Jagged-notch signaling: patterning the vertebrate face

PDF

Download

Open document

Flip pages

Download a page range

Download transcript

Copy asset link

Request this asset

Request accessible transcript

Transcript (if available)

Content JAGGED-NOTCH SIGNALING: PATTERNING THE VERTEBRATE FACE by Elizabeth Zuniga A Dissertation Presented to the FACULTY OF THE USC GRADUATE SCHOOL UNIVERSITY OF SOUTHERN CALIFORNIA In Partial Fulfillment of the Requirements for the Degree DOCTOR OF PHILOSOPHY (NEUROSCIENCE) December 2012 Copyright 2012 Elizabeth Zuniga ii This thesis is dedicated to my husband, Rafael who has always been there for me, and to little Joaquin for bringing so much joy into my life. iii ACKNOWLEDGEMENTS I would like to first and foremost thank my advisor Gage D. Crump for all his guidance and support. I cannot thank him enough for everything he has done in making me a better scientist. Thanks for letting me work on this great project and for always giving me the freedom to express my ideas. Thank you for believing in me! I would also like to thank my Dissertation committee members: Rob Maxson, Neil Segil, Samantha Butler, and Le Ma for all their help and advice throughout my career here at USC. In addition, I would also like to thank the post-docs in the Crump Lab: Samuel Cox, Chong Pyo Choe, Bartek Balczers, and Sandeep Paul for all their help and words of wisdom. I would especially like to thank Frank Stellabotte for being my mentor and for always making me laugh. I would also like to acknowledge all of the past and present Crump Lab members: Ankita Das, Amjad Askary, Simone Schindler, Jennifer Crump, and Lindsey Mork for all the fun times in lab! A special thanks to my CrossFit buddies: Liz Forman, Megan Groff, and Megan Matsutani for helping me get through those painful workouts right before lab. I am also very grateful to my Neuroscience friends: Letisha Wyatt, Raina Pang, Anna Kamitakahara, and Vilay Khandelwhal for all the great memories here at USC. iv TABLE OF CONTENTS Dedication ii Acknowledgements iii List of Figures v Abstract vii Introduction 1 Chapter 1: Jagged-Notch signaling ensures dorsal skeletal identity in the vertebrate face 7 Chapter 2: Reverse signaling of Jagged1 in craniofacial patterning 38 Chapter 3: Gremlin2 regulates distinct roles of Bmp and Endothelin1 signaling in dorsoventral patterning of the facial skeleton 56 Conclusion 86 References 89 v LIST OF FIGURES INTRODUCTION: Figure 1: The facial skeleton in zebrafish is homologous to the inner ear in mammals. 2 Figure 2: Regionalization of neural crest-derived precursors dictate skeletal elements. 2 Figure 3: The Notch pathway in vertebrates. 4 CHAPTER 1: Figure 4: Jag1b-Notch2 signaling regulates DV patterning of the facial skeleton. 17 Figure 5: Jag1b-Notch2 signaling inhibits dlx3b and dlx5a expression in the pharyngeal arches. 21 Figure 6: Jag1b generally represses ventral gene expression in the pharyngeal arches. 22 Figure 7: jag1b, notch2, and hey1 expression is regulated by Notch and Edn1 signaling. 24 Figure 8: Jag1b-Notch2 signaling functions within CNCC for DV facial patterning. 26 Figure 9: Reduction of Jag1b-Notch2 signaling rescues the ventral defects of edn1 mutants. 29 Figure 10: Model of DV facial skeletal patterning. 31 CHAPTER 2: Figure 11: Ventral-specific defects are observed in both animals with increased JAGGED1 and JICD. 45 vi Figure 12: Jagged-Notch forward signaling pathway upregulates jag1b and hey1 but not ectopic JICD. 47 Figure 13: Jagged is not localized in the nucleus. 48 Figure 14: Loss of Jag1b and increased JICD disrupt condensations of the dorsal hyoid arch. 50 Figure 15: Aberrant barx1 gene expression in jag1b mutants. 51 Figure 16: Proposed model of Jagged aiding in both patterning and formation of condensations. 52 CHAPTER 3: Figure 17: Facial skeletal defects upon Bmp4 or Edn1 misexpression. 66 Figure 18: Distinct effects of Bmp4 and Edn1 misexpression on hand2 and dlx3b/5a expression. 70 Figure 19: DV gene expression in Bmp4 and Edn1 misexpression embryos. 72 Figure 20: Cell-autonomous regulation of DV gene expression by Bmp. 74 Figure 21: Bmp4 induces hand2 and msxe expression in the absence of Edn1. 75 Figure 22: Edn1 and Jag1b negatively regulate grem2 expression. 77 Figure 23: Grem2 promotes the dorsal and intermediate facial skeleton. 79 Figure 24: Model of DV arch patterning in zebrafish. 81 CONCLUSION: Figure 25: The function of Jagged in craniofacial patterning is conserved among vertebrates. 88 vii ABSTRACT Craniofacial abnormalities are the most common birth defects, and yet little is known about the developmental etiology that leads to mispatterning of the face. Several studies have shown that the development of the face depends on the regionalization of neural crest precursors into distinct domains along the dorsoventral (DV) axis. Previous research has shown Endothelin 1 (Edn1) is required for patterning the ventral (lower) face, in part by regulating the expression of ventral genes such as those of the Dlx family. However, little is known about the factors required for development of the dorsal (upper) face. By analyzing a newly identified zebrafish jag1b mutant and transgenic overexpressing JAGGED1, we find that Jagged-Notch signaling promotes dorsal identity by repressing ventral gene expression. Jagged ligands are thought to act primarily as ligands for Notch receptors, with cleavage and nuclear translocation of a Notch intracellular domain (NICD) affecting gene transcription. Surprisingly, we find that transgenic misexpression of JAGGED1 intracellular domain (JICD), which lacks the extracellular domain required for Notch binding, produces facial skeletal and DV gene expression defects similar to those seen upon misexpression of full-length JAGGED1. These findings lead us to propose a novel cell-autonomous role for Jagged in transcriptional regulation responsible for patterning the dorsal face. Next, we identified the Bmp antagonist Gremlin2 as a target of both Jagged-Notch and Edn1 signaling with Grem2 being required to restrict Bmp activity to the ventral-most domain of the arches. Using gain- and loss-of-function studies, we revealed a complex genetic interaction among Jagged, Edn1, and Bmp signaling in specifying distinct skeletal fates along the DV facial axis. Taken all together, our findings are the first to show how Jagged is involved in regional patterning of the viii face. Mutations in Jagged are found in patients with Alagille syndrome who often have a characteristic facial dysmorphology. Thus determining how Jagged patterns the face will lead us closer in understanding how a disruption in this pathway results in facial anomalies in humans. 1 INTRODUCTION The craniofacial skeleton An intriguing question in developmental biology is how do we form different shapes and sizes of cartilage and bone of the face? The importance of understanding this will shed light into why defects in this process have been associated to facial dysmorphologies and deafness in humans. The facial skeleton forms from a specialized population of cranial neural crest cells (CNCC) that migrate and form a series of segments called the branchial (pharyngeal) arches (LeDouarin, 1982; Schilling and Kimmel, 1994). Although CNCC carry some positional information, the majority of patterning instructions are obtained from signaling molecules secreted from the surrounding tissues (Clouthier and Schilling, 2004). Based on this, intrinsic and extrinsic signals are thought to be responsible for setting up the proper shape and size of the facial skeleton. Zebrafish as a model system Zebrafish is an excellent model for studying patterning during craniofacial development. The pharyngeal arches that will give rise to the face are morphologically similar in all vertebrates and use the same signaling pathways. As shown in Fig. 1, the first and second arches in zebrafish give rise to the skeleton and support of the jaw. In mice, the homologous structures are the lower jaw and the middle ear bones (Clouthier and Schilling, 2004). Therefore, what we learn by studying craniofacial development in 2 zebrafish will be directly relevant for understanding the mechanisms responsible for facial birth defects in humans. Figure 1: The facial skeleton in zebrafish is homologous to the inner ear in mammals. The dorsal- derived skeletal elements are depicted in red whereas the ventral structures are shown in green (modified from Clouthier and Schilling, 2004). Skeletal patterning along the DV facial axis The skeletal elements of the upper and lower face correlate to their origin along the dorsal-ventral (DV) axis of the pharyngeal arches. Fate mapping studies in zebrafish (Crump et al., 2004; Crump et al., 2006) have shown that dorsal cells of the pharyngeal arch will give rise to derivatives of the upper face such as palatoquadrate (Pq), hyomandibular (Hm), and opercular (Op) bone; and the more ventral cells become the derivatives of the lower face such as Meckel’s (M), ceratohyal (Ch), and branchiostegal (Br) bone (Fig. 2). Figure 2: Regionalization of neural crest-derived precursors dictate skeletal elements. Fate mapping studies have shown that cells from the dorsal domain of the first and second arch give rise to Hm and Pq cartilage, and the Op bone whereas ventral cells give rise to M and Ch cartilage, and the Br bone. !"#$%!"#$%&'()*!+,-. /0'&'()!*123'-0456'-4$$5 78 !"#$%!"#$%&'()*!+,-. /0'&'()!*123'-0456'-4$$5 78 9,:;04'<=!'80#>5?$#>6#6,/>'64-@>,A;4B')'04.1.C4',5',>D4-64.',>6/'!"#$%!"#$%&'()*!+,-.'4EF0C/5'/0' &'()!*123'604#64.'4EF0C/5'#6'6@4'<1-4$$'56#:4B')6'6@4'5@,4$.'56#:4'GH@?IJK'6@4'04.'./>/0'-4$$5'#04' 60#>5?$#>64.',>6/'6@4'04:,/>'6@#6'L,$$'F4-/E4'>4;0#$'-0456'-4$$5',>'L,$.'6C?45B')I640'60#>5?$#>6#6,/>K' 6@4'@/56'4EF0C/'L,$$'F4'4M#E,>4.'I/0'-@#>:45',>'+,-./04M?0455,/>'#6'NH'@?IK'#>.'I/0'5O4$46#$' ?@4>/6C?45'#6'P.?IB''QEF0C/'.0#L,>:5'6#O4>'I0/E'GR,EE4$'46'#$BK'<SSPJB 9,:;04'<!'8@4'I#-,#$'5O4$46/>',>'T4F0#I,5@',5'@/E/$/:/;5'6/'6@4',>>40'4#0',>'E#EE#$5B' 8@4'./05#$1.40,U4.'5O4$46#$'4$4E4>65'#04'.4?,-64.',>'04.'L@404#5'6@4'U4>60#$'560;-6;045' #04'5@/L>',>':044>B' 9,:;04'<<!'V0/?/54.'E/.4$''/I'W#::4.1+/6-@'5,:#>$,>:'.;0,>:'I#-,#$'?#6640>,>:'56#:45B'1234/14M?0455,>: -4$$5'G04.J'#04'$/-#$,T4.',>'6@4'./05#$'./E#,>'/I'6@4'#0-@'L@,$4'&'()!*14M?0455,>:'-4$$5'G:044>J'#04',>'6@4' U4>60#$'./E#,>B'+/6-@'#-6,U#6,/>'GC4$$/LJ'/>$C'/--;05',>'-4$$5'$/-#64.'#6'6@4'F/;>.#0C'F46L44>'1234/1'#>.0 &'()!*14M?0455,>:'-4$$5B'(?/>'56,E;$#6,/>K''+/6-@'5,:>#$,>:'#-6,U#645'!564'#>.'1234/'4M?0455,/>K'#>.' 04?045545'+,-0:4>45B')I640'6@4'+/6-@'?#6@L#C'@#5',>.;-4.'1234/'4M?0455,/>'6@4>'6@4'>4M6'0/L'/I'-4$$5'-#> ,>640#-6'L,6@'6@4'+/6-@='04-4?6/0K'6@404FC'?0/?#:#6,>:'+/6-@'#-6,U#6,/>',>'#'XY'L#U4'/U40'6,E4B'Z/L4U40K' 1234/'4M?0455,/>'./45'>/6'4M64>.'6/'6@4'U4>60#$'./E#,>'.;4'6/'6@4',>@,F,6,/>'FC'Q.><B !"#$%& '()*#%& +, $- ./ 0 12 "3 45 !"#$%&'()'*&#"+,-."/-0"+,'+1',&$%-.'2%&3045&%"6&5'7%&2$%3+%3'5"20-0&'38&.&0-.'&.&9&,03:'!-0&'9-77",#'30$5"&3' ;-6&'3;+<,'0;-0'2&..3'1%+9'0;&'5+%3-.'5+9-",'+1'0;&'=30'-,5'(,5'-%2;'#"6&'%"3&'0+'>9'-,5'?@'2-%0".-#&A'-,5' 0;&'B7'C+,&A'<;&%&-3'6&,0%-.'2&..3'#"6&'%"3&'0+'D'-,5'E;'2-%0".-#&A'-,5'0;&'F%'C+,&:' !"#$%&'DB G"25 ())*+ HI ,-.)( !"#$%&'J)'K0-",",#'+1'0;&'9-5"C$.-%'-,5';L+"545&%"6&5'38&.&0+,'-0'M'571'3;+<",#' 2-%0".-#&'NC.$&O'-,5'C+,&'N%&5O:'K2;&9-0"23'3;+<'5+%3-.'N%&5O'-,5'6&,0%-.'N#%&&,O' &.&9&,03:',-.)(//////''''9$0-,03'-,5'!"#$%&4DB'-,"9-.3'5"37.-L'0%$,2-0"+,3'+1'?@A' 3;-7&'2;-,#&3'+1'>9A'-,5'%&5$20"+,'",'B7'C+,&:'G"25'-,"9-.3'3;+<'%&5$20"+,' ",'D'-,5'KLA'P+",0'.+33A'3;-7&'2;-,#&3'",'?@'-,5'B7'&Q7-,3"+,:' ())*+ % 4 1 ! %6 46 16 !6 3 Previous studies have shown that the morphogen Endothelin1 (Edn1) is secreted from the ventral ectoderm and interacts with the Edn receptor (Ednr) in the crest to induce ventral gene expression (Nair et al., 2007). Several studies have shown that Edn1 is required to promote ventral identity, in part by regulating the ventral Dlx3/4/5/6 gene set. In mice, ventral to dorsal skeletal transformations have been observed in both Edn1 -/- and Dlx5 -/- ; Dlx6 -/- mutants (Depew et al., 2002; Beverdam et al., 2002; Ozeki et al., 2004). In zebrafish, edn1 -/- mutants (Miller et al., 2000) and animals reduced for dlx3 and dlx5 (Walker et al., 2006) also show defects in the ventral facial skeleton. Conversely, dorsal to ventral skeletal transformations have been reported in both zebrafish with Edn1 overexpression (Kimmel et al., 2007) and in mice with misexpression of Edn1 throughout the arches (Sato et al., 2008). Whereas several studies have shown that Edn1 is responsible for ventral identity, dorsal specification has been thought to be a default state with dorsal skeletal precursors being too far from the Edn1 source to activate ventral gene expression. Notch signaling in development In vertebrates, the Notch pathway consists of a family of Notch receptors that can either bind one of two classes of ligands, Jagged or Delta (Fig. 3). Upon ligand binding, the Notch receptor undergoes a series of cleavage events that results in the release of the intracellular domain of the receptor (Nicd). The Nicd translocates to the nucleus where it forms a ternary complex with the transcription factors CSL (CBF1/RBP in mammals, Suppressor of Hairless in Drosophila, and LAG-1 in C. elegans) and Mastermind (Mam). 4 This ternary complex displaces corepressors from CSL, allowing transcription of Notch target genes such as the hes/hey/her gene family (reviewed in Gering and Patient, 2008). Figure 3: The Notch pathway in vertebrates. Binding of Jagged or Delta from one cell to the Notch receptor in another cell activates a cascade of cleavage events mediated by ADAM10 and γ-secretase. The intracellular domain of the Notch receptor (Nicd) is released and translocates to the nucleus where it forms a ternary structure with CSL and mastermind (Mam) to induce transcription of target genes (modified from Bray, 2006). The Notch signaling pathway has been shown to have multiple roles in development. One function of Notch signaling is to establish compartmental boundaries in diverse developmental systems. Studies in Drosophila demonstrate that Notch is critical in specifying DV fates in the developing wing (Diaz-Benjumea et al., 1995). Furthermore, studies on Drosophila and vertebrate neurogenesis show that Notch signaling mediates a process termed “lateral inhibition”, in which one cell acquires a particular fate while inhibiting surrounding cells from acquiring the same fate in order to achieve diverse cell specification (reviewed in Bertrand et al., 2002). A similar function for Notch has also ©!2006!Nature Publishing Group! ! Delta Notch ADAM10 or TACE (S2 cleavage) γ-secretase (S3 cleavage) Nicd CSL Target genes repressed Target genes active Co-R Mam E3 ubiquitin ligase An adaptor protein that links ubiquitin-conjugating E2 enzymes with substrates and contributes to the catalytic transfer of ubiquitin onto the substrate. Epsin A clathrin and phosphatidyli- nositol-4,5-bisphosphate- binding protein that contains ubiquitin-interaction motifs. It is thought to facilitate endocytosis of ubiquitylated cargo proteins. Auxilin A J-domain-containing protein that is implicated in the disassembly of clathrin from clathrin-coated vesicles. Recycling endosome A compartment that sorts transmembrane proteins that are recycled to the plasma membrane following endocytosis. Exocyst A heteromeric protein complex that is required for polarized exocytosis of post-Golgi secretory vesicles. question is, what happens once Nicd enters the nucleus? Both the duration of signalling and the identity of target genes have impacts on the output of Notch activation, so their regulation is of major importance. Together, the different mechanisms give a perspective on how this simple pathway can be manipulated, but they also show that we are still just beginning to understand the full complexities of Notch regulation. Regulation of Notch-ligand activity Expression of Notch ligands during development is quite dynamic and contributes significantly to differential activity of the pathway. In some developmental con- texts, the ligand is produced by a distinct population of cells (boundaries/inductive signalling; BOX 2). However, under many circumstances, differential ligand transcrip- tion is not sufficient to explain why certain cells become the signal-sending cells. Other post-transcriptional mechanisms are clearly at work. Ubiquitylation and ligand activity. The identification of the E3 ubiquitin ligases, Neuralized (Neur) and Mind bomb (Mib), that interact directly with Notch ligands and are required for ligand activation (FIG. 2) was a strik- ing and surprising recent discovery 14,15 . Loss of Neur in D. melanogaster or Xenopus laevis and of Mib1 in zebrafish results in neurogenic phenotypes 16–19 . In D. melanogaster, mib1 mutants have a later defect of arrested appendage (imaginal disc) development (possibly due to persistence of maternal protein or redundancy with MIB2). The MIB1-associated defects can be rescued by expression of Neur, which indicates that these two proteins — although they share few structural similarities apart from RING domains — can perform the same function 20–22 . Much of the difference between these two E3 families might be attributed to their expression patterns and to their regula- tion (see below), although it remains possible that they preferentially interact with different Notch ligands. In normal cells, the extensive trafficking of Notch lig- ands through the cell is evident from intracellular puncta that are detected in different tissues and animals. This traf- ficking is compromised in the absence of Neur or Mib, as ligands accumulate at the cell surface but are inactive 18,21 . This surprising observation indicates that regulation of ligand activity by Neur and Mib is intimately associated with endocytosis (FIG. 2) and it requires the ubiquitin- binding protein Epsin 23–25 and probably the J-domain- containing protein auxilin (which can disassemble clathrin coats) 26 . Different models have been proposed to explain the link between ubiquitylation, endocytosis and ligand activity 14,15,23 . For example, ligand endocytosis could generate a ‘pulling force’ on a bound receptor that causes a conformational change in the juxtamembrane region 27 . Another possibility is that ubiquitylation promotes ligand clustering. Indeed, Notch activation is more effective if soluble ligands are clustered through fusion to an Fc moiety or through immobilization on plastic 28,29 . A third possibility is that ubiquitylation permits traffick- ing into an endocytic compartment, which enables ligand modification or results in re-insertion of the ligand into specific membrane domains. Two observations support this model. Segregation of RAB11, a component of the recycling endosome, influences signalling in the D. mela- nogaster sensory organ precursors (SOP). Furthermore, mutations in an exocyst component, SEC15, compromise SOP Notch signalling 30,31 . Paradoxically, some functional ligands in C. elegans are secreted (for example DSL-1; REF. 32) and so would presumably not be ubiquitylated. However, the ubiquitin-binding protein Epsin is also required for Notch (LIN-12) signalling activity in this animal, implying that mechanisms of ligand activation are conserved 33 . Whatever the mechanism for ligand activa- tion, regulation of E3 ligases is potentially one signifi- cant strategy for controlling the activity of the Notch pathway, as exemplified by the Bearded-related family of small inhibitory polypeptides 34,35 (BOX 3). Therefore, elucidating the mechanism of ligand activation is of prime importance. Ligand localization. The localization of ligands within the cell is important for effective signalling and might be influenced by other proteins. For example, Echinoid, an immunoglobulin C2-type cell-adhesion molecule, colocalizes with Notch and Delta at adherens junctions in D. melanogaster. Genetic interactions indicate that Echinoid functions as a positive regulator to promote Notch signalling 36 . Echinoid colocalizes with Delta in endocytic vesicles, and Echinoid overexpression depletes Delta from the membrane. Therefore, it is possible that Echinoid Figure 1 | The core Notch pathway. Binding of the Delta ligand (green) on one cell to the Notch receptor (purple) on another cell results in two proteolytic cleavages of the receptor . The ADAM10 or TACE (TNF-α-converting enzyme; also known as ADAM17) metalloprotease (yellow) catalyses the S2 cleavage, generating a substrate for S3 cleavage by the γ-secretase complex (brown). This proteolytic processing mediates release of the Notch intracellular domain (Nicd), which enters the nucleus and interacts with the DNA-binding CSL (CBF1, Su(H) and LAG-1) protein (orange). The co-activator Mastermind (Mam; green) and other transcription factors (see also FIG. 4) are recruited to the CSL complex, whereas co-repressors (Co-R; blue and grey) are released. REVIEWS NATURE REVIEWS | MOLECULAR CELL BIOLOGY VOLUME 7 | SEPTEMBER 2006 | 679 5 been observed in the developing somites and hindbrain rhombomeres (Cheng et al., 2004; Conlon et al., 1995). Alagille syndrome Although Notch is known to control patterning in many developmental systems, little is known about the role of Notch signaling in craniofacial development. Mutations in the human JAGGED1 ligand and in the NOTCH2 receptor have been attributed to Alagille syndrome (AGS; Oda et al., 1997; Samejima et al., 2007). The prevalence of AGS is estimated to be 1 out of 70,000 live births and affects multiple organs including the liver, heart, eyes, face, and skeleton (Quiros-Tejeira et al., 1999; Kamath et al., 2002b). Patients with AGS display characteristic facial dysmorphologies that include a prominent forehead, deep-set eyes, a straight nose with a flattened tip, a pointed chin, and deafness (Kamath et al., 2002b). Interestingly, about 90% of AGS cases are attributed to mutations in JAGGED1 whereas only less than 1% of patients have mutations in the NOTCH2 receptor (Warthen et al., 2006; McDaniell et al., 2006). In mice, Jag1 -/- mutants are early lethal and thus could not be analyzed for facial defects (Xue et al., 1999). However, loss of one copy of Jagged1 and Notch2 in mice result in liver, heart, and eye defects similar to those observed in AGS patients (McCright et al., 2002). In zebrafish, blocking Jag1b and Notch2 function via morpholinos results in liver defects reminiscent of AGS but causes overall loss of the facial skeleton (Lorent et al., 2004). One of the pitfalls of using morpholinos has been their off-target binding and overall toxicity (Eisen and Smith, 2008), thus the function of Jagged-Notch signaling in facial development remains unclear. 6 In Chapter 1, I discuss our findings in zebrafish showing a novel role of Jagged-Notch signaling in regional patterning of the facial skeleton. We find Jagged-Notch signaling is responsible for repressing ventral genes from extending to dorsal CNCC and thus aiding in patterning the dorsal facial skeleton. In addition, we find Edn1 represses jag1b from extending ventrally thereby allowing expression of ventral patterning genes. Next, in Chapter 2 we investigate a novel cell-autonomous signaling function of Jagged1, independent from its role in binding to the Notch receptor, in patterning the dorsal facial skeleton. We find misexpression of the intracellular domain of Jagged1 results in ventral- specific skeletal defects and loss of ventral dlx3b gene expression. Finally, Chapter 3 summarizes our findings of a network established at early arch patterning stages between Jagged, Edn1, and Bmp signaling. We find that complex genetic interactions between these signaling pathways are responsible for setting up a dorsal, intermediate, and ventral gene expression domain. These domains are then responsible for patterning the distinct elements of the face. 7 CHAPTER 1: JAGGED-NOTCH SIGNALING ENSURES DORSAL SKELETAL IDENTITY IN THE VERTEBRATE FACE SUMMARY The development of the vertebrate face relies on the regionalization of neural crest- derived skeletal precursors along the dorsoventral (DV) axis. Here we show that Jagged- Notch signaling ensures dorsal identity within the hyoid and mandibular components of the facial skeleton by repressing ventral fates. In a genetic screen in zebrafish, we identified a loss-of-function mutation in jagged 1b (jag1b) that results in dorsal expansion of ventral gene expression and partial transformation of the dorsal hyoid skeleton to a ventral morphology. Conversely, misexpression of human jagged 1 (JAG1) represses ventral gene expression and dorsalizes the ventral hyoid and mandibular skeletons. We further show that jag1b is expressed specifically in dorsal skeletal precursors, where it acts through the Notch2 receptor to activate hey1 expression. Whereas Jagged-Notch positive feedback propagates jag1b expression throughout the dorsal domain, Endothelin1 (Edn1) inhibits jag1b and hey1 expression in the ventral domain. Strikingly, reduction of Jag1b or Notch2 function partially rescues the ventral defects of edn1 mutants, indicating that Edn1 promotes facial skeleton development in part by inhibiting Jagged-Notch signaling in ventral skeletal precursors. Together, these results indicate a novel function of Jagged-Notch signaling in ensuring dorsal identity within broad fields of facial skeletal precursors. 