Genes & development. 2011;25:781-788.

Shi Y, Shi Y, Lan F, et al. Histone Demethylation Mediated by the Nuclear Amine
Oxidase Homolog LSD1. Cell. 2004;119:941-953.

Stewart MD, Li J, Wong J. Relationship between histone H3 lysine 9 methylation,
transcription repression, and heterochromatin protein 1 recruitment. Molecular and
cellular biology. 2005;25:2525-2538.

Suzuki Y, Kagawa N, Fujino T, et al. A novel high-throughput (HTP) cloning strategy for
site-directed designed chimeragenesis and mutation using the Gateway cloning system.
Nucleic acids research. 2005;33:e109-e109.

Tachibana M, Sugimoto K, Nozaki M, et al. G9a histone methyltransferase plays a
dominant role in euchromatic histone H3 lysine 9 methylation and is essential for early
embryogenesis. Genes & development. 2002;16:1779-1791.

Tachibana M, Ueda J, Fukuda M, et al. Histone methyltransferases G9a and GLP form
heteromeric complexes and are both crucial for methylation of euchromatin at H3-K9.
Genes & development. 2005;19:815-826.

Tjeertes JV, Miller KM, Jackson SP. Screen for DNA-damage-responsive histone
modifications identifies H3K9Ac and H3K56Ac in human cells. The EMBO journal.
2009;28:1878-1889.

Tan M, Luo H, Lee S, et al. Identification of 67 histone marks and histone lysine
crotonylation as a new type of histone modification. Cell. 2011;146:1016-1028.

Turan S, Galla M, Ernst E, et al. Recombinase-mediated cassette exchange (RMCE):
traditional concepts and current challenges. Journal of molecular biology. 2011;407:193-
221.

Vaquero A, Sternglanz R, Reinberg D. NAD+-dependent deacetylation of H4 lysine 16
by class III HDACs. Oncogene. 2007;26:5505-5520.

43

Vaute O, Nicolas E, Vandel L, Trouche D. Functional and physical interaction between
the histone methyl transferase Suv39H1 and histone deacetylases. Nucleic acids research.
2002;30:475-481.

Wakabayashi-Ito N, Nagata S. Characterization of the regulatory elements in the
promoter of the human elongation factor-1 alpha gene. The Journal of biological
chemistry. 1994;269:29831.

Wang H, Wang L, Erdjument-Bromage H, et al. Role of histone H2A ubiquitination in
Polycomb silencing. Nature. 2004;431:873-878.

Wen B, Wu H, Shinkai Y, Irizarry RA, Feinberg AP. Large histone H3 lysine 9
dimethylated chromatin blocks distinguish differentiated from embryonic stem cells.
Nature genetics. 2009;41:246-250.

West MH, Bonner WM. Histone 2B can be modified by the attachment of ubiquitin.
Nucleic acids research. 1980;8:4671-4680.

Wilson JR, Jing C, Walker PA, et al. Crystal structure and functional analysis of the
histone methyltransferase SET7/9. Cell. 2002;111:105.

Wu H, Chen X, Xiong J, et al. Histone methyltransferase G9a contributes to H3K27
methylation in vivo. Cell research. 2011;21:365-367.

Xiao B, Jing C, Kelly G, et al. Specificity and mechanism of the histone
methyltransferase Pr-Set7. Genes & development. 2005;19:1444-1454.

Yang X, Seto E. HATs and HDACs: from structure, function and regulation to novel
strategies for therapy and prevention. Oncogene. 2007;26:5310-5318.

Yun M, Wu J, Workman JL, Li B. Readers of histone modifications. Cell Research.
2011;21:564-578.

Zhenyu Li, Lihong Chen, Neha Kabra, Chuangui Wang, Jia Fang, Jiandong Chen.
Inhibition of Suv39h1 Methyltransferase Activity by DBC1. Journal of Biological
Chemistry. 2009;284:10361-10366.

