University of Southern California Dissertations and Theses

Exploring the molecular and cellular underpinnings of organ polarization using feather as the model system

(USC Thesis Other)

Exploring the molecular and cellular underpinnings of organ polarization using feather as the model system

PDF

Download a page range

Download transcript

Copy asset link

Request this asset

Transcript (if available)

Content EXPLORING THE MOLECULAR AND CELLULAR UNDERPINNINGS OF ORGAN POLARIZATION USING FEATHER AS THE MODEL SYSTEM by AngLi A Dissertation Presented to the FACULTY OF THE USC GRADUATE SCHOOL UNIVERSITY OF SOUTHERN CALIFORNIA In Partial Fulfillment of the Requirements for the Degree DOCTOR OF PHILOSOPHY (PATHOBIOLOGY) August 2014 Dedication To my beloved dinosaurs and Commander Shepard from Mass Effect. 11 Acknowledgements First and foremost, I would like to thank my advisor, Dr. Chuong for his guidance, encouragement and support during my graduate study at USC. I am also grateful to the support of my committee members throughout these years. Dr. Luis Chiappe, Dr. Gage Crump, Dr. Robert Maxson and Dr. Randall Widelitz provide many helpful discussions, insightful suggestions for my thesis project and academic career development. I would also like to thank my collaborators: Dr. Qing Nie and his two Ph.D. student Meng Chen and Seth Figueroa at UC Irvine for their help in the mathematical modeling part of two of my papers; Dr. Robert Chow and his Ph.D. student Jung-Hwa Choat USC Department of Physiology & Biophysics for their help in the electrophysiology and imaging; Dr. Yu-Wei Li from Dr. Scott Fraser's lab for his help in imaging and virus preparation; Dr. Jingmai O'connor at Institute of Vertebrate Paleontology and Paleoanthropology for introducing me to the avian sternum project; Dr. Wentao Juan at Academia Sinica for collaboration in the rachis ridge morphogenesis project; Dr. Chih-Feng Chen and Pin-Chi Tang at National Chung Hsing University for their assistance in the peacock project and taking care of me in Taiwan. Furthermore I would like to thank all the former and current members of Dr. Chuong's lab. Former members: Chi-Chang Chen, Damon de Ia Cruz, Jerry Lin, Julie Mayer, Maksim plikus, Michael Hughes, Sam Wu, Simon Tsai, Syuzanna Avetyan. 111 Current members: Cathleen Chiu, Erin Weber, Gary Lai, Frank Luo, Jie Yan, Joe Yeh, Mason Lei, Ping Wu, Ting-xin Jiang, Sharon Jiang, Stephanie Tsai. I am grateful for the technical support and advice from the the Cell and Tissue Imaging Core of the University of Southern California Research Center for Liver Disease; Imaging core of the Eli and Edythe Broad Center for Regenerative Medicine and Stem Cell Research at USC; USC Epigenome Center; and Yi-Bu Chen and Meng Li of the USC Norris Medical Library Bioinformatics Service. Part of my research funding comes from Wen-Hui Chen Scholarship and CIRM pre-doctoral trainee grant and I would like to thank them for their support. Last but not least, I would like to thank my parents for their long term support. !V Tables of Contents Dedication u Acknowledgements 111 List of Tables vu List of Figures vm Abstract XI Chapter 1: Overview and introduction 1 1.1 Studying pattern formation in the feather model 1 1.2 Studying evo-devo in the feather model 7 Chapter 2: Determination of anterior-posterior polarity by a Wnt/Notch/ 12 nonmuscle myosin module in feather buds 2.1 Introduction 2.2 Materials and methods 2.3 Results 2.3.1 Transplantation experiments reveal localized polarizing activity within the posterior feather bud 2.3.2 Identifying cellular and molecular activities present in the polarizing zone during the time of oriented bud elongation 12 14 18 18 19 2.3.3 Perturbation of the dermal nuclear ~-Catenin positive zone causes 24 random orientation of feather buds 2.3.4 Dermal nuclear ~-Catenin activates nonmuscle myosin liB expression to mediate polarized cell rearrangement 2.3.5 Notch signaling is activated by the nuclear ~-Catenin positive dermis and sustains the DBZ through a positive feedback loop 2.3.6 Notch signaling converts the highly variable Wnt gradient into a spatially well-defined, localized nuclear ~-Catenin dermal response 27 32 35 2.4 Discussion 41 Chapter 3: Modulation of bilateral asymmetry and vane width by Greml 48 and RA signaling in feather follicles v 3.1 Introduction 48 3.2 Materials and methods 50 3.3 Results 55 3.3.1 Morphological parameters affecting feather vane width/asymmetry 55 3.3.2 Transcriptome analyses of medial and lateral feather vanes reveal 58 several differentially regulated pathways 3.3.3 Grem1 defines the spatial distribution of barb generative zone 58 3.3.4 RA pathway is differentially regulated in asymmetric feather vanes 62 3.3.5 Mathematical model links molecular activity to cellular events and 65 organ shapes 3.4 Discussion 70 Chapter 4: Conclusions and perspectives 79 Bibliography 83 Vl List of Tables Table 2.1: Equations simulating Wnt-Notch crosstalk Table 2.2: Simulation parameters for the Wnt-Notch crosstalk model Table 3.1: Simulation parameters for the activator-inhibitor model Table 3.2: Mean tortuosity and its effect on diffusion Table 3.3: Statistics summary 38 41 68 69 73 Vll List of Figures Figure 2.1: Exchanging different parts of feather buds indicates that the nuclear 19 ~-catenin positive dermis bears polarizing activity Figure 2.2: Characterization of ~-catenin pattern and cell proliferation during the 20 early stages of feather development Figure 2.3: A zone of nuclear ~-catenin positive cells is localized to posterior 21 dermis during feather bud elongation. This zone has high levels of NM liB and Jagl. Figure 2.4: Stages of feather bud development and corresponding NM liA, NM liB, 23 SMA expression patterns, actin network alignment Figure 2.5: Misexpression of stabilized ~-catenin caused drastic feather misorientation and up-regulation ofNM liB and Jag1 Figure 2.6: Dermal cell proliferation and apoptosis do not show high spatial correlation with nuclear ~-catenin positive cells 25 26 Figure 2.7: Endo-IWR1 inhibited feather bud elongation and down-regulatedjag1 28 and NM liB levels. Blebbistatin inhibits the misoriented elongation upon RCAS-~-catenin treatement Figure 2.8: Blocking NM liB function disrupted fibroblast migration patterns in 30 vitro and inhibited feather bud elongation in vivo Figure 2.9: Mis-expression of Notch intracellular domain does not significantly 32 change feather elongation orientation Figure 2.10: Inhibition of Notch signaling by DAPT causes drastic feather misorientation and dose-dependent inhibition of bud elongation. Meanwhile DBZ nuclear ~-catenin and NM liB level are dramatically decreased 32 Figure 2.11: Dual dye tracking experiment shows mesenchymal cells can move 34 in the direction perpendicular to the bud elongation orientation Figure 2.12: Mathematical modeling of Wnt-Notch cross-talk simulates the change 35 from a noisy, gradual Wnt gradient to a definitive threshold Wnt response V111 Figure 2.13: The Wnt-Notch cross-talk model with the addition of another modulator X Figure 2.14: Summary of the core and modulatory molecular modules for polarized elongation during feather bud morphogenesis 38 42 Figure 3.1: Stepwise diversification of feather forms and the characterization of 57 bilateral asymmetric remiges Figure 3.2: Differentially expressed genes in wide/narrow vaned contour feathers 57 and bilaterally asymmetric flight feathers Figure 3.3: Helical growth angles are differentially regulated in different feather 59 forms Figure 3.4: Comparing transcriptome of the lateral and medial half of chicken 60 . . pnmary rem1ges Figure 3.5: Sostdcl, Aldh6, Greml expression and pSmadl/5/8 distribution in 61 different feather forms Figure 3.6: Greml is the key factor specifying the location and width of barb generative zone 62 Figure 3.7: Applying exogeneous Greml induces BGZ morphology and decreases 63 cell proliferation Figure 3.8: Endogenous BGZ show lower cell proliferation rate than other epithelial components 64 Figure 3.9: Differential distribution ofCrabpl nuclear localization in the four 64 feather forms Figure 3.10: Exploring potential cross-talks between Greml and RApathway 66 Figure 3.11: Retinoic acid signaling modulates epithelial cell shape, barb-rachis 67 angle, and feather vane width Figure 3.12: Effect ofRA perturbation on helical growth angle, epithelial cell shape and Greml expression 67 !X Figure 3.13: Mathematical modeling reveals how Greml and RA signaling modulate the basic periodical branching mechanism 68 Figure 3.14: Narrower and wider vanes in the same type of feather have differential 69 epithelial cell shapes Figure 3.15: Changing inhibitor's diffusivity has little effect on the helical growth 70 angle Figure 3.16: Cell proliferation rate, apoptosis and differentiation events in feathers 71 Figure 3.17: Integration of boundary-organized patterning with self-organized 77 patterning during feather form diversification X Abstract During development, epidermal appendages like feathers and hairs can self-organize into patterns with characteristic distribution and orientation. Adult feathers, hairs also exhibit amazing regeneration ability. In addition, adult feathers show tremendous diversity of size, shape and color pattern through space (body regions) and time (season, physiological developmental stages). These features make epidermal appendages favorable systems for studying periodical pattern formation (Chuong eta!., 2013), organ shaping (Hughes et a!., 2011), stem cell activity regulation (Lin et a!., 2013) and evolutionary developmental biology (Evo-devo) (Wu et a!., 2004). My Ph.D. research includes two projects exploring the molecular and cellular mechanisms for establishing organ polarity using feather as the model system. Project 1 is aimed to answer how feather buds on chicken embryos precisely specify their elongation orientation along the body anterior-posterior axis. Project 2 is aimed to understand how the primary flight feathers on adult birds acquire the unique bilateral asymmetric shape. In development, a feather bud grows from dome-shaped primordia into thin conical structures with an anterior- posterior axis of specific orientation. From a systems biology perspective, the process is precise and robust. Using tissue transplantation assays, we demonstrate that the polarizing activity to mediate directional elongation is localized in the posterior feather bud. This region contains a spatially well-defined nuclear ~-catenin zone (3-5 cell layer thick), which is induced by wingless-int (Wnt)7a protein diffusing in Xl from posterior bud epithelium. Misexpressing constitutively active ~-catenin randomizes feather polarity. This dermal nuclear ~-catenin zone, surrounded by Notchl positive dermal cells, induces Jagged!. Inhibition of Notch signaling disrupts the spatial configuration of the nuclear ~-catenin zone and leads to randomized feather polarity. Mathematical modeling predicts that lateral inhibition, mediated by Notch signaling, functions to reduce Wnt7a gradient variations and fluctuations to form the sharp boundary observed for the dermal ~-catenin zone. This zone is also enriched for nonmuscle myosin liB. Suppressing nonmuscle myosin liB disrupts directional cell rearrangements and abolishes feather bud elongation. These data suggest that a unique molecular module involving chemical-mechanical coupling converts a pliable chemical gradient to a precise domain, ready for subsequent mechanical action, thus defining the position, boundary, and duration of localized morphogenetic activity that molds the shape of growing organs (Li eta!., 2013). In adult birds, feathers exhibit great diversity of shapes. Among them, the bilateral asymmetric flight feathers attached to the wing greatly facilitated the evolution of powered (flapping) flight in feathered non-avialan dinosaurs and basal Aves. Here we explore the molecular and cellular mechanisms underlying feather form diversification, with focus on bilateral asymmetric vane formation in flight feathers. We identified the spatial distribution of barb generative zone (BGZ) and sharpness of barb-rachis insertion angles are two morphological parameters that can modulate feather vane width. xn Through transcriptome profiling and candidate analysis, we further identified two distinct molecular processes regulating the above parameters: (i) localized mesenchymal Greml inhibits BMP signaling in adjacent epithelium to define BGZ spatial distribution and decreases cell proliferation; (ii) Differentially regulated mesenchymal RA signaling modulates epithelial cell shapes and barb-rachis angles to adjust vane width. We applied mathematical modeling to propose mechanisms linking the above phenotypes and demonstrate the integration of novel mesenchymal-epithelial interactions with basic epithelial branching mechanism can generate diverse feather forms, paving the road for the evolution of flight. X111 Chapter 1 Overview and Introduction 1.1 Studying pattern formation in the feather model Pattern formation and organ shaping are fundamental issues for developmental biology and tissue engineering (Chuong and Richardson, 2009). With today's advancement of stern cell biology it is no longer difficult to acquire pluripotent stem cells (e.g. embryonic stem cells, induced-pluripotent stem cells (Takahashi eta!., 2007)) and induce lineage-specific differentiations. However, it is still challenging to engineer a multi-tissue organ with shape, polarity and cell layout comparable to ontogenetically developed ones. Skin appendages such as hairs and feathers provide a convenient platform to study the cellular and molecular mechanisms underlying pattern formation and organ shape regulation because: (i) they develop close to the skin surface and hence are easy to observe and manipulate; (ii) their primordia self-organize into periodical distribution with characteristic spacing; (iii) their growth exhibit precise orientations with respect to the body axes; (iv) their size, shape and color (especially those of feathers) could have great diversity through space (body regions) and time (seasons, physical developmental stages). Feather morphogenesis can be divided into five stages (Lin et a!., 2006): (i) Macro-patterning stage in which feather tracts form at discrete body regions; (ii) Micro-patterning stage in which feather placodes periodically emerge within the tracts; (iii) Intra-bud morphogenesis stage in which the anterior-posterior and proximal-distal polarity of feather bud are established; (iv) Follicle morphogenesis stage in which the dermal papilla and epithelial stem cell niche form. Periodical branching of barbs becomes observable; (v) Regenerative cycling in which the oscillating activities of the feather epithelial stem cells (modulated by intrafollicular and extrafollicular signals) drive the cyclic molting and regeneration of feathers. During the macro-patterning stage, the formation of feather tracts is initiated by increasing the density of dermis at discrete body regions. Cell migration is believed to be a main contributor to dense dermis formation. Molecules like Wntl, BMP2, Dermo-1 have been implicated to play a role in this process (Lin et a!., 2006). The feather tracts exhibit bilaterally distribution with respect to body midline and hence are likely to be mediated by boundary-organized patterning mechanisms (cell behaviors are determined by their positions to fixed landmarks (Lander, 2011) ). Previous studies have implicated HoxC8 and HoxD13 in specifying the dorsal feather tract and foot scale tract, respectively, in chick embryo (Kanzler et a!., 1997). Some other Hox genes also show regionally restricted expression pattern in embryonic chicken skin. These results are consistent with the idea that Hox genes convey body positional information. However, functional experiments directly supporting the role of Hox genes in specifying chicken skin regional specificity are still vacant. During the micro-patterning stage, feather primordium (composed of the epithelial 2 placode and the underlying dermal condensation) emerge m waves within the feather tracts. In the dorsal tract, the morphogenetic wave spreads in a bilateral symmetric manner from the dorsal midline. In the femoral tract, the wave spreads in caudal to rostral direction. Propagation of the feather morphogenetic wave itself is not essential for periodic feather primordial formation because feather explants reconstituted in vitro from dissociated mesenchymal cells re-form periodically positioned feather primordia simultaneously (Jiang et a!., 1999). Thus the morphogenetic wave of feather primordia formation is a process integrating boundary-organized patterning onto self-organized patterning (cell behaviors are determined by the simple rules of local molecular or cellular interactions). The molecular basis of the feather morphogenetic wave is still unclear today. In contrast, the self-organized periodical formation of feather primordia has been comprehensively investigated. A classic theory to explain self-organized patterning was proposed by Turing (Turing, 1952). In this model, periodic patterns can arise from a homogeneous chemical state through interaction between a pair of factors (activator and inhibitor) diffuse at different diffusion rates. The slower diffusing activator is autocatalytic and can induce the production of the inhibitor. While the faster diffusing inhibitor negatively feedback to the production of the activator. Our lab discovered that FGF and BMP serve as an activator/inhibitor pair (not necessarily the only one) in the process of periodical feather primordial formation. FGF4 bead treatment of E6 chicken skin caused bud fusion (i.e. turning the original interbud region into bud region) (Jung et 3 a!., 1998). FGF2 bead treatment induced dermal condensation formation in denuded E8 scaleless chicken (lack of almost all feathers, scutate scales and spurs) dermis and even caused E7 scaleless chicken skin to grow feather buds (Song et a!., 2004). Genomically the scaleless phenotype is associated with a nonsense mutation in FGF20, which is also expressed in the epithelium during early feather bud patterning (Wells eta!., 2012). FGF4 induces local expression ofBMP4, which negatively feedback to the expression ofFGF4. Bead delivery of BMP4 locally inhibited feather bud formation and hence it works as the inhibitor in this process. BMP2 protein also has suppressive effect on feather bud formation (Jung et a!., 1998). Another inhibitor, BMP12, has elevated expression in naked neck chicken due to genetic mutations. Naked neck chicken has reduced body feathering and a complete bare neck. The more prominent suppression of feather bud formation in the neck region by BMP12 is caused by regional specific elevation of RA signaling. The neck region expresses more RA synthetase (RALDH2/3) during the early feather bud formation period. Treating E7 skin culture with RA and RA antagonist altered the skin's sensitivity to BMP's inhibition of bud formation, indicating endogenous RA level endows a cryptic mechanism for regulating feather bud patterning (Mou et a!., 2011). Another group of regulators for feather bud patterning is the TNF receptors Edar, Troy and Xedar. Eda signaling is implicated to be important for skin appendage development through the study of the genetic lesions causing hyophidrotic ectodermal dysplasia (HED) in mouse and human (Kere et a!., 1996; Thesleff and Mikkola, 2002). 4 All three receptors are expressed during early feather bud morphogenesis. Mis-expressing the dominant negative forms of each receptor impair the epithelial contribution to feather bud morphogenesis while has no apparent effect on the dermal condensation. Mis-expressing constitutively active forms of each receptor led to alteration of feather bud density and size (Drew eta!., 2007). Furthermore, the cell-cell interactions through Notch signaling have also been implicated in modulating feather primordia formation. One crucial evidence is that the mis-expression of Notch ligand Dlll can suppress feather primordial formation. Yet the effect of Dlll is stage dependent. Elevating Dlll expression in feather buds after the primordium stage increase feather bud size (Crowe et a!., 1998). Another study from Dhouailly's group indicates Notch pathway may interact with Integrin to stabilize dermal condensations (Michon et a!., 2007). In the next morphogenetic stage the feather primordium has to polarize and elongate in a specific direction to become the filament-like feather bud. Many genes are known to show polarized expression patterns at this stage, such as Wnt7a, Wnt5a, Wntll, Notch1, Jag1, Dlll, Shh etc (Chang et a!., 2004; Chen et a!., 1997; Ting-Berreth and Chuong, 1996; Widelitz et a!., 1999). In reconstitution assay Wnt7a mis-expression resulted in "posteriorizing" of the feather bud, meaning these buds have diffused expression of posterior bud markers such as Dill and Jag], as well as reduced expression of anterior bud markers such as Tenascin-C (Widelitz et a!., 1999). A recent study by me and my collaborators indicate Wnt, Notch and non -muscle myosin liB form a molecular module 5 that precisely demarcate a zone of polarized cell rearrangement in the posterior bud, guaranteeing the directional elongation to feather buds. This work will be described in detail in Chapter 2. The feather buds not only grow outward but also dig into the skin to form the follicle structure. The follicle structure enables further elongation of the feather filament and also provides housing for feather epithelial stem cells in preparation of future regeneration. Follicle formation is mainly achieved through feather bud epithelium invagination. One of our recent works show the treatment of chicken skin explant with ephrin-B1-Fc (perturbing eph/ephrin signaling) resulted in incomplete follicle invagination with less compact dermal papillae (Suksaweang eta!., 2012). Ephrin and their receptors, Ephs, are cell membrane molecules widely known to be involved in cell-cell interactions through cell adhesion and repulsion (Patan, 2004). Other molecules related to cell adhesion and migration, such as Tenascin-C, NCAM are also highly expressed in the mesenchyme next to the invaginating feather epithelium (data not shown because it is unpublished). However the detailed mechanisms of how invagination occurs are still unclear. The feather follicle consists of two major components: the epithelium and mesenchyme. The follicle epithelium can be generally divided into four parts based on their distinct cell behaviors during feather growth and regeneration: papillary ectoderm, collar bulge, ramogenic zone and barbs. The papilla ectoderm is tightly connected with the dermal papilla and is preserved both in the growing and resting phases (Lucas and Stettenheim, 1972). Latent feather epithelial stem cells are believed to reside in papilla 6 ectoderm and lower follicle sheath. These stem cells will be activated upon emergency cases such as forceful removal of feather during growing phase. The collar bulge is where feather epithelial stem cells reside during growing phase and these cells are arranged in a ring configuration, giving rise to transit amplifying progeny who gradually move vertically upwards (Yue et a!., 2005). Ramogenic zone is where the epithelial cylinder is periodically divided into barb and inter-barb regions. The barbs will further differentiate through keratinization while the inter-barb cells will perish, possibly through apoptosis (Chang et a!., 2004). The follicle mesenchyme is composed of the dermal papilla and pulp. The dermal papilla is a permanent structure, while the pulp cyclically grows in the growing phase and regresses as feathers enter the resting phase. These mesenchymal components are known to contain signals modulating feather phenotypes such as the pigmentation pattern (Lin eta!., 2013). The cyclic molting/regeneration of feather not only enables replacement of damaged skin appendages but also alteration of the appendage phenotype to adapt to seasonal needs or changes of physiological developmental stages, which is a phenomenon known as metamorphosis. Currently the molecular basis of metamorphosis is not clear but systematic factors such as sex hormones are suggested to play a role. 1.2 Studying evo-devo in the feather model Evo-devo is a type of interdisciplinary research exploring the mechanistic relationships between the processes of individual development and phenotypic change 7 during evolution (Muller, 2007). Feather is believed to derive from squamate scales (Dhouailly, 2009) and later evolved a variety of shapes, pigmentation patterns carrying out different functions. During the last 15 years, the jointed efforts between paleontologists, developmental biologists, evolution biologists and mathematicians enabled the mapping of feather form evolution trajectory as well as some of the underlying morphogenetic principles and molecular mechanisms. Since 1996 multiple non-avian dinosaurs with different feather or feather-like integuments have been discovered one after another, mainly from Jehol Biota at Northeast China. Although debates about the true identities of these filamentous structures never stopped (Lingham-Soliar et a!., 2007), these structures, in the morphology aspect, are indeed congruent with the transitional stages described in the feather form diversification model proposed by developmental biologists (Chuong eta!., 2003; Prum, 1999). In this model three major transition events occurred in sequence during feather form diversification: (i) from a cylindrical filament to radially symmetric branched feathers (e.g., downy feathers); (ii) from radially symmetric to bilaterally symmetric feathers (e.g., contour feathers); (iii) from bilaterally symmetric to the most advanced, bilaterally asymmetric feathers (e.g., flight feathers or remiges). Besides these macro-scale morphological changes, there are also micro-scale structural modifications taking place, such as the branching of barbs into barbules and rami, specialization of barbule pennulum and base, and the differential morphogenesis of proximal and distal barbules. Fossils of unbranched, cylindrical feather-like structures 8 were found on Psittacosaurus (Mayr et a!., 2002), Sinosauropteryx (Chen et a!., 1998), Beipiaosaurus (Xu et a!., 2009). The filamentous structures in Psittacosaurus and Beipiaosaurus are rigid and thick "bristles" possibly hollow in the center. The unbranched filaments, such as the bristle-like structures mentioned above and the elongated ribbon-like tail feathers on Epidexipteryx (Zhang et a!., 2008) may be specialized decorative appendages that have no direct relationship with modern feathers. Epidexipteryx also has a type of non-shafted feather composed of parallel barbs closely united as an unbranched membranous structure. It may be a transitional form between the singular filaments and downy feathers. Fossils of radially branched, downy feather like integuments were found on Sinornithosaurus (Xu eta!., 2001), Beipiaosaurus (Xu eta!., 1999), Protarchaeopteryx and Caudipteryx (Qiang eta!., 1998), Dilong (Xu eta!., 2004) and possibly also on Shuvuuia (Schweitzer et a!., 1999), Yutyrannus (Xu et a!., 2012). Clearly vaned pennaceous feathers (contain rachis) were found on Caudipteryx, Protarchaeopteryx (Qiang et a!., 1998), Pedopenna (Xu and Zhang, 2005), Anchiornis (Hu eta!., 2009), Similicaudipteryx (Xu eta!., 2010) and possibly also onXiaotingia (Xu et a!., 2011) as well as a type of Ornithomimus discovered in Canada (Zelenitsky et a!., 2012). Bilaterally asymmetric flight feathers were found on Microraptor (Xu eta!., 2003) and most Avialae (such as Archaeopteryx (Feduccia and Tordoff, 1979)). On the molecular aspect, to explain the periodical branching of downy feathers a Turing type of activator/inhibitor model was proposed (Harris et a!., 2005) and the molecular identities of the activator/inhibitor are explored by functional perturbation 9 experiments. Mis-expressing BMP2 and BMP4 caused barb fusion (rachis enhancement) while mis-expression of the BMP antagonist Noggin promoted further branching of barbs. Meanwhile antisense Shh mis-expression or cyclopamine treatment produces fused feather vanes and decreases marginal cell apoptosis (Yu eta!., 2002), hence Shh and BMP may act as the activator and inhibitor to regulate the feather branching periodicity and barb/rachis ratio. Transition from radially symmetric downy feathers to the bilaterally symmetric pennaceous feathers is basically setting up new polarity in the organ. We observed the feather epithelial stem cells form a horizontal ring within proximal follicle in downy feathers (Yue et a!., 2005) but tilted downward anteriorly (rachis side) in pennaceous feathers. An endogenous Wnt3a gradient in the anterior-posterior direction is involved in setting up the polarity as over-expression of Wnt3a can convert pennaceous feathers to a downy feather-like appearance (Yue eta!., 2006). Bilaterally asymmetric flight feathers are an evolution novelty adapting to powered flight in feathery dinosaurs and basal Aves. Yet the cellular and molecular mechanisms sculpturing this shape remain unknown. In one of my recent work, I and my collaborators recruited systematic transcriptome profiling, candidate gene characterization and functional perturbations, as well as mathematical modeling to show how Greml and RA signaling modulate the position of barb generative zone (BGZ) and barb-rachis angles to adjust the level of bilateral asymmetry and feather vane width. This work will be described in detail in Chapter 3. Another interesting issue of feather evo-devo study is whether the scales on the avian 10 feet today are homologous to the scales of reptiles or secondarily derived from feathers. In fossil record, many feathery dinosaurs and basal birds have long feathers attached to the tarsometatarsal regions. During chicken embryonic development, many reagents can cause growth of feathers from the originally scaled regions on the feet, including constitutively active ~-catenin, RA, Dlll, Grem1, dominant negative-Type I BMP receptor, etc (Dhouailly, 2009; Fisher et a!., 1988; Widelitz et a!., 2000; Zou and Niswander, 1996). However up-till-now no reagent can induce scutate scales to form in feather tracts. Hence it was proposed that the scutate scales covering the tarsometatasus and dorsal surface of digits are secondarily derived from feathers. 