8 INTRODUCTION The facial skeleton arises from cranial neural crest cells (CNCCs) that populate a series of pharyngeal arches in all vertebrate embryos. CNCCs of the mandibular and hyoid arches are further divided into dorsal and ventral domains that generate distinctly shaped cartilages and bones. In the larval zebrafish, ventral mandibular CNCCs generate the lower jaw Meckel’s (M) cartilage, and dorsal mandibular CNCCs give rise to part of the palatoquadrate (Pq) cartilage (Crump et al., 2006). However, the pterygoid process (Ptp) of Pq, which functions as the larval upper jaw, arises from maxillary CNCCs (Eberhart et al., 2006). In the hyoid arch, ventral CNCCs give rise to the ceratohyal (Ch) and symplectic (Sy) cartilages and the branchiostegal ray (Br) bone, and dorsal CNCCs generate the hyomandibular (Hm) cartilage and opercle (Op) bone that support the gill covering (Fig. 4A,E). In general, dorsal mandibular and hyoid cartilages have plate-like morphologies, whereas their ventral cognates have rod-shaped morphologies. Moreover, the dorsal Op bone has a fan-shaped morphology that is distinct from the finger-shape ventral Br bone. Within the mandibular and hyoid arches, the secreted ligand Edn1 plays a central role in specifying ventral identity. In zebrafish and mice lacking Edn1 or the Endothelin type-A receptors (Ednras), the ventral facial skeleton either fails to develop or is transformed to a dorsal morphology (Kurihara et al., 1994; Clouthier et al., 1998; Miller et al., 2000; Ozeki et al., 2004; Nair et al., 2007). By contrast, Edn1 misexpression transforms the dorsal facial skeleton to a ventral morphology (Kimmel et al., 2007; Sato et al., 2008). Edn1 is thought to promote ventral skeletal development in part by activating the earlier 9 expression of a network of ventral-specific genes in the mandibular and hyoid arches. Edn1 targets include Dlx3/dlx3b, Dlx5/dlx5a, Dlx6/dlx6a, Msx1/msxe, and epha4b (rtk2) in ventral CNCCs of each arch, bapx1 (nkx3.2) in dorsoventral (DV)-intermediate CNCCs of the mandibular arch, and Hand2 (dHand)/hand2 in the most ventral CNCCs of each arch (Thomas et al., 1998; Clouthier et al., 2000; Miller et al., 2000; Miller et al., 2003; Walker et al., 2006). Moreover, several of these Edn1 targets have been shown to be required for development of the ventral face. Compound Dlx5 -/- ; Dlx6 -/- mutant mice display transformations of the ventral mandibular skeleton (Beverdam et al., 2002; Depew et al., 2002), zebrafish lacking bapx1 fail to form the jaw joint (Miller et al., 2003), and mutations in Hand2/hand2 result in ventral skeletal loss in mice and zebrafish (Miller et al., 2003; Yanagisawa et al., 2003). However, whether patterning of the dorsal facial skeleton occurs simply by default (i.e. in the absence of ventral signaling) has remained unclear. Here, we show that dorsal skeletal identity requires active repression of ventral fates by Jagged-Notch signaling. The Notch pathway is widely used during animal development to determine cell fates. Notch signaling occurs when transmembrane ligands of the Delta and Jagged/Serrate families engage Notch receptors on adjacent cells. Ligand binding then triggers cleavage and release of a Notch intracellular domain that translocates to the nucleus and activates the transcription of genes such as those of the Hey/Her/Hes class. In a process termed lateral inhibition, differential Notch signaling causes neighboring cells to adopt distinct fates. In other contexts, such as the fly wing, Notch signaling patterns fields of cells in organ primordia (Diaz-Benjumea and Cohen, 1995). In vertebrates, Jagged-Notch 10 signaling has been implicated in the development of diverse organs, including the ear (Brooker et al., 2006; Kiernan et al., 2006), liver (Geisler et al., 2008; Lozier et al., 2008), pancreas (Golson et al., 2009), and cardiovascular system (High et al., 2008). The role of Jagged-Notch signaling in craniofacial development is less clear. Several components of Jagged-Notch signaling are expressed in facial skeletal precursors, including zebrafish jag1b (Zecchin et al., 2005), mouse and human Jag1/JAG1 (Mitsiadis et al., 1997; Kamath et al., 2002b), zebrafish and mouse jag2/Jag2 (Jiang et al., 1998; Zecchin et al., 2005), and mouse Notch2 (Higuchi et al., 1995; Mitsiadis et al., 1997). Heterozygous mutations in human JAG1 or NOTCH2 are linked to Alagille syndrome, which is characterized by defects in multiple visceral organs, an abnormal facial appearance and occasional craniosynostosis and deafness (Li et al., 1997; Oda et al., 1997; Kamath et al., 2002b; Kamath et al., 2002a; Le Caignec et al., 2002; McDaniell et al., 2006). Whereas Jag1 -/- mice are embryonic lethal (Xue et al., 1999), Jag2 -/- mice die at birth from cleft palate (Jiang et al., 1998). In zebrafish, combined reduction of jag1b and jag2 function with morpholino oligonucleotides (MOs) has been reported to result in general reductions of facial cartilage (Lorent et al., 2004). However, a potential function of Jagged-Notch signaling in regional patterning of the facial skeleton has not been previously investigated. Here, we employ mutant and transgenic analysis in zebrafish to demonstrate a novel role for Jagged-Notch signaling in patterning the dorsal face. In particular, we find that Jagged-Notch signaling limits the dorsal extent of ventral gene expression and helps 11 determine dorsal skeletal morphology in the mandibular and hyoid arches. We further show that Jagged-Notch positive feedback and Edn1 inhibition are integrated through jag1b expression to restrict Notch activity to dorsal skeletal precursors. Moreover, compound mutant analysis reveals that a major function of Edn1 in ventral skeletal development is the repression of Jagged-Notch signaling. Together, our work defines a crucial role for Jagged-Notch signaling in DV facial patterning that might help to explain some of the craniofacial anomalies seen in Alagille syndrome. MATERIALS AND METHODS Zebrafish lines Zebrafish (Danio rerio) embryos were raised at 28.5°C and staged as described (Kimmel et al., 1995). The jag1b b1105 allele was identified in an ENU mutagenesis screen in which parthenogenic diploid progeny were analyzed for skeletal defects, and the sucker/edn1 tf216b mutant is as described (Miller et al., 2000). Tg(hsp70I:Gal4) kca4/+ (Scheer and Campos-Ortega, 1999) and fli1a:GFP (Lawson and Weinstein, 2002) zebrafish are as described. To create UAS:JAG1 el108 transgenic zebrafish, we used the Gateway (Invitrogen) Tol2kit (Kwan et al., 2007). Full-length human JAG1 cDNA (Open Biosystems Clone 30528888) was inserted into pDONR221 by PCR using primers hJAG1-L2 (5’- GGGGACAAGTTTGTACAAAAAAGCAGGCTGAATTCCGCGGCGCAGCGATGC GTT-3’) and hJAG1-R2 (5’- GGGGACCACTTTGTACAAGAAAGCTGGGTACTAGTCCCGCGGTCTGCTATAC G-3’). The resultant pME-JAG1 vector was combined with p5E-UAS, p3E-polyA, and 12 pDestTol2CG2 to create UAS:JAG1, which also contains a cmlc2:EGFP transgene that expresses GFP in the heart (cmlc2 is also known as myl7 – Zebrafish Information Network). UAS:JAG1 was injected with Tol2 transposase RNA into one-cell stage embryos, and stable line el108 was isolated. For heat-shock induction, embryos were placed in a 40°C incubator at 20 hours post-fertilization (hpf) and then transferred to 28.5°C at 28 hpf. Morpholino injections One-cell-stage embryos were injected with 3 nl of jag1b-MO (400 µM), notch2-MO (800 µM), or edn1-MO (27 µM) (GeneTools, Philomath, OR, USA). jag1b-MO (previously known as jag3-MO) and notch2-MO have been demonstrated to block translation and mRNA splicing, respectively, and we confirmed inhibition of notch2 splicing as described (Lorent et al., 2004). The concentration of edn1-MO used causes partial loss of Edn1 function (Miller and Kimmel, 2001). In situ hybridization and skeletal analysis Skeletal staining with Alcian Blue and Alizarin Red (Walker and Kimmel, 2007), live bone staining with Calcein Green (Kimmel et al., 2003), and colorimetric in situ hybridization experiments (Crump et al., 2004) were performed as described. For fluorescent in situ experiments, two modifications were made to the published protocol (Welten et al., 2006): hybridizations were conducted at 68°C and antibody concentrations were 1:500 anti-DIG-POD and 1:200 anti-DNP-peroxidase. 13 jag1a, jag1b, jag2, notch2, hey1, and ednra2 probes were synthesized with T7 RNA polymerase from PCR products using the following primers: (Shown 5’ to 3’): Jag1a-L, CCGCGTATGTTTGAAGGAGT; Jag1a-RT7, GCTAATACGACTCACTATAGGGCAGTTCTGTCCGGAGTAGC; Jag1b-3L, CACGTGACGAGTTCTTTGGA; Jag1b-4RT7, GCTAATACGACTCACTATAGGGACACCGGTATCCATTCACC; Jag2-L, TGGGACTGGGATAACTCCAC; Jag2-RT7, GCTAATACGACTCACTATAGGTCAAAGCCATTTTCCAGGTC; Notch2-L, ACCCTGTCATCATGGCAAAT; Notch-RT7, GCTAATACGACTCACTATAGGACAGGTTCCCTGATTCATGC; Hey1-L, TCATTTAAAGATGCTTCATGCTG; Hey-RT7, GCTAATACGACTCACTATAGGGTCTGTTTCTGTGCATCTGTTCA; Ednra2-L, CAATCATTTCCTGCATCGTG; and Ednra2-RT7, GCTAATACGACTCACTATAGGCAAGAGTTCACAGTCGCCAA. Published probes include dlx2a and dlx3b (Akimenko et al., 1994), bapx1 (Miller et al., 2003), epha4b [referred to as EphA3 by Xu et al. (Xu et al., 1995)], msxe (Akimenko et al., 1995), dlx5a and dlx6a (Walker et al., 2006), hand2 (Angelo et al., 2000), and edn1 (Miller et al., 2000). In all experiments, genotyping of embryos confirmed the observed phenotypes. For jag1b b1105 genotyping, we amplified product using primers Jag1b-IDL (5’- GTACCAAATCCGGGTGACCT-3’) and Jag1b-IDR (5’- GTGGCTTTTTGGGTCATTATCA-3’) and digested with BtsCI to generate a 206 bp 14 fragment in mutants and 134/72 bp fragments in wild types. edn1 tf216b genotyping was performed using primers Edn1-IDL (5’-AGCGCGACAAATTCAATCAT-3’) and Edn1- IDR (5’-CAAAAGTAGACGCACTCGTTA-3’), followed by digestion with HpaI to produce 178/20 bp fragments in mutants and a 198 bp fragment in wild types. The presence of hsp70I:Gal4 was detected by PCR using Gal4-IDL (5’- CTCCCAAAACCAAAAGGTCTCC-3’) and Gal4-IDR (5’- TGAAGCCAATCTATCTGTGACGG-3’). UAS:JAG1 embryos were selected by heart GFP, and hsp70I:Gal4-negative UAS:JAG1 siblings were used as controls. Transplantations Unilateral tissue transplantations were performed as previously described, with the non- recipient side acting as an internal control (Crump et al., 2004). Briefly, donor tissue from fli1a:GFP embryos injected with Alexa568-dextran (Molecular Probes) was transplanted into different fate-map regions of jag1b b1105 ; fli1a:GFP or notch2-MO; fli1a:GFP hosts at 6 hpf. Targeting of Alexa568-positive donor tissue was assessed at 36 hpf by localization relative to fli1a:GFP. For endoderm transplants, donor embryos were also injected with Tar RNA to promote endoderm targeting. Imaging Skeletons and in situ hybridization embryos were photographed on a Zeiss Axioimager.Z1 microscope using Axiovision software. Fluorescent images were captured on a Zeiss LSM5 confocal microscope and, except where indicated otherwise z-stacks of approximately 40 µM were flattened into single projections. Levels were adjusted in 15 Adobe Photoshop CS2, with care taken to apply identical adjustments to images from the same data set and to avoid removing information from the image. Dissected skeletons were cropped to remove surrounding soft tissue. Statistical analysis JMP 7.0 software (SAS) was used for one-way analysis of variance. A Tukey-Kramer honestly significant difference (HSD) test (α= 0.05) showed significance for all dlx3b and dlx5a expression differences and for the following comparisons in the skeletal analysis of Edn1 and Jagged-Notch interactions: M and Ch (edn1 versus all others), Hm (edn1;jag1b versus all others), and Op (edn1 versus jag1b and edn1;notch2-MO). RESULTS Identification of a zebrafish jag1b mutant with dorsal-specific facial skeletal defects As part of an ENU mutagenesis screen conducted at the University of Oregon, we isolated a mutation, b1105, that displays defects in the facial skeleton (Fig. 4B). Linkage analysis, phenocopy with a jag1b-MO and gene sequencing reveal that the b1105 lesion is a G-to-A transition in the zebrafish jag1b gene. The jag1b b1105 mutation converts tryptophan 223 to a premature stop codon, truncating the Jag1b protein within the extracellular DSL domain required for Notch binding (Fig. 4C) (Cordle et al., 2008). At 5 days post-fertilization (dpf), jag1b b1105 mutants have variable facial defects that ranged from mild reductions to more striking shape changes of dorsal hyoid and mandibular skeletal elements (Fig. 4I). In the hyoid arch of the most severely affected jag1b b1105 larvae, the dorsal Hm cartilage became more rod-shaped, partially resembling the ventral 16 Ch, and the normally fan-shaped Op bone adopted the finger-shaped morphology of the ventral Br bone to which it occasionally fused (Fig. 4E,H). In the jag1b b1105 mandibular arch, the dorsal portion of Pq was truncated rather than transformed. Contrary to previous jag1b-MO studies (Lorent et al., 2004), we observed no defects in the ventral Ch, Sy and M cartilages or the ventral Br bone in jag1b b1105 larvae. The maxillary-derived Ptp and the neurocranium, which is derived from maxillary and frontonasal CNCCs (Wada et al., 2005), were likewise unaffected. jag1b b1105 larvae died by 7 dpf, precluding an examination of the DV morphology of later-forming facial bones. Nonetheless, our loss- of-function data suggest that, particularly in the hyoid arch, Jag1b is required for dorsal skeletal morphology. 17 Figure 4: Jag1b-Notch2 signaling regulates DV patterning of the facial skeleton. (A and B) Skeletal staining at 5 dpf showing cartilage (blue) and bone (red). jag1b b1105 mutants display a characteristic kink (arrow) behind the eye, which is not seen in the wild type (Wt). (C) Schematic of Jag1b protein showing DSL (blue), EGF-like (white), cysteine-rich (red), transmembrane (TM) and intracellular (yellow) domains. The jag1b b1105 lesion is a nonsense mutation (W223*) that truncates Jag1b in the DSL domain required for Notch binding. (D-G) Dissected facial skeletons from wild-type (D), jag1b b1105 (E), notch2-MO (F), and 20-28 hpf heat-shock-treated hsp70I:Gal4; UAS:JAG1 (G) larvae. Schematics (below) show ventral (red) and dorsal (green) elements derived from the mandibular and hyoid arches, with bones more lightly shaded. The maxillary-derived pterygoid process (Ptp) is in grey. Scale bar = 100 µM. (H) Calcein Green bone staining at 5 dpf shows Op-to-Br transformations in jag1b b1105 and notch2-MO larvae and Br-to-Op transformations in 20-28 hpf heat-shock-treated hsp70I:Gal4;UAS:JAG1 larvae. (I) The proportion of wild- type, jag1b b1105 , jag1b-MO, notch2-MO and 20-28 hpf heat-shock-treated hsp70I:Gal4; UAS:JAG1 larvae showing normal (yellow), reduced (red) or transformed (blue) skeletal elements. M, Meckel’s; Pq, palatoquadrate; Hm, hyomandibular; Sy, symplectic; Ch, ceratohyal; Op, opercle bone; Br, branchiostegal ray bone. The proportion of larvae showing ectopic cartilage (blue) is also shown. 18 Notch2 is required for development of the dorsal facial skeleton We next investigated which Notch receptor mediates Jag1b signaling in the face. In humans, heterozygosity of either NOTCH2 or JAG1 can result in Alagille syndrome, and Notch2 genetically interacts with Jag1 in mouse (McCright et al., 2002). Moreover, of the four zebrafish Notch genes (notch1a, notch1b, notch2 and notch3), we found that only notch2 is expressed in the pharyngeal arches at DV patterning stages, 28-36 hpf (data not shown). We thus tested the requirement for Notch2 in facial skeleton patterning. Using a notch2-MO to block notch2 mRNA splicing (Lorent et al., 2004), we found that Notch2 reduction results in partial transformation of dorsal Hm to a ventral rod-like morphology, the transformation of dorsal Op to a ventral finger-like morphology, and the truncation of dorsal Pq (Fig. 4F,H). notch2-MO larvae also infrequently developed ectopic cartilage near the DV boundaries within the mandibular and hyoid arches, suggesting an additional role for Notch2 in suppressing skeletal development at the DV interface (data not shown). Overall, the skeletal phenotypes of notch2-MO larvae are comparable to those of jag1b-MO larvae, but weaker than those of jag1b b1105 mutants, which might be due to incomplete reduction of Notch2 function by the MO or partial compensation by other, weakly expressed Notch receptors (Fig. 4I). Nonetheless, as Notch2 reduction results in dorsal-specific skeletal defects that are similar to, although less severe than, those seen in jag1b b1105 mutants, we conclude that Notch2 at least partially mediates Jag1b signaling during DV facial patterning. 19 JAG1 misexpression transforms the ventral facial skeleton We next tested whether Jagged-Notch signaling is also sufficient to promote a dorsal skeletal morphology. Using a heat shock-inducible Gal4/UAS system (Scheer and Campos-Ortega, 1999) to induce human JAG1 expression throughout zebrafish embryos at early facial patterning stages (20-28 hpf), we found that JAG1 misexpression results in ventral-specific defects of the mandibular and hyoid skeletons (Fig. 4G). In the most severely affected larvae, ventral M and Ch cartilages adopted plate-like morphologies similar to those of dorsal Pq and Hm cartilages. In addition, the ventral Sy cartilage and mandibular jaw joint were lost, and the ventral Br bone fused to the dorsal Op bone. By contrast, dorsal Hm and Pq cartilages and the maxillary-derived Ptp were unaffected. In less severe examples, the ventral Br bone was strikingly transformed to a mirror-image duplicate of the fan-shaped dorsal Op, the jaw joint was lost, and ectopic cartilage formed near Pq and the midline (Fig. 4H,I). As loss and gain of Jag1b function result in reciprocal DV skeletal transformations, we conclude that Jag1b is both necessary and sufficient for dorsal skeletal morphology in the hyoid and, to a lesser extent, the mandibular arches. Jagged-Notch signaling inhibits ventral gene expression in the dorsal face We next examined whether Jag1b-Notch2 signaling might control dorsal skeletal character by regulating earlier patterns of DV gene expression in CNCC-derived skeletal precursors. Whereas dlx2a was expressed throughout mandibular and hyoid CNCCs, double-fluorescent in situ hybridizations showed that dlx3b and dlx5a expression is restricted to more ventral CNCCs at 36 hpf wild-type embryos (Fig. 5A,E). By contrast, 20 we observed a moderate dorsal expansion of dlx3b and dlx5a expression in jag1b b1105 and notch2-MO embryos (Fig. 5B,C,F,G). In particular, the dorsal expansion of dlx3b and dlx5a was more prominent in the hyoid arch, correlating with the stronger transformations seen in the dorsal hyoid skeleton. In order to rule out the possibility that of dlx3b and dlx5a expression is simply due to changes in arch size, we measured the areas of dlx2a, dlx3b, and dlx5a expression in the hyoid arches of wild-type, jag1b b1105 and notch2-MO embryos. Normalization of hyoid arch size by measuring the ratio of dlx3b/dlx2a (wt – 43%, jag1b b1105 – 61%, notch2-MO – 55%) and dlx5a/dlx2a (wt – 41%, jag1b b1105 – 55%, notch2-MO – 54%) confirms that the percentage of the hyoid arch expressing dlx3b and dlx5a increases in both jag1b b1105 and notch2-MO embryos. In contrast, we find that dlx3b and dlx5a expression is severely reduced in JAG1 misexpression embryos (Fig. 5D,H). Thus, Jagged-Notch signaling is also sufficient to inhibit dlx3b and dlx5a expression in ventral CNCC. 21 Figure 5: Jag1b-Notch2 signaling inhibits dlx3b and dlx5a expression in the pharyngeal arches. (A-H) Double-fluorescence in situ hybridizations showing the expression of dlx3b or dlx5a (red) and dlx2a (green) at 36 hpf. Compared with wild types (A,E), dlx3b and dlx5a expression is expanded into the dorsal hyoid arches (asterisks) of jag1b b1105 (B,F) and notch2-MO (C,G) zebrafish embryos and is reduced in the ventral arches of 20-28 hpf heat shock-treated hsp70I:Gal4; UAS:JAG1 (D,H) embryos. The expression of dlx3b and dlx5a in otic placodes (arrowheads) is unaffected in UAS:JAG1 embryos. Endodermal pouches (solid lines) and the DV arch boundaries (dashed lines) are indicated in the merged images. The maxillary domain (mx) and the dorsal (D) and ventral (V) domains of the mandibular (m) and hyoid (h) arches are indicated for wild type. We next examined whether Jag1b might regulate the expression of a broader cohort of ventral-specific genes. dlx6a, epha4b, and msxe are expressed in a ventral-specific pattern similar to that of dlx3b and dlx5a at 36 hpf. Compared with wild types, we found that the expression of dlx6a, epha4b, and msxe also extends more dorsally in the hyoid and mandibular arches of jag1b b1105 mutants and was severely reduced in JAG1- misexpression embryos (Fig. 6A-I). The expression of the mandibular joint marker bapx1 was also expanded dorsally in jag1b b1105 mutants and lost in JAG1-misexpression 22 embryos (Fig. 6J-L). By contrast, the expression of hand2, one of the most ventrally restricted genes in the arches, was unaffected in jag1b b1105 embryos, although it was reduced in JAG1-misexpression embryos (Fig. 6M-O). Furthermore, the arch expression of edn1 and its receptor, ednra2, are unaffected in jag1b b1105 , notch2-MO, and JAG1- misexpression embryos (Fig. 6P-U and data not shown). We therefore conclude that the role of Jag1b and Notch2 in dorsal skeletal patterning correlates with an earlier requirement in limiting the dorsal extent of most, but not all, ventral gene expression in facial skeletal precursors. Figure 6: Jag1b generally represses ventral gene expression in the pharyngeal arches. (A-U) In situ hybridizations showing the mandibular and hyoid arch expression of dlx6a (A-C), epha4b (D-F), msxe (G- I), hand2 (M-O), ednra2 (P-R), and edn1 (S-U) at 36 hpf and of bapx1 (J-L) at 40 hpf. The expression of dlx6a, epha4b, msxe, and bapx1 is dorsally expanded in jag1b b1105 zebrafish embryos (B,E,H,K) and is greatly reduced in 20-28 hpf heat shock-treated hsp70I:Gal4; UAS:JAG1 embryos (C,F,I,L). hand2 expression is reduced in UAS:JAG1 embryos, whereas ednra2 and edn1 expression is unaffected in jag1b b1105 and UAS:JAG1 embryos. Endodermal pouch are outlined. jag1b and the Notch target hey1 are selectively expressed in dorsal skeletal precursors In order to understand where Jagged-Notch signaling functions to repress ventral gene expression, we analyzed the expression of jag1b, notch2 and the Notch target gene hey1 during arch patterning stages. At 28 hpf, double-fluorescence in situ hybridizations of jag1b with notch2, and of hey1 with the CNCC-specific dlx2a probe, showed that jag1b 23 and hey1 are expressed in the dorsal-most CNCCs of the mandibular and hyoid arches and in pouch endoderm (Fig. 7A,H). From 32 to 36 hpf, jag1b and hey1 expression continued to be dorsally restricted yet extended more ventrally to abut dlx3b and dlx5a expression; concomitantly, expression becomes more prominent in posterior CNCC in each arch and endoderm expression disappeared (Fig. 7B,C,I,J). By 36 hpf, hey1 also began to be expressed in ventral arch mesoderm. Double-fluorescence in situ hybridization revealed that hey1 expression extended just ventral to jag1b, as predicted if Jag1b is activating Notch2 in adjacent cells, and extensive colocalization of jag1b with dlx2a confirmed that within the dorsal arches, jag1b is expressed primarily in CNCCs (data not shown). In addition, jag2 but not jag1a, was co-expressed at low levels with jag1b in dorsal CNCCs at 36 hpf (data not shown). 