Abstract (if available)

Abstract Histone modification is a major epigenetic regulatory mechanism that controls chromatin structure and gene expression potential. However, the causal potential of individual histone modifications remains largely unknown. Here, we report that G9a is able to initiate transcriptional repression when targeted to a robust mammalian promoter, the human EF1α promoter, in a transient reporter assay, while other histone methyltransferases, Suv39h1, Suv39h2, and PR-set7 fail to do so. We observed the same G9a-specific transcriptional repression from the human ubiquitin C promoter, suggesting that the G9a-initiated transcriptional repression might not be a promoter-dependent phenomenon. We found that the G9a catalytic SET domain is both necessary and sufficient to initiate repression. In addition, we found that the G9a SET domain is able to confer a repressive capability to a non-repressive histone methyltransferase, Suv39h1, when replacing the SET domain of Suv39h1. Further, a null mutation (H1166K) in the G9a SET domain completely abolished the repressive function, suggesting H3K9 di- methylation is mediating the repression. Our results provide evidence for a causal repressive function for H3K9 di-methylation and for the existence of potential functional differences among the histone methylations that have been uniformly considered as repressive mark.

Linked assets

University of Southern California Dissertations and Theses

Conceptually similar

PDF

Identification and characterization of PR-Set7 and histone H4 lysine 20 methylation-associated proteins

PDF

Investigation of a causal role of transposable element activation in vertebrate aging

PDF

Multiple functions of the PR-Set7 histone methyltransferase: from transcription to the cell cycle

PDF

Impacts of post-translational modifications on interactions between G9a and its N-terminus binding partners

PDF

The role of histone H4 lysine 20 monomethylation in gene expression and differentiation

PDF

Mixed lineage leukemia proteins (MLLs), their effect as coregulators on target gene expression and global histone methylation

PDF

Regulation of Aurora kinase B and its effect on phosphorylation of G9a/GLP

PDF

G9a, GLP and HP1γ facilitate glucocorticoid-induced apoptosis in B-ALL cells

PDF

Characterization and functional study of a novel human protein SFMBT, and PR-Set7 histone methyltransferase

PDF

Studies of the biological relevance of Histone H4 Lysine 20 monomethylation: discovery of its role in the cell cycle and localization within the human genome

PDF

Investigating the function and epigenetic regulation of ABCA3, a novel LUAD tumor suppressor gene

PDF

Using epigenetic toggle switches to repress tumor-promoting gene expression

PDF

Transcriptional regulation by epigenetic mechanisms

PDF

Epigenetic plasticity of cultured female human embryonic stem cells and regulation of gene expression and chromatin by PR-SET7 mediated H4K20me1

PDF

Molecular mechanism of the recruitment of SWI/SNF chromatin remodeling complex and histone acetyltransferase to estrogen-responsive promoters

PDF

Targeting chromatin modification in human cancer: SMYD3 mediated ERα transcription regulation. Cooperative role between H3.3 and HP1ϒ

PDF

The relationship between DNA methylation and transcription factor binding in colon cancer cells

PDF

The kinetic study of engineered MBD domain interactions with methylated DNA: insight into binding of methylated DNA by MBD2b

PDF

Breast epithelial cell type specific enhancers and functional annotation of breast cancer risk loci

PDF

Successful integration of biomarkers (hFR) into mainstream medicine

Asset Metadata

Creator Si, Yuchen (author)

Core Title Determinination of the causal potential of histone modifications on transcription and chromatin structure

School Keck School of Medicine

Degree Master of Science

Degree Program Biochemistry and Molecular Biology

Publication Date 07/25/2012

Defense Date 05/10/2012

Publisher University of Southern California (original), University of Southern California. Libraries (digital)

Tag chromatin structure,G9a,histone modification,OAI-PMH Harvest,PR-Set7,Suv39h1,Suv39h2,Transcription

Language English

Contributor Electronically uploaded by the author (provenance)

Advisor Laird, Peter W. (committee chair), Laird-Offringa, Ite A. (committee member), Tokes, Zoltan A. (committee member)

Creator Email siyuchen1218@gmail.com,yuchensi@usc.edu

Permanent Link (DOI) https://doi.org/10.25549/usctheses-c3-62768

Unique identifier UC11288235

Identifier usctheses-c3-62768 (legacy record id)

Legacy Identifier etd-SiYuchen-985.pdf

Dmrecord 62768

Document Type Thesis

Rights Si, Yuchen

Type texts

Source University of Southern California (contributing entity), University of Southern California Dissertations and Theses (collection)

Access Conditions The author retains rights to his/her dissertation, thesis or other graduate work according to U.S. copyright law. Electronic access is being provided by the USC Libraries in agreement with the a...

Repository Name University of Southern California Digital Library

Repository Location USC Digital Library, University of Southern California, University Park Campus MC 2810, 3434 South Grand Avenue, 2nd Floor, Los Angeles, California 90089-2810, USA