11 Chapter 2 Determination of anterior-posterior polarity by a Wnt/Notch/nonmuscle myosin module in feather buds 2.1 Introduction During their morphogenesis, each organ must be oriented and shaped properly. To achieve this, progenitor cells in organ primordia are guided to coordinated orientation and self-regulated size and shape by tissue interactions (Slack, 2008). Our lab have proposed a general scheme where multiple localized activity modules in organ primordia can serve as the foundation to generate complex patterns and shapes (Chuong et a!., 2012). Different cellular activity modules can be based on highly localized physical processes such as cell polarity, rearrangement, proliferation, apoptosis, and differentiation. The number, size, position, duration, and spacing of these activity modules can converge to form a spectrum of organ designs suitable for different physiological stages or adaptation to evolutionary needs (Chuong eta!., 2012). In avian skin development, the emergence of multiple cell condensations leads to the periodic arrangements of feather germs. Localized growth zones increase cell numbers producing organ elongation in a directed fashion to begin to shape avian beaks (Wu eta!., 2004) and skin appendages (Chodankar et a!., 2003). During feather branch formation, alternating localized differentiated/apoptotic modules in feather filament epithelia become barbs and interbarb space (Yu et a!., 2002), further configuring the final feather shape. The boundary and 12 durations of these different activity modules can work in coordination to build and sculpt complex architectures during organ development and regeneration. These activity modules are likely to be initiated by morphogen gradients emitted from organizers that specify axial polarity, first in the body axis and later in organ primordia (Wolpert and Tickle, 2011 ). Remarkable examples of morphogen gradients regulating activity modules have been identified in the specification of the anterior-posterior (A-P) axis by a decapentaplegic gradient in the Drosophila wing (O'Connor eta!., 2006) and a sonic hedgehog gradient in the limb bud zone of polarizing activity (Riddle eta!., 1993). How an early chemical morphogenetic signal is converted to multicellular mechanical processes and how its performance can be adjusted was studied in a chicken feather model. Feather primordia on embryonic chicken dorsal skin autonomously elongate with a common orientation along the original body A-P axis in vivo and in cultured skin explants. These observations suggest the feather elongation process is both precise and robust. In chickens, individual feathers appear on the dorsal skin as a local epithelial thickening around Stage 29 (St. 29) (Hamburger and Hamilton, 1951). Soon afterward the underlying dermis condenses to form a round, radially symmetric feather primordium. This early stage feather bud first grows radially during the symmetric short bud stage. The bud apex then shifts posteriorly during the asymmetric short bud stage. The feather bud continues to elongate and its height exceeds its diameter (long bud stage). At this point the bud tilts caudally. After the long bud stage the feather invaginates and develops its follicle structure (follicle stage). Through this series of morphological changes A-P 13 and then proximal-distal (P-D) axes emerge in the feather buds. Previous efforts to unveil the molecular mechanism of feather polarity revealed dynamic molecular expression patterns from the short symmetric bud stage to the follicle stage. In general, these expression patterns show three domains within the bud: anterior, central, and posterior. BMP2 is in the anterior epithelium and BMP4 is in the anterior mesenchyme (Noramly and Morgan, 1998). Notch] is in the central mesenchyme and Dill is in the posterior mesenchyme (Chen eta!., 1997; Viallet eta!., 1998). Wnt7a is in the posterior epithelium (Widelitz eta!., 1999). However, two critical questions remain to be answered. How do these pathways cross-talk with one another? How does this cross-talk network regulate cell behavior to produce oriented bud elongation? The study here sheds light on these issues. 2.2 Materials and methods Materials Charles River pathogen-free chicken embryos were staged (Hamburger and Hamilton, 19 51) before use. Section and Whole-Mount In Situ Hybridization. Probes: cNotchl, cDeltal, and cSerratel (Myat et a!., 1996). RCAS (Crowe and Niswander, 1998). cHeyl probe was cloned using the following primers: Sense: AAGCTGGAGAAAGCCGAGAT; Antisense: TTTGCCAAGGTTTGCTGAT. The whole-mount and paraffin section in situ hybridization were done as described (Jiang 14 et a!., 1998). Staining was visualized usmg either chloro-3-indolyl-phosphate/nitro blue tetrazolium (blue) or Vector Red (red). Section and Whole-Mount Immunostaining 5-bromo-4- Immunostaining antibodies: ~-catenin (Sigma, 15b8 monoclonal for quantification; C-2206 for normal immunefluorescence); Wnt-7a (Abeam, abl00792); NM liB (Hybridoma Bank, CMII 23); Phalloidin-FITC (Sigma,P-5282); proliferating cell nuclear antigen (PCNA, clone PC 10 DAKO); BrdU (Abeam, ab8955); smooth muscle actin (Sigma, A5228). RCAS (Hybridoma Bank, AMV-3C2); TUNEL kit (Roche applied sc1ence, 11684817910). Immunostaining follows our published method (Jiang et a!., 1998). Secondary antibody was Alexa Fluor 488 or Alexa Fluor 594 labeled. Chromatin Immunoprecipitation. We used the protocol modified from R&D systems ExactaChiP ~-catenin chromosome immunoprecipitation (ChiP) manual. The primers for PCR: WRE sense: GCTTGCACAACTTCCACTGA; WRE antisense: TGGAAGTGCAAAGTCTTGGA. Short-Term BrdU Labeling For short-term BrdU labeling (Sigma, catalog no. B5002), 10 JlL of 1% BrdU was injected into the vein 4 h before embryo collection. The sample was then fixed in 4% paraformaldehyde overnight before further treatment. Confocal Imaging A Zeiss LS51 0 confocal microscope was used to image the fluorescently labeled specimens. Z-stack images were captured and processed in the Zeiss Laser Scanning 15 Microscope Image Browser software. Electroporation Electroporation was performed as described (Jiang et a!., 1998). The embryo was exposed to three electric shocks at 16 V, 1 s interval between each shock (BTX ECM 830). Plasmids: RCAS-~-catenin was a gift of C. Tabin (Harvard University, Boston). RCAS-NICD, the chicken Notch1 intracellular domain coding region, was inserted into Replication Competent Avian Sarcoma Virus Bryan Polymerase subtype Y destination vector using the Invitrogen Gateway system. Skin Explant Culture and Drug/Bead Treatment, Transplantation of Different Parts of Feather Buds, and EMRR Explant cultures were performed as described (Ting-Berreth and Chuong, 1996). Transplantation experiments: Part of unlabeled feather buds at symmetric short bud stage were removed from the explant and replaced with a region from a Dii- (3 mM) labeled explant (same stage). Drug treatment: the indicated concentrations of Blebbistatin, Y27632 or DAPT (Tocris) dissolved in DMSO were added to the explant culture media. Bead experiments: Affi-Gel Blue (Bio-rad) beads soaked with BSA(lOmg/mL) or Wnt7a protein (PeproTech 120-31) were put on E7 dorsal dermis and cultured for 24 h. EMRR experiments were performed as described (Chen eta!., 1997). Cell Tracking on Skin Explant and Time-Course Imaging of Cell Behavior Invitrogen Vybrant 5-Carboxyfluorescein Diacetate cell tracer (25 11M) was injected into anterior or posterior feather bud dermis at the late symmetric short bud stage and 16 observed for 4 d. For dual dye tracking experiments, Invitrogen Qtracker 625 and Vybrant cell tracer were injected into two different spots at posterior bud mesenchyme and images were taken every 6 h. For in vitro cell culture, RCAS-~-catenin electroporated chicken embryo fibroblast cells were treated with 10 11M Blebbistatin or DMSO for controls. Cell movements were tracked with a Leica DFC300 FX camera. Statistics Paired sample T test, and independent two-sample T test and angular histogram plots were done with MATLAB 7. Statistics for Figure 2.81 were calculated as follows: The movements of 25 cells picked randomly from each of 6 views were analyzed. "Severe direction change" is defined as a sudden change in direction between 45° and 135°, which is maintained for at least 100 Jlffi. Morphogen Gradient Measuring and Modeling Wnt7a and ~-catenin confocal images were analyzed with Fiji. A line (width ~ 50) was drawn from the posterior epithelial-mesenchymal boundary toward the center of the bud. Plot Profile recorded the signal intensity along this axis. The influence from Wnt7a to DBZ is modeled using a Hill function, supported by the observation that there is the positive and reinforcing feedback loop from Lef-1 to Wnt7a (56). The Wnt-Notch cross-talk relationship was based on prev1ous compartmental models (31 ). All simulations were performed using MATLAB. 17 2.3 Results 2.3.1 Transplantation experiments reveal localized polarizing activity within the posterior feather bud To investigate where feather bud polarizing activity resides during bud growth, we exchanged different parts of late symmetric short bud stage feather buds on chicken embryonic skin explants. The donor dermis was 1,1 '-dioctadecyl-3,3, 3 '3 '-tetramethylindocarbocyanine perchlorate (Dii) labeled. Anterior-to-anterior (n ~ 4) or posterior-to-posterior (n ~ 5) transplantation did not alter feather bud elongation (Figure 2.1A-B). Replacing a posterior bud region with an anterior bud abolished bud growth (Figure 2.1 C; 48 h; n ~ 8). In contrast, replacing the anterior region with a posterior region caused the chimeric bud to grow two tips 180° apart after 48 h (Figure 2.1D; 48 h; n ~ 14). Replacing the left lateral half of a feather bud with a Dii-labeled posterior bud caused the chimeric bud to develop two tips oriented about 90° apart (Figure 2.1E; n ~ 12). In these dual tipped feather buds, tip orientations are consistent with those of the original and transplanted posterior buds. 18 ... -... . ...... ..... _ .. . ... ' - ' ..... Figure 2.1: Exchanging different parts of feather buds indicates that the nuclear ~-catenin positive dermis bears polarizing activity. (A-E) Exchanging different parts of feather buds. Chimeric bud morphology observed 48 h after surgery. Blue: transplant donor site. Green: transplant recipient site. (Red) Dil-labeled donor tissue. (Scale bar: 250 J.Ull.) (A) Anterior-to-anterior transplantation. (B) Posterior-to-posterior transplantation. (C) Replacing posterior bud with anterior bud. (D) Replacing anterior bud with posterior bud. (E) Replacing left lateral bud with posterior bud. (C- E) Confocal images of the corresponding chimeric buds stained for ~-catenin 14 h after surgery. (F) Summary of EMRR experiments. A- P axis orientation for epithelium (red arrows) and dermis (blue arrows). (G) St. 34 chicken embryo dorsal skin cultured for 72 h after EMRR shows bifurcated orientation(*). (Scale bar: 1 mm) (H) Same stage specimen Jag1 cultured 20 h after EMRR. Arrows: nuclear ~-catenin positive dermis and up-regulated nonmuscle myosin (NM) liB. (H') and (H") show the ~-catenin and NM liB pattern, respectiv ely. (Scale bar: 50 f.Lm) (I) Jagl expression increases at the location of nuclear ~-catenin positive dermis (*). (Scale bar: 500 J.Ull) 2.3.2 Identifying cellular and molecular activities present in the polarizing zone during the time of oriented bud elongation Previously we found that the earliest feather polarity cues come from the epithelium during development (Chen et al., 1997). Endogenous Wnt7a was expressed in the posterior bud epithelium during the symmetric short bud stage. Ectopic expression of Wnt7a caused "posteriorization" of both feather bud morphology and molecular expression (Widelitz et al., 1999). Our past and present findings suggest that the Wnt7a expressing posterior epithelium is the potential signaling center directing feather bud growth. Nuclear ~-catenin positive cells were also observed during normal feather bud development (Noramly et al., 1999). We examined the subcellular localization of 19 ~-catenin in feather buds from the symmetric short bud stage to the early follicle stage (Figure 2.2A-D). Nuclear ~-catenin positive cells are observed in posterior bud dermis beginning in the symmetric short bud stage. Their number increases throughout the asymmetric short bud and early long bud stage and decreases rapidly thereafter (Figure 2.3B). Confocal microscopy at the asymmetric short bud stage and early long bud stage showed the dermal nuclear ~-catenin zone (DBZ) is crescent shaped with relatively homogeneous intensity. On the edge of this crescent the intensity of nuclear ~-catenin drops precipitously (sharp boundary) (Figure 2.3A). Interestingly, in the transplantation experiments described above, buds without DBZs did not elongate (Figure 2.1C; 14 h). Buds with two DBZs developed two separate distal ends (Figure 2.1D-E; 14 h). These observations imply a correlation between the DBZ and feather polarizing activity. !Katenin DAPI A " ' B " I ' " ' " 0 ' . . . . ~ '.' . Figure 2.2: Characterization of J}-catenin pattern and cell proliferation during the early stages of feather development. (A-D) ~-catenin staining on sagittal sections of feather buds at symmetric short bud stage, asymmetric short bud stage, long bud stage, follicle stage, respectively. Arrows: nuclear ~-catenin positive dermis. Arrowheads: nuclear ~-catenin positive epithelium. Dashed line: epithelial sheet invagination (Scale bar 50 Jlm). Panel B and C are also used in Fig. 2C, C' . (A'-D') 4h BrdU-labeling shows proliferating cells in feather buds of corresponding stages. Nuclear ~-catenin positive cells were also observed in anterior bud epithelium before the long bud stage (Figure 2.3C and Figure 2.2A-B; arrowheads). However, three observations suggest this epithelial nuclear ~-catenin zone may not contain polarizing 20 activity. First, in skin explants epithelial nuclear ~-catenin diminishes to undetectable levels at the symmetric short bud stage whereas the buds can still elongate. Second, growth can be disrupted whereas the epithelial nuclear ~-catenin zone remained intact (e.g., culturing skin in media containing 5 ~LM DAPT, a y-secretase inhibitor). Finally, the epithelial nuclear ~-catenin zone diminishes in area from the symmetric short bud stage (Noramly et al., 1999) and completely disappears by the long bud stage. The temporal and spatial dynamics of this zone (Figure 2.30) suggest that it is likely involved in morphogenetic events occurring before bud elongation. c· I Jl . I Jl F' / G • Nuclear j3-catentn postive cells :·~··:~-ifl~ Figure 2.3: A zone of nuclear J}-catenin positive cells is localized to posterior dermis during feather bud elongation. This zone has high levels ofNM liB and Jagl. (A) Confocal pictures ofE8 chicken embryo dorsal skin feather buds at the asymmetric short bud stage show nuclear P-catenin positive dermis. Green boxes show the magnified region. Ep, epithelium; Me, mesenchyme. (Scale bar: 50 f.Lm and 20 f.lffi, respectively.) (B) Counts of dermal cells with nuclear accumulated J3-catenin from sagittal sections of feather buds at the symmetric short bud stage, asymmetric short bud stage, long bud stage, and follicle stage. For each stage n = 12. (C) and (C') J3-catenin staining on sagittal sections off eather buds at asymmetric short bud and long bud stage, respectively. Arrows: Nuclear P-catenin positive dermis. Arrowheads: Nuclear P-catenin positive epithelium. (Scale bar: 50 f.Lm) (D-F') High-level NM liB and Jag1 are detected in the nuclear P-catenin positive dermis. MyhlO encodes NM liB heavy chain. (Scale bar: 100 f.LID.) (G) Schematic summary of the results. 21 Asymmetry in organ morphology may be caused by several possible mechanisms. Previous work has suggested that localized cell proliferation can contribute to the A-P axis of the feather buds (Chodankar et a!., 2003; Desbiens et a!., 1991). Hence, we examined whether there are any spatial correlations between the DBZ and proliferating dermal cells. BrdU pulse labeling revealed that dermal cell proliferation is homogeneous at the symmetric short bud stage and becomes localized to the posterior bud at the asymmetric short bud stage. However, the range of this proliferation zone is much larger than that of the DBZ and shifts distally thereafter (Figure 2.2A' -D' and Figure 2.4A-B). The DBZ starts to appear in the posterior bud at symmetric short bud stage and generally maintains its position close to the posterior epithelial-mesenchymal boundary thereafter (Figure 2.2A-D and Figure 2.4A-B). Confocal images of feather buds stained with proliferating cell nuclear antigen (PCN A) and ~-catenin show no significant overlap between the two (Figure 2.4C). Due to the different spatial distributions of proliferating cells and nuclear ~-catenin positive cells, it is unlikely that nuclear ~-catenin in the DBZ directly controls cell proliferation. 22 0 ~ E E 10 symmetric short bud asymmetric short bud c long bud follicle Figure 2.4: Stages of feather bud development and corresponding NM IIA, NM liB, SMA expression patterns, actin network alignment. (A, A') Confocal pictures showing the levels of NM liB in feather buds at symmetric short bud stage and asymmetric short bud stage, respectively. Arrows: highly expressed NM liB at posterior bud dermis. (B, B ') The F-actin network arrangement in feather buds at the two stages. Arrows: F-actin network aligned along the posterior epithelial-dermal boundary (Scale bar 50 fllll). The lower panels are magnified pictures from above. (C) Myh9 (NM IIA heavy chain) in situ results. The signal is mainly restricted to the vasculature (Scale bar 100 fllll). (D) Myhl 0 (NM liB heavy chain) in situ on feather buds at the four stages. Only at the asymmetric short bud and long bud stage can lvf yhl 0 be seen within feather bud mesenchyme (at the posterior bud dermis). The positive signal underlying feather bud at the follicle stage is the feather muscle._(C') and (D') are enlargements of (C) and (D), respectively. (E) Smooth muscle actin (SMA) staining on feather buds at the four stages. Feather muscle does not show up until the long bud stage (arrows). We also tried to examine the distribution of apoptotic cells using the terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) assay. No areas in feather bud dermis were enriched for apoptotic cells (Figure 2.40). Therefore, although cell proliferation may play a role, other mechanism(s) may also provide significant contributions to the polarized elongation process. Besides B-catenin, we also found that the DBZ is enriched for Jagl (Notch ligand) and nonmuscle myosin (NM) liB (MyhlO) mRNAs during the asymmetric short bud and 23 long bud stages (Figure 2.3D-F'). Next, we investigated the relationship between these molecules in feather bud elongation through functional perturbations. 2.3.3 Perturbation of the dermal nuclear Jl-Catenin positive zone causes random orientation of feather buds To evaluate the relationship of the DBZ and feather polarizing activity, we first performed epithelial-mesenchymal recombination and rotation experiments (EMRR) (Chen eta!., 1997) (Figure 2.1F-G). EMRR of St. 34 chicken dorsal skin yield numerous dual-tip feather buds. The two tips follow the epithelial and mesenchymal A-P orientations, respectively. ~-catenin staining 20 h after EMRR showed the presence of two DBZs. Their locations were consistent with the positions of the two tips (Figure 2.1H-H'). This result confirms the close relationship between the DBZs and polarizing activity. To evaluate the functional role of the DBZ in feather bud morphogenesis, we used electroporation to introduce Replication Competent Avian Sarcoma Virus (RCAS)-~-catenin proviral plasmids to the left side of E3 chicken embryos. This proviral plasmid can generate active virus misexpressing a constitutively active form of ~-catenin in cells. The right side serves as an internal control (Figure 2.5C). Most RCAS-~-catenin treated embryos demonstrated significant feather misorientation on the treated side 6 d after treatment (62/72) (Figure 2.5B, B', and D). The severity of bud fusion in the remaining samples prevented us from assessing feather orientation. Fusion, an 24 abnormality in determining the bud-vs.-interbud area, occurs before polarization and may be related to the presence of nuclear ~-catenin in the epithelium. RCAS-GFP-treated control embryos show that the viral vector has no effect on feather orientation or bud fusion (31/35) (Figure 2.5A-A'). 0 RCAS-fkalemn - RCAS-Jk:atenin + 90 90 1525 32 1~ 5 0 ' -o~ -. Scale chr18: 500 bases · ga1Gal4 1,625.500 1 ,626.000 -1.625,579 Perfect Matches ro Short Secuence (TCTITGTI) I J marker lgG Input 13·c;;~~t ~-c:oJI me o< M93676tt - Figure 2.5: Misexpression of stabilized ~-catenin caused drastic feather misorientation and up-regulation of NM ITB and Jagl. (A) E9 chicken embryo with RCAS-GFP electroporated to its left side at E3. (blue, Shh in situ; red, RCAS staining) (n = 35). (B) E9 chicken embryo with RCAS-~-catenin electroporated to its left side at E3 (n = 72). (Scale bar: 500 )lll1.) (A'-B') Schematic drawing of feather orientation and RCAS positive area. (C) E3 embryo electroporation setup. (D) Summary of feather bud orientation relative to the body A-P axis in RCAS-~-catenin negative (n = 45) and positive (n =57) areas, respectively. (E) Confocal images at two different levels (proximal and distal) of a misoriented, ~-catenin overexpressing feather bud. The distal view shows a nuclear ~-catenin zone at the original posterior region (green arrows). The proximal view shows a second nuclear ~-catenin zone in the new, reoriented posterior region (red arrows). (E') 3D reconstruction of ~-catenin staining pattern in E. (E") Schematic representation of the original and new bud A p axis. (F and G) Control and ~-catenin overexpressed short feather buds stained with ~-catenin, and NM IIB. (Scale bar: 50 )lm) (H) Jagl whole mount in situ of RCAS ~-catenin expressing skin. Enlargement of feather buds from a control (H*l) and RCAS ~-catenin expressing (H*2) region in H. (I) Potential WRE located upstream ofMyhlO (shown in University of California, Santa Cruz genome browser. M93676 is Myhl 0 accession code in GenBank). (J) ChiP-PCR result. ~-cat me, monoclonal ~-catenin antibody; ~-cat pc, polyclonal ~-catenin antibody. To better understand the topological relationship between the DBZ and directional feather growth, we analyzed the distribution of nuclear ~-catenin positive cells in the 25 misoriented buds by confocal microscopy (Figure 2.5E). These buds retained their endogenous DBZ (distal; green arrows) but have acquired an ectopic DBZ located within the lateral regions of the bud, oriented 90° from the original DBZ (proximal; red arrows). The location of the bud tip was consistent with the location ofthe ectopic DBZ. The buds also retained a small, visible bulge that colocalizes with the endogenous DBZ. In 30 reconstruction we can see the endogenous and exogenous DBZs (Figure 2.5E'). We also blocked canonical Wnt signaling in E7 chicken skin explants usmg endo-IWRl (an axin stabilizer) or DKKl overexpression (Chang et al., 2004). In both cases feather bud elongation was inhibited and feather bud polarity became obscured (Figure 2.6A). These results demonstrate that the DBZ is necessary and sufficient to mediate the polarized elongation of feather buds. A B c 0.2: . ptOximaiiMWftC.I'!Vmt • dist.~IM'Hf'IChyme 0 TUNEL Figure 2.6: Dermal cell proliferation and apoptosis do not show high spatial correlation with nuclear 1}-catenin positive cells. (A) Longitudinal section oflong bud stage feather bud stained with ~-catenin (red) and BrdU (green; 4h labeling) (Scale bar: 50 ).1m). (B) Comparison of nuclear ~-catenin and BrdU positive cell ratio from proximal and distal dermis of36 feather buds at the long bud stage (NB: nuclear ~-catenin). (C) Confocal picture of feather bud at early long bud stage shows poor overlap between nuclear ~-catenin and PCNAsignals. (D) TUNEL assay indicates that apoptosis is rare in feather bud dermis and lacks set spatial distribution (Scale bar: 100 )liD). 26 2.3.4 Dennal nuclear Jl-Catenin activates nonmuscle myosin liB expression to mediate polarized cell rearrangement Polarized tissue morphogenesis can be attributed either to polarized cell rearrangement (Rolo et a!., 2009), oriented cell division (Li and Dudley, 2009), or localized cell proliferation/apoptosis (Yu et a!., 2002; Zou and Niswander, 1996). Previously we tried to examine the orientation of mitosis through y-tubulin staining. We did not observe a clear alignment of cell division orientation. To test whether polarized cell rearrangement contributes to feather bud elongation we examined the expression patterns of NM II isoforms. These proteins are highly conserved motor proteins for cell motility (Kasza and Zallen, 2011; Rolo et a!., 2009). Mammals have three NM II isoforms (A, B, and C), distinguished by the non-helical tail region of the heavy chains (Vicente-Manzanares eta!., 2009). These mammalian heavy chain isoforms are encoded by Myh9 (NM IIA), MyhlO (NM liB), and Myhl4 (NM IIC). Myhl4 is not found in the chicken genome. Chicken Myh9 expression is restricted to the vasculature (Figure 2.7C-C'). Chicken MyhlO RNA and protein are both present at high levels in the DBZ during the asymmetric short bud and long bud stages (Figure 2.3D, E, and E' and Figure 2.7D-D'). 27 50 ~M IWR1 Figure 2. 