24 Figure 7: Expression of jag1b, notch2 and hey1 is regulated by Jagged-Notch and Edn1 signaling. (A- N) Confocal sections of double-fluorescence in situ hybridizations showing mandibular (m) and hyoid (h) arch expression of jag1b (green) and notch2 (red) (A-G) and of dlx2a (green) and hey1 (red) (H-N). In wild types, jag1b and hey1 CNCC expression expands ventrally from 28 hpf (A,H) to 32 hpf (B,I) and 36 hpf (C,J). In jag1b b1105 (D,K) and notch2-MO (E,L) zebrafish embryos, jag1b and hey1 expression is reduced and strong ventral notch2 expression (brackets) is expanded at 36 hpf. Arrowheads in J,K indicate ventral mesoderm expression of hey1, which is unaffected in jag1b b1105 mutants. In 20-28 hpf heat shock-treated hsp70I:Gal4; UAS:JAG1 (F,M) and edn1 -/- (G,N) embryos, jag1b and hey1 expression is expanded into ventral CNCCs (arrows) and notch2 expression is reduced at 36 hpf. Endodermal pouches are outlined in A-G. We also confirmed that hey1 is a bona fide target of Jag1b-Notch2 signaling in CNCCs, as hey1 CNCC expression was greatly reduced in jag1b b1105 and notch2-MO embryos and upregulated in JAG1-misexpression embryos (Fig. 7K-M). Of note, the expression of 25 hey1 in ventral arch mesoderm was lost in notch2-MO, but not in jag1b b1105 embryos, suggesting a specific function of Jag1b in regulating hey1 expression within CNCCs. Furthermore, in contrast to the dorsal-specific expression of jag1b, we found that notch2 is more widely expressed throughout the pharyngeal arches from 28 to 36 hpf. Whereas higher expression of notch2 was observed in ventral CNCCs that also express dlx3b and dlx5a, notch2 was co-expressed at weaker levels with jag1b, hey1, and dlx2a in dorsal CNCCs (Fig. 7A-C). This widespread expression of notch2 was confirmed with two independent probes (data not shown). Thus, despite the stronger ventral expression of notch2, hey1 expression indicates that Jag1b activates Notch2 specifically in dorsal CNCCs, consistent with the observed function of Notch2 in repressing ventral gene expression in dorsal skeletal precursors. Jagged-Notch signaling functions within CNCCs for DV skeletal patterning As jag1b and notch2 are expressed in multiple arch tissues, we used mosaic rescue experiments to test in which tissues Jag1b and Notch2 are sufficient for facial skeletal patterning. In order to create tissue mosaics, we transplanted wild-type fli1a:GFP precursors at early gastrulation stages (6 hpf) into different fate-map domains of jag1b b1105 ; fli1a:GFP or notch2-MO; fli1a:GFP hosts. fli1a:GFP specifically labels the CNCC component of the pharyngeal arches (Lawson and Weinstein, 2002), allowing us to assess the correct targeting of donor tissue to CNCCs, endoderm, or ectoderm of the arches. Whereas transplantation of wild-type CNCC precursors rescued facial skeletal patterning in 30/39 jag1b b1105 embryos, transplantations of wild-type endodermal (0/5) or ectodermal (1/8) precursors did not reliably rescue (Fig. 8B-D). Similarly, wild-type 26 CNCC precursor transplants rescued skeletal defects in 12/15 notch2-MO embryos (Fig. 8E). We therefore conclude that Jag1b and Notch2 function predominantly in CNCCs, and not in the surrounding endoderm or ectoderm, to pattern the dorsal facial skeleton. Figure 8: Jag1b-Notch2 signaling functions within CNCCs for DV facial patterning. (A-E) Dissected zebrafish facial skeletons at 5 dpf with wild type (A) shown for reference. Transplantations of wild-type CNCC precursors (B), but not wild-type endoderm (C) or surface ectoderm (D) precursors, rescue the jag1b b1105 skeleton, as compared with the control non-recipient sides. Wild-type CNCC precursor transplants also rescue notch2-MO skeletal defects (E). Jagged-Notch signaling positively regulates jag1b expression in dorsal CNCCs We next investigated how Notch activity might be established throughout dorsal skeletal precursors. As Notch positively regulates the expression of Jagged/Serrate in other contexts (de Celis and Bray, 1997; Daudet et al., 2007), we examined whether Notch signaling also regulates jag1b expression in CNCCs. Indeed, we found that jag1b expression is severely reduced in dorsal CNCCs of jag1b b1105 and notch2-MO embryos and is expanded into ventral CNCCs of JAG1-misexpression embryos at 36 hpf (Fig. 7D- F). Conversely, the stronger ventral expression domain of notch2 was expanded in jag1b b1105 and notch2-MO embryos and reduced in JAG1-misexpression embryos. We therefore conclude that Jagged-Notch signaling activates jag1b expression and represses strong notch2 expression in dorsal CNCCs of the mandibular and hyoid arches. 27 Edn1 signaling restricts jag1b and hey1 expression to dorsal CNCCs As Edn1 is known to promote ventral gene expression, we examined whether Edn1 also inhibits the ventral expression of Jagged ligands. Similar to what we observe in JAG1- misexpression embryos, we found that jag1b expression expands into ventral arch CNCCs in edn1 mutants (Fig. 7G). jag2 expression also expanded ventrally in edn1 mutants (data not shown), whereas ventral notch2 expression was reduced. Concomitantly, hey1 expression was upregulated in ventral CNCCs (Fig. 7N), suggesting that ectopic jag1b and/or jag2 expression results in increased Notch activity in ventral CNCCs of edn1 mutants. Thus, Edn1 acts opposite to Jagged-Notch signaling to inhibit Jagged ligand expression and hence Notch activity in ventral skeletal precursors. Reduction of Jag1b-Notch2 signaling partially rescues the ventral facial defects of edn1 mutants As we found that Edn1 represses Jag1b-Notch2 activity, we reasoned that inappropriate Notch signaling in the ventral domain might contribute to the ventral skeletal defects of edn1 mutants. edn1 mutants exhibit nearly complete loss of ventral M, Ch, and Sy cartilages, ventral Br bone and joints, and the dorsal Op bone is variably reduced or expanded (Fig. 9C) (Miller et al., 2000; Kimmel et al., 2003). Remarkably, reduction of Jag1b or Notch2 function in edn1; jag1b b1105 and edn1; notch2-MO larvae substantially rescued ventral cartilage (Fig. 9D-G). Whereas the rescued ventral mandibular M cartilage was morphologically abnormal, the ventral hyoid Ch and Sy cartilages were restored to a nearly normal morphology in some edn1; jag1b b1105 and edn1; notch2-MO larvae. Interestingly, heterozygosity of jag1b also partially rescued the ventral cartilage 28 defects of edn1 mutants at a low frequency, underscoring the critical balance of Jagged- Notch and Edn1 signaling required for DV skeletal patterning (Fig. 9E,G). Consistent with the rescue of ventral skeletal defects, we found that the earlier ventral expression of dlx3b, dlx5a, and dlx6a is partially restored in edn1; jag1b b1105 mutants (Fig. 9H). Of note, hey1 expression was reduced but not completely absent, in ventral CNCCs of edn1; jag1b b1105 embryos, potentially reflecting the presence of residual low-level Notch signaling mediated by Jag2 (data not shown). 29 Figure 9: Reduction of Jag1b-Notch2 signaling rescues the ventral defects of edn1 mutants. (A-F) Ventral views of dissected zebrafish facial skeletons at 5 dpf, with element labeled in wild type (A). jag1b b1105 mutants (B) have Pq reductions (arrowhead) and variable transformations of Hm (arrow) and Op (asterisk). In edn1 -/- mutants (C), M (red arrow) and Ch (red arrowhead) are nearly absent. In edn1 -/- ; jag1b b1105 larvae (D), development of ventral M and Ch is variably restored yet Pq and Hm are still evident. M and Ch development is also partially restored in some edn1 -/- ; jag1b b1105/+ (E), and edn1 -/- ; notch2-MO (F) larvae. (G) Quantification of skeletal rescue, showing wild-type (yellow), weakly defective (red), severely defective (blue), and expanded (green) cartilage and bone. (H) In situ hybridizations showing dlx3b, dlx5a, and dlx6a expression in arch CNCCs at 36 hpf. Compared with edn1 -/- embryos, edn1 -/- ; jag1b b1105 embryos show partial rescue of expression. Endodermal pouches are outlined. See Fig. 4 for abbreviations. 30 In contrast to the rescue of edn1 -/- phenotypes by loss of jag1b, partial reduction of Edn1 function with a low dose of edn1-MO did not rescue the dorsal Hm, Op, and Pq cartilage defects of jag1b b1105 mutants (data not shown). However, upon nearly complete loss of Edn1 function in edn1; jag1b b1105 mutants, there was a slight rescue of Hm shape and an increase in the frequency of expanded Op compared with that seen in jag1b b1105 single mutants. Thus, although the dorsal skeletal defects of jag1b b1105 mutants are not simply the consequence of increased Edn1, the presence of Edn1 appears to influence the penetrance of dorsal transformations in jag1b b1105 mutants. Nonetheless, our genetic analysis shows that for ventral skeletal patterning, Edn1 functions primarily as an upstream inhibitor of Jagged-Notch signaling. DISCUSSION Jagged-Notch signaling inhibits ventral identity in the dorsal face Here, we demonstrate a novel function of Jagged-Notch signaling in ensuring dorsal identity in the mandibular and hyoid arches (Fig. 10). Several lines of evidence indicate that Jag1b-Notch2 signaling acts opposite to Edn1 and ventral Dlx genes in DV facial patterning. In particular, reduction of Jag1b-Notch2 signaling in jag1b b1105 and notch2- MO larvae results in dorsal-specific defects that are similar to those seen upon Edn1 overexpression, including dorsal-to-ventral transformations of hyoid cartilage (Hm to Ch- like) and dorsal reductions of mandibular cartilage (Pq truncation) (Kimmel et al., 2007). Conversely, JAG1 misexpression results in ventral-specific skeletal defects similar to those seen upon reduction of Edn1 or combined Dlx3b/Dlx5a function, including loss of ventral Sy cartilage and joints and striking homeotic transformation of the ventral Br 31 bone into a dorsal Op-like morphology (Miller and Kimmel, 2001; Walker et al., 2006). Moreover, JAG1 misexpression results in partial transformations of ventral M and Ch cartilages to dorsal plate-like morphologies, phenotypes that are not observed in zebrafish edn1 mutants but are reminiscent of the ventral mandibular transformations of Edn1 -/- , Ednra -/- and Dlx5 -/- ; Dlx6 -/- mice (Beverdam et al., 2002; Depew et al., 2002; Ozeki et al., 2004; Ruest et al., 2004). Thus, Jag1b-Notch2 signaling is specifically required for dorsal skeletal morphology and is also sufficient to alter the morphology of the ventral hyoid and mandibular skeleton. Figure 10: Model of DV facial skeletal patterning in zebrafish. (A) In the wild-type dorsal domain Jag1b activates the Notch2 receptor, promoting the expression of jag1b and hey1 and repressing the expression of dlx3b, dlx5a, dlx6a, epha4b, msxe, bapx1, and the otherwise strong expression of notch2. In the ventral domain, Edn1 represses jag1b expression and Notch signaling, permitting the expression of dlx3b, dlx5a, dlx6a, epha4b, msxe, and bapx1. Edn1 promotes hand2 expression independently of Jag1b in more ventral CNCCs. Separate from relieving Jagged-Notch inhibition, Edn1 might also directly promote 32 Figure 10, continued. dlx3b, dlx5a, dlx6a, epha4b, msxe, and bapx1 expression. (B) Schematic of the pharyngeal arches showing the dorsal (d) and ventral (v) portions of the mandibular (MAND) and hyoid domains, and the Jagged-Notch-independent maxillary (MAX) domain. The ectodermal Edn1 source, ventral fates (red-to-yellow gradient) and dorsal fates (green) are shown. Outlines show the fate-map origin of cartilage (blue) and bone (red) based on published data (Crump et al., 2006; Eberhart et al., 2006). (C) Ventral fates are moderately expanded in jag1b b1105 and notch2-MO larvae, resulting in reduction of dMAND cartilage and variable transformations of dHYOID cartilage and bone to ventral morphologies. (D) Dorsal fates are expanded in JAG1-misexpression larvae, resulting in partial transformations of vMAND and vHYOID cartilages and full transformation of vHYOID bone to a dorsal morphology. The opposite effect of Jag1b-Notch2 and Edn1 signaling on skeletal morphology is also reflected at the level of DV gene expression. Edn1 has been shown to positively regulate a broad cohort of ventral genes (dlx3b/dlx5a/dlx6a/epha4b/msxe/bapx1) (Miller et al., 2000; Miller et al., 2003; Walker et al., 2006), and here we show that Edn1 also negatively regulates two newly characterized dorsal-specific genes, jag1b and hey1. By contrast, our gain- and loss-of-function studies demonstrate that Jag1b-Notch2 signaling negatively regulates these same ventral genes and positively regulates dorsal jag1b and hey1. Although we find that Jag1b and Notch2 function tissue autonomously within CNCCs for DV patterning, we do not know whether Jag1b-Notch2 signaling inhibits ventral gene expression directly through transcriptional repressors such as hey1, or indirectly via other downstream targets. Moreover, whereas changes in DV skeletal morphology correlate with earlier changes in DV gene expression in jag1b b1105 mutants and JAG1-misexpression animals, we cannot rule out the possibility that Jag1b and/or Notch2 have additional roles in the proliferation, survival, and/or differentiation of skeletal precursors (Crowe et al., 1999; Nakanishi et al., 2007). Indeed, the stronger expression of notch2 in ventral CNCC suggests additional roles of Notch2 in arch development that are independent from its function in mediating Jag1b-dependent repression of ventral gene expression in dorsal skeletal precursors. Nonetheless, the 33 mirror-image homeotic changes of hyoid bone seen in jag1b b1105 and JAG1- misexpression larvae, combined with the opposite effects on dorsal versus ventral gene expression and cartilage morphology, indicate a clear role for Jag1b-Notch2 signaling in promoting dorsal identity in the mandibular and hyoid arches. Whereas Jag1b-Notch2 signaling plays a crucial role in ensuring dorsal identity in the face, except for the previously discussed hyoid bones, loss and gain of Jag1b-Notch2 signaling results in only partial transformations of DV skeletal character. There are several reasons why skeletal elements might adopt morphologies similar, but not identical, to their DV cognates upon Jag1b-Notch2 manipulation. First, the lack of full transformations in jag1b b1105 larvae could be due to residual Jagged-Notch signaling mediated by Jag2. Similarly, the partial transformations of notch2-MO larvae could be attributed to incomplete efficacy of the MO. However, our analysis of jag1b b1105 ; jag2 double mutants has not revealed a striking enhancement of facial defects over jag1b b1105 single mutants (data not shown), suggesting that the partial nature of the transformations is not due to residual Jagged-Notch activity. Second, cell-intrinsic changes in identity often do not lead to homeotic transformations of an identical nature, as a field of cells that adopts the identity of another may encounter different types of extrinsic signals or spatial constraints. For example, loss of Hox paralog 2 genes, which function as homeotic selectors in anterior-posterior patterning, results in only partial duplications of the mandibular facial skeleton in the more posterior hyoid arch (Gendron-Maguire et al., 1993; Rijli et al., 1993; Miller et al., 2004). Analogously, Edn1 overexpression results in only partial transformations of dorsal skeletal elements, similar to what we observe in 34 jag1b b1105 mutants (Kimmel et al., 2007; Sato et al., 2008). Third, the partial transformations of the dorsal skeleton in jag1b b1105 and notch2-MO embryos correlate with the only moderate expansion of dlx3b, dlx5a, dlx6a, epha4b, msxe, and bapx1 expression into the dorsal arches, with the expression of the most ventrally restricted gene hand2 being unaffected. Hence, rather than inhibiting ventral identity throughout the dorsal domain, the function of Jagged-Notch signaling might be to refine the dorsal limit of a subset of ventral genes that are expressed up to the DV border. Therefore, as discussed below, it might be that other signaling pathways act in parallel with Jagged- Notch to repress ventral gene expression in dorsal skeletal precursors. Jagged-Notch signaling patterns a distinct axis within the mandibular and hyoid arches Our analysis also reveals that Jagged-Notch signaling has a more restricted role in patterning a DV axis of the mandibular and hyoid arches that is distinct from the maxillary-mandibular axis (Fig. 10B). Whereas jag1b and hey1 are expressed in dorsal mandibular CNCCs anterior to the first pouch and in dorsal hyoid CNCCs between the first and second pouches, they are not expressed in maxillary CNCCs anterior to the oral ectoderm. Concomitantly, ventral gene expression expands into the dorsal mandibular and hyoid domains, but not the maxillary domain of jag1b b1105 and notch2-MO embryos. Our previous fate maps of wild-type arches (Crump et al., 2006; Eberhart et al., 2006) also help explain why Hm and Op are strikingly transformed in shape, yet only a portion of Pq is lost, in jag1b b1105 mutants. Whereas Hm and Op derive entirely from dorsal 35 hyoid CNCCs, only a portion of Pq derives from dorsal mandibular CNCCs, with the Ptp process of Pq deriving from maxillary CNCCs that are unaffected in jag1b b1105 mutants. Species-specific differences might also account for the relative importance of Jagged- Notch signaling in facial patterning. Whereas the majority of the craniofacial skeleton of the larval zebrafish derives from mandibular and hyoid CNCCs, in mammals most of the facial skeleton derives from frontonasal, maxillary, and ventral mandibular CNCCs, with dorsal mandibular and hyoid CNCC contributing prominently to ossicles of the middle ear. Recently, Pofut1 flox/- ; Wnt1-Cre mice have been generated that lack Notch signaling throughout CNCCs owing to the tissue-specific deletion of O-fucosyltransferase 1, an essential component of Notch signaling (Okamura and Saga, 2008). The lack of severe craniofacial defects in Pofut1 flox/- ; Wnt1-Cre mice is consistent with our findings in zebrafish that Jag1b and Notch2 are not required for patterning of maxillary and frontonasal CNCCs. As we find that Jag1b and Notch2 inhibit ventral skeletal identity only in the dorsal mandibular and hyoid domains, it will be interesting to examine whether a role of JAG1 in development of the ossicles of the middle ear contributes to the conductive hearing loss seen in some Alagille Syndrome patients (Le Caignec et al., 2002). Jagged-Notch signaling propagates throughout dorsal skeletal precursors Our analysis of jag1b transcriptional regulation also indicates a potential mechanism by which Notch patterns a broad field of dorsal skeletal precursors. In contrast to secreted morphogens, Jagged and Notch are transmembrane proteins and do not generally act at a 36 distance. In the Drosophila wing, Notch signaling induces the expression of morphogens, in particular Wingless, which act at a distance to pattern the dorsal domain (Diaz- Benjumea and Cohen, 1995). However, our observation that the Notch2 target hey1 is expressed throughout dorsal skeletal precursors suggests a more direct role for Notch in dorsal facial patterning. Similar to what is observed during early inner ear development (Daudet et al., 2007), we find that Jagged-Notch transcriptional feedback serves to extend jag1b expression more ventrally over time. Such a mechanism would propagate Notch activity throughout the dorsal facial domain, ensuring that each cell within the dorsal field experiences Notch activity at some point during development. Edn1 represses Jagged-Notch signaling in the ventral face Whereas Jagged-Notch feedback extends Notch activity, we find that Edn1 signaling prevents Notch activity from spreading into the ventral domain by repressing jag1b expression. Previous studies have demonstrated a nearly complete loss of the ventral facial skeleton in zebrafish edn1 mutants, suggesting that Edn1 is essential for development of the ventral facial skeleton (Miller et al., 2000). By contrast, we find that in the absence of Jag1b-Notch2 signaling, Edn1 is partially dispensable for development of the ventral face. Thus, the ventral gene expression and skeletal defects of edn1 mutants can at least partially be attributed to aberrant jag1b expression and hence Notch activity in the ventral domain. However, the partial nature of the rescue in edn1; jag1b b1105 mutants suggests that Edn1 may also have Notch-independent roles in promoting ventral gene expression and skeletal development. Moreover, we find that partial reduction of Edn1 signaling fails to rescue jag1b b1105 defects, and the expression of edn1 and its 37 receptor ednra2 are not regulated by Jag1b-Notch2 signaling. Thus, the dorsal to ventral transformations of jag1b b1105 mutants are not due to increased Edn1 signaling. What then might account for the striking ability to form fairly normally patterned ventral hyoid skeleton even in the complete absence of Edn1? Studies in mouse suggest that unknown redundant signals might function in parallel with Edn1 to promote ventral skeletal fates (Ruest et al., 2004). In the absence of Edn1, these redundant signals might be unable to sustain ventral skeletal development owing to ectopic repressive Notch activity in the ventral domain. However, in the absence of both Edn1 and Notch signaling, redundant ventralizing signals might now be able to partially support ventral skeletal development. Further investigation of ventral patterning in the absence of both Edn1 and Jagged-Notch signaling should help to reveal the extent of functional redundancy in specifying the DV axis of the facial skeleton. 38 CHAPTER 2: REVERSE SIGNALING OF JAGGED1 IN CRANIOFACIAL PATTERNING SUMMARY The development of the face depends on regionalization of neural crest precursors into distinct dorsal and ventral domains. Notch signaling has been implicated in compartmentalization of tissues into discrete fields during development. We have recently shown that Jagged1-Notch2 signaling is involved in patterning facial precursors along the dorsoventral (DV) axis of zebrafish. Jagged ligands are thought to act primarily as ligands for Notch receptors, with cleavage and nuclear translocation of a Notch intracellular domain (NICD) affecting gene transcription. Surprisingly, we find that transgenic misexpression of the human JAGGED1 intracellular domain (JICD), which lacks the extracellular domain required for Notch binding, produces facial skeletal and DV gene expression defects similar to those seen upon misexpression of full-length JAGGED1. We find the forward Notch-dependent pathway activates hey1 and propagates jag1b expression whereas the Jagged reverse Notch-independent pathway represses dlx3b expression. In addition, we find both loss of Jagged and misexpression of JICD results in defective condensation formations at arch stages. We propose JICD patterns the dorsal facial skeleton by repressing a ventral identity in dorsal facial precursors and directly aiding in cell adhesion during chondrogenesis. Jagged-Notch signaling is widely utilized during development therefore investigating the receptor- and ligand- signaling will be important in understanding organ patterning. 