7: Endo-IWRl inhibited feather bud elongation and down-regulated jagl and NM liB levels. Blebbistatin inhibits the misoriented elongation upon RCAS-p-catenin treatement. (A) E7 skin explants cultured for 4 days with DMSO or 50 fJM endo-1\VRl. (B)Jagl expression significantly decreased in endo-1\VRl treated samples compared to the control ( 40h culture; scale bars: 500 Jllll). (C, D) Significant decrease of nuclear ~-catenin and NM liB level in endo-1\VRl treated samples compared to control (Scale bar: 50 Jllll). (E) E8 chicken embryo dorsal skin ( electroporated with RCAS-~-catenin at E3) cultured for 48h with DMSO and lOfJM Blebbistatin, respectively. The misoriented elongation was inhibited by Blebbistatin treatment (Red: RCAS in situ hybridization, scale bar: 500 ~m). NM liB expression dynamics suggests it may be a target of ~-catenin signaling. We located a perfect match to the Wnt-response element (WRE; CIT-C-T-T-T-G-NT-NT) at - 494 to - 487 upstream of the MyhlO transcription start site (Figure 2.51). WRE is a conserved binding site for Lef!Tcf proteins (Shanely et al., 2009). To confirm binding of ~-catenin to this potential WRE we did ChiP analysis on chromatin isolated from E8 chicken dorsal skin using anti-~-catenin antibodies. The chromatin was amplified by PCR with primers across this potential WRE. Both monoclonal and polyclonal ~-catenin antibodies can successfully pull it down (Figure 2.5J). Previous studies showed that NM liB works through the actin network (Vicente-Manzanares et al., 2009). The actin network is randomly arranged before NM liB up-regulation but becomes aligned along the posterior epithelium-mesenchyme 28 boundary after NM liB up-regulation (Figure 2.7 A, B, and B'). This observation indicates that NM liB is functionally active in feather buds. We next compared the NM liB expression pattern in ~-catenin overexpressing and normal feather buds. The area expressing NM liB expanded in ~-catenin overexpressing dermis (Figure 2.5G) compared with the control (Figure 2.5F). In St. 34 EMRR experiments, the two DBZs in the "dual-tip" buds both have high levels of NMliB (Figure 2.1H, H1, and H2). In contrast, NM liB expression decreases when the DBZ disappears upon DAPT (10 JlM) and endo-IWR1 (10 JlM) treatment (Figure 2.6C-D). Additionally, we treated the E7 skin explants overexpressing stabilized ~-catenin with 10 11M Blebbistatin, a selective inhibitor formyosin !!.Misoriented feather bud elongation caused by ectopic ~-catenin was inhibited (Figure 2.6E). Together, these data demonstrate that NM liB works downstream of ~-catenin signaling. To test whether NM liB is involved m cell rearrangement during feather bud elongation, we blocked its function with Blebbistatin. In cell culture, E7 chicken dorsal skin fibroblasts were treated with DMSO or 10 11M Blebbistatin. Cell behavior was documented for 12 h after treatment. Most control group cells showed bipolar, elongated cell shapes (Figure 2.8A, Left) and moved along their long axis (Figure 2.8A', Left), whereas almost all Blebbistatin-treated cells showed multipolar shapes (Figure 2.8A, Right). Their trajectories were random compared with controls (Figure 2.8A'). Many Blebbistatin-treated cells made sudden and significant turns during migration, which occurred rarely in control cells (Figure 2.8D). These results confirm the previous report 29 that blocking NM liB function affects cell rearrangement patterns (Lo et al., 2004 ). Figure 2.8: Blocking NM liB function disrupted fibroblast migration patterns in vitro and inhibited feather bud elongation in vivo. (A) E7 chicken embryo dorsal skin fibroblasts transfected with RCAS-~-catenin to mimic posterior dermis were cultured 12 h in media containing DMSO or 10 1JM Blebbistatin (Bleb), respectively. Notice the difference in cell shape. (A') Most control cells moved in the direction of their long axis, whereas many Blebbistatin treated cells moved randomly. (Scalebar: 100 IJlll) Red, blue lines show the movement trajectory of two cells artificially colored yellow at time 0. (B) Skin explants cultured 4dwith DMSO (control) and different doses of Blebbistatin, respectively. (Scale bar: 500 Jlm.) (C) Inhibition of bud elongation by Blebbistatin could be phenocopied by treatment with Y27632 (ROCK inhibitor). (D) Statistics of cell rearrangements for A!. For details please see Statistics. (E) Feather bud aspect ratio (length/ width) at different Blebbistatin concentrations (n = 20 for each treatment condition). (F-1) Time-course pictures of Vybrant dye labeled posterior (F and G) and anterior (Hand I) bud dermis in control and Blebbistatin-treated buds. (Scale bar: 250 IJlll) (F'- 1') Confocal images of feather buds from the corresponding 72-h explants. (Scale bar: 100 Jlill) (J) Schematic representing cell tracking results for the anterior (blue) and posterior (red) dermis. In tissue culture, E7 chicken skin explants were treated with different doses of Blebbistatin. Blebbistatin treatment inhibited feather bud elongation in a dose-dependent manner. Feather bud polarity was lost at 50 ~LM (Figure 2.8B and E). Rho-kinases (ROCK) are known be involved in NM activation (Verdier et al., 2006). Treating specimens with Y27632 (ROCK inhibitor) also generated a similar inhibitory phenotype (Figure 2.8C). To further examine the role of altered cell rearrangement patterns on 30 feather bud morphology, some posterior cells of late symmetric short bud stage skin explants treated with 10 11M Blebbistatin or DMSO were labeled (Vybrant cell tracer, Invitrogen). Time-course images (Figure 2.8F -G) show that in control explants these cells gradually aligned parallel to the axis of elongation, whereas cells in Blebbistatin-treated specimens scattered randomly from their site of origin. Labeled dermis cells in the anterior bud did not move much in either DMSO or Blebbistatin-treated specimens (Figure 2.8H-I). The directional rearrangement of posterior dermal cells is consistent with changes in the DBZ configuration: the DBZ decreases from -3-5 cell layers at the asymmetric short bud stage to -1-2 layers at the long bud stage (Figure 2.2B-C). Collectively, these results demonstrate that the DBZ induces NM liB to mediate polarized cell rearrangements during feather bud elongation (Figure 2.8J). We further investigated the cell rearrangement pattern through dual dye tracking experiments. Two separate populations of mesenchymal cells were labeled on the right (Invitrogen Qtracker) and left (Vybrant Cell Tracker) lateral side of the bud. Through timelapse imaging we found that cells from these two populations can mix together to form a broad line, suggesting the bud mesenchymal cells could rearrange perpendicular to the direction of bud elongation (Figure 2.9). Therefore, we hypothesize that NM liB may mediate cell intercalation in feather bud elongation, as has been reported in other systems (Kasza and Zallen, 2011 ). This hypothesis will be tested further in the near future with higher resolution live tissue imaging. 31 • ~( ~ 270 ~ 270 Figure 2.9: Mis-expression of Notch intracellular domain does not significantly change feather elongation orientation. (A) E9 chicken embryo after electroporation ofRCAS-NICD to its left side at E3. (B)Jn situ hybridization of a Notch] probe to the same specimen. (C) Schematic drawing of feather orientation and virus positive area (red). (D) Summary of feather bud orientation relative to body A-P axis in virus negative (n = 28) and positive areas (n = 38). 2.3.5 Notch signaling is activated by the nuclear )}-Catenin positive dermis and sustains the DBZ through a positive feedback loop 8 ~. DMSO 90 270 20 E RCAS-NICo:.--_ l!IL ____ 10 ~MDAPT C , 90 2 ') t:: [[Oj] CJ = 1 J 0.5 270 O OpM 5}JM 10~M SOvM DAPT ' 2 · -~ ~( ~ RCAS-NICD+ 90 ito OMS(( 10~M DAPT H' DMSO 10 ~M DAPT Figure 2.10: Inhibition of Notch signaling by DAPT causes drastic feather misorientation and dose-dependent inhibition of bud elongation. Meanwhile DBZ nuclear ~-catenin and NM liB level are dramatically decreased. (A) E7 skinexplants cultured for 4 d with DMSO or different doses of DAPT (B) Summary of feather bud orientation relative to the body A-P axis uponDMSO (n = 40) or lO~APT (n = 40) treatment, respectively, (C) Feather buds' aspect ratio at different DAPT concentrations (n = 20 for each concentration). (D) E8 chicken embryo dorsal skin (electroporated with RCAS-NICD at E3) cultured with 10 ~ DAPT for 72 h. Red signal shows RCAS positive area. Arrows in the schematic drawing represent feather bud orientation. (E) Divergence of feather bud orientations from the body A-P axis in the RCAS-NICDnegative andpositive area, respectively (n = 44for each condition). (F and G) Confocal image of a feather bud on E7 skin explant cultured for 1.5 d with DMSO and DAPT (10 ~)in media, respectively. (Arrow) nuclear P-catenin positive cells. (Scale bar: 50 Jliil.) (H-J) Whole-mount in situ hybridization ofDMSO- and 32 DAFT-treated skin explants (after 40 h in culture) with Note hi, Hey I, Jag I probes, respectively. (Scale bar: 500 fllll) (H'-J') Section in situ hybridization ofDMSO- and DAFT-treated skin explants with the three probes, respectively. (Scale bar: 100 Jlm) Molecules along the Notch pathway showed polarized expression patterns in feather buds (Chen et a!., 1997). Jag1, a Notch ligand, is expressed in the DBZ (Figure 2.3G) during the symmetric short bud and long bud stages. Jag1 was up-regulated upon ~-catenin overexpression (Figure 2.5H). In addition, Jag1 is expressed in both DBZs produced by the EMRR experiment (Figure 2.1I). Blocking ~-catenin signaling with endo-IWR1 also significantly decreased the expression of Jag1 (Figure 2.6B). These findings indicate that Jag1 expression is induced by ~-catenin signaling. To further understand Notch pathway function in feather bud elongation, we used DAPTto block Notch signal transduction. Feather orientation was significantly randomized even at very low drug concentrations (5 11M), and feather bud elongation was inhibited at higher DAPT doses (Figure 2.10 A-C). These phenotypes imply that the Notch pathway may be activated by ~-catenin signaling to mediate polarized feather bud elongation. To confirm that the phenotype ofDAPT-treated samples was due to Notch inhibition, we treated the DAPT specimens with RCAS-NICD (Notch intracellular domain, the constitutively active form ofNotch1). Misorientation by DAPT-treated feather buds generally does not happen in the RCAS-NICD positive area (Figure 2.10D, E, and E'; 4/8), but RCAS-NICD can produce other phenotypes making rescue difficult to discern in the remaining four samples. 33 However, RCAS-NICD alone did not induce altered feather orientation (Figure 2.11). Therefore, we compared the expression pattern of Notch pathway members, ~-catenin , and NM liB between feather buds from DMSO- and DAPT-treated explants. Notchl expression was lost in the bud dermis but appeared in an abnormal epithelial invagination in DAPT-treated specimens (Figure 2.10H-H'). Heyl, a classical Notch target gene, also disappeared in the bud dermis but became expressed in the interbud epithelium (Figure 2.101-1'). Jagl expression was undetectable in DAPT specimens, even at low concentrations (5 11M; Figure 2.10J-J'). DAPT treatment also causes decreased Jag1 expression in other systems (Daudet et al., 2007; Tsao et al., 2008). Nuclear ~-catenin was nearly completely lost in 10 11M DAPT treated specimens and NM liB levels were very low throughout the bud dermis compared with controls (Figure 2.1 OF -G). Even a low DAPT dose (5 11M) significantly decreased the DBZ area and altered its configuration (Figure 2.12D-D'). These observations imply that Notch signaling helps to stabilize the DBZ spatial configuration. A Oh 12h 24h . -: 36h . . • . . . . ._ ____ . . - ... ; • •• .. .. ... A' B * • I E ., * Figure 2.11: Dual dye tracking experiment shows mesenchymal cells can move in the direction perpendicular to the bud elongation orientation. (A) Time-course pictures of two separate clusters of labeled mesenchymal cells gradually mix together (Red: Qtracker, Green: Vybrant cell tracker). (A') rvfagnified picture of the outlined region at 36h. (B) Confocal examination of the same region (Scale bar 100 fllll). Mixing of cells with different dye labeling (*). (C) Schematic drawing of the results. 34 [l]Wnt 1 [2J 11:-. ___., G - Wnt gradient H 40 DIS!arx:A .. Nuclear jl-catenin without notch signaling Wnt gradient Nudear j3-ca1emn Nudear P-catenin - Nuclear jkatenin with notch signaling (With Notch signaling) (Without Notch s1gnalfnQ) ~J' s ! } / c : I ...... ..... 1 0 - D Figure 2.12: Mathematical modeling ofWnt-Notch cross-talk simulates the change from a noisy, gradual Wnt gradient to a definitive threshold Wnt response. (A) Section in situ hybridization for Wnt7a (arrow) in feather buds. (B) Fluorescent staining ofWnt7a. (C and C') Effect ofBSA and Wnt7a (0.2 M) soaked beads on E7 chicken skin dermis cultured for 24 h. (Scale bar: 50 Jliil.) (D) Wnt7a and ~-catenin staining in control and 5 ~DAFT-treated feather buds (compact confocal Z-stack pictures). (D') Schematic summary ofD. (E) Wnt7a, ~-catenin signal intensity measured from five feather buds for each condition (distance is calculated from the posterior epithelial-dermal boundary to the center of the bud). (F) Wnt-Notch cross-talk relationships used for mathematical modeling. (G) Simulation (lD) shows Wnt-Notch cross-talk can help nuclear ~-catenin form an ultrasensitive response to Wnt ligand. (H) Simulation (2D) results. 2.3.6 Notch signaling converts the highly variable Wnt gradient into a spatially well-defined, localized nuclear )}-Catenin dermal response Wnt7 a was expressed in the posterior bud epithelium during the short bud stage, so the spatial and temporal concurrence ofDBZ emergence with Wnt7a expression suggests a potential connection between the two (Figure 2.12A). We examined this potential connection by comparing the effects of placing Wnt7a (0.2 M) or control (BSA) soaked beads on E7 chicken dorsal skin dermis. After 24 h significant B-catenin accumulation was observed in the Wnt7a group but not in the control group, indicating Wnt7a is an upstream trigger of nuclear B-catenin (Figure 2 .12C-C'). This relationship has also been 35 revealed in other systems (Caricasole eta!., 2003; Davis eta!., 2008). However, the spatial distributions of Wnt7a and nuclear ~-catenin intensity exhibit two major differences. By immunostaining we found Wnt7a protein showed a punctate expression pattern in the bud dermis. The density is highest at the posterior dermal epidermal boundary (source) and decreases toward the anterior regions of the bud, forming a molecular gradient (Figure 2.12B, D, and D'). Similar to some other reported organizer morphogens, this gradient shows an exponential decay, fitting Wolpert's diffusion degradation model (Wartlick et a!., 2009). However, due to its punctate nature, measurements of this gradient fluctuate (in contrast with the smooth curve of a deterministic gradient). Meanwhile, the slope of the gradient exhibits relatively large variations among individual buds (Figure 2.12E). Hence, this process is "noisy" from the mathematical perspective. In contrast, the intensity of the nuclear ~-catenin decreases precipitously -20 11m from the posterior epithelial-mesenchymal boarder, forming a sharp DBZ boundary, and this distance is quite consistent between different buds (Figure 2.12D, D', and E). How is the noisy Wnt7a gradient converted to a sharp on/off downstream response? We speculate that Notch signaling may be involved in this process. Indeed, inhibiting Notch signaling (5 11M DAPT) induces the nuclear ~-catenin plateau to fragment into multiple small clusters (composed of -1-6 cells) randomly distributed along the epithelial-mesenchymal boundary (Figure 2.12D, D', and E). This implies that the response to Wnt signaling became noisy after Notch signaling was blocked. 36 Based on these observations and evidence from others (Nakagawa et a!., 2000; Sprinzak et a!., 2010), we built a Wnt-Notch cross-talk model to investigate the sharp on/off response (Figure 2.12F, black arrows). In the model, Wnt7a increases nuclear ~-catenin, which induces Jag] expression. Jag] and Notch] mutually inhibit each other's expression within the same cell but their interactions between neighboring cells activate Notch signaling. Notch signaling would positively feedback to enhance localization of ~-catenin to the nucleus. To test the proposed network, we performed 1D and 2D simulations (Figure 2.13, Table 2.1, Table 2.2) and examined whether this model can achieve the observed conversion from Wnt to nuclear ~-catenin (Figure 2.12G-H). First, without including Wnt-Notch cross-talk, we found the noisy Wnt7a gradient is converted into multiple small nuclear ~-catenin clusters (Figure 2.12H), consistent with our experimental observation on DAPT-treated specimens. However, when Wnt-Notch cross-talk was added, we found isolated clusters of nuclear ~-catenin (Figure 2.12G-H). In this case, there is an expansion of the Jag1 positive area with Notch] expression in the rest of the domain due to lateral inhibition, as observed in normal feather buds. As a result, Notch signaling appears at the Jagl and Notch] expression interface, leading to a sharp boundary which reduces fluctuations in nuclear ~-catenin activity, thus forming a more uniform DBZ. These simulations show an interesting dual role of the Wnt-Notch cross-talk module: It converts a graded gradient into a sharper on/off response as well as reduces cell-to-cell variability in response to the signal. 37 F jg>llb 2 .13': The \Vni-No'll:lt Q~ss-talk 1ttodd willt thAI ~d.dit>iii •of 11Jlotlter .moclulatnr :\:, Sfx f¢g>.U:atoryfi!all.ori$llip~ b'~kwe.en;,: &1Jd WrclCN olthtlldwotli \bat c~· Mp .as.t~blhm Stea4lf state: ll!e llste.d. (1 ) X: inlibits ·~lo.ll$- Si~ngto f-..AQ>,<<:k to nUcl~ar ~-d't,enfu, (2J X acfi><JJ>les No. I!:!< r~c"(!tO!t ~ X: tnhfl:ill: N:ol,ch1 •x !Jres,jion. (A) X il)hiblt$ J agf -~xp..asS.o.n. (:1) :iZ illbil:i~s.eqtiV>lJon :ri Jag! -~p.esslon hy mwleat ]}'c,;tmlln (6.) ¥'l'~a ditfusi:;e.t!WtbSt:r«Orti pro~of Notch·sl~'llinll..-tdi.nhiWts'No!Cb ·si!'PJililtg ii1t"t l!l: is$htgjl eOflC, •illt•tiotc (1) Mditilinat lltlti> ilo!:; illr up. -reg!tlaiio n. linn N~ tclt Slgl\alilog_ jcn\ueleat" jlo eateJ!in For 1hi~·~OS~ >: inl~ 1:4 IS the up tegu),_~ cii ftottt ND~Ghsi!'PJ~linglo whet~ /(A/81:-2!0./lJ :nUci lea:r· ~-c.a'tenin ,at &latce• stage, or at t1r~eoste:1ior re@:on of Ule f.eatiter b\ld. 38 (2) Additional activator for Notch For this case X activates Notch receptor at a later stage, or at the posterior region of the feather bud (3) Additional inhibitor for Notch production For this case X inhibits Notch/Notch receptor production at a later stage, or at the posterior region of the feather bud, which results in depletion of Notch everywhere and hence a steady state of the system (4) Additional inhibitor for Jagl For this case X inhibits Jag] production at a later stage, or at the posterior region of the feather bud An where f(A; ecSO, n) = _ __:_:c __ An+ecSOn An 1 where f(A;ecSO,n) = , g(A;ecSO,n) = ---- An+ ecSOn An+ ecSOn Dtran.,N" An 1 where f(A;ecSO,n) = , g(A;ecSO,n) An+ ecSOn An+ ecSOn 39 (5) Additional inhibitor for up-regulation from nuclear ~-catenin to Jagl For this case X inhibits the up-regulation from nuclear D-catenin to Jag I at a later stage, or at the posterior region of the feather bud (6) Additional downstream product of Notch signaling and Inhibitor for Notch signaling X is a diffusive downstream product of Notch signaling and inhibits Notch signaling when X is at high concentration J\n 1 where f(J\;ecSO,n) = , g(J\;ecSO,n) = . J\n+ ecson J\n+ ecson aN= fJ _ N- DN _ Dtmn,N at N rN k k ' n t aD DN N n -=/] f(RecSO n )-r D--- tmn~ f)f D ' D' D D kc kt ' ax o 2 X - = dx- 2 -+ flxf(N;ecSOx,nx)- rxX, at & as 1 D -r-.1 - = fJ ( tmns")Pg(X"ecSO n )- r S f)f S k RS kt ' S' S S ' aR - = fJRf(S;ecSOR,nR)- yNR, at J\n 1 where f(J\;ecSO,n) = , g(J\;ecSO,n) = . J\n+ ecson J\n+ ecson We prescribe zero initial conditions for all the variables except for nuclear ~-catenin (R): N(x,t = 0) = D(x,t = 0) = S(x,t = 0) = 0, R(x,t = 0) = f(Wnt;K,n 0 ), where f 1s an activating Wntn' f(Wnt;K,n 0 )=--- Wni"'+Kn' hill function of the form Table 2.1: Equations simulating Wnt-Notch crosstalk. Here N stands for the concentration ofNotchl. D stands for the concentration of Jag I. S is the intensity of Notch signaling and R is the concentration of nuclear D-catenin. X is the concentration of the additional hypothesized regulator. The interactions between Notch! and Jagl are hypothesized to happen only in neighboring cells (1), with D 1 mn" denoting the 40 concentration of Jagl in neighboring cells of Notchl, and Ntrans denoting the concentration of Notch in neighboring cells of Jag!. k,- 1 and k,- 1 are defined similarly as in (1) to be the effective cis-inhibition and trans-activation rate respectively. The parameters fJN, fJD f3s and fJR refer to the generating rates of the corresponding chemical, while yN, rn, y 3 and YR refer to their degradation rates. The same notation will be used in the following cases. Figure Parameters Remarks Wnt gradient was generated by K~0.9, 11o~4, ~N~2. ~n~5, ~x~lo, ~R~3, YN~o 1, Yn~O.l, a quadratic function that equals zero on the center and one on 2.12G Yx~0.02, y,~l, YR~O.l5, k,~lo, k,~333.33, ec50n~0.2, the posterior epithelial-dermal nn~2, ec50x~0.035, nx~l, ec5o,~o. 5, n,~2, ec50R~O.l, boundary. Only the right 10 nR~2, hs~O.l, p~2, dx~5. cells in the posterior part are shown. Wnt gradient was generated by K~o_sl, 11o~4, ~N~2. ~n~5, ~x=20, ~,~1. ~R~o 5, YN~o 1. a quadratic function that equals zero on the center and one on 2.12H Yn~O.l, y,r0.02, y,~l, YR~o.m, k,~3.33, k,~o.2, the posterior epithelial-dermal ec50n~0.5, nn=2, ec50x~0.03, nx=l, ec5o,~o.00125, boundary with uniformly a n,~2, ec50R~O.Ol, nR~2, hs~O.l, p~2, d,r0.5625. distributed additive noise varied from -0.5 to 0.5. Table 2.2: Simulation parameters for the Wnt-Notch crosstalk model 2.4 Discussion Here, we identified a unique local molecular module that can generate oriented organ elongation, which then contributes to organ polarity. The molecular module uses an epithelial signaling component and a dermal polarizing zone characterized by the presence of a local nuclear ~-catenin centered molecular module. The execution of morphogenetic activity is mediated by NM liB. Upstream regulation comes from epidermal Wnt signaling (the core pathway). Its activity and boundary is maintained and modulated by Notch signaling (the modulatory pathway). This molecular network is 41 summarized in Figure 2.14. Wnt7a and/or other? ! Notch1 - J g - Dermal nuclear P-catenin I ~ ! DAPT -I • i Notch signaling ·····• De-no1sing, and ultra-sens1tiz1ng Modulatory pathway sharpens the boundary of the localized activ1ty zone. NM liB ! 1-- Blebbistatin Polanzed cell rearrangement Core chemical mechanical coupling pathway mediates polarized elongation. Figure 2.14: Summary of the core and modulatory molecular modules for polarized elongation during feather bud morphogenesis. Purple, Wnt7a and/or other Wnt molecules from posterior epithelium induce ~-catenin nuclear accumulation in DBZ cells (red spots); yellow, Jagl positive zone; blue, Notchl positive zone; red arrows, nuclear ~-catenin-Notch feedback loop; green arrows, nuclear-~-catenin-induced directional cell rearrangement; dashed lines, unknown mechanism. A crucial point m organogenesis IS how the organ primordial set up signaling organizers and how these signals shape and orient organs. In the limb bud, retinoic acid and Shh were shown to possess polarizing activity (Wolpert and Tickle, 2011). Using a similar tissue transplantation strategy, we identified the zone with feather polarizing activity, which is positioned in the posterior short feather buds. However, when we characterized the molecular properties of this zone, we found that its activity is not based on Shh. Rather, it is based on a Wnt/B-catenin /NM liB module which shows crosstalk with Notch signaling. The Wnt pathway has been implicated in setting organ polarity during multiple morphogenetic processes. Canonical Wnt signaling helps establish the primary body axis in a number of species, as well as to specify neural plate A-P axis in Xenopus laevis (Kiecker and Niehrs, 2001 ). However, most reports infer the noncanonical Wnt/planar cell polarity pathway (PCP) as a key polarizing organizer (Wang et al., 20 10). Common cellular mechanisms for the organ polarization process include alignment of cell division orientation, localization of cell proliferation/apoptosis, and polarized cell 42 rearrangement (including directional cell migration, intercalation). The canonical Wnt pathway can activate directional cell motility during early stages of Xenopus gastrulation (Brown et a!., 2000). Noncanonical Wnt/PCP members can control the axis of cell division orientation during long bone elongation (Li and Dudley, 2009) and can also mediate cell intercalation to achieve tissue/organ convergent extension (Goto and Keller, 2002; Heisenberg et a!., 2000). Rho GTPases act downstream of the PCP pathway to reorganize the actin-NM network (Habas eta!., 2001; Tahinci and Symes, 2003; Verdier et a!., 2006). Therefore, we had thought the PCP pathway should play an important role in feather polarizing activity. It turns out noncanonical Wnt/PCP pathway members are expressed later after long bud stage in feather development and do not function to orient feather buds. Specifically localized cell proliferation may lead to asymmetric organ shape. Previous studies showed that asymmetric short bud stage cell proliferation is primarily localized to the posterior bud (Chodankar et a!., 2003; Desbiens et a!., 1991). We found that this localized proliferation zone and DBZ co-localize only temporarily and have distinct spatial configurations later on. Thus, we consider it unlikely that the ~-catenin/NM liB module affects feather bud elongation through the direct regulation of localized proliferation. However, it is possible that both cell rearrangement and localized proliferation contribute to the bud elongation process. NM II is a pivotal controller of cell migration and tissue architecture (Vicente-Manzanares et a!., 2009). It is critical for cell intercalation in Drosophila germ 43 band convergent extension (Kasza and Zallen, 2011 ). NM liB is the subtype most frequently reported to mediate directional cell migration in vertebrates (Rolo et a!., 2009; Witze et a!., 2008). In several cases canonical Wnt signaling lies upstream of NM II (Herman, 2001; Lee et a!., 2006; Zimmerman et a!., 2010). In feather buds, anterior dermal cells (NM liB-) remain relatively stationary whereas the posterior dermal cells (NM liB+) exhibit polarized movements. Blocking NM liB severely disrupted directional cell rearrangements and inhibited polarized organ elongation. Dual dye tracking experiments demonstrate that dermal cells can move horizontally, probably in a manner similar to cell intercalation in convergent extension. However, these data do not exclude the possibility that some cells also migrate vertically. If so, a chemoattractant likely is needed for directional guidance. Shh is known to be expressed in the distal bud epithelium starting from the asymmetric short bud stage, and serves as a directional cue. Another important aspect of this work is the cross-talk between Wnt and Notch signaling in configuring the DBZ. A critical issue in tissue morphogenesis is how a signaling center can establish a cellular activity zone precisely and robustly. Morphogen gradients show fluctuations and even large variability between individuals (Houchmandzadeh eta!., 2002). However, the zones for cell rearrangement (as seen here) and apoptosis (as used to generate space between barb branches) have well-defined domains. Thus, we need to know how noisy morphogen gradients are transformed into localized cell activity zones with sharp boundaries. In our feather bud system we observed dramatic differences between the shape and 44 fluctuation level of the Wnt gradient (noisy) and the Wnt response (relatively homogeneous with a sharp boundary). We also found nuclear ~-catenin activates Notch signaling at the DBZ boundary. When we perturbed Notch signaling, the DBZ boundary destabilized, indicating the response to Wnt became noisy. The morphogen gradient and threshold-based differentiation model (Wolpert and Tickle, 2011) led us to ask how a nmsy morphogen gradient is translated into well-defined cell domains. Several different mechanisms were previously proposed (Houchmandzadeh eta!., 2002; O'Connor et a!., 2006). For our system we built a model to integrate Notch lateral inhibition and Wnt-Notch cross-talk. Mathematical simulations revealed the "denoising" and "ultrasensitizing" effects of Notch signaling that reshape the configuration of this localized polarized zone. The ultrasensitizing effect is crucial for the proper function of Wnt signaling as it is dictated by the fold change, rather than the absolute level of ~-catenin (Goentoro and Kirschner, 2009). In other words a precipitous increase or decrease of nuclear ~-catenin determines whether the downstream Wnt signaling effects are on or off. However, due to the positive feedback nature of the Wnt Notch cross-talk, it alone cannot result in a steady state for nuclear~-catenin. One possibility is that the DBZ does not reach a steady state because its presence is temporal and the nuclear ~-catenin positive cells are continuously moving. Another possibility is that an additional regulator may help to establish the steady state by counteracting Wnt activity. BMP is a candidate for this activity (Kamiya eta!., 2008) (Figure 2.13). The synergistic action of canonical Wnt and Notch signaling has been proposed to 45 work as an integrated device, called the"Wntch" module (Hayward et a!., 2008). The cross-talk we observed in feathers is consistent with this concept: Wnt signaling activates a Notch ligand, such as Jagl. The Notch ligand stimulates neighboring cells to up-regulate Notch expression. This creates a positive feedback loop that maintains local Notch and Wnt signaling. Well-studied examples include establishing the Drosophila wing margin and size determination of the mouse otic placode (Jayasena et a!., 2008; Zecca and Struhl, 2007). It is possible the Wntch module can be coopted to function in different biological processes, and similar mechanisms may be adopted in regulating other localized activity zones. Morphogenesis is achieved through patterned cell arrangements. This process is usually directed by biochemical signals (e.g., morphogen gradient), because chemical signals are pliable (e.g., the diffusion rate can be modified by extracellular matrix), adaptable (e.g., signal strength changes according to the location of signaling centers), and interactive (e.g., chemical signals can be synergistic or antagonistic). Frequently, a Turing model is cited as the driving force in pattern formation (Painter et a!., 2012). Physical forces also play key roles in shaping embryos (Forgacs and Newman, 2005). Chemical-based morphogenetic cues are prone to variations, whereas the physical activities that shape organs must be well-defined spatially. Hence, additional mechanisms are required to enhance the precision during this "chemical" to "physical" transition. Here we show that during feather bud elongation, the chemical based morphogenetic cue (Wnt7a gradient) is transformed into a relatively homogeneous and sharp-edged dermal 46 zone enriched with nuclear ~-catenin. This zone coincides with feather polarizing activity, which we defined using transplantation experiments. Through Notch -~-catenin feedback (core pathway) and Notch lateral inhibition (modulatory pathway; Figure 7), the Wnt gradient is converted to a threshold response, thus the sharp boundary of this localized polarizing zone. The nuclear ~-catenin zone induces expression of NM liB. The NM liB-dependent cell rearrangement then drives the directional elongation of the whole feather bud. The distinct morphogenetic process of our feather model helps reveal a polarity forming molecular module for oriented organ elongation. Similar morphogenetic processes may occur in many other organogenesis scenarios. We expect the fundamental principles we deciphered here will be applicable to organogenesis in general. 47 Chapter 3 Modulation of bilateral asymmetry and vane width by Greml and RA signaling in feather follicles 3.1 Introduction Over the last two decades, spectacular paleontological discoveries, mainly from China, have revolutionized our understanding in the origin and evolution of feathers (Chiappe, 2007; Chuong eta!., 2003; Li eta!., 2012; Prum and Brush, 2002; Prum, 2005; Xu eta!., 2010; Xu et a!., 2001) (Figure 3.1A). Novel functions of feathers evolved including endothermy, communication, aerodynamic flight, etc. These are achieved through stepwise retrofitting the original feather forms (Chuong et a!., 2000; Chuong et a!., 2003; Prum and Brush, 2002; Prum, 2005). Three major transforming events occurred during feather form diversification: (i) from a cylindrical filament to radially symmetric branched feathers (e.g., downy feathers); (ii) from radially symmetric to bilaterally symmetric feathers (e.g., contour feathers); (iii) from bilaterally symmetric to the most advanced, bilaterally asymmetric feathers (e.g., flight feathers or remiges). Previous comparative analysis of primary remige shapes in a variety of birds indicates a strong association between the level of bilateral asymmetry and flying ability (Feduccia and Tordoff, 1979). This unique shape is a pivotal adaptive trait to powered (flapping) flight because: (i) they themselves serve as mini-airfoils that can generate lift; (ii) they are more stable in airflow due to the co-localization of the center of gravity and the center of the 48 lifting force; (iii) they facilitate unidirectional pass-through of air during flapping; (iv) they can separate from each other to allow faster passing -through of air to minimize wind resistance (Dyke eta!., 2013; Feduccia and Tordoff, 1979; Norberg, 1985; Norberg, 1985; Paul, 2002; Pennycuick, 2008; Scott and McFarland, 2010). In the past efforts have been made to unveil the patterning rules and molecular circuitries generating different feather forms. For the previously mentioned transforming event (i), BMP and its antagonist, Noggin, were shown to regulate the branching periodicity (Yu et a!., 2002). An activator I inhibitor model characterized by equations (1-3) was further used to explain how periodical branching pattern forms autonomously (without using any landmarks on the body as reference point) by morphogen diffusion and interaction in epithelium (Harris et a!., 2005). For event (ii), feather stem cells were found to exhibit a ring configuration, horizontally placed in downy feathers but tilted downward anteriorly (rachis side) in bilaterally symmetric feathers (Yue et a!., 2005). An anterior-posteriorWnt3a gradient was further shown to mediate the location of the rachis. Flattening of the gradient converted bilaterally to radially symmetric feathers (Yue et a!., 2006). Yet for event (iii), the molecular and cellular mechanisms specifying lateral-medial asymmetry remain unknown. Here we compared the morphologies of four different feather forms and found two key parameters affecting feather vane width and asymmetry: (i) the location and range of barb generative zone (BGZ), which is an epithelial structure present in growing feather follicles 49 and disintegrate to allow feather vanes to separate upon maturation; (ii) the insertion angles of barbs into the rachis. We applied transcriptome profiling and candidate analysis to identify the key molecular circuitries controlling feather vane width and asymmetry. In one aspect, localized Greml from peripheral pulp mesenchyme modulate BMP signaling in adjacent epithelium and regulate BGZ location and range. On the other aspect, differential RA signaling in lateral-medial peripheral pulp mesenchyme modulates epithelial cell shape and adjust barb-rachis angle. We applied mathematical modeling to demonstrate how these two molecular mechanisms could manipulate the self-organized (cell behaviors determined by their positions relative to each other) periodical branching machinery to modulate BGZ distribution and bar-rachis angle, respectively. Thus the hierarchical integration of differential patterning mechanisms drives feather form diversification and the evolution of flight. This principle may also apply to the morphogenesis of other organs. 3.2 Materials and methods Materials Pathogen free Charles River (Connecticut, USA) white leghorn chickens were used for virus injection and mature feather, growing feather follicle collection. RNA-seq sample preparation and analysis We cut the proximal follicles of 3 primary remiges from spafas white leghorn chicken into the lateral and medial halves and separated the epithelium from the mesenchyme in 2xCMF solution. Total RNA was extracted using Trizol reagent. 4 11g RNA from the four 50 components: lateral side epithelium, lateral side mesenchyme, medial side epithelium, medial side mesenchyme, respectively, were used for library construction by TruSeq RNA Sample Prep Kit Version2 (Illumina). Two batches of samples were sent for sequencing (50bp, single end) with Illumina HiSeq 2000 in the USC Epigenome Center. FastQ files were trimmed and mapped to the chicken genome (ga1Gal3) using TopHat2(Kim et a!., 2013) in Partek Flow. RPKM values were quantified using the Partek Genomic Suite to identify differentially expressed genes. Whole-Mount and section RNA in situ hybridization Whole-Mount in situ hybridization was performed as previously described( Jiang eta!., 1998). Proximal feather follicles were cut open at the rachis side and the mesenchyme was removed in 2xCMF solution to expose the inner side of the epithelial cylinder. Samples were kept flat during probe hybridization with a narrow chamber that fits only 1 ~2 sheets of the flattened epithelial cylinder. Section in situ hybridization was done as described(Zhang eta!., 2009). The Shh and F-Ker probe was previously described(Ng et a!., 2012; Ting-Berreth and Chuong, 1996). Probes for Greml, Sostdcl, Cyp26bl, Crabpl, Aldh6, Zebra Finch (zf) Greml were cloned with the following primers, respectively: c-Greml sense: cgacagcagaagggagaaag; c-Greml antisense: gcacttctcggcttagtcca; c-Sostdcl sense: caagaacgatgccactgaga, c-Sostdcl antisense: tctttgtgatgctggacagg; c-Cyp26bl sense: cctgatagagagcggcaaag; c-Cyp26bl antisense: gttggaatccagtccgaaga; c-Crabpl sense: acctggaagatgaggagcag; c-Crabpl antisense: ggtcacatacaacaccgcatt; 51 c-Aldh6 sense: gcccatcaaggtgtgttctt; c-Aldh6 antisense: tgccaaagcatattcaccaa; zf-Greml sense: catcggtgccttgtttcttc; zf-Greml antisense: gacaccggcactccttaactc. RT-gPCR of cultured pulp cell RN As RNA was isolated with the Qiagen RN easy Mini Kit and the concentration was measured with the NanoDrop 2000 spectrophotometer. 80 ng of RNA from cells of each treatment condition (triplicate) were used to do reverse transcription with Superscript III (Life Technologies). eDNA (200 ng) were used for qPCR with the following primers: Actb sense: gctatgaactccctgatggtc; Actb antisense: ggactccatacccaagaaaga; Greml sense: tcttctgacgggatttctgc; Greml antisense: aatcattgggctgatccttg. Maxima SYBR Green/ROX qPCR Mix was from Thermo Scientific. The Ct values were measured by Agilent Mx3000P qPCR system. The relative quantification was done by pyQPCR v0.9 software. Immunohisochemistry and immunofluorescence Antibodies: pSmadl/5/8 (Millipore, AB3848); ~-catenin (Sigma, C-2206); Phalloidin-FITC (Sigma,P-5282); Crabpl (Abeam, ab2816); PCNA (DAKO, clone PClO); CldU (Abeam, ab6326); RCAS (Hybridoma Bank, AMV-3C2); TUNEL (Roche In Situ Cell Death Detection Kit, POD). Immunostaining follows our published method(Jiang et a!., 1998). Secondary antibody was Alexa Fluor 488 (green) or Alexa Fluor 594 (red) labeled. CldU labeling and quantification To show transient amplifYing cells, chicken were injected with the BrdU homology CldU (Sigma) at 5 mg/kg. Feathers were collected 2 h later. To quantifY CldU positive 52 cell ratio, 6 circles (100 11m diameter) were drawn on the confocal image at different area. CldU positive nucleus and DAPI stained nucleus within the circles were quantified using ImageJ. RCAS virus preparation and injection RCAS-Greml is a gift of J.-C. Belmonte, Salk Institute. RCAS-DNhRARu is from add gene (CC#l865). The pnmers for cloning RCAS-DNRAR~ are: ggggacaagtttgtacaaaaaagcaggcttcattaacatgacaaccagca and ggggaccactttgtacaagaaagctgggtctcaaggaatttccattttcaacgta. The pnmers for cloning RCAS-Aldh6 are: ggggacaagtttgtacaaaaaagcaggcttcagaaccatggccgcggtcaacgg and ggggaccactttgtacaagaaagctgggtctcatggactcttctgggaca. The PCR products were cloned into RCAS using BP-LR reaction (Life Technologies). The viruses were grown and injected as described (Yu eta!., 2002). Confocal microscopy and image processing A Zeiss LS51 0 confocal microscope was used to image the fluorescently labeled specimens. Background correction, z-stack compaction, image stitching and cell counting were done in Fiji ImageJ(Preibisch eta!., 2009; Thevenaz and Unser, 2007). Statistics Please refer to Table 3.3 for the details. Two independent sample T-tests were done with Matlab. One way ANOVAcontrasts were done with SPSS. Mathematical model simulation All the simulation codes for solving the Partial Differential Equations along with 53 analysis of tortuosity and estimation of the barb-rachis angle are developed using Matlab. The equations used are listed and explained below: a a at a 2 a r a+D - 2 a a ax (1) (2) (3) Equations (1-3) I Three-component activator-inhibitor model (Harris eta!., 2005). a, b and c denote the concentration of activator (Shh), inhibitor (BMP) and a second inhibitor, respectively. ab and b, are activator-dependent production coefficients, ba and bb are activator-independent production rates, Da and Db are diffusion coefficients, fa, fb and r, are degradation rates, Sa and s, are saturation constants, and s describes the activators autocatalytic ability. Periodic boundary conditions are prescribed. As time evolves the earlier formed feather propagates upward and cells with high activator concentration degenerates. The speed at which this upward propagation occurs is the gross expansion rate of the feather (V). (4) Equation (4) I Predicted helical growth angles. (B) is equal to the inverse tangent ofthe propagating wave speed of the activator (W) divided by the gross elongation rate of the 54 feather (V). Wave speed was estimated by calculating the product of the mean wavelength and frequency of the travelling activator waves. Wave speed can be thought of as the horizontal component of barb growth as described before (Yue eta!., 2006). (5) Equation (5) I Estimating Tortuosity of Feather Tissue. Tortuosity(/l)is calculated as the length of the shortest path between two points (L) divided by the length of the chord connecting those two points (C) (Shen, L. & Chen, Z. X., 2007). Figure 3.13E shows examples of calculating the path length between two points in a tissue. Mean tortuosity for different feathers are shown in Table 3.2. D*= D ;t' (6) Equation (6) I Relationship between diffusion and tortuosity. The apparent diffusivity coefficient (D') of a molecule in a medium is equal to its free diffusivity (D) divided by the square of the tortuosity of the medium (Shen, L. & Chen, Z. X., 2007). Table 3.2 shows the effect of tortuosity on diffusion coefficients in different feather tissues. A more tortuous medium will lead to a lower apparent diffusion of a molecule. 3.3 Results 3.3.1 Morphological parameters affecting feather vane width/asymmetry We started by comparing the morphologies of primary and secondary remiges m zebra finches (Taeniopygia guttata) and chickens (Gallus gallus), as well as the breast 55 and dorsal contour feathers of roosters. Remiges positioned along the wmg show a continuum of asymmetry, with the lateral primary remiges (furthest from the body midline) most asymmetric and the medial secondary remiges (closest to body midline) least asymmetric (Figure 3.1B-C). Breast and dorsal contour feathers in roosters are symmetric but differ significantly in their vane width (Figure 3.2A). We found two morphological parameters closely associated with vane width and asymmetry. The first parameter is the angle barbs insert into the rachis. The barb-rachis angle is the sum of the barb ridge helical growth angle and the expansion angle after emergence from feather sheath (Prum and Williamson, 200 1 ). Our measurement shows in the same type of feather, wider vanes have larger barb-rachis angles while narrower vanes have smaller angles (Figure 3.1D, Figure 3.2B). So are the helical growth angles, which is an integral part of the bar-rachis angles (Figure 3.3). The other parameter is the spatial distribution of the barb generative zone (BGZ). The BGZ, also called new barb locus (Prum and Williamson, 2001 ), is where barb ridges initiate to form. It is a relatively thin epithelial region contains some irregular tiny branches. BGZ is located centrally between the epithelial regions forming the two vanes in growing contour feathers (Chuong and Edelman, 1985). In asymmetric remiges, BGZ is located more laterally, making the epithelial region forming the lateral vane smaller than that forming the medial vane (Figure 3.1E-F, Figure 3.2C-D). Upon feather maturation BGZ disintegrate to allow the two feather vanes to separate from each other. Since BGZ will not form the vanes, the range of BGZ restricts the epithelial region available for vane formation. We found for the same type of feather, 56 larger BGZ is associated with narrower vanes (Figure 3 .2A-D). A Sinomnhosaurus millenii Protarchaeopteryx robust a / ~ ~ B +--- Lateral (wing tip) c " :ru " '0 .!: ~ 4 ' E 2 E 0 ,., "' <{ D ~ .. Cl) ~ JO "' .!:2 20 .c; u 10 !'! }:, D ffi ID PnPr1PnPliPn S« S.C. S.C Set ~ w v ~ t 2 • 6 8 Lateral vane 0 Medial vane I1J ~:,~ral 0 Medial vane • Rachis • BGZ Microraptor Archaeopteryx lithographica Medial (body)----+ Figure 3.1: Stepwise diversification of feather forms and the characterization of bilateral asymmetric remiges. (A) Fossil feathers with radially symmetric, bilaterally symmetric, bilaterally asymmetric morphologies (Carney et al., 2012; Li et al., 2012; Qiang et al., 1998; Xu et al., 2001). Scale bar: 5 mm, 5 mm, 1 em, 5 em. (B-D) Zebra finch primary (Pri) and secondary (Sec) renuges positioned along the wmg show a continuum of asymmetry inversely correlated with the value of the barb rachis angles in the lateral vanes. The vane widths (measured at 1 em down from the feather distal tip) are highlighted and used to calculate the asymmetric index (medial vane width/lateral vane width, n = 9 per feather position). Barb-rachis angles are highlighted and quantified (n = 10 per vane) (E) Schematic drawing illustrate the layout of rachis, BGZ and two vanes in a growing feather follicle. (F) BGZ regions are localized laterally to a different degree in remiges positioned along the wing. Boxes indicate the BGZ regions magnified below. Scale bar: 100 11m. c o Lateral vane • BGZ • Medial vane • Rachis B F LS_M·I LS_M·II MS·M·I MS_M·II ·1.40 0.00 1.40 (Log2 scale) Figure 3.2 Differentially expressed genes in wide/narrow vaned contour feathers and bilaterally asymmetric flight feathers. (A-B) Comparison of four feather forms reveals narrower feather vanes have smaller barb-rachis angles. Boxes indicate the regiOns magnified on the right. Barb-rachis angles are highlighted. ** p < 0.01 (n = 30 per group). (C-D) Shh in situ hybridization of the 57 opened epithelial cylinders from the four above feather forms show the width of BGZ is inversely correlated with that of the vanes for the same type of feather. ** p < 0.01 (n ~ 4 per group). (E) In situ hybridization of sections from the four feather forms show: mesenchymal Greml expression pattern (arrows) matches the location and width of BGZ. Cyp26bl and CrabpJexpression patterns (arrows) are correlated with relatively narrow and wide vanes, respectively. (F) RNA-seq results of example genes showing lateral/ medial differential expression. Scale bars: 500 flm. 3.3.2 Transcriptome analyses of medial and lateral feather vanes reveal several differentially regnlated pathways To search for pivotal molecular pathways regulating these morphogenetic parameters, we bisected chicken primary remiges, separate epithelium and mesenchyme, and compared the transcriptomes of the lateral vs the medial side using RNA-seq (Figure 3.4). Previous work showed feather phenotypes are mainly controlled by the follicle mesenchyme (dermal papilla and peripheral pulp) (Lin eta!., 2013; Yue eta!., 2005). We mainly focused on differentially expressed genes in the lateral vs medial pulp. We found two BMP antagonists, Sostdcl and Greml, have higher expressiOn in the lateral mesenchyme (1.85 fold; 7.27 fold, p < 0.05). In addition, two genes along the RA pathway: the RA degradation enzyme Cyp26bl and the RA binding protein Crabpl are expressed higher in the lateral and medial mesenchyme, respectively (2.92 fold; 1.95 fold, p < 0.05) (Figure 3.2F, Figure 3.4D). These results are further evaluated with in situ hybridization for transcript localization (Figure 3.2E). 3.3.3 Greml defines the spatial distribution of barb generative zone Comparing in situ hybridization patterns for Greml and Sostdcl, we found Greml 58 has a more localized expression pattern, enriched in the peripheral pulp next to the BGZ (Figure 3 .2E, Figure 3.5A). To see how prevalent this finding is, we examined Greml expression in feathers from zebra finch and Japanese quail. The results were identical to chicken (Figure 3 .5B), suggesting the association between Grem 1 and BGZ is likely to be conserved in birds. B • BGZ • lateral vane • Medial vane Figure 3.3: Helical growth angles are differentially regulated in different feather forms. (A-B) Shh in situ hybridization of opened follicles. Boxed regions are magnified on the right. Helical growth angles are highlighted and quantified. Narrower vanes in the same type of feather have sharper angles. * p < 0.05, ** p < 0.01 (n = 30 for each group). To evaluate the functional role of Grem1 protein, we injected RCAS viral vectors carrying Grem1 (Capdevila et al., 1999) or control (GFP) into follicles of plucked primary remiges. 10 out 15 regenerated feathers showed altered degree of asymmetry (Figure 3 .6A-B). Sectioning the proximal follicle of feathers with phenotypic changes (still growing) revealed expansion of BGZ range compared to controls (Figure 3.6A, Figure 3.7 A). The feathers without phenotypic changes also have different degrees of virus infection, mainly in the epithelium. We speculate that Greml mis-expressed in 59 epithelium may not function properly. Furthermore, inserting Grem 1 protein coated beads (lmg/ml) into growmg follicles induced a BGZ-like phenotype m the neighboring epithelium (Figure 3.6D, Figure 3.7D) (3/4). A c D B MS_E _ 16 r-0.9B ~ 12 .· o_ ./ w . . ~· a ·.~ .-~ .· ~:/. _·· " 4 .4 0 4 B 12 16 LS_E-1 (log2(RPKM)) ~ 15 r=0.96 ::; ~11.2 .I l:: ,' /'~ ~ 1 -02, -4_4 -o 4 a f2 16 MS E-1 (loo2(RPKM)) ~ 9.6 o_ ~ 6.2 Cyp26b1 g 2.8 ~.-0.6• ~ I -. -4--4 -0.6 2:s 6:2 9_6 13 MS_M-1 (log2(RPKM)) ~ 13 r=0.97 ,9.6:,.- "'' gs.2; _ . ·· ~ 2.81. .-- _ , · I I'. ~ ~0.6· . - . .. ' ' .· -44 -0_6 2.8 6~3 LS_M-I(Iog2(RPKM)) Figure 3.4: Comparing transcriptome of the lateral and medial half of chicken primary remiges. (A) Schematics of RNA-seq sample preparation from proximal follicles of pnmary rerniges. Dashed lines show the separation processes. (B) Hierarchical clustering of RNA-seq samples and genes. LS, lateral side; MS, medial side; E, epithelium; M, mesenchyme; I, Batch-1; II, Batch-2. The four genes referred in the main text are indicated. (C) Scatter plots depicting the reproducibility between commensurate samples of the two batches. (D) Scatter plots comparing gene expression in the lateral vs medial mesenchyme. The four genes referred in the main text shown similar pattern between the two batches. 60 2 D Sostdct II A!dh6 + .. pSmad1/518 2 D. ·.:.·· .#'; ... ~ '\.o ~- 3 I pSmad115/8 DAPI , • Lateral • Medial vane vane • BGZ • Rachis Figure 3.5: Sostdcl, Aldlt6, Greml expression and pSmadl/5/8 distribution in different feather forms. (A) Sostdcl and Aldh6 expression patterns in the four feather forms. Regional differential expression patterns are indicated by arrows. Scale bar: 5 mm, 500 11m. (B) Greml expressiOn patterns m zebra fmch and Japanese quail remiges are similar to those of chicken. Scale bar: 2 mm, 100 11m. (C) Greml expression pattern is complementary to pSmadl/5/8 nuclear staining spatially. Black boxes show regwns magnified. Golden boxes indicate regions magnified to show pSmadl/5/8 immuno-fluorescence. Scale bar: 100 !liD· To see if Grem 1 's function involves alterations in BMP signaling, we examined the distribution of phosphorylated (p)-SMADl/5/8. We observed nuclear pSMAD l/5/8 staining in the rachis and vane region, but not in the BGZ of normal feathers (Figure 3 .5C). While in the Greml bead experiment nuclear pSMAD 115/8 disappeared next to the bead (originally vane region) (Figure 3 .6D). Eventually, the BGZ region generally shows fewer proliferating cells (using 2 h CldU labeling) than in the rachis and vanes (Figure 3.8) (19). This may explain why it is thinner than other regions ofthe epithelial cylinder. Meanwhile Greml mis-expressed follicles also showed fewer proliferating cells (PCNA staining) than controls (Figure 3.6C, Figure 3.7B-C). Thus, Greml adjusts the location and range of the BGZ to modulate the feather epithelial area for vane formation. 61 A I ~hh c I I L----> G"-'re"-"m"-1 _.....JI B 1 2 c 1 2 1 2 • Lateral vane • Medial vane • BGZ • Rachis 0 BSA bead !~ n nn a; 1 ~ >- < c RCAS -GFP hGrem1 bead RCAS -Grem1 Shh II pSmad1/5/8 L____; S,_,h"-h ---'11 psmad1t5ts 0 E l Figure 3.6: Greml is the key factor specifying the location and width of barb generative zone. (A) Compared to GFP mis-expressed controls, Greml mis-expressed feathers have vanes of reduced width and BGZ of increased width. Boxes indicate the boundary regions between BGZ and vanes rna gnified below. Arrowheads indicate regions examined in (c). Scale bars: 5 mrn, 500 11m. (B) Greml mis-expression changes the degree of asymmetry. ** p < 0.01 (n = 10). (C) Greml mis-expressed region has less cell proliferation than control. Scale bar: 100 11m. (D) hGreml soaked beads induced BGZ-like morphology and loss of nuclear pSmadl/5/8 in the neighboring epithelium. Black boxes show regions magnified. Scale bar: 500 11m. 3.3.4 RA pathway is differentially regulated in asymmetric feather vanes In the four feather types examined, the Cyp26bl transcript is highly expressed in the peripheral mesenchyme of narrow-vaned but not wide-vaned contour feathers. Crabpl shows the opposite distribution. In the primary remiges, Cyp26bl and Crabpl are enriched in the peripheral pulp corresponding to the lateral and medial vane, respectively (Figure 3.2£). Crabp1 is a marker of RA presence, and its nuclear translocation may imply increased nuclear RA uptake (Donovan et al., 1995; Gustafson et al., 1996). Immunostaining reveals enrichment of nuclear Crabp1 positive cells in the pulp mesenchyme corresponding to wider vanes, but not narrower vanes in the same type of feather (Figure 3.9). In addition, one RA synthetase, Aldh6, exhibits similar expression as Crabpl in the breast contour feather (Figure 3.5A). These observations imply an 62 association between RA signaling and feather vane width. Cyp26b1 C\ 2 1 2 1 2 • Lateral vane • Medial vane • BGZ • Rachis Figure 3.7: Applying exogeneous Greml induces BGZ morphology and decreases cell proliferation. (A) H&E staining and Cyp26bl in situ hybridization of RCAS-GFP, RCAS-Greml injected feather follicles, respectively. The boundaries between BGZ and two vanes are highlighted (boxes). Arrowheads indicate regions examined in (b). Scale bar: 100 ~· (b) Decreased cell proliferation was detected upon Greml mis-expression compared to control. (c) Quantification of PCNApositive cell ratio. *p < 0.05, **p < 0.01 (n = 6 for each region). (d) hGreml soaked beads induced BGZ-like morphology (H&E staining). The most critical question is whether this is simply correlation or has a functional relationship. Therefore we evaluated the role of perturbing RA signaling in asymmetric feather formation. Previously we mis-expressed RCAS-Aldh6 in feather follicles but observed no phenotype (Figure 3.10A, n = 10), possibly because RA processing demands multiple enzymes. Neither did RCAS-dominant negative (DN) human RARa (Sen et al., 2005) (not shown, n = 10), possibly due to the lack of RARa expression in feathers (Supplementary Database 1 ). Next we cloned (Damm et al., 1993) and mis-expressed DN chicken RARB. It induced reproducible decreases in feather vane widths and sharper barb-rachis angles (Figure 3.11A-B) (12/ 12). The helical growth angles were also sharper (Figure 3.12A). These observations indicate RA signaling modulates barb-rachis angles 63 to adjust feather vane width. A ~ c 8 "' "' ~ Ol ~ 8 1 " .2' E ~ ~ "' I? 8 " (J) " .2' E ~ ~ "' E (f I Grem1 3 Rach1s 0 Lateral vane 10 0 4BGZ 0 10 0 4 3 0 10 0 4 3 0 10 4 0 1 2 .. - • Lateral vane • Medial vane • BGZ • Ractus ... ... L•terel Nltdlal Aachls BGZ LaterW Medii!! Rachis BGZ Figure 3.8: Endogenous BGZ show lower cell proliferation rate than other epithelial components. (a) Cell proliferation (2 h CldU labeling) at Greml postive (BGZ) and negative regions (two vanes, rachis). Black boxes indicate the regions magnified and quantified. Scale bar: 500 f.ltn. lOOfJ.m. (b) Quantification results for the corresponding feathers. *p < 0.05, **p < 0.01, NS : not significant (n = 6 for each region). Figure 3.9: Differential distribution of Crabpl nuclear localization in the four feather forms. Immuno-fluorescence with Crabpl antibody show nuclear staining in the peripheral pulp mesenchyme of breast contour feathers and medial vane of remiges. Arrowheads indicate the region examined on the right. White arrows indicate nuclear Crabp 1. Scale bar: 20 fJ.ffi. 64 3.3.5 Mathematical model links molecular activity to cellular events and organ shapes The periodical branching of barb ridges is known to be a self-organized pattern generated by activator-inhibitor diffusion and interactions (equation (1-3)) (Harris et a!., 2005). The localized expression of Greml brings down the inhibitor (BMP)'s activity, causing localized overproduction of the activator. The activator specifies the area that will be carved out from feather epithelium cylinder upon feather maturation. Therefore the width of Greml expressed region is inversely correlated with the epithelial regwn available for vane formation. Off-centered localization of Greml positive regwn unequally demarcates the vane forming regwn unequally, contributing to bilateral asymmetry phenotype (Figure 3.13A-B). In the aspect of RA signaling, we wondered how DNRAR mis-expression alters barb-rachis angles at the cell level. One clue is that the four types of feathers we compared have different epithelial cell shapes, especially close to the BGZ. Those in wide-vaned feathers (higher Aldh6 or Crabpl) show cuboidal shapes; while those in narrow-vaned feathers (higher Cyp26bl) are more elongated in the proximal-distal direction (Figure 3.11 C, Figure 3.14 ). Interestingly, epithelial cells in follicles mis-expressing DNRAR~ are also more elongated than controls (Figure 3.11D-E, Figure 3.12B-C). Therefore RA level changes can somehow modulate epithelial cell shapes. With the help of mathematical modeling, we propose two possible mechanisms that can link cell shape alteration with the helical growth angle, which is a component of the barb-rachis angle: (i) The helical growth angle is an arctangent function of the 65 activator's traveling wave-speed over the gross elongation rate (Figure 3.13C, equation (4)). Since cell shape elongation increases the gross feather elongation rate, it would reduce the helical growth angle (Figure 3.13D). (ii) Elongated cell shape can increase tissue tortuosity (Figure 3 .13E, equation (5)), which decreases the activator/inhibitor diffusivity. The smaller traveling wave-speed of the activator also produces a sharper helical growth angle (Figure 3.13F, equation (6)). However, altering the traveling wave-speed ofthe inhibitor can hardly affect the helical growth angle (Figure 3.15). We also examined other cellular mechanisms that may contribute to asymmetry formation. Cell proliferation rates in medial and lateral vanes in primary remiges were quantified (using 2 h CldU labeling) but did not yield any significant difference (Figure 3 .16A-B). The distribution of apoptotic cells was similar to the F-Ker expression pattern (Figure 3 .16C-D), suggesting the apoptosis is associated with cell differentiation (Chang et al., 2004 ), which occurs after feather patterning. A .