39 INTRODUCTION In all vertebrates, the facial skeleton develops from cranial neural crest cells (CNCC) that migrate to form a series of segments called the pharyngeal arches (Platt, 1893). In zebrafish, the arches can be subdivided along the dorsoventral (DV) axis with dorsal CNCC of the mandibular arch giving rise to palatoquadrate (Pq) cartilage and the upper jaw pterygoid process (Ptp) whereas the dorsal hyoid arch forms the hyomandibular (Hm) cartilage and the dermal opercle (Op) bone. Ventral CNCC of the mandibular arch forms the lower jaw Meckel’s (M) cartilage, the hyoid-derived CNCC generate ceratohyal (Ch) and symplectic (Sy) cartilage and branchiostegal ray (Br) bone (Crump et al., 2004; Crump et al., 2006). Edn1 secreted from the surrounding epithelia induces expression of Dlx3/dlx3b, Dlx5/dlx5a, and Dlx6/dlx6a genes in ventral CNCC. Dlx genes are thought to be responsible for patterning the ventral face as Dlx5 -/- ; Dlx6 -/- compound mutant mice show ventral to dorsal facial transformations (Beverdam et al., 2002; Depew et al., 2002). Previously, we have shown a mutation in the zebrafish jag1b gene results in dorsal- specific defects (Zuniga et al., 2010). In jag1b mutants, we observe an expansion of ventral dlx3a/5a/6a, msxe, epha4b, and barx1 gene expression into dorsal CNCC that correlates with transformation of the dorsal hyoid skeleton into a ventral-like morphology. Conversely, transgenic misexpression of human JAGGED1 during facial patterning stages results in the loss of ventral gene expression and corresponding transformations of ventral elements to dorsal morphologies. 40 Notch signaling is widely used throughout development in cell fate determination and compartamentization of tissues into discrete domains (Artavanis-Tsakonas et al., 1999). Notch receptors are transmembrane receptors that interact with two types of transmembrane ligands, Delta and Jagged (Serrate in Drosophila). Activation of the pathway relies on the ligand binding to the receptor resulting in release of the intracellular domain of the Notch receptor that then enters the nucleus to modulate gene transcription (reviewed in Louvi and Artavanis-Tsakonas, 2006). Although extensive research has been done on Delta and Jagged in activating the Notch pathway (forward signaling), little is known whether these ligands via the intracellular domain are capable of signaling in a cell autonomous manner (reverse signaling). All Notch ligands share a common extracellular (N-terminus) domain associated with Notch binding; however, they vary greatly in their intracellular (C-terminus) domain (Le Borgne et al., 2005). Cell culture studies have shown the intracellular domain of JAGGED1 is required for cellular transformation (Ascano et al., 2003). On the other hand, studies in Drosophila have shown misexpression of the intracellular domain of Delta produces no developmental defects (Sun and Artavanis-Tsakonas, 1996). Here, we investigate the function of the intracellular domain of Jagged in craniofacial patterning. We find that misexpression of the intracellular domain of human JAGGED1 (JICD) alone results in loss of dlx3b expression and skeletal phenotypes reminiscent of ectopic full-length JAGGED1. However, Notch target genes such as jag1b and hey1 are differently regulated in embryos with increased JICD compared to those with full-length 41 JAGGED1. These findings suggest a novel role of Jagged in craniofacial patterning independent from activating the Notch pathway. The intracellular domain of JAGGED1 contains a putative nuclear localization signal (NLS) and a PDZ (PSD-95/Dlg/Zo-1) binding motif (Ascano et al., 2003; Popovic et al., 2006). To elucidate the mechanism of how Jagged reverse signaling patterns the facial skeleton, we use a combination of gain- and loss-of-function approaches to determine which domain is responsible for this function. We further find Jagged is involved in restricting condensations to the dorsal-posterior domain of the arches. Studies have shown formation of condensations involve cell adhesion (Hall and Miyake, 1995), and PDZ-based interactions mediate cell-to-cell contacts (Pintar et al., 2007). Therefore, we propose the PDZ-binding domain of Jagged might be involved in forming CNCC condensations to pattern the dorsal facial skeleton. Our findings will be the first to characterize the function of Jagged reverse signaling in a developmental context where we demonstrate it is responsible for both patterning and condensation formations in the zebrafish face. MATERIALS AND METHODS Zebrafish lines Zebrafish lines were staged and maintained as described (Kimmel et al., 1995). The following mutant and transgenic fish were used: jag1b b1105 (jag1b; Zuniga et al., 2010), Tg(hsp70I:Gal4) kca4 and Tg(UAS:notch1a-intra) or Tg(UAS:NICD) (Scheer and Campos- 42 Ortega, 1999), Tg(UAS:JAG1) ei108 (referred as UAS:JAGGED1; Zuniga et al., 2010), and fli1a:GFP (Lawson and Weinstein, 2002). Tg(sox10:mCherryCAAX) was modified from the published Tg(sox10:GFP) (Wada et al., 2005). To create UAS transgenic zebrafish lines, we used the Gateway (Invitrogen) Tol2kit (Kwan et al., 2007). To create Tg(UAS:JICD; cmlc2:GFP), the following primer sets were used to clone the human JAGGED1 intracellular domain (1094-1218 aa residues) into the pDONR221 vector: hJicd-L (5’- GGGGACAAGTTTGTACAAAAAAGCAGGCTCCACCATGCGGAAGCGGCGGAA G-3’) and hJicd-R (5’- GGGGACCACTTTGTACAAGAAAGCTGGGTCTATACGATGTACTCCATTCGGTT T-3’). The resultant pME vectors were combined with p5E-UAS, p3E-polyA, and pDestTol2CG2 to create the UAS transgenic line, which contains a cmlc2:GFP selectable marker driving GFP expression in the heart. Constructs were injected with Tol2 transposase RNA into one-cell-stage embryos. Skeletal analysis and in situ hybridization Skeletal staining with Alcian Blue and Alizarin Red were performed as described (Walker and Kimmel, 2007). Published probes include dlx2a and dlx3b (Akimenko et al., 1994), and jag1b and hey1 (Zuniga et al., 2010). barx1 probe was synthesized with T7 RNA polymerase from PCR products amplified with the following primers: barx1-L (5’- CATAACCACTTAGTTCTGAAGGCAGAC -3’) and barx1-R (5’- GCTAATACGACTCACTATAGGTCGGGATAATCTATCACGTTTATT 43 -3’). In situ hybridization and fluorescent in situ hybridization was performed as described previously (Zuniga et al., 2010). Skeletal and colorimetric in situ hybridization images were acquired on a Leica D2500 upright microscope. Fluorescent images were captured on a Zeiss LSM5 confocal microscope using ZEN software and presented as sections. Heat-shock treatment For hsp70I:Gal4; UAS:JICD, embryos were placed in a thermocycler at 39°C from 23-24 hours-post-fertilization (hpf) for heat-shock induction and then returned to an incubator set at 28.5°C. For hsp70I:Gal4; UAS:NICD activations, embryos were placed in a programmable incubator at 40°C for 4 hours and then returned to 28.5°C. hsp70I:Gal4; UAS:JAGGED1 heat-shock activations were performed as described (Zuniga et al., 2010). Antibodies Immunohistochemistry was performed as described (Crump et al., 2004) using 1:100 rabbit polyclonal anti-human JAGGED1 primary antibody (Abcam, Cambridge, MA, USA) and 1:300 AlexaFluor488 goat anti-rabbit secondary antibody (Invitrogen). DRAQ5 was used at 1:1000 (Biostatus, Leicestershire, UK). TALE nucleases TALE nucleases were designed using the ZiFit Targeter software as described (Sander et al., 2010). TALE repeat arrays were constructed using the REAL assembly protocol 44 (Sander et al., 2011). RNA was synthesized using the Ambion mMessage mMachine T7 Ultra kit (Invitrogen). To assess mutations, 20 embryos were lysed and the following primers were used to clone the PCR fragment flanking the C-terminus of Jag1b into the TOPO vector: EXT-L (5’-GGCGTGCCCATAAAAGACTA-3’) and EXT-R (5’- ATTGATTGCCAGTGTGAAGC-3’). Then the following internal primers were used INT-L (5’-TGGACAAACACCTGCAGAAA-3’) and INT-R (5’- CCAGAACACAACGCAACAGT-3’) and the PCR product generated was subsequently digested with PvuII. Wild-type Jag1b produced 171/74 fragments. RESULTS Misexpression of JICD results in ventral-specific defects similar to increased full- length JAGGED1 To assess the function of Jagged reverse siganling in craniofacial patterning, we generated a transgenic line Tg(UAS:JICD; cmlc2:GFP) under the control of a heat-shock- inducible hsp70I:Gal4 vector (Scheer and Campos-Ortega, 1999) to conditionally misexpress the JICD transgene during arch patterning stages. Surprisingly, hsp70I:Gal4; UAS:JICD embryos subjected to a heat-shock at 23-24 hpf (referred to as UAS:JICD) results in ventral-specific facial defects. We find UAS:JICD embryos display ventral skeletal defects where M, Sy, and Ch cartilage are severely reduced and the Br bone is missing whereas dorsal elements such as Pq, Hm, and the Op bone are less affected (Fig. 11A-C). In addition, we find these skeletal defects are similar to hsp70I:Gal4; UAS:JAGGED1 (referred to as UAS:JAGGED1) as previously reported (Zuniga et al., 2010 ). 45 Since UAS:JICD and UAS:JAGGED1 result in similar ventral-specific skeletal defects, we next investigated if they also have similar changes in early gene expression. Our previous findings show dlx3b gene expression is restricted to ventral CNCC at arch stages (Fig. 11A), and is negatively regulated by Jagged-Notch signaling (Zuniga et al., 2010). Interestingly, we find dlx3b is also reduced in embryos with ectopic JICD similar to embryos with increased full-length JAGGED1 (Fig. 11D-F). Figure 11: Ventral-specific defects are observed in both animals with increased JAGGED1 and JICD. (A-C) Lateral views of 5 dpf dissected zebrafish facial skeletons in control (A), UAS:JAGGED1 (B), and UAS:JICD (C). In both UAS:JAGGED1 and UAS:JICD, M and Sy cartilage are severely reduced, Ch is abnormally shaped, and the Br bone is absent. By contrast, Pq and Hm skeletal elements and the Op bone are not as affected. Cartilage is blue and bone red. Arrows point to ventral skeletal defects in (B) and (C). Misexpression of JICD represses dlx3b gene expression similarly to increased JAGGED1 (D-F). Confocal sections of double fluorescent in situ hybridization for dlx2a (green) with dlx3b (red) in 36 hpf control (D), UAS:JAGGED1 (E), and UAS:JICD (F). Misexpression of JAGGED1 or JICD show loss of ventral dlx3b gene expression compared to controls. Embryos containing only the hsp70I:Gal4 vector served as controls. JICD is not an activator of the forward Jagged-Notch pathway We find increased JICD results in similar facial defects and changes in gene expression to ectopic full-length JAGGED1. Previously, we have shown UAS:JAGGED1 embryos 46 have upregulation of the Notch target, hey1 and expansion of jag1b (Fig. 12B,F; Zuniga et al., 2010). In addition, conditional misexpression of the active transcriptional component of the Notch pathway (NICD) from 20-24 hpf in hsp70I:Gal4; UAS:NICD (referred as UAS:NICD) results in similar changes in gene expression (Fig. 12C,G). Based on this, we asked if JICD also alters the Notch pathway by upregulating hey1 and jag1b gene expression. Interestingly, we find no upregulation of hey1 in UAS:JICD embryos compared to UAS:JAGGED1 and UAS:NICD. Furthermore, we observe a reduction rather than expansion of jag1b gene expression in UAS:JICD embryos (Fig. 12D,H). 47 Figure 12: Jagged-Notch forward signaling pathway upregulates jag1b and hey1 but not ectopic JICD. (A-H) Confocal sections of fluorescent in situ hybridization for jag1b (green) in A-D and dlx2a (green) with hey1 (red) in E-H. Control (A,E), UAS:JAGGED1 (B,F), UAS:NICD (C,G), and UAS:JICD (D,H) are shown at 36hpf. Expression of jag1b is expanded in UAS:JAGGED1 and UAS:NICD but reduced in UAS:JICD. Similarly, hey1 is upregulated in both UAS:JAGGED1 and UAS:NICD while downregulated in UAS:JICD. hsp70I:Gal4 only transgenic fish served as controls. We find JICD is involved in facial patterning similar to full-length JAGGED1; however, this role does not involve activating the Notch pathway. To further elucidate the mechanism of how JICD exerts this function, we examined the known structure of the intracellular domain of Jagged1. Previous findings have shown that the intracellular 48 domain contains a putative nuclear localization signal (NLS) and a PDZ binding motif (LaVoie and Selkoe, 2003; Popovic et al., 2006). Jagged1 does not appear to be localized in the nucleus Previous studies have shown cleavage of Jagged results in release of the intracellular domain and exposes an NLS (LaVoie and Selkoe, 2003). Since JICD contains an NLS, we addressed if the intracellular domain translocates to the nucleus to mediate facial patterning. To test this, we used an antibody that recognizes the C-terminus of human JAGGED1 and examined its localization. We find Jagged1 is expressed predominately in the cytoplasm and cell membrane, but excluded from the nucleus compared to the nuclear DRAQ5 counter-stain in wild types (Fig. 13A). However, we reasoned that the endogenous intracellular domain might be expressed at low levels and thus is undetectable with our antibody stain. Based on this, we examined Jagged localization in UAS:JICD embryos where we transgenically express the protein at high levels. We find that even though JICD is upregulated compared to wild type there is no significant expression in the nucleus (Fig. 13B). Figure 13: Jagged is not localized in the nucleus. (A-B) Antibody stains of human JAGGED1 (anti- JAGGED1; green) with DRAQ5 (blue) in 36 hpf wild type (A) and UAS:JICD (B). Although the intracellular domain of Jagged is upregulated in UAS:JICD embryos, there is still no detectable expression in the nucleus. Higher magnification views (boxed regions) are shown of merged and individual channels. 49 PDZ binding domain of JICD We find that the intracellular domain of Jagged is not localized in the nucleus; therefore, we reasoned that the PDZ-interacting domain of JICD might be responsible for skeletal patterning. Several studies have shown that the terminal Valine of JAGGED1 is required for PDZ protein interactions (LaVoie and Selkoe, 2003; Ascano et al., 2003). To determine if a PDZ-based mechanism is involved in craniofacial patterning, we used Transcription Activator-Like Effector (TALE) nucleases to create lesions in zebrafish Jag1b. TALE nucleases are short protein motifs derived from bacteria that can recognize single nucleotides and have been widely used to effectively create mutations in zebrafish (Huang et al., 2011; Sander et al., 2011). Our preliminary data shows we can create mutations in somatic cells. In one example, we created a base pair substitution in the stop codon of zebrafish Jag1b resulting in read-through of the protein and thus blocking the terminal Valine from binding with other PDZ proteins (data not shown). We reasoned that if the terminal Valine is required for skeletal patterning then disrupting PDZ binding of Jagged will result in no facial defects contrary to what we find in embryos with JICD misexpression. Defective condensations in jag1b mutants and in UAS:JICD embryos Notch ligands containing PDZ-binding domains have been linked to the organization of cell-to-cell junctions (reviewed in Pintar et al., 2007). Furthermore, condensations are described as cell aggregates preceding chondrogenesis and osteogenesis (Hall and Miyake, 1995). We then asked if the PDZ-interacting domain of Jagged is involved in formation of CNCC condensations during arch patterning stages. To assess this, we 50 examined condensations using a fli1a:GFP and sox10:mCherryCAAX transgenic fish lines to label arch-derived CNCC. We find that in jag1b mutants crossed with fli1a:GFP transgenic fish, dorsal condensations of the hyoid arch are greatly reduced compared to wild-type (Fig. 14A-B). Furthermore, UAS:JICD crossed with sox10:mCherryCAAX; hsp70I:Gal4 have no clear condensations compared to wild-type. Figure 14: Loss of Jag1b and increased JICD disrupt condensations of the dorsal hyoid arch. (A-D) Transgenic fli1a:GFP fish show a smaller dorsal condensation in jag1b mutants (B) compared to wild type (A) as outlined by the dotted line. Embryos with increased JICD (D) never form visible condensations compared to wild type (C) as shown in sox10:mCherryCAAX; hsp70I:Gal4 transgenic fish at 36 hpf. To indeed demonstrate that Jagged affects formation of condensations, we examined expression of a known condensation marker, barx1 (Hall and Miyake, 1995). Barx1 is a homeodomain-containing transcription factor required for early formation of condensations in the arches (Sperber and Dawid, 2008). In jag1b mutants, we find abnormal expression of barx1 compared to wild type (Fig. 15A-B). Specifically, dorsal 51 CNCC of the mandibular and hyoid arch show ectopic barx1 expression in areas correlating to where we observe skeletal defects in jag1b mutants. Figure 15: Aberrant barx1 gene expression in jag1b mutants. In situ hybridization of barx1 gene expression at 48 hpf in wild type (A) and jag1b mutants (B). Arrows denotes the ectopic expression of barx1 in the mandibular and hyoid arch. DISCUSSION Here we find a novel function of the intracellular domain of Jagged in craniofacial development. Our findings show misexpression of JICD represses ventral genes and results in ventral-specific skeletal defects without upregulating Notch target genes. Based on this, we propose Jagged reverse signaling acts in a Notch-independent manner when patterning the dorsal facial skeleton. JICD does not directly modulate gene transcription Our preliminary data shows Jagged is not expressed in the nucleus suggesting that it might not directly influence gene transcription. This is contrary to what is reported with the intracellular domain of Notch, which enters the nucleus and directly associates with other proteins to alter gene regulation (Gering and Patient, 2008). The finding that Jagged is not expressed in the nucleus is consistent with previous cell culture studies that showed 52 how a JICD-Gal4 fusion construct does not activate a nuclear Gal4-luciferase reporter (Lavoie and Selkoe, 2003). On the other hand, our data shows misexpression of JICD results in changes of dlx3b, jag1b, and hey1 gene expression thus arguing against the idea that Jagged is not involved in transcriptional regulation. Based on this, we propose Jagged in the cytoplasm or cell membrane interacts and activates another protein that then enters the nucleus to alter gene transcription (Fig. 16). Figure 16: Proposed model of Jagged aiding in both patterning and formation of condensations. (A- C) Jagged via PDZ-based interactions mediates cell adhesion among dorsal CNCC shown in green (A). Next, JICD activates protein X which then enters the nucleus to repress ventral dlx3b gene expression and allowing ventral CNCC to acquire a ventral identity shown in red (B). Cell adhesion of distinct dorsal and ventral CNCC condensations aids in patterning the distinct elements of the face (C). 53 Downstream targets of the intracellular domain of Jagged In cell culture studies, Jagged1 has been reported to interact with Afadin6 (AF6), a protein located at adherens junctions and involved in cell adhesion of epithelial cells (Popovic et al., 2010). The short isoform of AF6 has been shown to enter the nucleus (Buchert et al., 2007); however, the developmental effect of this remains unclear. Thus, we performed additional experiments to test if AF6 (by binding to Jagged) enters the nucleus to aid in skeletal patterning. Although we find blocking AF6 via a morpholino (AF6-MO) produces skeletal defects, these are not dorsal-specific nor do they disrupt dlx3b expression. Animals injected with AF-MO show phenotypes that are different to what is observed in those with impaired Jagged function (data not shown). Based on these results, we conclude that AF6 is not the downstream target of Jagged responsible for craniofacial patterning. We then propose to investigate other known binding partners of JICD to determine which is responsible for facial patterning. A good candidate is syntenin1, a protein that has been shown to bind to the intracellular domain of Jagged based on a yeast-two hybrid screen (Ascano, 2005). Future work will focus on disrupting syntenin function to determine if this results in similar skeletal defects as loss of Jagged. In addition, we will overexpress syntenin and assess if this causes ventral-specific defects as those observed in misexpression of JICD. In our preliminary findings, we have not addressed if misexpression of JICD is simply an artifact of interfering with the endogenous Jagged-Notch forward signaling pathway. By 54 inducing expression of JICD we could be simply competing for the targets of endogenous Jagged. For example, Mind bomb2, an E3 ligase shown to ubiquinate Jagged and subsequently result in its degradation (Koo et al., 2005), could be ubiquinating JICD instead of endogenous Jagged resulting in prolonged activity. However, this does not explain why we do not observe upregulation of hey1 or jag1b genes if they are presumably targets of Jagged-Notch signaling. A possible explanation is JICD could be competing for an unknown binding partner of Jagged that does not signal through the Notch pathway. To determine if JICD phenotypes are not simply due to increased levels of endogenous Jagged activity, we will be examining skeletal defects and gene expression in UAS:JICD crossed with jag1b; jag2 double mutants. If we no longer observe ventral-specific defects in mutants lacking Jagged but increased JICD then this will suggest misexpression of JICD was simply prolonging endogenous Jagged activity. Is the PDZ-binding domain of Jagged involved in forming dorsal CNCC condensations? Several studies have shown that the C-terminal PDZ binding domain of Notch ligands can perform additional functions independent from the Notch pathway. In oncogenesis, the PDZ binding domain of Jagged1 is required for transformation of RKE cells into tumors, and mutation of the six C-terminal residues involved in PDZ-binding does not affect Jagged1 to initiate Notch signaling in the neighboring cells (Ascano et al., 2003). In addition, blocking the terminal Valine required for PDZ binding in DeltaD results in migration defects of Rohan Beard neurons but does not affect the Notch pathway (Wright et al., 2004). 55 Our preliminary data shows altering Jagged activity disrupts condensation formations at arch patterning stages. Condensations have been shown to require cell-cell adhesion (Hall and Miyake, 1995), which could possibly be mediated by PDZ-based interactions. To determine if JICD patterns the dorsal face by aiding in condensation formations, we will first examine if barx1 is altered in UAS:JICD embryos. Next, we will assess the skeletal defects and changes in gene expression produced by disrupting the terminal Valine of zebrafish Jag1b. If we detect abnormal barx1 expression in UAS:JICD embryos, and elimination of the PDZ-binding domain no longer results in JICD phenotypes then we will conclude that this could be a mechanism responsible for dorsal patterning. Taken all together, we propose a model where the intracellular domain of Jagged is responsible for both patterning and forming condensations of dorsal CNCC (Fig. 16). The intracellular domain of Jagged would indirectly repress ventral genes in dorsal facial precursors, and at the same time aid in forming dorsal CNCC condensations by mediating PDZ-based interactions. In this model, facial patterning involves both gene regulation and cell adhesion to give rise to the distinct shapes of the zebrafish face. 56 CHAPTER 3: GREMLIN2 REGULATES DISTINCT ROLES OF BMP AND ENDOTHELIN1 SIGNALING IN DORSOVENTRAL PATTERNING OF THE FACIAL SKELETON SUMMARY Patterning of the upper versus lower face involves generating distinct pre-skeletal identities along the dorsoventral (DV) axes of the pharyngeal arches. Whereas previous studies have shown roles for BMPs, Endothelin1 (Edn1), and Jagged1b-Notch2 in DV patterning of the facial skeleton, how these pathways are integrated to generate different skeletal fates has remained unclear. Here, we show that BMP and Edn1 signaling have distinct roles in development of the ventral and intermediate skeletons, respectively, of the zebrafish face. Using transgenic gain-of-function approaches and cell-autonomy experiments, we find that BMPs strongly promote hand2 and msxe expression in ventral skeletal precursors, while Edn1 promotes the expression of nkx3.2 and three Dlx genes (dlx3b, dlx5a, and dlx6a) in intermediate precursors. Furthermore, Edn1 and Jagged1b pattern the intermediate and dorsal facial skeletons in part by inducing the BMP antagonist Gremlin2 (Grem2), which restricts BMP activity to the ventral-most face. We therefore propose a model in which later cross-inhibitory interactions between BMP and Edn1 signaling, in part mediated by Grem2, separate an initially homogenous ventral region into distinct ventral and intermediate skeletal precursor domains. 