____, G""'re""'m '--1 _ _,II RCAS I • Aclb • Gremt l O h 24h 48 h Figure 3.10 Exploring potential cross-talks between Greml and RA pathway. (A) Aldh6 mis-expression has no notable motphological changes compared to the control and the Greml expression pattern is also similar. (B) qRT-PCR for Actb (for normalization) and Greml from pulp cells cultured with DMSO, RA and Citra!. RA treatment caused significant decrease of Greml expression. ** p < 0.01, NS: not significant (n = 3 per treatment condition). (C) Applying Citra! to pulp cell culture inhibits cell number increase. 66 " c ~ O AS -GFP H&E Shh II 0: .:::::;:::::. 2 1 <) () 1 2 Grem1 ~ 02 2- - <) <> · 1 2 Figure 3.11: Retinoic acid signaling modulates epithelial cell shape, barb-rachis angle, and feather vane width. (A) Compared to the GFP mis-expressed controls, RCAS-DNRAR~ treated feathers have significantly reduced vane width and sharper barb-rachis angles. Boxes highlight boundaries between BGZ and vanes. Arrowheads highlight regtons examined in (c).Scale bars: 5 mm, 5 mm, 500 11m. (B) Barb-rachis angles and vane width are significantly reduced upon DNRAR~ mis-expression. **p < 0.01 (n = 15 (upper), n = 8 (lower)). (C) BGZ epithelial cell shapes in feathers with different RAlevels. Scale bar: 50 11m. White outlines highlight cell boundaries. (D-E) BGZ epithelial cells are more elongated upon DNRAR~ mis-expression. The cell aspect ratio is significantly different but not the cell area. NS: not significant (n = 30). Figure 3.12: Effect of RA perturbation on helical growth angle, epithelial cell shape and Greml expression. (A) Compared to GFP mis-expressed controls, RCAS-DNRAR~ infected follicles show smaller helical growth angles (highlighted by red angle symbols). (B-C) Epithelial cells bear more elongated shape in feathers treated with RCAS-DNRAR~. Arrowheads indicate the three regions examined on the right. Scale bar: 100 11m. *p < 0.05, **p < 0.01, NS : not significant (n = 30 per region). 67 A ~- B ;~~:~?> ~i~ l..J-A--L 1--L~ j_ ~IIillllc·-:~ OFeather epithei ;;l area forming v anes ~ • Fealh eo epithe~al area not rooming vao·es f{t"~~<i D (i) - Meastred Angle Predicted Angle ~50~ (i) ~ (iii) -;j .~~.49.!!' ~30 M .!!. ~~ A ~ •• ~ 1 ~ @. 0 o.5 1 1.5 2 Circumference E F., 35 ~· :.E 25 ~ -e 15 ~ Gross fea:her elongation rete [ioi) (v) (V ) 27.5" ~~335' Figure 3.13: Mathematical modeling reveals how Greml and RA signaling modulate the basic periodical branching mechanism. (A) Simulating variation of feather vane widths and asymmetry by Greml 's inhibition of B.MP activity. (B) Schematic of the interaction between Grem 1 and the patterning machinery of periodical branching. (C) Vectors affecting the helical growth angle 8. AB: feather gross elongation rate. AC: the traveling wave-speed of the activator. (D) Helical growth angle decreases with the increase of gross feather elongation rate and feather simulations of selected data points. Measured angles are simulated using the activator-inhibitor model; predicted angles are calculated by an arctangent function of wave speed over gross elongation rate "' 0 a 004 0 · 008 0 · 012 (equation ( 4)). (E) Differential epithelium tortuosity in different feathers (equation (5), Table 3.2). Red lines: shortest path around the cells; blue lines: the distance between two points. Tissue tortuosity is inversely correlated with activator/inhibitor diffusivity. (f) Helical growth angle increases with the increase of activator's diffusivity and selected feather simulations. Model Parameter Figure 3.13A Figure 3.13D Figure 3.13F Figure 3.15 ab (a.u.) 0.015 0.015 0.015 0.015 ba (a.u.) 0 0 0 0 max(bb) (a.u) 0.004 0.004 0.004 0.004 be (a.u.) 2.50E-04 2.50E-04 2.50E-04 2.50E-04 Da (a.u.) 0.008 0.008 Varied 0.008 Db (a.u) 0.2 0.2 0.2 Vari:d V (a.u.) 1 Vari:d 1 1 ra (a.u.) 0.01 0.01 0.01 0.01 rb (a.u.) 0.015 0.015 0.015 0.015 rc (a.u.) 3.00E-04 3.00E-04 3.00E-04 3.00E-04 s (a.u.) 0.01 0.01 0.01 0.1 sa (a.u.) 1.8 1.8 1.8 1.8 sc (a.u.) 0.3 0.3 0.3 0.3 Table 3.1: Simulation parameters for the activator-inhibitor model 68 Feather Breast contour Dorsal contour Primary remige (lateral) Primary remige (medial) Mean Tortuosity (a.u.) 1. 13 D: D* (a.u.) 1 0. 78 1. 61 1 0. 39 1. 34 1 0. 56 1. 18 1 0. 72 Table 3.2: Mean tortuosity and its effect on diffusion. Last we would like to know whether Greml and RA signaling cross-talk in feather asymmetry formation. Cyp26bl expression remains nonnal upon Greml mis-expression (Figure 3.7 A). RCAS-DNRAR~ and RCAS-Aldh6 treatment barely causes any changes of Greml expression pattern, respectively (Figure 3.11A, Figure 3.1 OA). In pulp cell culture, RA (40 )lM) treatment decreased Greml expression ~2 fold (Figure 3.10B). To inhibit RA signaling we tried different doses of Citral (Tanaka et al., 1996). Even at an anti-proliferative dose (Chaouki et al., 2009) (Figure 3.10C), Greml expression levels were not significantly changed. Thus we consider Greml and RA signaling generally work independently through different cell processes to shape bilateral asymmetry in flight feathers. 5 - g . (' i:liLn Jl 1 2 .) 4 5 s :1(1)~ -~-Hnn ~ 100 0 123456 Figure 3.14: Narrower and wider vanes in the same type of feather have differential epithelial cell shapes. (A-B) Staining cell boundaries with (Phalloidin-FITC) reveal narrower vanes have more elongated cell shapes. Scale bar: 100 flill. **p < 0.01, NS: not significant (n = 30). 69 400 200 .,....,. E" ~~ ~ 35 :--J~-J.---i :o:::::-...,j \....--. • (v) :~= 25 ~- _, (~ i) ~-- (iii) ~ 15 ~· --r~ -t--i Ill 0.1 0.2 0.3 Diffusivity of the inhibitor 0.4 - Measured Angle • Predicted Angle ~;~~ 1' Circumference l ~il~ ~ 31.0° Circum erence ll"'' Circumference 3.4 Discussion Figure 3.15: Changing inhibitor's diffusivity has little effect on the helical growth angle. Increasing the inhibitor's diffusivity can only trivially increase the helical growth angle. Feather simulations of corresponding data points are shown on the right. How organs are shaped is a fundamental question m development and critical in tissue engmeenng. We have been usmg feather as the model system to decipher the principles of morphogenesis. Feathers exhibit distinct functional forms under direct pressure of nature selection. Therefore molecular circuits controlling their shapes are likely to be more flexible and changes caused by perturbation can be assayed clearer. Meanwhile feathers exhibit robust regenerative power, providing a good opportunity to do test candidate molecular pathways during plucking and regeneration. The shaping of bilateral asymmetric remiges is an intriguing evo-devo question because this shape is a cmcial trait adapting to powered (flapping) flight in feathery dinosaurs and early birds. During evolution the emergence of bilateral asymmetric remige is likely to occur after the appearance of passive (gliding) flight behavior. One reason is that in wind tunnel experiments, unfeathered model of the four-winged lvficroraptor gui performs almost equally well as the feathered ones, suggesting highly derived lifting surfaces are not required for medium -distance gliding from moderate heights (Dyke et al., 70 2013). The other reason is that Pedopenna daohugouensis and Anchiornis huxleyi have hindlimb wings composed of long symmetric feathers (Hu et al., 2009; Xu and Zhang, 2005). However, when it comes to long distance flight or high altitude flight, which requires propulsion force generated by flapping, asymmetric remiges have unprecedented superiority mentioned previously. Hence we speculate lvficroraptor gui is at a transition stage between the passive and powered mode of flight while ArchaeopfelJ'X lithographica is possibly well adapted to powered flight (Figure 3.1A). c D r·ru NS n NS NS 8 0 3 f' . £;0.2 -~ ~ · " l) 0 • Lateral vane 1 • Medial vane I Figure 3.16: Cell proliferation rate, apoptosis and differentiation events in feathers. (A-B) Confocal images of 6 regions from the lateral and medial vane of a primary remige follicle (longitudinal section) show cell proliferation rate (2 h CldU labeling). No significant difference was found between the two vanes (n = 6 per region). Boxes indicate regions magnified and quantified. Scale bar: 100 Jlffi. (C) TUNEL staining showing the distribution of apoptotic cells. (D) F-Ker expressiOn patterns are similar to the distribution of TUNEL positive cells in different feather forms. Red boxes show regions magnified. Scale bar: 500 Jlffi. Beside the evolution history of the bilateral asymmetric renuges we are also concemed about the patterning mechanism and molecular circuitry underlying its 71 morphogenesis. Bilateral asymmetry is an integral part of vertebrate body plan and is crucial for the correct positioning and morphogenesis of internal organs. It is known that the asymmetric expression of Nodal, Lefty and Pitx2 in lateral plate mesoderm is essential for this process (Tetsuya Nakamura and Hiroshi Hamada 2012). Yet the mechanisms establishing bilateral asymmetry within individual organs are less well understood. The flight feathers not only established bilateral asymmetry in individual follicles, but also show a continuum of asymmetry along the wing. Different wing shapes, summing up relative length and levels of asymmetry in each flight feather, allow different modes of flight (Scott and McFarland, 201 0). Therefore, unlike the all-or-none decision in the body left-right axis, there is an incremental change of asymmetry in a population of feathers. The underpinning molecular mechanisms will not only need to produce bilateral asymmetry, but also be able to modulate the degree of asymmetry according to the distance of the feather follicle from the body midline. 72 Figure No. Test type Sample size (n) p-value Figure 3.2B (left) Two independent sample t-test 60 4.42E-71 Figure 3.2B (right) Two independent sample t-test 30 2.68E-52 Figure 3.2D (left) Two independent sample t-test 4 1.20E-09 Figure 3.2D (right) Two independent sample t-test 4 3.73E-04 Figure 3.3B (left) Two independent sample t-test 40 1.63E-19 Figure 3.3B (right) Two independent sample t-test 20 8.22E-24 Figure 3.6B Two independent sample t-test 10 3.47E-07 Figure 3. 7C (left) Two independent sample t-test 6 1.10E-02 Figure 3. 7C (right) Two independent sample t-test 6 0.0039 Figure 3. 8B (brest contour) One-Way ANOVA contrasts 24 0.197 Figure 3. 8B (dorsal contour) One-Way ANOVA contrasts 24 0.005 Figure 3. 8B (secondary remige) One-Way ANOVA contrasts 24 0.019 Figure 3. 8B (primary remige) One-Way ANOVA contrasts 24 0.001 Figure 3.10B (DMSO vs RA) Two independent sample t-test 3 7.20E-04 Figure 3.10B (DMSO vs CitraD Two independent sample t-test 3 0.4606 Figure 3.11B (upper lateral vs lateraD Two independent sample t-test 15 5.75E-32 Figure 3.11B (upper medial vs mediaD Two independent sample t-test 15 1.83E-21 Figure 3. 11 B (bwer lateral vs lateral) Two independent sample t-test 8 4.42E-05 Figure 3.11B (bwer medial vs mediaD Two independent sample t-test 8 3.36E-06 Figure 3.11E (upper) Two independent sample t-test 30 1.12E-12 Figure 3.11E (bwer) Two independent sample t-test 30 0.0917 Figure 3.12C (upper left) Two independent sample t-test 30 2.08E-07 Figure 3.12C (upper middle) Two independent sample t-test 30 1.12E-12 Figure 3.12C (upper right) Two independent sample t-test 30 4.58E-09 Figure 3.12C (lower left) Two independent sample t-test 30 2.15E-07 Figure 3.12C(lower middle) Two independent sample t-test 30 0.0917 Figure 3.12C (lower right) Two independent sample t-test 30 0.0318 Figure 3.14B (upper left) Two independent sample t-test 30 1.33E-17 Figure 3.14B (upper middle) Two independent sample t-test 30 4.86E-01 Figure 3.14B (upper right) Two independent sample t-test 30 1.27E-15 Figure 3.14B (bwer left) Two independent sample t-test 30 2.16E-01 Figure 3. 14 B (bwer middle) Two independent sample t-test 30 4.53E-Ol Figure 3.14B (bwerright) Two independent sample t-test 30 1.86E-15 Figure 3.16B (left) Two independent sample t-test 10 0.792 Figure 3.16B (middle) Two independent sample t-test 10 0.4976 Figure 3.16B (right) Two independent sample t-test 10 0.5118 Table 3.3: Statistical summary. The test-types, sample sizes and p-values. One such molecular mechanism we found is that Greml (peripheral pulp mesenchyme) I BMP (epithelium) interaction defines the BGZ's location and width. BGZ is present between the vane-forming epithelial regions in growing feather follicles. 73 Because the circumference of the epithelial cylinder is generally fixed (or at least cannot change dramatically in a short time), the width of BGZ restricts the epithelial area available for vane formation. Larger BGZ results in smaller area for vane formation, and smaller BGZ yields more space to form vanes. The location of BGZ determines how the vane forming epithelium is demarcated: centrally located BGZ leads to bilateral symmetric vane formation. Off-centered BGZ yields vanes of unequal widths, and therefore asymmetry in feather shape. Then how is the spatial expression of Greml determined? In other systems, body axis organizers such as the Homeobox gene family and Tbx genes have been reported to regulate Grem1 expression (Farin eta!., 2013; Nie eta!., 2011; Sheth eta!., 2013). In the future we will investigate histone modification and transcription factor binding in enhancer regions ofGrem1 during feather morphogenesis. However, the location of BGZ alone is not sufficient to explain the divergent levels of asymmetry in mature remiges. By cross-sectioning or cutting open a primary remige's proximal follicle it is easy to find out the ratio between the epithelial regions forming the medial and lateral vane is far less than that that in a mature feather (Figure 3.1B, 1F and Figure 3.2A). So there must be other mechanisms enhancing the level of asymmetry. Adjusting barb-rachis insertion angle is one of them. The barb-rachis angle in mature feather reflects the combination effect of helical growth angle and expansion angle of barbs after the feather sheath breaks apart (Prum and Williamson, 2001 ). We found the helical growth angle is generally 1/3 of the barb-rachis angle observed in mature feather 74 (Figure 3.2B and Figure 3.3B). Previously we have shown the helical growth angle can be affected by Wnt3a. Putting Wnt3a coated beads in growing feather follicle made barbs sway towards it (Yue eta!., 2006). We believe that anterior-posterior Wnt3a gradient sets up the basic helical growth angle and RA signaling step in to tune it in different feather forms. RA signaling is mainly controlled by the combined action of RA synthesizing (Rdhs, Raldhs) and degrading enzymes (Cyp26s). RA binding proteins (Crabps) also help modulate RA signaling by present RA either to its metabolizing enzymes or to its nuclear receptors (Rhinn and Dolle, 2012). Raldhz 1 - mouse embryos have been reported to show bilateral asymmetric somitogenesis due to left-right desynchronization of the segmentation clock oscillations. Our study here indicates differential RA signaling is also involved in bilateral asymmetric vane formation in feather follicles. Higher level RA (Crabpl +, Aldh6+) results in wider vanes with large helical growth angles. Lower level RA (Cyp26bl +)yields narrower vanes with smaller helical growth angles. Perturbing RA signaling with dominant negative RAR leads to sharper helical growth angles and narrower vane formation. Then how does RA signaling modulate helical growth angles? We observed differential feather epithelial cell shapes in feather vanes of different RA levels. Higher RA is associated with cuboidal shapes while lower RA is associated with shapes more elongated along proximal-distal axis. In other systems, RA signaling also has been shown to regulate multiple biological processes including studies reporting its effect on cell shape/polarity (Brown and Benya, 1988; Horton and Hassell, 1986). Cell shape 75 polarization is usually related to planar cell polarity (PCP) signaling (Li and Dudley, 2009; Seifert and Mlodzik, 2007). Meanwhile non-canonical Wnt/PCP pathway has also been implicated in establishing body bilateral asymmetry through regulating cilia movement and distribution (Nakamura et a!., 2003). Our RNA-seq data did not show significant differential expression of PCP pathway members (e.g. Wnt5a, Wnt5b, Wntll, Fzd3, Fzd6) between the lateral and medial side (Supplementary Database 1 ). However, because PCP proteins endow cell polarity through asymmetric localization within cells, which will not be detected by the RNA expression analysis. It is still possible they are involved in cell shape modulation during asymmetric feather vane formation. Asymmetric cell shapes have also been implicated in bilateral asymmetric organogenesis such as gut rotation (Plageman et a!., 2011 ). To gain a more holistic understanding, we applied mathematical simulations to help comprehend how these processes function. The previous activator-inhibitor model can easily explain how Greml specify the BGZ region and hence modulate the epithelial regions form feather vanes (Harris et a!., 2005). However we found Shh, which was claimed to be the activator in this model, did not show highly increased expression at the BGZ as it supposed to be. One possibility is that Shh has certain negative feedback mechanism that tunes down its expression when overproduced, or Shh may work as a downstream factor of the real activator that carries out only part of its function. In the aspect of RA signaling, we proposed two mechanisms, namely gross feather elongation rate and tissue tortuosity, to link cell deformation with barb-rachis angle change. Because 76 the epithelial cylinder can generally be considered as a flat sheet so we applied a 2D model to demonstrate how tissue tortuosity affects morphogen diffusion. Besides the barb-rachis angle and the spatial distribution of BGZ, there are other parameters that can modulate feather vane width and feather follicle circumference is one of them. We think it's possible that the follicle circumference changed gradually during feather growth to produce the smoothly arced outline of feathers. However the keratinized follicle sheath and the tension from ex-follicular musculature may limit this change to a very restricted range. I 4 ~ follicle Circumference i ~ (RA. other?) t ~ lateral·med•al s c•ahzation ~. (D11feren11a1 Grem11RA acbv1ty) ~ I I Structural features I Unbranched filament Radial symmetry Bilateral symmetry Vane width adjustment Bilateral asymmetry Figure 3.17: Integration of boundary-organized patterning with self-organized patterning during feather form diversification. Step-wise feather form diversification during evolution from periodically formed filamentous structures to the bilateral asymmetric flight feathers. Blue highlights self-organized patterning and red highlights boundary organized patterning. In summary, during evolution feather forms diversified multiple times to reach the enormous spectrum today from the original filamentous shape (Chen et al., 1998). The original periodical formation of each feather (filament) is a self-organized pattern mediated by FGF (activator) and BMP (inhibitor) (Jung et al., 1998). When the single feather filament start to branch, another set of self-organized patterning was recruited involving BMP, Noggin, and Shh signaling (Harris et al., 2005; Yu et al., 2002). To form bilateral symmetric feather vanes an anterior (rachis)-posterior (BGZ) Wnt3a gradient 77 was created. The relative position of the rachis in feather follicle is generally fixed with reference to body anterior-posterior axis, suggesting the Wnt3a mechanism is a type of boundary-organized (cell behaviors determined by their positions relative to fixed landmarks) patterning. Here we show another two boundary-organized patterning mechanisms, mediated by Greml and RA signaling, work through different cell processes to shape the bilateral asymmetry morphology (Figure 3.17). Interestingly, both mechanisms are carried out in the form of mesenchymal-epithelial interactions. Mesenchymal-epithelial interactions have also been reported to specify the morphology of other skin appendages such as hairs (Driskell eta!., 2009). Yet further study will be required to identify the upstream mechanism initiating these mesenchymal regulatory modules and understand how to regulate these modules through space (body regions) and time (physiological developmental stages). 78 Chapter 4 Conclusions and perspectives The establishment of organ polarity is a fundamental biological question as well as a critical issue for future regenerative medicine. In my Ph.D. projects described above I explored the molecular basis and patterning rules underlying polarity establishment using feather as the model system. The first project revealed a molecular module composed of Wnt/Notch signaling and the cell motor protein non-muscle myosin liB mediates the precise elongation of feather buds along the rostral-caudal direction. In the second project I found Greml and RA signaling converge onto the establishment of bilateral asymmetry in flight feathers by modulating different morphological parameters. For the first project there are at least two related issues worth further exploration: A. What is the upstream signal determining the location of the Wnt/Notch/NM liB module? B. Since Wnt/Notch crosstalk is so widely present in developmental processes, is the Wnt/Notch/NM liB module also involved in polarity establishment of other organs? We currently have some clue for Issue A. Using RNA-seq and in situ hybridization we discovered the differential expression of some Voltage Gated Calcium Channel (VGCC) proteins in the feather bud epithelium at different development stages. Live imaging of E8 chicken embryonic skin using fluorescent calcium sensor (GCaMPSg, GCaMP6s) indicates the presence of active calcium channels within feather bud and the endogenous cytoplasmic calcium level of feather bud epithelial cells show inhomogeneity along the 79 A-P ax1s. More important, apply calcium channel blockers can cause feather bud misorientation. We speculate a systematic calcium gradient may help set up the A-P polarity for the feather tract. As to Issue B we are current doing immunostaining for chicken embryos at different developmental stages and searching for sites with local enrichment of nuclear ~-catenin and NM liB. The regulation of actomyosin network is known to be regulated by phosphorylation of the myosin regulatory light chain (Vicente-Manzanares et a!., 2009). The mechanisms controlling specific myosin heavy chain subtype have rarely been reported. We hope to start from the relationship between nuclear ~-catenin and NM liB to explore what determines the differential expressions of the three subtypes of myosin heavy chains in different cell types. For the second project one related question is how could remiges along the wing form a continuum of asymmetry, with those close to the wing tip more asymmetric and those close to the body midline more symmetric. This phenomenon itself indicates the feather follicles can somehow detect their positions relative to the body axis and modulate the feather phenotype accordingly. In other words this 1s a case the body polarity cue can modulate the polarity of individual skin appendages. The largest suspect providing the body positional information is the homeobox genes such as the Hox family (Mallo et a!., 201 0). This is particularly interesting because Hox genes have been known to specify limb axis (Zakany et a!., 2004). It is possible the predetermined Hox codes in the mesenchyme are now used to regulate different degrees 80 of feather asymmetry. It is worthwhile to examme whether homeobox genes can modulate the expresswn of the genes controlling the bilateral asymmetry phenotype. Previous studies show HoxA/D clusters are required for activation of Greml expression in limb development. In enhancer-report assay HoxD9 can bind to the HMC01 enhancer of Greml and up-regulate the expression of the reporter. Another homeobox gene, Six1 modulates Greml expression during branching morphogenesis of metanephric mesenchyme (Nie eta!., 2011). Currently we are doing Chromatin immunoprecipitation sequencing (ChiP-seq) to identify activated and repressed enhancers for the genes associated with bilateral asymmetry morphology. We will further analyze these enhancer regions to determine whether they contain homeobox gene binding sites. In the future, we may even try genetically editing these enhancers with CRISPR (Ran et a!., 2013) and examining whether they can indeed affect the expression pattern of genes such as Greml, Cyp26bl, Crabpl, and alter the feather phenotype. On the other hand, RA signaling has been reported to modulate Hox gene (such as HoxA7, HoxDJO, HoxDJJ) expression through the retinoic acid response element in their regulatory sequences (Gerard et a!., 1993; Gerard et a!., 1996; Kim et a!., 2002). Our RNA-seq data show HoxA 7 is highly expressed in the remige but not significantly different between the lateral and medial side. This may be because the follicles we collected for RNA-seq are from different locations of the wing. Although up till now we don't have solid evidence supporting the crosstalk between RA and Grem1 signaling. We consider it possible that RA signaling modulate Greml expression indirectly through 81 adjusting Hox gene expression. Another evo-devo question deriving from the second project is how the remiges from ratites (such as ostriches) become bilateral symmetric in shape. The flightlessness of ostrich is known to be secondary (Kavanau, 201 0), meaning the original molecular mechanisms forming the bilateral asymmetric shape become defective. Because genes such as Greml, Cyp26bl and Crabpl are also involved in many other developmental processes, it is unlikely that the coding regions of these genes become mutated to generate the symmetric shaped remiges in ostriches. We hypothesize that during evolution single nucleotide polymorphism (SNPs) occur in the regulatory sequences (e.g. feather-specific enhancers) for one or more of these genes, causing changes of transcription factor binding and gene expression pattern. Ostrich genome is under sequencing in BGI-Genome lOK project. Once it becomes publicly available we can compare it to the chicken genome in search of the SNPs. 82 Bibliography Brown, J.D., Hallagan, S.E., McGrew, L.L., Miller, J.R., and Moon, R.T. (2000). The maternal Xenopus beta-catenin signaling pathway, activated by frizzled homologs, induces goosecoid in a cell non-autonomous manner. Dev. Growth Differ. 42, 347-357. Brown, P.D., and Benya, P.D. (1988). Alterations in chondrocyte cytoskeletal architecture during phenotypic modulation by retinoic acid and dihydrocytochalasin B-induced reexpression. J. Cell Bioi. 106, 171-179. Capdevila, J., Tsukui, T., Rodriquez Esteban, C., Zappavigna, V., and Izpisua Belmonte, J.C. (1999). Control of vertebrate limb outgrowth by the proximal factor Meis2 and distal antagonism ofBMPs by Gremlin. Mol. Cell 4, 839-849. Caricasole, A., Ferraro, T., Iacovelli, L., Barletta, E., Caruso, A., Melchiorri, D., Terstappen, G.C., and Nicoletti, F. (2003). Functional characterization ofWNT7A signaling in PC12 cells: interaction with A FZD5 x LRP6 receptor complex and modulation by Dickkopfproteins. J. Bioi. Chern. 278, 37024-37031. Carney, R.M., Vinther, J., Shawkey, M.D., D'Alba, L., and Ackermann, J. (2012). New evidence on the colour and nature of the isolated Archaeopteryx feather. Nat. Commun. 3, 637. Chang, C.H., Jiang, T.X., Lin, C.M., Burrus, L.W., Chuong, C.M., and Widelitz, R. (2004). Distinct Wnt members regulate the hierarchical morphogenesis of skin regions (spinal tract) and individual feathers. Mech. Dev. 121, 157-171. Chang, C.H., Yu, M., Wu, P., Jiang, T.X., Yu, H.S., Widelitz, R.B., and Chuong, C.M. (2004). Sculpting skin appendages out of epidermal layers via temporally and spatially regulated apoptotic events. J. Invest. Dermatol. 122, 1348-1355. Chaouki, W., Leger, D.Y., Liagre, B., Beneytout, J.L., and Hmamouchi, M. (2009). Citra! inhibits cell proliferation and induces apoptosis and cell cycle arrest in MCF -7 cells. Fundam. Clin. Pharmacol. 23, 549-556. Chen, C.W., Jung, H.S., Jiang, T.X., and Chuong, C.M. (1997). Asymmetric expression ofNotch/Delta/Serrate is associated with the anterior-posterior axis of feather buds. Dev. Bioi. 188, 181-187. 83 Chen, P., Dong, Z., and Zhen, S. (1998). An exceptionally well-preserved theropod dinosaur from the Yixian Formation of China. Nature 391, 147-152. Chiappe, L.M. (2007). Glorified dinosaurs: the origin and early evolution of birds (Hoboken, NJ: John Wiley). Chodankar, R., Chang, C.H., Yue, Z., Jiang, T.X., Suksaweang, S., Burrus, L., Chuong, C.M., and Widelitz, R. (2003). Shift oflocalized growth zones contributes to skin appendage morphogenesis: role of the Wnt/beta-catenin pathway. J. Invest. Dermatol. 120, 20-26. Chuong, C.M., Chodankar, R., Widelitz, R.B., and Jiang, T.X. (2000). Evo-devo of feathers and scales: building complex epithelial appendages. Curr. Opin. Genet. Dev. 10, 449-456. Chuong, C.M., and Edelman, G.M. (1985). Expression of cell-adhesion molecules in embryonic induction. II. Morphogenesis of adult feathers. J. Cell Bioi. 101, 1027-1043. Chuong, C.M., Randall, V.A., Widelitz, R.B., Wu, P., and Jiang, T.X. (2012). Physiological regeneration of skin appendages and implications for regenerative medicine. Physiology (Bethesda) 27, 61-72. Chuong, C.M., and Richardson, M.K. (2009). Pattern formation today. Int. J. Dev. Bioi. 53, 653-658. Chuong, C.M., Wu, P., Zhang, F. C., Xu, X., Yu, M., Widelitz, R.B., Jiang, T.X., and Hou, L. (2003). Adaptation to the sky: Defining the feather with integument fossils from mesozoic China and experimental evidence from molecular laboratories. J. Exp. Zoo!. B. Mol. Dev. Evol. 298, 42-56. Chuong, C.M., Yeh, C.Y., Jiang, T.X., and Widelitz, R. (2013). Module-based complexity formation: periodic patterning in feathers and hairs. Wiley Interdiscip. Rev. Dev. Bioi. 2, 97-112. Crowe, R., Henrique, D., Ish-Horowicz, D., and Niswander, L. (1998). A new role for Notch and Delta in cell fate decisions: patterning the feather array. Development 125, 767-775. Crowe, R., and Niswander, L. (1998). Disruption of scale development by Delta-1 misexpression. Dev. Bioi. 195, 70-74. 84 Damm, K., Heyman, R.A., Umesono, K., and Evans, R.M. (1993). Functional inhibition ofretinoic acid response by dominant negative retinoic acid receptor mutants. Proc. Nat!. Acad. Sci. U. S. A. 90, 2989-2993. Daudet, N., Ariza-McNaughton, L., and Lewis, J. (2007). Notch signalling is needed to maintain, but not to initiate, the formation ofprosensory patches in the chick inner ear. Development 134, 2369-2378. Davis, E.K., Zou, Y., and Ghosh, A. (2008). Wnts acting through canonical and noncanonical signaling pathways exert opposite effects on hippocampal synapse formation. Neural Dev. 3, 32. Desbiens, X., Queva, C., Jaffredo, T., Stehelin, D., and Vandenbunder, B. (1991). The relationship between cell proliferation and the transcription of the nuclear oncogenes c-myc, c-myb and c-ets-1 during feather morphogenesis in the chick embryo. Development 111, 699-713. Dhouailly, D. (2009). A new scenario for the evolutionary origin of hair, feather, and avian scales. J. Anat. 214, 587-606. Donovan, M., Olofsson, B., Gustafson, A.L., Dencker, L., and Eriksson, U. (1995). The cellular retinoic acid binding proteins. J. Steroid Biochem. Mol. Bioi. 53, 459-465. Drew, C. F., Lin, C.M., Jiang, T.X., Blunt, G., Mou, C., Chuong, C.M., and Headon, D.J. (2007). The Edar subfamily in feather placode formation. Dev. Bioi. 305, 232-245. Driskell, R.R., Giangreco, A., Jensen, K.B., Mulder, K.W., and Watt, F.M. (2009). Sox2-positive dermal papilla cells specify hair follicle type in mammalian epidermis. Development 136, 2815-2823. Dyke, G., de Kat, R., Palmer, C., van der Kindere, J., Naish, D., and Ganapathisubramani, B. (2013). Aerodynamic performance of the feathered dinosaur Microraptor and the evolution of feathered flight. Nat. Commun. 4, 2489. Farin, H. F., Ludtke, T.H., Schmidt, M.K., Placzko, S., Schuster-Gossler, K., Petry, M., Christoffels, V.M., and Kispert, A. (2013). Tbx2 terminates shh/fgfsignaling in the developing mouse limb bud by direct repression of gremlin!. PLoS Genet. 9, el003467. Feduccia, A., and Tordoff, H. B. (1979). Feathers of archaeopteryx: asymmetric vanes indicate aerodynamic function. Science 203, 1021-1022. 85 Fisher, C.J., Knapp, L.W., and Sawyer, R.H. (1988). Retinoic acid induction of featherlike structures from reticulate scales. Teratology 38, 321-328. Forgacs, G., and Newman, S.A. (2005). Biological physics of the dveloping embryo (Cambridge: Cambridge University Press). Gerard, M., Chen, J.Y., Gronemeyer, H., Chambon, P., Duboule, D., and Zakany, J. (1996). In vivo targeted mutagenesis of a regulatory element required for positioning the Hoxd-11 and Hoxd-10 expression boundaries. Genes Dev. 10, 2326-2334. Gerard, M., Duboule, D., and Zakany, J. (1993). Structure and activity of regulatory elements involved in the activation of the Hoxd-11 gene during late gastrulation. EMBO J. 12, 3539-3550. Goentoro, L., and Kirschner, M. W. (2009). Evidence that fold-change, and not absolute level, ofbeta-catenin dictates Wnt signaling. Mol. Cell 36, 872-884. Goto, T., and Keller, R. (2002). The planar cell polarity gene strabismus regulates convergence and extension and neural fold closure in Xenopus. Dev. Bioi. 247, 165-181. Gustafson, A.L., Donovan, M., Annerwall, E., Dencker, L., and Eriksson, U. (1996). Nuclear import of cellular retinoic acid-binding protein type I in mouse embryonic cells. Mech. Dev. 58, 27-38. Habas, R., Kato, Y., and He, X. (200 1 ). Wnt/Frizzled activation of Rho regulates vertebrate gastrulation and requires a novel Formin homology protein Daaml. Celli 07, 843-854. Hamburger, V., and Hamilton, H.L. (1951). A series of normal stages in the development of the chick embryo. J. Morpho!. 88, 49-92. Harris, M.P., Williamson, S., Fallon, J.F., Meinhardt, H., and Prum, R.O. (2005). Molecular evidence for an activator-inhibitor mechanism in development of embryonic feather branching. Proc. Nat!. Acad. Sci. U.S. A. 102, 11734-11739. Hayward, P., Kalmar, T., and Arias, A.M. (2008). Wnt/Notch signalling and information processing during development. Development 135, 411-424. Heisenberg, C.P., Tada, M., Rauch, G.J., Saude, L., Concha, M.L., Geisler, R., Stemple, D.L., Smith, J.C., and Wilson, S.W. (2000). Silberblick/Wnt11 mediates convergent extension movements during zebrafish gastrulation. Nature 405, 76-81. 86 Herman, M. (200 1 ). C. elegans POP-1/TCF functions in a canonical Wnt pathway that controls cell migration and in a noncanonical Wnt pathway that controls cell polarity. Development 128, 581-590. Horton, W., and Hassell, J.R. (1986). Independence of cell shape and loss of cartilage matrix production during retinoic acid treatment of cultured chondrocytes. Dev. Bioi. 115, 392-397. Houchmandzadeh, B., Wieschaus, E., and Leibler, S. (2002). Establishment of developmental precision and proportions in the early Drosophila embryo. Nature 415, 798-802. Hu, D., Hou, L., Zhang, L., and Xu, X. (2009). A pre-Archaeopteryx troodontid theropod from China with long feathers on the metatarsus. Nature 461, 640-643. Hughes, M.W., Wu, P., Jiang, T.X., Lin, S.J., Dong, C.Y., Li, A., Hsieh, F.J., Widelitz, R.B., and Chuong, C.M. (2011). In search of the Golden Fleece: unraveling principles of morphogenesis by studying the integrative biology of skin appendages. Integr. Bioi. (Camb) 3, 388-407. Jayasena, C.S., Ohyama, T., Segil, N., and Groves, A.K. (2008). Notch signaling augments the canonical Wnt pathway to specify the size of the otic placode. Development 135, 2251-2261. Jiang, T.X., Jung, H.S., Widelitz, R.B., and Chuong, C.M. (1999). Self-organization of periodic patterns by dissociated feather mesenchymal cells and the regulation of size, number and spacing of primordia. Development 126, 4997-5009. Jiang, T.X., Stott, S., Widelitz, R.B., and Chuong, C.M. (1998). Current Methods in the Study of Avian Skin Appendages. In Molecular Basis of Epithelial Appendage Morphogenesis, Chuong, C. M. ed., (Austin, TX: Landes Bioscience) pp. 359-408. Jung, H.S., Francis-West, P.H., Widelitz, R.B., Jiang, T.X., Ting-Berreth, S., Tickle, C., Wolpert, L., and Chuong, C.M. (1998). Local inhibitory action ofBMPs and their relationships with activators in feather formation: implications for periodic patterning. Dev. Biol.196, 11-23. Kamiya, N., Ye, L., Kobayashi, T., Mochida, Y., Yamauchi, M., Kronenberg, H.M., Feng, J.Q., and Mishina, Y. (2008). BMP signaling negatively regulates bone mass through sclerostin by inhibiting the canonical Wnt pathway. Development 135, 3801-3811. 87 Kanzler, B., Prin, F., Thelu, J., and Dhouailly, D. (1997). CHOXC-8 and CHOXD-13 expression in embryonic chick skin and cutaneous appendage specification. Dev. Dyn. 210, 274-287. Kasza, K.E., and Zallen, J.A. (2011). Dynamics and regulation of contractile actin-myosin networks in morphogenesis. Curr. Opin. Cell Bioi. 23, 30-38. Kavanau, J.L. (2010). Secondarily flightless birds or Cretaceous non-avian theropods? Med. Hypotheses 74, 275-276. Kere, J., Srivastava, A.K., Montonen, 0., Zonana, J., Thomas, N., Ferguson, B., Munoz, F., Morgan, D., Clarke, A., Baybayan, P., et al. (1996). X-linked anhidrotic (hypohidrotic) ectodermal dysplasia is caused by mutation in a novel transmembrane protein. Nat. Genet. 13, 409-416. Kiecker, C., and Niehrs, C. (2001). A morphogen gradient ofWnt/beta-catenin signalling regulates anteroposterior neural patterning in Xenopus. Development 128, 4189-4201. Kim, D., Pertea, G., Trapnell, C., Pimentel, H., Kelley, R., and Salzberg, S.L. (2013). TopHat2: accurate alignment oftranscriptomes in the presence of insertions, deletions and gene fusions. Genome Bioi. 14, R36. Kim, M.H., Shin, J.S., Park, S., Hur, M.W., Lee, M.O., Park, H., and Lee, C.S. (2002). Retinoic acid response element in HOXA-7 regulatory region affects the rate, not the formation of anterior boundary expression. Int. J. Dev. Bioi. 46, 325-328. Lander, A.D. (2011). Pattern, growth, and control. Cell144, 955-969. Lee, J.Y., Marston, D.J., Walston, T., Hardin, J., Halberstadt, A., and Goldstein, B. (2006). Wnt/Frizzled signaling controls C. elegans gastrulation by activating actomyosin contractility. Curr. Bioi. 16, 1986-1997. Li, A., Chen, M., Jiang, T.X., Wu, P., Nie, Q., Widelitz, R., and Chuong, C.M. (2013). Shaping organs by a wingless-int/Notch/nonmuscle myosin module which orients feather bud elongation. Proc. Nat!. Acad. Sci. U.S. A. 110, E1452-61. Li, Q., Gao, K.Q., Meng, Q., Clarke, J.A., Shawkey, M.D., D'Alba, L., Pei, R., Ellison, M., Norell, M.A., and Vinther, J. (2012). Reconstruction ofMicroraptor and the evolution of iridescent plumage. Science 335, 1215-1219. Li, Y., and Dudley, A.T. (2009). Noncanonical frizzled signaling regulates cell polarity of growth plate chondrocytes. Development 136, 1083-1092. 88 Lin, C.M., Jiang, T.X., Widelitz, R.B., and Chuong, C.M. (2006). Molecular signaling in feather morphogenesis. Curr. Opin. Cell Bioi. 18, 730-741. Lin, C.M., Jiang, T.X., Widelitz, R.B., and Chuong, C.M. (2006). Molecular signaling in feather morphogenesis. Curr. Opin. Cell Bioi. 18, 730-741. Lin, S.J., Foley, J., Jiang, T.X., Yeh, C.Y., Wu, P., Foley, A., Yen, C.M., Huang, Y.C., Cheng, H. C., Chen, C.F., et al. (2013). Topology of feather melanocyte progenitor niche allows complex pigment patterns to emerge. Science 340, 1442-1445. Lin, S.J., Wideliz, R.B., Yue, Z., Li, A., Wu, X., Jiang, T.X., Wu, P., and Chuong, C.M. (2013). Feather regeneration as a model for organogenesis. Dev. Growth Differ. 55, 139-148. Lingham-Soliar, T., Feduccia, A., and Wang, X. (2007). A new Chinese specimen indicates that 'protofeathers' in the Early Cretaceous theropod dinosaur Sinosauropteryx are degraded collagen fibres. Proc. Bioi. Sci. 274, 1823-1829. Lo, C.M., Buxton, D.B., Chua, G.C., Dembo, M., Adelstein, R.S., and Wang, Y.L. (2004). Nonmuscle myosin lib is involved in the guidance of fibroblast migration. Mol. Bioi. Cell15, 982-989. Lucas, P., and Stettenheim, A. (1972). Avian anatomy. Integument. Agriculture Handbook.362, Mallo, M., Wellik, D.M., and Deschamps, J. (2010). Hox genes and regional patterning of the vertebrate body plan. Dev. Bioi. 344, 7-15. Mayr, G., Peters, D.S., Plodowski, G., and Vogel, 0. (2002). Bristle-like integumentary structures at the tail of the horned dinosaur Psittacosaurus. N aturwissenschaften 89, 361-365. Michon, F., Charveron, M., and Dhouailly, D. (2007). Dermal condensation formation in the chick embryo: requirement for integrin engagement and subsequent stabilization by a possible notch/integrin interaction. Dev. Dyn. 236, 755-768. Mou, C., Pitel, F., Gourichon, D., Vignoles, F., Tzika, A., Tato, P., Yu, L., Burt, D.W., Bed'hom, B., Tixier-Boichard, M., Painter, K.J., and Headon, D.J. (2011). Cryptic patterning of avian skin confers a developmental facility for loss of neck feathering. PLoS Bioi. 9, el001028. 89 Muller, G.B. (2007). Evo-devo: extending the evolutionary synthesis. Nat. Rev. Genet. 8, 943-949. Myat, A., Henri que, D., Ish-Horowicz, D., and Lewis, J. (1996). A chick homologue of Serrate and its relationship with Notch and Delta homologues during central neurogenesis. Dev. Bioi. 174, 233-247. Nakagawa, 0., McFadden, D.G., Nakagawa, M., Yanagisawa, H., Hu, T., Srivastava, D., and Olson, E.N. (2000). Members of the HRT family of basic helix-loop-helix proteins act as transcriptional repressors downstream of Notch signaling. Proc. Nat!. Acad. Sci. U. S. A. 97, 13655-13660. Nakamura, M., Matzuk, M.M., Gerstmayer, B., Bosio, A., Lauster, R., Miyachi, Y., Werner, S., and Paus, R. (2003). Control of pelage hair follicle development and cycling by complex interactions between follistatin and activin. FASEB J. 17, 497-499. Ng, C.S., Wu, P., Foley, J., Foley, A., McDonald, M.L., Juan, W.T., Huang, C.J., Lai, Y.T., Lo, W.S., Chen, C. F., et al. (2012). The chicken frizzle feather is due to an alpha-keratin (KRT75) mutation that causes a defective rachis. PLoS Genet. 8, e1002748. Nie, X., Xu, J., El-Hashash, A., and Xu, P.X. (2011). Six1 regulates Grem1 expression in the metanephric mesenchyme to initiate branching morphogenesis. Dev. Bioi. 352, 141-151. Noramly, S., Freeman, A., and Morgan, B.A. (1999). Beta-Catenin Signaling can Initiate Feather Bud Development. Development 126, 3509-3521. Noramly, S., and Morgan, B.A. (1998). BMPs mediate lateral inhibition at successive stages in feather tract development. Development 125, 3775-3787. Norberg, R.A. (1985). Function of vane asymmetry and shaft curvature in bird flight feathers: Inference on flight ability of Archaeopteryx. In The beginnings of birds, Hecht, M. K., Ostrom, J. H., Viohl, G. and Wellnhofer, P. eds., (Eichsta··tt: Freunde des Jura-Museums) pp. 303-313. Norberg, U.M. (1985). Evolution of flight in birds: Aerodynamic, mechanical and ecological aspects. In The beginnings of birds, Hecht, M. K., Ostrom, J. H., Viohl, G. and Wellnhofer, P. eds., (Eichsta··tt: Freunde des Jura-Museums) pp. 293-302. O'Connor, M.B., Umulis, D., Othmer, H. G., and Blair, S.S. (2006). Shaping BMP morphogen gradients in the Drosophila embryo and pupal wing. Development 133, 183-193. 90 Painter, K.J., Hung, G.S., Wells, K.L., Johansson, J.A., and Headon, D.J. (2012). Towards an integrated experimental-theoretical approach for assessing the mechanistic basis of hair and feather morphogenesis. Interface Focus 2, 433-450. Patan, S. (2004). Vasculogenesis and angiogenesis. Cancer Treat. Res. 117, 3-32. Paul, G.S. (2002). Dinosaurs of the air: the evolution and loss of flight in dinosaurs and birds (Baltimore: Johns Hopkins University Press). Pennycuick, C.J. (2008). Modelling the flying bird (Amsterdam; Boston: Academic Press). Plageman, T.F.,Jr, Zacharias, A.L., Gage, P.J., and Lang, R.A. (2011). Shroom3 and a Pitx2-N-cadherin pathway function cooperatively to generate asymmetric cell shape changes during gut morphogenesis. Dev. Bioi. 357, 227-234. Preibisch, S., Saalfeld, S., and Tomancak, P. (2009). Globally optimal stitching of tiled 3D microscopic image acquisitions. Bioinformatics 25, 1463-1465. Prum, R.O. (2005). Evolution of the morphological innovations of feathers. J. Exp. Zoo!. B. Mol. Dev. Evol. 304, 570-579. Prum, R.O. (1999). Development and evolutionary origin of feathers. J. Exp. Zoo!. 285, 291-306. Prum, R.O., and Brush, A. H. (2002). The evolutionary origin and diversification of feathers. Q. Rev. Bioi. 77, 261-295. Prum, R.O., and Williamson, S. (2001). Theory of the growth and evolution of feather shape. J. Exp. Zoo!. 291, 30-57. Qiang, J., Currie, P.J., Norell, M.A., and Shu-An, J. (1998). Two feathered dinosaurs from northeastern China. Nature 393, 753-761. Qiang, J., Currie, P.J., Norell, M.A., and Shu-An, J. (1998). Two feathered dinosaurs from northeastern China. Nature 393, 753-761. Ran, F.A., Hsu, P.D., Wright, J., Agarwala, V., Scott, D.A., and Zhang, F. (2013). Genome engineering using the CRISPR-Cas9 system. Nat. Protoc. 8, 2281-2308. Rhinn, M., and Dolle, P. (2012). Retinoic acid signalling during development. Development 139, 843-858. 91 Riddle, R.D., Johnson, R.L., Laufer, E., and Tabin, C. (1993). Sonic hedgehog mediates the polarizing activity of the ZPA. Cell 75, 1401-1416. Rolo, A., Skoglund, P., and Keller, R. (2009). Morphogenetic movements driving neural tube closure in Xenopus require myosin liB. Dev. Bioi. 327, 327-338. Schweitzer, M.H., Watt, J.A., Avci, R., Knapp, L., Chiappe, L., Norell, M., and Marshall, M. (1999). Beta-keratin specific immunological reactivity in feather-like structures of the cretaceous alvarezsaurid, Shuvuuia deserti. J. Exp. Zoo!. 285, 146-157. Scott, S.D., and McFarland, C. (2010). Bird feathers: a guide to North American species Stackpole Books). Seifert, J.R., and Mlodzik, M. (2007). Frizzled/PCP signalling: a conserved mechanism regulating cell polarity and directed motility. Nat. Rev. Genet. 8, 126-138. Sen, J., Harpavat, S., Peters, M.A., and Cepko, C.L. (2005). Retinoic acid regulates the expression of dorsoventral topographic guidance molecules in the chick retina. Development 132, 5147-5159. Shanely, R.A., Zwetsloot, K.A., Childs, T.E., Lees, S.J., Tsika, R.W., and Booth, F.W. (2009). IGF-I activates the mouse type lib myosin heavy chain gene. Am. J. Physiol. Cell. Physiol. 297, Cl019-27. Shen, L. & Chen, Z. X. (2007). Critical review of the impact of tortuosity on diffusion. Chemical Engineering Science 62, 3748-3755. Sheth, R., Gregoire, D., Dumouchel, A., Scotti, M., Pham, J.M., Nemec, S., Bastida, M.F., Ros, M.A., and Kmita, M. (2013). Decoupling the function ofHox and Shh in developing limb reveals multiple inputs ofHox genes on limb growth. Development 140, 2130-2138. Slack, J.M. (2008). Origin of stem cells in organogenesis. Science 322, 1498-1501. Song, H.K., Lee, S.H., and Goetinck, P.F. (2004). FGF -2 signaling is sufficient to induce dermal condensations during feather development. Dev. Dyn. 231, 741-749. Sprinzak, D., Lakhanpal, A., Lebon, L., Santat, L.A., Fontes, M.E., Anderson, G. A., Garcia-Ojalvo, J., and Elowitz, M.B. (2010). Cis-interactions between Notch and Delta generate mutually exclusive signalling states. Nature 465, 86-90. Suksaweang, S., Jiang, T.X., Roybal, P., Chuong, C.M., and Widelitz, R. (2012). Roles of EphB3/ephrin-B1 in feather morphogenesis. Int. J. Dev. Bioi. 56, 719-728. 92 Tahinci, E., and Symes, K. (2003). Distinct functions of Rho and Rae are required for convergent extension during Xenopus gastrulation. Dev. Bioi. 259, 318-335. Takahashi, K., Tanabe, K., Ohnuki, M., Narita, M., Ichisaka, T., Tomoda, K., and Yamanaka, S. (2007). Induction of pluripotent stem cells from adult human fibroblasts by defined factors. Cell131, 861-872. Tanaka, M., Tamura, K., and Ide, H. (1996). Citra!, an inhibitor of retinoic acid synthesis, modifies chick limb development. Dev. Bioi. 175, 239-247. Thesleff, I., and Mikkola, M.L. (2002). Death receptor signaling giving life to ectodermal organs. Sci. STKE 2002, pe22. Thevenaz, P., and Unser, M. (2007). User-friendly semiautomated assembly of accurate image mosaics in microscopy. Microsc. Res. Tech. 70, 135-146. Ting-Berreth, S.A., and Chuong, C.M. (1996). Local delivery ofTGF beta2 can substitute for placode epithelium to induce mesenchymal condensation during skin appendage morphogenesis. Dev. Bioi. 179, 347-359. Ting-Berreth, S.A., and Chuong, C.M. (1996). Sonic Hedgehog in feather morphogenesis: induction of mesenchymal condensation and association with cell death. Dev. Dyn. 207, 157-170. Tsao, P.N., Chen, F., Izvolsky, K.I., Walker, J., Kukuruzinska, M.A., Lu, J., and Cardoso, W. V. (2008). Gamma-secretase activation of notch signaling regulates the balance of proximal and distal fates in progenitor cells of the developing lung. J. Bioi. Chern. 283, 29532-29544. Turing, A.M. (1952). The chemical basis of morphogenesis. Phil. Trans. R. Soc. B 237, 37-72. Verdier, V., Guang-Chao-Chen, and Settleman, J. (2006). Rho-kinase regulates tissue morphogenesis via non-muscle myosin and LIM -kinase during Drosophila development. BMC Dev. Bioi. 6, 38. Viallet, J.P., Prin, F., Olivera-Martinez, I., Hirsinger, E., Pourquie, 0., and Dhouailly, D. (1998). Chick Delta-1 gene expression and the formation of the feather primordia. Mech. Dev. 72, 159-168. 93 Vicente-Manzanares, M., Ma, X., Adelstein, R.S., and Horwitz, A.R. (2009). Non-muscle myosin II takes centre stage in cell adhesion and migration. Nat. Rev. Mol. Cell Bioi. 10, 778-790. Wang, Y., Chang, H., and Nathans, J. (2010). When whorls collide: the development of hair patterns in frizzled 6 mutant mice. Development 137, 4091-4099. Wartlick, 0., Kicheva, A., and Gonzalez-Gaitan, M. (2009). Morphogen gradient formation. Cold Spring Harb Perspect. Bioi. 1, a001255. Wells, K.L., Hadad, Y., Ben-Avraham, D., Hillel, J., Cahaner, A., and Headon, D.J. (2012). Genome-wide SNP scan of pooled DNA reveals nonsense mutation in FGF20 in the scaleless line of featherless chickens. BMC Genomics 13, 257-2164-13-257. Widelitz, R.B., Jiang, T.X., Chen, C.W., Stott, N.S., Jung, H.S., and Chuong, C.M. (1999). Wnt-7a in feather morphogenesis: involvement of anterior-posterior asymmetry and proximal-distal elongation demonstrated with an in vitro reconstitution model. Development 126, 2577-2587. Widelitz, R.B., Jiang, T.X., Lu, J., and Chuong, C.M. (2000). Beta-Catenin in Epithelial Morphogenesis: Conversion of Part of Avian Foot Scales into Feather Buds with a Mutated Beta-Catenin. Dev. Bioi. 219, 98-114. Witze, E.S., Litman, E.S., Argast, G.M., Moon, R.T., and Ahn, N.G. (2008). Wnt5a control of cell polarity and directional movement by polarized redistribution of adhesion receptors. Science 320, 365-369. Wolpert, L., and Tickle, C. (20 II). Principles of development (Oxford: Oxford University Press). Wu, P., Hou, L., Plikus, M., Hughes, M., Scehnet, J., Suksaweang, S., Widelitz, R., Jiang, T.X., and Chuong, C.M. (2004). Evo-Devo of amniote integuments and appendages. Int. J. Dev. Bioi. 48, 249-270. Wu, P., Jiang, T.X., Suksaweang, S., Widelitz, R.B., and Chuong, C.M. (2004). Molecular shaping of the beak. Science 305, 1465-1466. Xu, X., Wang, K., Zhang, K., Ma, Q., Xing, L., Sullivan, C., Hu, D., Cheng, S., and Wang, S. (2012). A gigantic feathered dinosaur from the lower cretaceous of China. Nature 484, 92-95. 94 Xu, X., You, H., Du, K., and Han, F. (2011). An Archaeopteryx-like theropod from China and the origin of Avialae. Nature 475, 465-470. Xu, X., and Zhang, F. (2005). A new maniraptoran dinosaur from China with long feathers on the metatarsus. Naturwissenschaften 92, 173-177. Xu, X., Zheng, X., and You, H. (20 1 0). Exceptional dinosaur fossils show ontogenetic development of early feathers. Nature 464, 1338-1341. Xu, X., Norell, M.A., Kuang, X., Wang, X., Zhao, Q., and Jia, C. (2004). Basal tyrannosauroids from China and evidence for protofeathers in tyrannosauroids. Nature 431, 680-684. Xu, X., Tang, Z., and Wang, X. (1999). A therizinosauroid dinosaur with integumentary structures from China. Nature 399, 350-354. Xu, X., Zheng, X., and You, H. (2009). A new feather type in a nonavian theropod and the early evolution of feathers. Proceedings of the National Academy of Sciences 106, 832-834. Xu, X., Zhou, Z., and Prum, R.O. (2001). Branched integumental structures in Sinornithosaurus and the origin of feathers. Nature 410, 200-204. Xu, X., Zhou, Z., Wang, X., Kuang, X., Zhang, F., and Du, X. (2003). Four-winged dinosaurs from China. Nature 421, 335-340. Yu, M., Wu, P., Widelitz, R.B., and Chuong, C.M. (2002). The morphogenesis of feathers. Nature 420, 308-312. Yue, Z., Jiang, T.X., Widelitz, R.B., and Chuong, C.M. (2006). Wnt3a gradient converts radial to bilateral feather symmetry via topological arrangement of epithelia. Proc. Nat!. Acad. Sci. U.S. A. 103, 951-955. Yue, Z., Jiang, T.X., Widelitz, R.B., and Chuong, C.M. (2005). Mapping stem cell activities in the feather follicle. Nature 438, 1026-1029. Zakany, J., Kmita, M., and Duboule, D. (2004). A dual role for Hox genes in limb anterior-posterior asymmetry. Science 304, 1669-1672. Zecca, M., and Struhl, G. (2007). Recruitment of cells into the Drosophila wing primordium by a feed-forward circuit of vestigial autoregulation. Development 134, 3001-3010. 95 Zelenitsky, D.K., Therrien, F., Erickson, G.M., DeBuhr, C.L., Kobayashi, Y., Eberth, D.A., and Hadfield, F. (2012). Feathered non-avian dinosaurs from North America provide insight into wing origins. Science 338, 510-514. Zhang, F., Zhou, Z., Xu, X., Wang, X., and Sullivan, C. (2008). A bizarre Jurassic maniraptoran from China with elongate ribbon-like feathers. Nature 455, 1105-1108. Zhang, Z., Lan, Y., Chai, Y., and Jiang, R. (2009). Antagonistic actions of Msxl and Osr2 pattern mammalian teeth into a single row. Science 323, 1232-1234. Zimmerman, S.G., Thorpe, L.M., Medrano, V.R., Mallozzi, C. A., and McCartney, B.M. (2010). Apical constriction and invagination downstream of the canonical Wnt signaling pathway require Rho! and Myosin II. Dev. Bioi. 340, 54-66. Zou, H., and Niswander, L. (1996). Requirement for BMP signaling in interdigital apoptosis and scale formation. Science 272, 738-741. 96