57 INTRODUCTION The facial skeleton develops from cranial neural crest cells (CNCCs) that populate a series of segments called the pharyngeal arches (Platt, 1893). Subsequently, skeletal elements of varying morphology develop from distinct DV domains within the arches (Crump et al., 2006; Eberhart et al., 2006), although a one-one correspondence between specific elements and DV expression domains has not been established. Initially, ventral CNCCs, unlike their dorsal counterparts, co-express Hand2 and the Dlx family members Dlx5 and Dlx6 (Charite et al., 2001). As development progresses, DV gene expression becomes further segregated within the arches, with ventral CNCCs of zebrafish expressing hand2, intermediate CNCCs expressing dlx3b, dlx5a, dlx6a, and nkx3.2, and dorsal CNCCs expressing jag1b (Talbot et al., 2010; Zuniga et al., 2010). Mice also show a similar separation of ventral Hand2 and more intermediate Dlx5/6 expression (Barron et al., 2011). An important question is how such distinct preskeletal domains are specified during development. All three classes of genes (Hand2, Dlx, and Jag1b) are required to form distinct DV structures of the facial skeleton. Loss of Hand2/hand2 function leads to reductions of the ventral skeleton and expansion of intermediate fates (Miller et al., 2003; Yanagisawa et al., 2003; Talbot et al., 2010), whereas Hand2 misexpression transforms the dorsal facial skeleton to a ventral morphology in mice (Sato et al., 2008). Dlx5 - ; Dlx6 - compound mutants display loss of ventral Hand2 expression and transformation of the lower (ventral) jaw skeleton (Beverdam et al., 2002; Depew et al., 2002), and Dlx3b/4b/5a in zebrafish have important roles in development of the intermediate skeleton such as the 58 jaw joint (Talbot et al., 2010). Similarly, reduction of Nkx3.2 in zebrafish causes joint fusions in the mandibular arch (Miller et al., 2003). Recent studies in zebrafish have also shown a prominent role for Jagged1b-Notch2 signaling in specifying the dorsal skeletal domain (Zuniga et al., 2010). Hence, at least in zebrafish, there is a clear functional separation between ventral, intermediate, and dorsal genes within the arches, and their disruption leads to specific craniofacial malformations. Edn1 signaling specifies ventral and intermediate skeletal derivatives in the arches. Deficiencies in Edn1 or its receptors (Ednra in mouse and Ednra1/Ednra2 in zebrafish) result in reductions and/or dorsalization of the ventral and intermediate facial skeletons (Kurihara et al., 1994; Miller et al., 2000; Ozeki et al., 2004; Ruest et al., 2004; Nair et al., 2007). Cells lose expression of Dlx3-6/dlx3a-6a, Hand2/hand2, Nkx2.3/nkx3.2, Msx1/msxe, and epha4b in the arches in Edn1 -/- and Ednra -/- mouse mutants and edn1 -/- zebrafish mutants (Miller et al., 2000; Ozeki et al., 2004; Ruest et al., 2004; Walker et al., 2006; Walker et al., 2007). Conversely, transgenic misexpression of Edn1 in mice or injection of human EDN1 protein in zebrafish transforms the dorsal skeleton (Kimmel et al., 2007; Sato et al., 2008). Edn1 also restricts Jagged1b-Notch2 activity to dorsal CNCCs in zebrafish, with loss of jag1b partially restoring ventral skeletal patterning in edn1 mutants (Zuniga et al., 2010). Notably, the facial skeleton forms largely normally in the absence of both Edn1 and Jagged1b-Notch2 signaling, suggesting the presence of additional signals that promote ventral skeletal identity. 59 BMP signaling is likely one such pathway that plays a role in development of the ventral facial skeleton (reviewed by Nie et al., 2006). Members of the Bmp2/4/7 subfamily are expressed in the arches of mice, chickens, and zebrafish (Francis-West et al., 1994; Wall and Hogan, 1995; Holzschuh et al., 2005; Liu et al., 2005). Furthermore, conditional deletion of Bmp4 in the arch epithelia of Nkx2.5 CRE ; Bmp4 lacZ/flox mice reduces Hand2, Msx1, and Msx2 expression in ventral CNCCs and reduces/transforms the ventral mandibular skeleton (Liu et al., 2004; Liu et al., 2005). However, gain-of-function BMP experiments have given conflicting results. In some cases Bmp4-coated beads induce the formation of branched/duplicated Meckel’s cartilages (Mina et al., 2002; Mariani et al., 2008), but in other cases they cause CNCC death and skeletal loss (Shigetani et al., 2000; Mariani et al., 2008). BMPs also function in many other facets of CNCC development, such as induction (Liem et al., 1995; Nguyen et al., 1998; Steventon et al., 2009), apoptosis (Graham et al., 1994), migration (Kanzler et al., 2000), and skeletogenesis (Wozney et al., 1988), which complicates the interpretation of these studies. A further obstacle is genetic redundancy among BMPs. In zebrafish, four members of the Bmp2/4/7 family – bmp2a, bmp2b, bmp4, and bmp7b – are expressed in the developing pharyngeal arches (Holzschuh et al., 2005; Wise and Stock, 2010). As such, loss-of- function studies have yielded little insights into DV patterning roles of BMPs, with bmp2b mutants having gastrulation defects and a lack of neural crest (Nguyen et al., 1998) while bmp4 mutants are viable and show no craniofacial defects (Wise and Stock, 2010). Here we circumvent these issues by utilizing zebrafish transgenic lines that allow us to control the timing and levels of BMP and Edn1 activity during craniofacial 60 development. In so doing, we show that BMPs and Edn1 have distinct roles in establishing the ventral and intermediate domains of the arches, respectively. Several types of BMP antagonists regulate BMP activity, indicating that precise levels of BMP signaling are critical for developmental patterning. Early arch primordia in the mouse express Noggin and Chordin and mutations in either BMP antagonist disrupts development of the ventral mandibular skeleton (Stottmann et al., 2001). By contrast, members of the Gremlin family of BMP antagonists, including grem2 (prdc1) in zebrafish (Muller et al., 2006), are expressed in the arches at later stages (Hsu et al., 1998; Bardot et al., 2001). Functions for Gremlin proteins in craniofacial development have not been previously investigated. With gain- and loss-of-function analyses, we show that Grem2 promotes dorsal and intermediate skeletal fates by restricting BMP activity to the ventral arches. Edn1 and Jagged1b are also required for grem2 expression, suggesting that they promote intermediate and dorsal skeletal fates in part through Grem2-mediated repression of BMP activity. MATERIALS AND METHODS Zebrafish Lines Zebrafish were staged as described previously (Kimmel et al., 1995). We used the following mutant and transgenic strains: edn1 tf216b (Miller et al., 2000), jag1b b1105 (Zuniga et al., 2010), Tg(hsp70I:Gal4) kca4 (Scheer and Campos-Ortega, 1999), Tg(hsp70I:dnBMPr1a-GFP) w30 (Pyati et al., 2005), and Tg(BRE:GFP) (Alexander et al., 2011). Tg(UAS:BMP4;cmlc2:GFP) el49 , Tg(UAS:Edn1;α-crystallin:Cerulean) el249 , and 61 Tg(UAS:Grem2;α-crystallin:Cerulean) el326 transgenic lines were generated using Gateway Cloning (Invitrogen) and the Tol2kit (Kwan et al., 2007). Zebrafish bmp4, edn1, and grem2 cDNAs were amplified with the following primers: Bmp4-1F (5’- GGGGACAAGTTTGTACAAAAAAGCAGGCTCGGCCACCATGATTCCTGGTAAT CGAAT-3’), Bmp4-2R (5’- GGGGACCACTTTGTACAAGAAAGCTGGGTTTAGCGGCAGCCACACCCCT-3’), Edn1-1F (5’- GGGGACAAGTTTGTACAAAAAAGCAGGCTCGGCCACCATGCATTTGAGGATT ATTTTCC-3’), Edn1-2R (5’- GGGGACCACTTTGTACAAGAAAGCTGGGTCTATGAGTTTTCAGAAATCC-3’), Grem2FL-L (5’- GGGGACAAGTTTGTACAAAAAAGCAGGCTCGGCCACCATGAGCAGTAAGGT GGCGCT-3’), and Grem2FL-R (5’- GGGGACCACTTTGTACAAGAAAGCTGGGTTCACTGTTTCCCCGACTCGGACA- 3’). PCR products were combined with pDONR221 to generate pME-Bmp4, pME-Edn1, and pME-Grem2. pME-Bmp4 was combined with p5E-UAS, p3E-polyA, and pDestTol2CG2 to generate UAS:Bmp4;cmcl2:GFP. pME-Edn1 and pME-Grem2 were combined with p5E-UAS, p3E-polyA, and pDestTol2AB2 to generate UAS:Edn1;α- crystallin:Cerulean and UAS:Grem2;α-crystallin:Cerulean. pDestTol2AB2 is a modification of pDestTol2pA2 that contains an α-crystallin promoter driving lens Cerulean expression. Vectors were injected with transposase RNA and two independent stable lines were isolated for each, with el49, el249, and el326 being used for further analysis. In all experiments, genotyping of embryos confirmed the observed phenotypes. 62 Genotyping for jag1b b1105 , edn1 tf216b , and hsp70I:Gal4 are as described (Zuniga et al., 2010). The presence of UAS:Bmp4;cmlc2:GFP was confirmed by PCR with primers: cmcl2-L (5’-TGGTGCAGATGAACTTCAGG-3’), and cmcl2-R (5’- TGCTGGAATCTGAGCACTTG-3’). UAS:Edn1- and UAS:Grem2-positive embryos were selected based on lens Cerulean. For hsp70I:Gal4 experiments, hsp70I:Gal4- negative siblings served as controls. Heat-shock treatments For hsp70I:Gal4; UAS:Bmp4 and hsp70I:Gal4; UAS:Edn1 activations, embryos were placed in a programmable incubator at 40°C for 4-8 hours, as indicated, and then returned to 28.5°C. hsp70I:dnBmpr1a-GFP and hsp70I:Gal4; UAS:Grem2 embryos were placed in a thermocycler at 39°C from 16-17 hours-post-fertilization (hpf) for heat-shock induction. For shorter hsp70I:Gal4; UAS:Bmp4 treatments, embryos were placed in 40°C pre-warmed Embryo Media at 21 hpf and transferred to 28.5°C Embryo Media after one or three minutes. Morpholino (MO) Injections One-cell-stage embryos were injected with 3 nl of hand2-MO (600 µM) (Maves et al., 2009), grem2-MO #1 (300 or 600 µM), or grem2-MO #2 (400 µM) (GeneTools, Philomath, OR, USA). grem2-MO #1 (5’- GACACAGCGCCACCTTACTGCTCAT -3’) and grem2-MO #2 (5’- CTCAGACACTGATGAAGGTGATGAT -3’) are translation blockers. Grem2:GFP was constructed by performing fusion PCR of the Grem2 cDNA template with primers Grem2:GFP-F (5’- 63 GGGGACAAGTTTGTACAAAAAAGCAGGCTCCACCATGAGCAGTAAGGTGGC GCTGTGT-3’) and Grem2:GFP-1M (5’- ACAGCTCCTCGCCCTTGCTCACCATCTGTTTCCCCGACTCGGACACGCTC-3’) and the GFP template with primers Grem2:GFP-2M (5’- GAGCGTGTCCGAGTCGGGGAAACAGATGGTGAGCAAGGGCGAGGAGCTG-3’) and Grem2:GFP-R (5’- GGGGACCACTTTGTACAAGAAAGCTGGGTTTACTTGTACAGCTCGTCCATGC- 3’). In the next round, the PCR product generated by Grem2:GFP-F and Grem2:GFP-R was combined with pDONR221 to generate pME-Grem2:GFP, which was combined with p5E-CMV/SP6, p3E-polyA, and pDestTol2pA2 to generate CMV/SP6:Grem2:GFP:pA. After digestion with XhoI and BglII, mRNA was synthesized using the Ambion mMessage mMachine SP6 kit (Applied Biosystems/Ambion, Austin, TX, USA). In situ Hybridizations and skeletal analysis Skeletal staining and in situ hybridization are as described previously (Zuniga et al., 2010). bmp4 and grem2 probes were synthesized with T7 RNA polymerase from PCR products amplified with the following primers: Bmp4-L (5’- GTGAGGCGAACTCCTTTGAG-3’), Bmp4-R (5’- GCTAATACGACTCACTATAGGTGTTTATCCGATGCAAACCA-3’), Grem2is-L (5’- AGTAAGGTGGCGCTGTGTCT-3’), and Grem2is-R (5’- GCTAATACGACTCACTATAGG-3’). All other probes are as described previously (Zuniga et al., 2010). Skeletal and colorimetric in situ hybridization images were acquired on a Leica D2500 upright microscope. Fluorescent images were captured on a 64 Zeiss LSM5 confocal microscope using ZEN software and presented as sections or flattened projections as indicated. Levels were adjusted in Adobe Photoshop CS4, with identical adjustments applied to images from the same data set. Cell transplantation Tissue transplantations were performed as described (Crump et al., 2004). Briefly, donor cells from hsp70I:dnBmpr1a-GFP or fli1a:GFP embryos were transplanted into the CNCC precursor domain of wild-type 6 hpf hosts, and hosts were subjected to heat-shock induction from 16-17 hpf. Fluorescent in situ hybridization was performed first with dlx3b, msxe, or hand2 probes, followed by immunohistochemistry (Crump et al., 2004) using 1:1000 rabbit polyclonal anti-GFP primary antibody (Torrey Pines Biolabs, East Orange, NJ, USA) and 1:300 AlexaFluor488 goat anti-rabbit secondary antibody (Invitrogen). Statistical analysis Using JMP 7.0 software, a Tukey-Kramer HSD test (alpha = 0.05) was employed to show significance between multiple classes. RESULTS Bmp4 and Edn1 are expressed in non-overlapping domains of ventral arch ectoderm Whereas previous studies have shown that bmp2a, bmp2b, bmp4, and bmp7b are expressed in or around the pharyngeal arches of zebrafish (Holzschuh et al., 2005; Wise 65 and Stock, 2010), their expression relative to developing CNCCs had not been thoroughly characterized. Here we found that bmp4 expression was restricted to ventral arch ectoderm at 24 hpf (Fig. 17A) and became localized to two domains of ventral ectoderm in the anterior mandibular and posterior hyoid arches at 36 hpf (Fig. 17D). Interestingly, edn1 expression also localized to ventral arch ectoderm at these stages (Fig. 17B,E), but did so in a slightly more dorsal domain that did not overlap with bmp4 expression (Fig. 17C,F). These distinct expression domains may indicate distinct roles in DV skeletal patterning. 66 Figure 17: Facial skeletal defects upon Bmp4 or Edn1 misexpression. (A-F) Confocal projections of in situ hybridizations for dlx2a (blue), bmp4 (green) and edn1 (red) at 24 hpf (A-C) and 36 hpf (D-F) in wild type. Mandibular (1) and hyoid (2) arches are labeled, as well as dorsal (D), intermediate (I), and ventral (V) domains. (G-I) Ventral views (top) and schematics (below) of 5 dpf facial skeletons in control hsp70I:Gal4 (G) and hsp70I:Gal4; UAS:Bmp4 larvae subjected to a 4-hour heat-shock (H), and hsp70I:Gal4; UAS:Edn1 larvae subjected to an 8-hour heat-shock (I). Cartilage is blue and bone red. Schematics show dorsal (green), intermediate (red), and ventral (blue) regions with dermal bones lightly shaded. Hm (black arrow), Pq (blue arrow), and Ptp (grey arrow) were transformed (arrowheads) in UAS:Bmp4 and UAS:Edn1 larvae. In the intermediate second arch, the joint (asterisk) and Sy were lost in UAS:Bmp4 but not UAS:Edn1 larvae. M, Meckel’s cartilage; Pq, palatoquadrate cartilage; Ptp, pterygoid process; Sy, symplectic cartilage; Hm, hyomandibular cartilage; Ch, ceratohyal cartilage; Op, opercular bone; Br, branchiostegal ray bone. Scale bars = 50µm. 67 Distinct effects of Bmp4 and Edn1 misexpression on facial skeleton development To test the relative roles of Bmp4 and Edn1 in arch development, we took a gain-of- function approach. We created transgenic lines (UAS:Bmp4 and UAS:Edn1) in which zebrafish Bmp4 or Edn1 are expressed under the control of the Gal4-sensitive UAS promoter. In embryos doubly transgenic for these UAS lines and the heat-shock-inducible hsp70I:Gal4 vector (Scheer and Campos-Ortega, 1999), the timing and dose of Bmp4/Edn1 is regulated by the stage and duration of heat-shock treatment. Strikingly, Tg(hsp70I:Gal4; UAS:Bmp4) embryos (referred to as UAS:Bmp4) subjected to heat- shock at postmigratory CNCC stages (20-24 hpf), had a range of defects in the dorsal and intermediate skeletons (Fig. 17H), consistent with those induced by BMP4/7 beads (Alexander et al., 2011). Phenotypic variability was reflected in different levels of BMP activation as revealed by bmp4 expression and a BMP-response-element:GFP (BRE:GFP) transgenic line (Alexander et al., 2011). Previous fate mapping and gene expression studies have shown that in the mandibular arch: 1) dorsal CNCCs generate the posterior palatoquadrate (Pq) cartilage, 2) intermediate CNCCs form the jaw joint and joint- proximal regions of Pq and Meckel’s (M) cartilage, and 3) ventral CNCCs form the majority of M. In the hyoid arch: 1) dorsal CNCCS form the hyomandibular (Hm) cartilage and opercle (Op) bone, 2) intermediate CNCCs form the symplectic (Sy), the joint, branchiostegal ray (Br) bones, and joint-proximal portions of ceratohyal (Ch) cartilage, and 3) ventral CNCCs form the majority of Ch (Fig. 17G). Defects in BMP- overexpressing embryos were most striking in the hyoid arch, where the dorsal Hm was typically transformed and fused in a mirror-image pattern to the ventral Ch, and intermediate Sy and joints were lost (Fig. 17H). In less severe classes, the dorsal Op bone 68 was transformed to resemble the more ventral Br bone to which it fused (data not shown). In the mandibular arch, Pq and its Ptp process (a maxillary-derived element) became rod- shaped and resembled the ventral M, and the jaw joint was occasionally lost. hsp70I:Gal4-only siblings lacking the UAS:Bmp4 transgene but subjected to the same heat-shock treatment were unaffected (Fig. 17G). In addition, a few more severely affected UAS:Bmp4 animals displayed widespread loss of the facial skeleton and increased CNCC death (data not shown). We next compared the effect of Edn1 misexpression to the skeletal transformations seen with Bmp4 misexpression. In Tg(hsp70I:Gal4; UAS:Edn1) embryos subjected to a 20-28 hpf heat-shock treatment (referred to as UAS:Edn1), we observed dorsal to ventral transformations, similar to those reported for 20 hpf injection of human EDN1 protein into zebrafish arches (Kimmel et al., 2007). In particular, UAS:Edn1 larvae displayed defects in the dorsal Hm (arch 2) and Pq (arch 1) cartilages (Fig. 17I). In addition, the maxillary-derived Ptp was thickened to resemble ventral M, similar to effects of ectopic BMPs. However, in marked contrast to Bmp4 misexpression, Edn1 misexpression never altered the intermediate-domain-derived joints or Sy in the hyoid arch. Hence, whereas Bmp4 misexpression affects development of both the dorsal and intermediate portions of the facial skeleton, Edn1 misexpression defects are largely confined further dorsally. Distinct effects of Bmp4 and Edn1 misexpression on DV gene expression We next asked if misexpression of Bmp4 and Edn1 has distinct effects on DV gene expression. Strikingly, Bmp4 misexpression strongly upregulated expression of hand2 69 throughout arch CNCCs at 36 hpf (Fig. 18B,G), whereas Edn1 misexpression slightly reduced hand2 expression (Fig. 18C,H). By contrast, expression of the intermediate genes dlx3b, dlx5a, and dlx6a was expanded throughout arch CNCCs of all UAS:Edn1 embryos, yet was variably reduced or mosaically expanded in different UAS:Bmp4 arches (Figs 18,19). Expression of the intermediate (joint) marker nkx3.2 was also expanded in UAS:Edn1 embryos and absent in UAS:Bmp4 embryos (Fig. 19J-L). We next analyzed the expression of epha4b, as well as msxe that marks a ventral subset of the broader dlx3b-expressing intermediate domain in wild types (Fig. 19S-U). Whereas msxe and epha4b were markedly expanded in UAS:Bmp4 embryos, they were only moderately so in UAS:Edn1 embryos (Fig. 19A-F). Furthermore, dorsal genes such as jag1b and hey1 were similarly reduced in UAS:Bmp4 and UAS:Edn1 embryos (Fig. 19M-R). In contrast to earlier stages (Alexander et al., 2011), these results suggest quite distinct roles for BMP and Edn1 signaling after 24 hpf, with BMPs strongly promoting ventral (hand2) and ventral-intermediate (msxe) gene expression and Edn1 promoting more intermediate (dlx3b/5a/6a and nkx3.2) gene expression. 70 Figure 18: Distinct effects of Bmp4 and Edn1 misexpression on hand2 and dlx3b/5a expression. (A-J) Confocal sections of in situ hybridization for hand2 (green) with dlx3b (red, A-E) or dlx5a (red, F-J) in the mandibular (1) and hyoid (2) arches of 36 hpf control hsp70I:Gal4 (A,F) and hsp70I:Gal4; UAS:Bmp4 embryos subjected to a 20-24 hpf heat-shock (B,G), as well as hsp70I:Gal4; UAS:Edn1 embryos subjected to a 20-28 hpf heat-shock (C,H). In controls, hand2 (n=48/48) was restricted to the ventral domain and dlx3b (n=30/30) and dlx5a (n=18/18) to intermediate domains. In UAS:Bmp4 embryos, hand2 was upregulated (n=23/32), dlx3b was variably expanded (n=11/21) or reduced (n=9/21) and dlx5a was also variably expanded (n=4/20) or reduced (n=9/20). In UAS:Edn1 embryos, hand2 was reduced (n=34/34) and dlx3b (n=20/20) and dlx5a (n=14/14) were expanded. Un-injected hsp70I:Gal4; UAS:Bmp4 embryos subjected to a 3-minute heat-shock at 21 hpf (D,I) never showed co-localization of hand2 with dlx3b (n=0/29) or dlx5a (n=0/21), whereas hand2 co-localized with dlx3b (n=21/35) and dlx5a (n=16/16) in hand2-MO-injected embryos (E,J). Anterior is towards the left and dorsal is upwards. Scale bar = 50µm. Dlx expression can either expand or disappear upon Bmp4 misexpression, even within different arches of the same embryo. By 36 hpf, hand2 expression is excluded from the intermediate dlx3b/5a-expressing domains of wild types (Fig. 18A,F). Similarly, in UAS:Bmp4 embryos heat-shocked for shorter times, the expansion of dlx3b and dlx5a expression was confined to regions lacking hand2 expression (Fig. 18D,I). As Hand2 represses dlx3b and dlx5a in ventral CNCCs (Miller et al., 2003; Talbot et al., 2010), we tested if the strong induction of Hand2 by Bmp4 caused the loss of intermediate gene 71 expression seen in our gain-of-function experiments. Indeed, reduction of Hand2 function with a hand2-MO (Maves et al., 2009) resulted in expansion of dlx3b and dlx5a expression throughout the arches of UAS:Bmp4 embryos (Fig. 18E,J). Hence, Bmp4 acts in a dose-dependent manner during DV facial patterning, with lower BMP promoting intermediate gene expression and higher BMP promoting Hand2, which subsequently inhibits expression of intermediate Dlx genes. 72 Figure 19: DV gene expression in Bmp4 and Edn1 misexpression embryos. (A-R) In situ hybridization shows gene expression in the mandibular (1) and hyoid (2) arches of control hsp70I:Gal4 and hsp70I:Gal4; UAS:Bmp4 embryos subjected to a 20-24 hpf heat-shock and hsp70I:Gal4; UAS:Edn1 embryos subjected to a 20-28 hpf heat-shock. (A-C) msxe (36hpf): compared to controls (A, n=22), expression was markedly expanded in UAS:Bmp4 (B, n=17/18) and slightly expanded in UAS:Edn1 (C, n=10/12) embryos. (D-F) epha4b (36hpf): compared to controls (D, n=11), expression was markedly expanded in UAS:Bmp4 (E, n=12/12) and moderately expanded in UAS:Edn1 (F, n=20/20) embryos. (G-I) dlx6a (36hpf): compared to controls (G, n=8), expression was variably expanded (n=4/7) or reduced (n=3/7) in UAS:Bmp4 (H), and markedly expanded in UAS:Edn1 (I, n=28/28) embryos. (J-L) nkx3.2 (44 hpf): compared to controls (J, n=13), expression was lost in UAS:Bmp4 (K, n=9/9) and expanded in UAS:Edn1 (L, n=21/25) embryos. 73 Figure 19, continued. (M-O) jag1b (36hpf): compared to controls (M, n=14), expression was reduced in UAS:Bmp4 (N, n=14/20) and UAS:Edn1 (O, n=21/25) embryos. (P-R) hey1 (36hpf): compared to controls (P, n=36), expression was reduced in UAS:Bmp4 (Q, n=26/27) and UAS:Edn1 (R, n=19/26) embryos. Arrow indicates hey1 staining in ventral mesoderm. (S-U) Confocal sections of in situ hybridizations for dlx3b (green) and msxe (red) in a 36 hpf wild-type embryo. Merged (S) and single (T,U) panels are shown. Intermediate (I) and ventral-intermediate (VI) domains are depicted. Scale bars = 50µm. Cell-autonomous requirements for BMP signaling in CNCCs Whereas reduction of BMP signaling in Tg(hsp70I:dnBmpr1a-GFP) embryos results in loss of hand2, msxe, and dlx3b expression, BMP signaling also regulates edn1 expression in the ventral ectoderm (Alexander et al., 2011). To discriminate cell-autonomous roles of BMP signaling from indirect roles such as edn1 regulation, we transplanted wild-type Tg(fli1a:GFP) or Tg(hsp70I:dnBmpr1a-GFP) CNCC precursors into wild types and examined gene expression in the GFP + donor cells. Whereas wild-type fli1a:GFP + donor CNCCs showed normal dlx3b (n=5), msxe (n=3), and hand2 (n=5) expression when compared to unlabeled host CNCCs, hsp70I:dnBmpr1a-GFP + donor CNCCs showed a cell-autonomous lack of hand2 (n=5/5) and msxe (n=6/6) expression yet no change in dlx3b (n=0/6) expression (Fig. 20). Thus, our mosaic analyses indicate that BMP signaling acts cell-autonomously in CNCCs for ventral (hand2 and msxe) but not intermediate (dlx3b) gene expression. 