Abstract (if available)

Abstract During development, epidermal appendages like feathers and hairs can self‐organize into patterns with characteristic distribution and orientation. Adult feathers, hairs also exhibit amazing regeneration ability. In addition, adult feathers show tremendous diversity of size, shape and color pattern through space (body regions) and time (season, physiological developmental stages). These features make epidermal appendages favorable systems for studying periodical pattern formation (Chuong et al., 2013), organ shaping (Hughes et al., 2011), stem cell activity regulation (Lin et al., 2013) and evolutionary developmental biology (Evo‐devo) (Wu et al., 2004). My Ph.D. research includes two projects exploring the molecular and cellular mechanisms for establishing organ polarity using feather as the model system. Project 1 is aimed to answer how feather buds on chicken embryos precisely specify their elongation orientation along the body anterior‐posterior axis. Project 2 is aimed to understand how the primary flight feathers on adult birds acquire the unique bilateral asymmetric shape. ❧ In development, a feather bud grows from dome‐shaped primordia into thin conical structures with an anterior–posterior axis of specific orientation. From a systems biology perspective, the process is precise and robust. Using tissue transplantation assays, we demonstrate that the polarizing activity to mediate directional elongation is localized in the posterior feather bud. This region contains a spatially well‐defined nuclear β‐catenin zone (3-5 cell layer thick), which is induced by wingless‐int (Wnt)7a protein diffusing in from posterior bud epithelium. Misexpressing constitutively active β‐catenin randomizes feather polarity. This dermal nuclear β‐catenin zone, surrounded by Notch1 positive dermal cells, induces Jagged1. Inhibition of Notch signaling disrupts the spatial configuration of the nuclear β‐catenin zone and leads to randomized feather polarity. Mathematical modeling predicts that lateral inhibition, mediated by Notch signaling, functions to reduce Wnt7a gradient variations and fluctuations to form the sharp boundary observed for the dermal β‐catenin zone. This zone is also enriched for nonmuscle myosin IIB. Suppressing nonmuscle myosin IIB disrupts directional cell rearrangements and abolishes feather bud elongation. These data suggest that a unique molecular module involving chemical‐mechanical coupling converts a pliable chemical gradient to a precise domain, ready for subsequent mechanical action, thus defining the position, boundary, and duration of localized morphogenetic activity that molds the shape of growing organs (Li et al., 2013). ❧ In adult birds, feathers exhibit great diversity of shapes. Among them, the bilateral asymmetric flight feathers attached to the wing greatly facilitated the evolution of powered (flapping) flight in feathered non‐avialan dinosaurs and basal Aves. Here we explore the molecular and cellular mechanisms underlying feather form diversification, with focus on bilateral asymmetric vane formation in flight feathers. We identified the spatial distribution of barb generative zone (BGZ) and sharpness of barb‐rachis insertion angles are two morphological parameters that can modulate feather vane width. ❧ Through transcriptome profiling and candidate analysis, we further identified two distinct molecular processes regulating the above parameters: (i) localized mesenchymal Grem1 inhibits BMP signaling in adjacent epithelium to define BGZ spatial distribution and decreases cell proliferation