74 Figure 20: Cell-autonomous regulation of DV gene expression by BMP. (A-F) Confocal sections of anti-GFP staining (green) and dlx3b (A,B), hand2 (C,D), and msxe (E,F) expression (red). Merged and individual channels are shown, as well as higher magnification views of boxed regions. Wild-type hosts received CNCC precursor transplants from either wild-type fli1a:GFP (A,C,E) or hsp70I:dnBmpr1a-GFP (B,D,F) donors. hand2 and msxe were cell-autonomously reduced in hsp70I:dnBmpr1a-GFP clones (white arrowheads), whereas dlx3b was largely unaffected. In high magnification views, the white arrow denotes a hsp70I:dnBmpr1a-GFP clone displaying loss of hand2, and the yellow arrow denotes a small clone of wild- type host cells still expressing msxe. Scale bar = 50µm. Bmp4 can induce hand2 and msxe independent of Edn1 The cell-autonomous requirement for BMP responsiveness in hand2 and msxe expression suggests that BMPs promote expression directly, rather than through induction of ectodermal edn1 expression. To further investigate this model, we analyzed whether ectopic Bmp4 can induce DV gene expression in the genetic absence of Edn1. As previously reported (Miller et al., 2000), edn1 -/- mutants have a near complete loss of hand2, dlx3b, and msxe expression at 36 hpf (Fig. 21E,M). Consistent with Bmp4 75 misexpression rescuing the ventral but not intermediate skeletal defects of edn1 -/- mutants (Alexander et al., 2011), we found that Bmp4 induced hand2 and msxe, but not dlx3b, in arch CNCCs in a dose-dependent manner in edn1 -/- ; UAS:Bmp4 embryos (Fig. 21). However, hand2 and msxe induction required higher doses of Bmp4 in edn1 -/- mutants compared to wild-type siblings, indicating that Edn1 is required for maximal induction of these genes by Bmp4. In addition, injection of hand2-MO into edn1 -/- ; UAS:Bmp4 embryos did not restore dlx3b expression (data not shown), suggesting that the failure of Bmp4 to induce dlx3b expression in edn1 -/- mutants is not due to Hand2 repression. We therefore conclude that BMPs can activate hand2 and msxe expression independently of Edn1, yet require Edn1 for regulation of dlx3b expression. Figure 21: Bmp4 induces hand2 and msxe expression in the absence of Edn1. (A-P) Confocal sections of 36 hpf in situ hybridizations for hand2 (green) with dlx3b (red, A-H) or msxe (red, I-P) in control hsp70I:Gal4 (A,I), edn1 -/- mutant (E,M), UAS:Bmp4 (B-D,J-L), and edn1 -/- ; UAS:Bmp4 (F-H,N-P) embryos. 76 Figure 21, continued. Increasing periods of Bmp4 heat-shock induction [1 minute at 21 hpf (B,F,J,N), 3 minutes at 21 hpf (C,G,K,O), and 4 hours from 20-24 hpf (D,H,L,P)] resulted in progressive recovery of hand2 and msxe but not dlx3b expression in edn1 -/- mutants. Consistent phenotypes were observed for the following: (A) n=55, (B) n=31, (C) n=15, (D) n=9, (E) n=8, (F) n=3, (G) n=4, (H) n=1, (I) n=37, (J) n=11, (K) n=6, (L) n=9, (M) n=20, (N) n=2, (O) n=3, and (P) n=2. Scale bar = 50µm. Edn1 and Jag1b promote Grem2 expression in dorsal and intermediate CNCCs As BMPs strongly promote hand2 expression, yet normally only do so in the ventral- most regions of the arches, we investigated whether BMP antagonists restrict BMP signaling ventrally. Grem2 was a good candidate since it is expressed in the arches during these early stages of DV patterning (Muller et al., 2006). Using double fluorescent in situ hybridizations with the CNCC marker dlx2a, we found that grem2 was expressed in dorsal and intermediate CNCCs of the arches (Fig. 22A). The grem2 expression domain partially overlaps with intermediate dlx3b and dorsal jag1b expression, and most strongly overlaps with expression of the Jag1b-Notch2 target gene hey1 (data not shown). Consistently, we found that grem2 expression was substantially reduced in jag1b b1105 mutants (Fig. 22B). grem2 expression was also reduced in edn1 -/- mutants and expanded in UAS:Edn1 embryos (Fig. 22C,D). This induction by Edn1 is required to suppress BMP signaling in intermediate and dorsal domains, as arch expression from a BRE:GFP transgenic line (Alexander et al., 2011) expanded in edn1 -/- mutants (Fig. 22G,H). By contrast, BMPs inhibit grem2 since expression was shifted ventrally in hsp70I:dnBmpr1a-GFP embryos and lost in UAS:Bmp4 embryos (Fig. 22E,F). Hence, a combination of Jag1b and Edn1 activation and BMP inhibition restricts grem2 expression to dorsal-intermediate CNCCs. 77 Figure 22: Edn1 and Jag1b negatively regulate grem2 expression. (A-F) Confocal sections of in situ hybridizations for grem2 (red) and dlx2a (green) in controls (A, n=62), jag1b b1105 mutant (B, n=9), edn1 -/- mutant (C, n=5), UAS:Edn1 (D, n=17), hsp70I:dnBmpr1a-GFP (E, n=32), and UAS:Bmp4 (F, n=23) embryos at 36 hpf. In UAS:Edn1 embryos, grem2 expression was seen throughout the mandibular and hyoid arches except for the ventral-most domain (white arrow). In hsp70I:dnBmpr1a-GFP embryos, grem2 expression shifted to ventral regions (yellow arrow) and was reduced dorsally (white arrowhead). Dorsal (D), intermediate (I), and ventral (V) domains of the mandibular (1) and hyoid (2) arches are labeled. Scale bar: 50µm. (G ,H) BRE:GFP expression increased throughout the dorsal and intermediate arch domains of edn1 -/- mutants (n=4) compared to wild-type siblings (n=16). Grem2 is required for dorsal and intermediate skeletal patterning To investigate if Grem2 is required to restrict BMP activity to ventral CNCCs, we designed two independent translation-blocking MOs against grem2. Of the two MOs, grem2-MO #1 was used for further analysis as it most effectively blocked translation from a Grem2:GFP fusion construct containing the MO-recognition site (Fig. 23A-C). Injection of grem2-MO into BRE:GFP fish increased BMP activity in the dorsal and intermediate arches at 36 hpf (Fig. 23D,E). In addition, grem2-MO caused dorsal and intermediate skeletal defects similar to those seen with moderate increases in BMP signaling (Fig. 23J). Skeletal transformations were most apparent in the hyoid arch, with the dorsal Hm adopting a rod-shaped morphology and the Op bone acquiring a finger-like appearance (n=21/36), and less frequently Hm and the intermediate Sy and joints were lost (n=14/36). Consistent with these dorsal and intermediate skeletal defects, the 78 expression of dlx3b, and to a lesser extent hand2, was moderately expanded in 36hpf grem2-MO-injected embryos (Fig. 23G). As with moderate Bmp4 misexpression (Alexander et al., 2011), reducing Grem2 function rescued development of the ventral (M and Ch) but not the intermediate (Sy and joints) skeleton in 15/24 edn1 -/- mutants (Fig. 23M). These effects were specific since: 1) co-injection of grem2-MO #1 and #2 at sub- threshold doses caused highly penetrant synergistic effects on dorsal skeletal development, 2) grem2-MO #2 also restored the ventral facial skeleton in 6/12 edn1 -/- mutants, and 3) arch misexpression of Grem2 (see details below) partially rescued the dorsal skeletal defects of grem2-MO-injected embryos (data not shown). These data strongly indicate that Grem2 is required for patterning of the dorsal and intermediate facial skeleton. Grem2 misexpression dorsalizes the ventral facial skeleton In order to test Grem2 sufficiency in dorsal skeletal patterning, we misexpressed it in the arches by subjecting Tg(hsp70I:Gal4; UAS:Grem2) embryos to a 16-17 hpf heat shock (referred to as UAS:Grem2). Similar to the skeletal defects of edn1 -/- mutants (Fig. 23L) and hsp70I:dnBmpr1a-GFP embryos (Alexander et al., 2011), Grem2 misexpression caused specific defects in the ventral and intermediate skeletons. In particular, the ventral (M and Ch) and intermediate (Pq and Sy) cartilages were variably reduced and altered in shape and the intermediate-domain-derived joints were lost in 56/72 UAS:Grem2 larvae (Fig. 23K). Consistent with Grem2 inhibiting ventral and intermediate skeletal development, ventral hand2 and intermediate dlx3b expression were almost completely lost in UAS:Grem2 embryos (Fig. 23H), again resembling hsp70I:dnBmpr1a-GFP 79 (Alexander et al., 2011) and edn1 -/- (Fig. 21E) embryos. We therefore conclude that the ventral exclusion of grem2 expression is critical for development of the ventral and intermediate facial skeleton. Figure 23: Grem2 promotes the dorsal and intermediate facial skeleton. (A) Structure of the grem2 gene and the Grem2:GFP fusion construct. grem2-MO #1 recognizes the ATG start site in Exon 2 and grem2-MO #2 recognizes the 5’ UTR. (B,C) Grem2:GFP fluorescence in un-injected (B) or grem2-MO-#1- injected (C) embryos at 9 hpf. (D,E) Confocal sections of 30 hpf BRE:GFP transgenic embryos. Compared to un-injected controls (G, n=5), injection of grem2-MO-#1 (H, n=8) increased BRE:GFP throughout the mandibular (1) and hyoid (2) arches. (F-H) Confocal sections of in situ hybridizations for hand2 (green) and dlx3b (red). Relative to the first pouch (white outlines), dlx3b and hand2 were mildly expanded in grem2-MO embryos (G, n=45/52) and lost in hsp70I:Gal4; UAS:Grem2 embryos subjected to a 16-17 heat- shock (H, n=16/16). Arrow denotes expanded hand2 expansion. 80 Figure 23, continued. (I-M) Ventral views of 5 dpf facial skeletons from control (I), grem2-MO-#1- injected (J), UAS:Grem2 (K), edn1 -/- mutant (L), and an edn1 -/- mutant injected with grem2-MO-#1 (M). Schematics show skeletal regions derived from dorsal (green), intermediate (red), and ventral (blue) arch domains, with bones lightly shaded. Elements of undefined morphology or derived from the maxillary domain or more posterior arches are grey. Scale bars = 50µm. DISCUSSION Here we show that BMP and Edn1 signaling play distinct roles in specifying ventral and intermediate domains, respectively, of the pharyngeal arches. Whereas misexpression of Bmp4 or Edn1 can partially compensate for the loss of the other at early stages, we find that BMP activity later becomes restricted and plays a more prominent role in development of the ventral-most facial skeleton. This restriction of BMP activity to the ventral face is mediated in part by Edn1- and Jag1b-mediated induction of the BMP antagonist, Grem2, in the intermediate and dorsal face. Together these results support a model of DV facial patterning in which cross-inhibitory interactions between initially redundant BMP and Edn1 signaling pathways result in the segregation of facial skeletal precursors into distinct ventral and intermediate domains. BMPs and Edn1 have distinct roles in DV patterning of the face Whereas Edn1 and BMP signaling are both required for ventral and intermediate facial skeletal development (Alexander et al., 2011), our gain-of-function studies reveal that misexpression of BMP4 but not Edn1 disrupts the development of the intermediate skeleton, including the joints. Such a result is consistent with BMPs having a distinct role in promoting ventral at the expense of intermediate skeletal fates. These different roles of BMPs and Edn1 in ventral versus intermediate facial patterning are also reflected in the earlier regulation of DV gene expression. Whereas Bmp4 misexpression strongly induces 81 the ventral genes hand2 and msxe, Edn1 more prominently induces intermediate genes such as dlx3b/5a/6a and nkx3.2. Previous studies have shown that as arch development progresses, hand2 becomes restricted to a distinct ventral domain from the more intermediate expression of dlx3b/5a/6a and nkx3.2 (Miller et al., 2003; Talbot et al., 2010). Moreover, we show here that DV gene expression is further refined, with msxe expression marking a ventral-intermediate domain within the broader dlx3b-positive intermediate domain. Hence, BMPs may serve to segregate ventral hand2 + /msxe - /dlx3b - and ventral-intermediate hand2 - /msxe + /dlx3b + skeletal precursors from more intermediate hand2 - /msxe - /dlx3b + precursors (Fig. 24). Figure 24: Model of DV arch patterning. (A) In the early arches (24 hpf), Hand2 and Dlx family genes are co-expressed ventrally. BMPs both directly, and indirectly via Edn1 and Dlx5/6, initiate hand2 expression ventrally. (B) In the later arches (36 hpf), higher BMP activity induces hand2 and msxe in ventral and ventral-intermediate domains, respectively, with Hand2 repressing intermediate genes such as dlx3b/5a/6a and nkx3.2. In the intermediate domain, Edn1 induces dlx3b/5a/6a and nkx3.2 and represses jag1b. In addition, Edn1 and Jag1b together induce grem2, with Grem2 inhibition of BMP signaling preventing Hand2-dependent inhibition of intermediate genes. In the dorsal domain, Jag1b-Notch2 signaling may repress intermediate genes directly (dotted line) and/or indirectly through Grem2-mediated inhibition of BMP signaling. Our findings in zebrafish also agree with those in avians and mice showing that Msx1, Msx2, and Hand2 are regulated by BMP signaling (Tucker et al., 1998; Liu et al., 2004; 82 Liu et al., 2005; Mariani et al., 2008), whereas Dlx3, Dlx5, and Dlx6 (but not Hand2) are strongly induced by Edn1 (Sato et al., 2008). Although BMPs promote edn1 expression in the ectoderm (Alexander et al., 2011), two lines of evidence argue that BMP signaling also regulates hand2 and msxe expression more directly: 1) Bmp4 can induce the expression of hand2 and msxe, but not dlx3b, in the genetic absence of Edn1 and 2) BMP responses are required cell-autonomously in CNCCs for the expression of hand2 and msxe but not dlx3b. We therefore conclude that BMP signaling likely functions directly to regulate Hand and Msx gene expression in the ventral arches, but may function indirectly through Edn1 to regulate Dlx family expression in intermediate domains. Conversely, the more prominent role of Edn1 in intermediate skeletal development would explain why the intermediate skeleton is particularly sensitive to partial reductions of Edn1 signaling (Miller and Kimmel, 2001; Walker et al., 2006). An important consideration is that the roles of BMPs and Edn1 may change as arch development progresses. DV gene expression is highly dynamic within the developing pharyngeal arches, with Hand2 and Dlx family gene expression co-localizing in the early ventral arches and later becoming segregated into distinct ventral and intermediate domains (Talbot et al., 2010; Barron et al., 2011). Dlx5 and Dlx6 are required for the initial arch expression of Hand2 in mice (Depew et al., 2002; Ruest et al., 2004), and we find that BMPs and Edn1 have overlapping roles in early dlx5a/6a expression (Alexander et al., 2011). However, once Hand2 reaches a certain level it begins to inhibit Dlx family and Nkx3.2 gene expression in the ventral arches (Miller et al., 2003; Talbot et al., 2010; Barron et al., 2011). Thus, as arch development progresses, arch elongation and the 83 expression of Grem2 in dorsal-intermediate domains would progressively restrict BMP activity and hence Hand2 to the ventral-most arches, where it would inhibit Dlx family and Nkx3.2 expression. In this model, the lack of Hand2 in the intermediate domain presumably allows continued Dlx family and Nkx3.2 expression (Fig. 24B). Edn1 and Jag1b function through Grem2 to restrict BMP activity to the ventral face Our genetic data indicate that the later restriction of BMP activity to the ventral arches is critical for proper development of intermediate and dorsal skeletal precursors. Whereas previous studies in mice have shown roles for the BMP antagonists Noggin and Chordin in restricting BMP activity during mandibular development, Noggin is expressed in ventral arch epithelium and Chordin weakly throughout the arches (Stottmann et al., 2001). By contrast, here we show that zebrafish grem2 is expressed in a dorsal- intermediate arch domain that opposes ventral bmp4 expression. Consistent with Grem2 restricting BMP signaling to the ventral domain, reduction of Grem2 results in upregulated BMP activity and altered skeletal development in the dorsal and intermediate face. As Edn1 is a potent inducer of grem2, Edn1 may pattern the intermediate domain in part by keeping BMP activity below the threshold required for hand2 expression, thus preventing Hand2 repression of dlx3b/5a/6a and nkx3.2 expression. In the dorsal domain, Jag1b would further contribute to grem2 induction and BMP inhibition. A role for Jag1b in Grem2 induction would explain why loss of Jag1b rescues ventral skeletal defects in edn1 -/- mutants (Zuniga et al., 2010), similar to depleting Grem2 or misexpressing Bmp4 84 (Alexander et al., 2011). In edn1 -/- mutants, a reduction of grem2 expression correlates with increased BMP activity, yet this is not sufficient to support ventral development in the absence of Edn1. Significantly, some residual grem2 expression remains in edn1 -/- mutants, likely due to Jag1b regulation. One possibility then is that depletion of remaining grem2 would increase BMP signaling above a threshold required to induce hand2 and msxe independently of Edn1, thus rescuing the ventral skeleton. However, we were unable to detect further increases in BRE:GFP expression upon depletion of grem2 in edn1 -/- mutants (data not shown), suggesting that only a minor further increase in BMP activity is needed to rescue loss of Edn1, consistent with the very short UAS:Bmp4 heat shocks required to rescue edn1 -/- mutants (Alexander et al., 2011). Moreover, as we find that BMP4 inhibits jag1b expression, BMPs might also function upstream of Jag1b to prevent Jag1b-mediated repression of ventral fates. An analogous Jag1-Gremlin-Bmp4 module has been described in the limb, with Gremlin1 inhibition of Bmp4 promoting Jag1 expression in the distal limb bud mesenchyme (Panman et al., 2006). Based on our findings, we propose a network model of craniofacial patterning in which positive and negative feedback progressively creates two states of BMP signaling: high BMP activity in the ventral domain and low BMP in the intermediate and dorsal domains. In the ventral domain, BMP repression of its own inhibitor, Grem2, reinforces BMP signaling. In the intermediate and dorsal domains, combined Edn1 and Jagged-Notch signaling induces Grem2 and inhibits BMP signaling, with reduced BMP-mediated repression of Grem2 reinforcing the low BMP state. Indeed, visualization of BMP activity by either BRE:GFP or phospho-SMAD staining suggests a two-state model as 85 opposed to a gradient of BMP responses (Alexander et al., 2011). One property of this feedback model of DV patterning is that it creates a sharp boundary between two domains, with BMP signaling self-reinforcing to either high or low levels depending on the initial activity relative to a specific threshold. Such a self-reinforcing BMP network would create robustness. For example, the underlying ventral bias of BMP signaling would explain why the unlocalized injection of Edn1 protein throughout the arches can largely restore normal DV patterning to zebrafish edn1 -/- mutants (Miller et al., 2000), a result not predicted if Edn1 functioned in isolation as a morphogen. If both Bmp4 and Edn1 are secreted from the ventral ectoderm, an important question is why BMP responses become restricted ventrally whereas Edn1 responses become more restricted to intermediate domains. In one model, arch CNCCs are exposed to different ratios of Bmp4 and Edn1, with the former higher ventrally. Distinct diffusion coefficients or the unique expression domains of these ligands might explain such differences. Indeed, we observe that bmp4 is expressed in a more ventral domain of facial ectoderm than edn1. Alternatively, the added input of Jagged-Notch signaling on grem2 expression might increase total Grem2 levels beyond which can be inhibited by BMP, thus reducing BMP activity to below a threshold required to maintain itself in dorsal and intermediate CNCCs. Future modeling studies will be needed to understand how BMP, Edn1, and Jagged-Notch signaling are integrated to generate such highly reproducible pre-skeletal domains within the developing face. 86 CONCLUSION The work presented in this thesis is the first to show a role of Jagged in regional patterning of the face. We have shown that this function relies on negatively regulating ventral patterning genes in dorsal facial precursors. In addition, we propose a novel function of Jagged, independent from the Notch pathway, in which the intracellular domain has a dual role in indirectly repressing ventral genes and directly aiding in the formation of condensations. Furthermore, we have characterized the genetic interaction of Jagged with other known patterning signals such as Edn1 and Bmp in forming discrete skeletal elements of the face. Our findings and previous work have demonstrated the importance of regionalization of gene expression during arch stages for patterning the vertebrate face. For instance, we found jag1b, hey1, and grem2 are restricted dorsally; dlx3b is intermediate; and hand2 is expressed ventrally. There are several lines of evidence showing that a disruption in establishing these expression domains results in facial defects; however, how these genes then dictate skeletal shapes remains unknown. In the dorsal domain, we hypothesize that Jagged via a PDZ-based mechanism might be involved in mediating cell adhesion of dorsal facial precursors. However, the cell adhesion molecules that interact with Jagged still remain to be identified. In the intermediate domain, we find that dlx3b is crucial in forming the Sy cartilage and joints, but how a transcription factor mediates skeletal shape is unclear. Similarly, the downstream targets of hand2 in the ventral domain are still unknown. Future work will focus on identifying the downstream targets of each of these gene expression domains responsible for specifying the different elements of the face. A 87 possible mechanism is that these genes could be inducing expression of distinct cell adhesion molecules, or these genes could be differently affecting proliferation of facial precursors. Identifying the mechanism by which these genes give rise to the distinct elements of the face will also provide insight into how other skeletal structures such as the limb are formed. We have described a novel role of Jagged in facial patterning; however, one important question that still remains is whether this function is unique to zebrafish or is conserved among other vertebrates. In the Introduction, I mentioned that the zebrafish facial skeleton is homologous to the middle ear bones in mammals. Although in humans, patients with Alagille syndrome (AGS) have conductive hearing loss there have been no reports on defective inner ear formation. To determine if a similar mechanism is utilized for facial patterning in both zebrafish and mammals, we examined the requirement of Jagged in forming the middle ear bones in mice. As mentioned previously, Jag1 -/- mutant mice are embryonically lethal; thus we examined Jag1 +/- heterozygous mice in order to determine the role of Jagged in facial patterning. Indeed, we find Jag1 +/- heterozygous mice have defects in the incus and the stapes (dorsal equivalents) whereas the malleus (ventral equivalent) is unaffected. (Fig. 25). 88 Figure 25: The function of Jagged in craniofacial patterning is conserved among vertebrates. In zebrafish, loss of Jag1b results in dorsal-specific skeletal defects. Jag1 +/- heterozygous mutant mice display defective dorsal middle ear bones. Patients with Alagille syndrome have a characteristic facial appearance and hearing loss. Since our preliminary data indicate partial loss of Jagged results in middle ear defects, we then want to address if Jagged has an early role in repressing ventral patterning genes similar to what we observe in zebrafish. We will examine ventral gene expression in Jag1 +/- mutant mice and determine if these genes are also expanded dorsally due to loss of Jagged inhibition. In summary, showing how our work in zebrafish translates to humans demonstrates that our findings have a more global impact, and that they will be important in understanding the developmental basis of facial birth defects. 89 REFERENCES Akimenko, M. A., Ekker, M., Wegner, J., Lin, W. and Westerfield, M. (1994). Combinatorial expression of three zebrafish genes related to distal-less: part of a homeobox gene code for the head. J Neurosci 14, 3475-3486. Akimenko, M. A., Johnson, S. L., Westerfield, M. and Ekker, M. (1995). Differential induction of four msx homeobox genes during fin development and regeneration in zebrafish. Development 121, 347-357. Artavanis-Tsakonas, S., Rand, M. D. and Lake, R. J. (1999) Notch signaling: cell fate control and signal integration in development. Science 284, 770-776. Alexander, C., Zuniga, E., Blitz, I., Wada, N., LePabic, P., Javidan, Y., Zhang, T., Cho, K., Crump, J. G. and Schilling, T. F. (2011). Combinatorial roles for Bmps and Endothelin-1 in patterning the dorsal-ventral axis of the craniofacial skeleton. Development 138, 5135-5146. Angelo, S., Lohr, J., Lee, K. H., Ticho, B. S., Breitbart, R. E., Hill, S., Yost, H. J. and Srivastava, D. (2000). Conservation of sequence and expression of Xenopus and zebrafish dHAND during cardiac, branchial arch and lateral mesoderm development. Mech Dev 95, 231-237. Ascano, J. M., Beverly, L. J. and Capobianco, A. J. (2003) The C-terminal PDZ-ligand of JAGGED1 is essential for cellular transformation. J Biol Chem 278, 8771-8779. Ascano, J. M. (2005) Jagged 1 mediates bi-directional cell-cell communication implications in carcinogenesis and thymic development. Department od Molecular Genetics, Biochemistry and Microbiology. Ph.D. Thesis. University of Cincinnati. Bardot, B., Lecoin, L., Huillard, E., Calothy, G. and Marx, M. (2001). Expression pattern of the drm/gremlin gene during chicken embryonic development. Mech Dev 101, 263-265. Barron, F., Woods, C., Kuhn, K., Bishop, J., Howard, M. J. and Clouthier, D. E. (2011). Downregulation of Dlx5 and Dlx6 expression by Hand2 is essential for initiation of tongue morphogenesis. Development 138, 2249-2259. Bertrand, N., Castro, D. S. and Guillemot, F. (2002) Proneural genes and the specification of neural cell types. Nat Rev Neurosci 3, 517-530. Beverdam, A., Merlo, G. R., Paleari, L., Mantero, S., Genova, F., Barbieri, O., Janvier, P. and Levi, G. (2002). Jaw transformation with gain of symmetry after Dlx5/Dlx6 inactivation: mirror of the past? Genesis 34, 221-227. 90 Brooker, R., Hozumi, K. and Lewis, J. (2006). Notch ligands with contrasting functions: Jagged1 and Delta1 in the mouse inner ear. Development 133, 1277-1286. Buchert, M., Poon, C., King, J. A., Baechi, T., D'Abaco, G., Hollande, F. and Hovens, C. M. (2007) AF6/s-afadin is a dual residency protein and localizes to a novel subnuclear compartment. J Cell Physiol 210, 212-223. Charite, J., McFadden, D. G., Merlo, G., Levi, G., Clouthier, D. E., Yanagisawa, M., Richardson, J. A. and Olson, E. N. (2001). Role of Dlx6 in regulation of an endothelin- 1-dependent, dHAND branchial arch enhancer. Genes & development 15, 3039-3049. Cheng, Y. C., Amoyel, M., Qiu, X., Jiang, Y. J., Xu, Q. and Wilkinson, D. G. (2004) Notch activation regulates the segregation and differentiation of rhombomere boundary cells in the zebrafish hindbrain. Dev Cell 6, 539-550. Clouthier, D. E., Hosoda, K., Richardson, J. A., Williams, S. C., Yanagisawa, H., Kuwaki, T., Kumada, M., Hammer, R. E. and Yanagisawa, M. (1998). Cranial and cardiac neural crest defects in endothelin-A receptor-deficient mice. Development 125, 813-824. Clouthier, D. E. and Schilling, T. F. (2004) Understanding endothelin-1 function during craniofacial development in the mouse and zebrafish. Birth Defects Res C Embryo Today 72, 190-199. Clouthier, D. E., Williams, S. C., Yanagisawa, H., Wieduwilt, M., Richardson, J. A. and Yanagisawa, M. (2000). Signaling pathways crucial for craniofacial development revealed by endothelin-A receptor-deficient mice. Dev Biol 217, 10-24. Conlon, R. A., Reaume, A. G. and Rossant, J. (1995) Notch1 is required for the coordinate segmentation of somites. Development 121, 1533-1545. Cordle, J., Johnson, S., Tay, J. Z., Roversi, P., Wilkin, M. B., de Madrid, B. H., Shimizu, H., Jensen, S., Whiteman, P., Jin, B. et al. (2008). A conserved face of the Jagged/Serrate DSL domain is involved in Notch trans-activation and cis-inhibition. Nat Struct Mol Biol 15, 849-857. Crowe, R., Zikherman, J. and Niswander, L. (1999). Delta-1 negatively regulates the transition from prehypertrophic to hypertrophic chondrocytes during cartilage formation. Development 126, 987-998. Crump, J. G., Swartz, M. E. and Kimmel, C. B. (2004). An Integrin-Dependent Role of Pouch Endoderm in Hyoid Cartilage Development. PLoS Biol 2, E244. 91 Crump, J. G., Swartz, M. E., Eberhart, J. K. and Kimmel, C. B. (2006). Moz- dependent Hox expression controls segment-specific fate maps of skeletal precursors in the face. Development 133, 2661-2669. Daudet, N., Ariza-McNaughton, L. and Lewis, J. (2007). Notch signalling is needed to maintain, but not to initiate, the formation of prosensory patches in the chick inner ear. Development 134, 2369-2378. de Celis, J. F. and Bray, S. (1997). Feed-back mechanisms affecting Notch activation at the dorsoventral boundary in the Drosophila wing. Development 124, 3241-3251. Depew, M. J., Lufkin, T. and Rubenstein, J. L. (2002). Specification of jaw subdivisions by Dlx genes. Science 298, 381-385. Diaz-Benjumea, F. J. and Cohen, S. M. (1995). Serrate signals through Notch to establish a Wingless-dependent organizer at the dorsal/ventral compartment boundary of the Drosophila wing. Development 121, 4215-4225. Eberhart, J. K., Swartz, M. E., Crump, J. G. and Kimmel, C. B. (2006). Early Hedgehog signaling from neural to oral epithelium organizes anterior craniofacial development. Development 133, 1069-1077. Eisen, J. S. and Smith, J. C. (2008) Controlling morpholino experiments: don't stop making antisense. Development 135, 1735-1743. Francis-West, P. H., Tatla, T. and Brickell, P. M. (1994). Expression patterns of the bone morphogenetic protein genes Bmp-4 and Bmp-2 in the developing chick face suggest a role in outgrowth of the primordia. Dev Dyn 201, 168-178. Geisler, F., Nagl, F., Mazur, P. K., Lee, M., Zimber-Strobl, U., Strobl, L. J., Radtke, F., Schmid, R. M. and Siveke, J. T. (2008). Liver-specific inactivation of Notch2, but not Notch1, compromises intrahepatic bile duct development in mice. Hepatology 48, 607-616. Gendron-Maguire, M., Mallo, M., Zhang, M. and Gridley, T. (1993). Hoxa-2 mutant mice exhibit homeotic transformation of skeletal elements derived from cranial neural crest. Cell 75, 1317-1331. Gering, M. and Patient, R. (2008) Notch in the niche. Cell Stem Cell 2, 293-294. Golson, M. L., Loomes, K. M., Oakey, R. and Kaestner, K. H. (2009). Ductal malformation and pancreatitis in mice caused by conditional Jag1 deletion. Gastroenterology 136, 1761-1771 e1761. 92 Graham, A., Francis-West, P., Brickell, P. and Lumsden, A. (1994). The signalling molecule BMP4 mediates apoptosis in the rhombencephalic neural crest. Nature 372, 684-686. Hall, B. K. and Miyake, T. (1995) Divide, accumulate, differentiate: cell condensation in skeletal development revisited. Int J Dev Biol 39, 881-893. High, F. A., Lu, M. M., Pear, W. S., Loomes, K. M., Kaestner, K. H. and Epstein, J. A. (2008). Endothelial expression of the Notch ligand Jagged1 is required for vascular smooth muscle development. Proc Natl Acad Sci U S A 105, 1955-1959. Higuchi, M., Kiyama, H., Hayakawa, T., Hamada, Y. and Tsujimoto, Y. (1995). Differential expression of Notch1 and Notch2 in developing and adult mouse brain. Brain Res Mol Brain Res 29, 263-272. Holzschuh, J., Wada, N., Wada, C., Schaffer, A., Javidan, Y., Tallafuss, A., Bally- Cuif, L. and Schilling, T. F. (2005). Requirements for endoderm and BMP signaling in sensory neurogenesis in zebrafish. Development 132, 3731-3742. Hsu, D. R., Economides, A. N., Wang, X., Eimon, P. M. and Harland, R. M. (1998). The Xenopus dorsalizing factor Gremlin identifies a novel family of secreted proteins that antagonize BMP activities. Mol Cell 1, 673-683. Huang, P., Xiao, A., Zhou, M., Zhu, Z., Lin, S. and Zhang, B. (2011) Heritable gene targeting in zebrafish using customized TALENs. Nat Biotechnol 29, 699-700. Jiang, R., Lan, Y., Chapman, H. D., Shawber, C., Norton, C. R., Serreze, D. V., Weinmaster, G. and Gridley, T. (1998). Defects in limb, craniofacial, and thymic development in Jagged2 mutant mice. Genes Dev 12, 1046-1057. Kamath, B. M., Stolle, C., Bason, L., Colliton, R. P., Piccoli, D. A., Spinner, N. B. and Krantz, I. D. (2002a). Craniosynostosis in Alagille syndrome. Am J Med Genet 112, 176-180. Kamath, B. M., Loomes, K. M., Oakey, R. J., Emerick, K. E., Conversano, T., Spinner, N. B., Piccoli, D. A. and Krantz, I. D. (2002b). Facial features in Alagille syndrome: specific or cholestasis facies? Am J Med Genet 112, 163-170. Kanzler, B., Foreman, R. K., Labosky, P. A. and Mallo, M. (2000). BMP signaling is essential for development of skeletogenic and neurogenic cranial neural crest. Development 127, 1095-1104. Kiernan, A. E., Xu, J. and Gridley, T. (2006). The Notch ligand JAG1 is required for sensory progenitor development in the mammalian inner ear. PLoS Genet 2, e4. 93 Kimmel, C. B., Ballard, W. W., Kimmel, S. R., Ullmann, B. and Schilling, T. F. (1995). Stages of embryonic development of the zebrafish. Dev Dyn 203, 253-310. Kimmel, C. B., Ullmann, B., Walker, M., Miller, C. T. and Crump, J. G. (2003). Endothelin 1-mediated regulation of pharyngeal bone development in zebrafish. Development 130, 1339-1351. Kimmel, C. B., Walker, M. B. and Miller, C. T. (2007). Morphing the hyomandibular skeleton in development and evolution. J Exp Zoolog B Mol Dev Evol 308, 609-624. Koo, B. K., Yoon, K. J., Yoo, K. W., Lim, H. S., Song, R., So, J. H., Kim, C. H. and Kong, Y. Y. (2005) Mind bomb-2 is an E3 ligase for Notch ligand. J Biol Chem 280, 22335-22342. Kurihara, Y., Kurihara, H., Suzuki, H., Kodama, T., Maemura, K., Nagai, R., Oda, H., Kuwaki, T., Cao, W. H., Kamada, N. et al. (1994). Elevated blood pressure and craniofacial abnormalities in mice deficient in endothelin-1. Nature 368, 703-710. Kwan, K. M., Fujimoto, E., Grabher, C., Mangum, B. D., Hardy, M. E., Campbell, D. S., Parant, J. M., Yost, H. J., Kanki, J. P. and Chien, C. B. (2007). The Tol2kit: a multisite gateway-based construction kit for Tol2 transposon transgenesis constructs. Dev Dyn 236, 3088-3099. LaVoie, M. J. and Selkoe, D. J. (2003) The Notch ligands, Jagged and Delta, are sequentially processed by alpha-secretase and presenilin/gamma-secretase and release signaling fragments. J Biol Chem 278, 34427-34437. Lawson, N. D. and Weinstein, B. M. (2002). In vivo imaging of embryonic vascular development using transgenic zebrafish. Dev Biol 248, 307-318. Le Borgne, R., Bardin, A. and Schweisguth, F. (2005) The roles of receptor and ligand endocytosis in regulating Notch signaling. Development 132, 1751-1762. Le Caignec, C., Lefevre, M., Schott, J. J., Chaventre, A., Gayet, M., Calais, C. and Moisan, J. P. (2002). Familial deafness, congenital heart defects, and posterior embryotoxon caused by cysteine substitution in the first epidermal-growth-factor-like domain of jagged 1. Am J Hum Genet 71, 180-186. Le Douarin, N. (1982) The Neural Crest. Cambridge University Press, Cambridge. Li, L., Krantz, I. D., Deng, Y., Genin, A., Banta, A. B., Collins, C. C., Qi, M., Trask, B. J., Kuo, W. L., Cochran, J. et al. (1997). Alagille syndrome is caused by mutations in human Jagged1, which encodes a ligand for Notch1. Nat Genet 16, 243-251. 94 Liem, K. F., Jr., Tremml, G., Roelink, H. and Jessell, T. M. (1995). Dorsal differentiation of neural plate cells induced by BMP-mediated signals from epidermal ectoderm. Cell 82, 969-979. Liu, W., Selever, J., Wang, D., Lu, M. F., Moses, K. A., Schwartz, R. J. and Martin, J. F. (2004). Bmp4 signaling is required for outflow-tract septation and branchial-arch artery remodeling. Proc Natl Acad Sci U S A 101, 4489-4494. Liu, W., Selever, J., Murali, D., Sun, X., Brugger, S. M., Ma, L., Schwartz, R. J., Maxson, R., Furuta, Y. and Martin, J. F. (2005). Threshold-specific requirements for Bmp4 in mandibular development. Dev Biol 283, 282-293. Lorent, K., Yeo, S. Y., Oda, T., Chandrasekharappa, S., Chitnis, A., Matthews, R. P. and Pack, M. (2004). Inhibition of Jagged-mediated Notch signaling disrupts zebrafish biliary development and generates multi-organ defects compatible with an Alagille syndrome phenocopy. Development 131, 5753-5766. Louvi, A. and Artavanis-Tsakonas, S. (2006) Notch signalling in vertebrate neural development. Nat Rev Neurosci 7, 93-102. Lozier, J., McCright, B. and Gridley, T. (2008). Notch signaling regulates bile duct morphogenesis in mice. PLoS ONE 3, e1851. Mariani, F. V., Ahn, C. P. and Martin, G. R. (2008). Genetic evidence that FGFs have an instructive role in limb proximal-distal patterning. Nature 453, 401-405. Maves, L., Tyler, A., Moens, C. B. and Tapscott, S. J. (2009). Pbx acts with Hand2 in early myocardial differentiation. Dev Biol 333, 409-418. McCright, B., Lozier, J. and Gridley, T. (2002). A mouse model of Alagille syndrome: Notch2 as a genetic modifier of Jag1 haploinsufficiency. Development 129, 1075-1082. McDaniell, R., Warthen, D. M., Sanchez-Lara, P. A., Pai, A., Krantz, I. D., Piccoli, D. A. and Spinner, N. B. (2006). NOTCH2 mutations cause Alagille syndrome, a heterogeneous disorder of the notch signaling pathway. Am J Hum Genet 79, 169-173. Miller, C. T., Schilling, T. F., Lee, K., Parker, J. and Kimmel, C. B. (2000) sucker encodes a zebrafish Endothelin-1 required for ventral pharyngeal arch development. Development 127, 3815-3828. Miller, C. T. and Kimmel, C. B. (2001). Morpholino phenocopies of endothelin 1 (sucker) and other anterior arch class mutations. Genesis 30, 186-187. Miller, C. T., Maves, L. and Kimmel, C. B. (2004). moz regulates Hox expression and pharyngeal segmental identity in zebrafish. Development 131, 2443-2461. 95 Miller, C. T., Schilling, T. F., Lee, K., Parker, J. and Kimmel, C. B. (2000). sucker encodes a zebrafish Endothelin-1 required for ventral pharyngeal arch development. Development 127, 3815-3828. Miller, C. T., Yelon, D., Stainier, D. Y. and Kimmel, C. B. (2003). Two endothelin 1 effectors, hand2 and bapx1, pattern ventral pharyngeal cartilage and the jaw joint. Development 130, 1353-1365. Mina, M., Wang, Y. H., Ivanisevic, A. M., Upholt, W. B. and Rodgers, B. (2002). Region- and stage-specific effects of FGFs and BMPs in chick mandibular morphogenesis. Dev Dyn 223, 333-352. Mitsiadis, T. A., Henrique, D., Thesleff, I. and Lendahl, U. (1997). Mouse Serrate-1 (Jagged-1): expression in the developing tooth is regulated by epithelial-mesenchymal interactions and fibroblast growth factor-4. Development 124, 1473-1483. Muller, II, Knapik, E. W. and Hatzopoulos, A. K. (2006). Expression of the protein related to Dan and Cerberus gene--prdc--During eye, pharyngeal arch, somite, and swim bladder development in zebrafish. Dev Dyn 235, 2881-2888. Nair, S., Li, W., Cornell, R. and Schilling, T. F. (2007). Requirements for Endothelin type-A receptors and Endothelin-1 signaling in the facial ectoderm for the patterning of skeletogenic neural crest cells in zebrafish. Development 134, 335-345. Nakanishi, K., Chan, Y. S. and Ito, K. (2007). Notch signaling is required for the chondrogenic specification of mouse mesencephalic neural crest cells. Mech Dev 124, 190-203. Nguyen, V. H., Schmid, B., Trout, J., Connors, S. A., Ekker, M. and Mullins, M. C. (1998). Ventral and lateral regions of the zebrafish gastrula, including the neural crest progenitors, are established by a bmp2b/swirl pathway of genes. Dev Biol 199, 93-110. Nie, X., Luukko, K. and Kettunen, P. (2006). BMP signalling in craniofacial development. Int J Dev Biol 50, 511-521. Oda, T., Elkahloun, A. G., Pike, B. L., Okajima, K., Krantz, I. D., Genin, A., Piccoli, D. A., Meltzer, P. S., Spinner, N. B., Collins, F. S. et al. (1997). Mutations in the human Jagged1 gene are responsible for Alagille syndrome. Nat Genet 16, 235-242. Okamura, Y. and Saga, Y. (2008). Notch signaling is required for the maintenance of enteric neural crest progenitors. Development 135, 3555-3565. Ozeki, H., Kurihara, Y., Tonami, K., Watatani, S. and Kurihara, H. (2004). Endothelin-1 regulates the dorsoventral branchial arch patterning in mice. Mech Dev 121, 387-395. 96 Panman, L., Galli, A., Lagarde, N., Michos, O., Soete, G., Zuniga, A. and Zeller, R. (2006). Differential regulation of gene expression in the digit forming area of the mouse limb bud by SHH and gremlin 1/FGF-mediated epithelial-mesenchymal signalling. Development 133, 3419-3428. Platt, J. B. (1893). Ectodermic origin of the cartilages of the head. Anat. Anz. 8, 506-509. Pintar, A., De Biasio, A., Popovic, M., Ivanova, N. and Pongor, S. (2007) The intracellular region of Notch ligands: does the tail make the difference?. Biol Direct 2, 19. Popovic, M., Coglievina, M., Guarnaccia, C., Verdone, G., Esposito, G., Pintar, A. and Pongor, S. (2006) Gene synthesis, expression, purification, and characterization of human Jagged-1 intracellular region. Protein Expr Purif 47, 398-404. Popovic, M., Bella, J., Zlatev, V., Hodnik, V., Anderluh, G., Barlow, P. N., Pintar, A. and Pongor, S. (2011) The interaction of Jagged-1 cytoplasmic tail with afadin PDZ domain is local, folding-independent, and tuned by phosphorylation. J Mol Recognit 24, 245-253. Pyati, U. J., Webb, A. E. and Kimelman, D. (2005). Transgenic zebrafish reveal stage- specific roles for Bmp signaling in ventral and posterior mesoderm development. Development 132, 2333-2343. Quiros-Tejeira, R. E., Ament, M. E., Heyman, M. B., Martin, M. G., Rosenthal, P., Hall, T. R., McDiarmid, S. V. and Vargas, J. H. (1999) Variable morbidity in alagille syndrome: a review of 43 cases. J Pediatr Gastroenterol Nutr 29, 431-437. Rijli, F. M., Mark, M., Lakkaraju, S., Dierich, A., Dolle, P. and Chambon, P. (1993). A homeotic transformation is generated in the rostral branchial region of the head by disruption of Hoxa-2, which acts as a selector gene. Cell 75, 1333-1349. Ruest, L. B., Xiang, X., Lim, K. C., Levi, G. and Clouthier, D. E. (2004). Endothelin- A receptor-dependent and -independent signaling pathways in establishing mandibular identity. Development 131, 4413-4423. Samejima, H., Torii, C., Kosaki, R., Kurosawa, K., Yoshihashi, H., Muroya, K., Okamoto, N., Watanabe, Y., Kosho, T., Kubota, M. et al. (2007) Screening for Alagille syndrome mutations in the JAG1 and NOTCH2 genes using denaturing high- performance liquid chromatography. Genet Test 11, 216-227. Sander, J. D., Cade, L., Khayter, C., Reyon, D., Peterson, R. T., Joung, J. K. and Yeh, J. R. (2011) Targeted gene disruption in somatic zebrafish cells using engineered TALENs. Nat Biotechnol 29, 697-698. 97 Sander, J. D., Maeder, M. L., Reyon, D., Voytas, D. F., Joung, J. K. and Dobbs, D. (2010) ZiFiT (Zinc Finger Targeter): an updated zinc finger engineering tool. Nucleic Acids Res 38, 462-468. Sato, T., Kurihara, Y., Asai, R., Kawamura, Y., Tonami, K., Uchijima, Y., Heude, E., Ekker, M., Levi, G. and Kurihara, H. (2008). An endothelin-1 switch specifies maxillomandibular identity. Proc Natl Acad Sci U S A 105, 18806-18811. Scheer, N. and Campos-Ortega, J. A. (1999). Use of the Gal4-UAS technique for targeted gene expression in the zebrafish. Mech Dev 80, 153-158. Schilling, T. F. and Kimmel, C. B. (1994) Segment and cell type lineage restrictions during pharyngeal arch development in the zebrafish embryo. Development 120, 483- 494. Shigetani, Y., Nobusada, Y. and Kuratani, S. (2000). Ectodermally derived FGF8 defines the maxillomandibular region in the early chick embryo: epithelial-mesenchymal interactions in the specification of the craniofacial ectomesenchyme. Dev Biol 228, 73- 85. Sperber, S.M. and Dawid, I.B. (2008). barx1 is necessary for ectomesenchyme proliferation and osteochondroprogenitor condensation in the zebrafish pharyngeal arches. Dev Biol 321, 101-110. Steventon, B., Araya, C., Linker, C., Kuriyama, S. and Mayor, R. (2009). Differential requirements of BMP and Wnt signalling during gastrulation and neurulation define two steps in neural crest induction. Development 136, 771-779. Stottmann, R. W., Anderson, R. M. and Klingensmith, J. (2001). The BMP antagonists Chordin and Noggin have essential but redundant roles in mouse mandibular outgrowth. Dev Biol 240, 457-473. Sun, X. and Artavanis-Tsakonas, S. (1996) The intracellular deletions of Delta and Serrate define dominant negative forms of the Drosophila Notch ligands. Development 122, 2465-2474. Talbot, J. C., Johnson, S. L. and Kimmel, C. B. (2010). hand2 and Dlx genes specify dorsal, intermediate and ventral domains within zebrafish pharyngeal arches. Development 137, 2507-2517. Thomas, T., Kurihara, H., Yamagishi, H., Kurihara, Y., Yazaki, Y., Olson, E. N. and Srivastava, D. (1998). A signaling cascade involving endothelin-1, dHAND and msx1 regulates development of neural-crest-derived branchial arch mesenchyme. Development 125, 3005-3014. 98 Tucker, A. S., Al Khamis, A. and Sharpe, P. T. (1998). Interactions between Bmp-4 and Msx-1 act to restrict gene expression to odontogenic mesenchyme. Dev Dyn 212, 533-539. Wada, N., Javidan, Y., Nelson, S., Carney, T. J., Kelsh, R. N. and Schilling, T. F. (2005). Hedgehog signaling is required for cranial neural crest morphogenesis and chondrogenesis at the midline in the zebrafish skull. Development 132, 3977-3988. Walker, M. B. and Kimmel, C. B. (2007). A two-color acid-free cartilage and bone stain for zebrafish larvae. Biotech Histochem 82, 23-28. Walker, M. B., Miller, C. T., Coffin Talbot, J., Stock, D. W. and Kimmel, C. B. (2006). Zebrafish furin mutants reveal intricacies in regulating Endothelin1 signaling in craniofacial patterning. Dev Biol 295, 194-205. Walker, M. B., Miller, C. T., Swartz, M. E., Eberhart, J. K. and Kimmel, C. B. (2007). phospholipase C, beta 3 is required for Endothelin1 regulation of pharyngeal arch patterning in zebrafish. Dev Biol 304, 194-207. Wall, N. A. and Hogan, B. L. (1995). Expression of bone morphogenetic protein-4 (BMP-4), bone morphogenetic protein-7 (BMP-7), fibroblast growth factor-8 (FGF-8) and sonic hedgehog (SHH) during branchial arch development in the chick. Mech Dev 53, 383-392. Warthen, D. M., Moore, E. C., Kamath, B. M., Morrissette, J. J., Sanchez, P., Piccoli, D. A., Krantz, I. D. and Spinner, N. B. (2006) Jagged1 (JAG1) mutations in Alagille syndrome: increasing the mutation detection rate. Hum Mutat 27, 436-443. Welten, M. C., de Haan, S. B., van den Boogert, N., Noordermeer, J. N., Lamers, G. E., Spaink, H. P., Meijer, A. H. and Verbeek, F. J. (2006). ZebraFISH: fluorescent in situ hybridization protocol and three-dimensional imaging of gene expression patterns. Zebrafish 3, 465-476. Wise, S. B. and Stock, D. W. (2010). bmp2b and bmp4 are dispensable for zebrafish tooth development. Dev Dyn 239, 2534-2546. Wozney, J. M., Rosen, V., Celeste, A. J., Mitsock, L. M., Whitters, M. J., Kriz, R. W., Hewick, R. M. and Wang, E. A. (1988). Novel regulators of bone formation: molecular clones and activities. Science 242, 1528-1534. Wright, G. J., Leslie, J. D., Ariza-McNaughton, L. and Lewis, J. (2004) Delta proteins and MAGI proteins: an interaction of Notch ligands with intracellular scaffolding molecules and its significance for zebrafish development. Development 131, 5659-5669. 99 Xu, Q., Alldus, G., Holder, N. and Wilkinson, D. G. (1995). Expression of truncated Sek-1 receptor tyrosine kinase disrupts the segmental restriction of gene expression in the Xenopus and zebrafish hindbrain. Development 121, 4005-4016. Xue, Y., Gao, X., Lindsell, C. E., Norton, C. R., Chang, B., Hicks, C., Gendron- Maguire, M., Rand, E. B., Weinmaster, G. and Gridley, T. (1999). Embryonic lethality and vascular defects in mice lacking the Notch ligand Jagged1. Hum Mol Genet 8, 723-730. Yanagisawa, H., Clouthier, D. E., Richardson, J. A., Charite, J. and Olson, E. N. (2003). Targeted deletion of a branchial arch-specific enhancer reveals a role of dHAND in craniofacial development. Development 130, 1069-1078. Zecchin, E., Conigliaro, A., Tiso, N., Argenton, F. and Bortolussi, M. (2005). Expression analysis of jagged genes in zebrafish embryos. Dev Dyn 233, 638-645. Zuniga, E., Stellabotte, F. and Crump, J. G. (2010). Jagged-Notch signaling ensures dorsal skeletal identity in the vertebrate face. Development 137, 1843-1852.