Linked assets

University of Southern California Dissertations and Theses

Conceptually similar

PDF

Epigenetic and genetic reprogramming during embryonic chicken feather bud morphogenesis, hair morphogenesis, and de novo hair regeneration

PDF

The role of Prkci in stem cell maintenance and cell polarity using a 3-D culture system

PDF

Canonical and non-canonical Wnt signaling in the patterning of multipotent stem cells during feather development

PDF

The role of HES/HEY transcriptional repressors in specification and maintenance of cell fate in the mouse organ of Corti

PDF

Insights from mouse models on the origin of ovarian cancer and its predisposing mechanisms

PDF

Morphoregulation and cycling of ectodermal organs

PDF

Characterizing the role of Dnmt1 and its downstream factors in progressive alopecia

PDF

Homologous cell systems for the study of progression of androgen-dependent prostate cancer to castration-resistant prostate cancer

PDF

Exploring three-dimensional organization of the genome by mapping chromatin contacts and population modeling

Asset Metadata

Creator Li, Ang (author)

Core Title Exploring the molecular and cellular underpinnings of organ polarization using feather as the model system

School Keck School of Medicine

Degree Doctor of Philosophy

Degree Program Pathobiology

Publisher University of Southern California (original), University of Southern California. Libraries (digital)

Tag breaking symmetry,evo devo,morphogenesis,OAI-PMH Harvest,reaction‐diffusion

Language English

Contributor Electronically uploaded by the author (provenance)

Advisor Chuong, Cheng-Ming (committee chair), Crump, Gage D. (committee member), Maxson, Robert E., Jr. (committee member), Widelitz, Randall B. (committee member)

Creator Email angli@usc.edu,raptorliang@hotmail.com

Permanent Link (DOI) https://doi.org/10.25549/usctheses-c3-465261

Unique identifier UC11288243

Identifier etd-LiAng-2844.pdf (filename),usctheses-c3-465261 (legacy record id)

Legacy Identifier etd-LiAng-2844.pdf

Dmrecord 465261

Document Type Dissertation

Rights Li, Ang

Type texts

Source University of Southern California (contributing entity), University of Southern California Dissertations and Theses (collection)

Access Conditions The author retains rights to his/her dissertation, thesis or other graduate work according to U.S. copyright law. Electronic access is being provided by the USC Libraries in agreement with the a...

Repository Name University of Southern California Digital Library

Repository Location USC Digital Library, University of Southern California, University Park Campus MC 2810, 3434 South Grand Avenue, 2nd Floor, Los Angeles, California 90089-2810, USA