Asset Metadata

Creator Zuniga, Elizabeth (author)

Core Title Jagged-notch signaling: patterning the vertebrate face

Contributor Electronically uploaded by the author (provenance)

School Keck School of Medicine

Degree Doctor of Philosophy

Degree Program Neuroscience

Publication Date 10/09/2012

Defense Date 09/26/2012

Publisher University of Southern California (original), University of Southern California. Libraries (digital)

Tag BMP,craniofacial,Edn1,Jagged1,Notch2,oai:digitallibrary.usc.edu:usctheses,OAI-PMH Harvest,zebrafish

Language English

Advisor Crump, Gage D. (committee chair), Butler, Samantha (committee member), Ma, Le (committee member), Maxson, Robert E., Jr. (committee member), Segil, Neil (committee member)

Creator Email elizabez@usc.edu,elizabez5@gmail.com

Permanent Link (DOI) https://doi.org/10.25549/usctheses-c3-102586

Unique identifier UC11288248

Identifier usctheses-c3-102586 (legacy record id)

Legacy Identifier etd-ZunigaEliz-1241.pdf

Dmrecord 102586

Document Type Dissertation

Rights Zuniga, Elizabeth

Type texts

Source University of Southern California (contributing entity), University of Southern California Dissertations and Theses (collection)

Access Conditions The author retains rights to his/her dissertation, thesis or other graduate work according to U.S. copyright law. Electronic access is being provided by the USC Libraries in agreement with the a...

Repository Name University of Southern California Digital Library

Repository Location USC Digital Library, University of Southern California, University Park Campus MC 2810, 3434 South Grand Avenue, 2nd Floor, Los Angeles, California 90089-2810, USA

Abstract (if available)

Abstract Craniofacial abnormalities are the most common birth defects, and yet little is known about the developmental etiology that leads to mispatterning of the face. Several studies have shown that the development of the face depends on the regionalization of neural crest precursors into distinct domains along the dorsoventral (DV) axis. Previous research has shown Endothelin 1 (Edn1) is required for patterning the ventral (lower) face, in part by regulating the expression of ventral genes such as those of the Dlx family. However, little is known about the factors required for development of the dorsal (upper) face. By analyzing a newly identified zebrafish jag1b mutant and transgenic overexpressing JAGGED1, we find that Jagged-Notch signaling promotes dorsal identity by repressing ventral gene expression. Jagged ligands are thought to act primarily as ligands for Notch receptors, with cleavage and nuclear translocation of a Notch intracellular domain (NICD) affecting gene transcription. Surprisingly, we find that transgenic misexpression of JAGGED1 intracellular domain (JICD), which lacks the extracellular domain required for Notch binding, produces facial skeletal and DV gene expression defects similar to those seen upon misexpression of full-length JAGGED1. These findings lead us to propose a novel cell-autonomous role for Jagged in transcriptional regulation responsible for patterning the dorsal face. Next, we identified the Bmp antagonist Gremlin2 as a target of both Jagged-Notch and Edn1 signaling with Grem2 being required to restrict Bmp activity to the ventral-most domain of the arches. Using gain- and loss-of-function studies, we revealed a complex genetic interaction among Jagged, Edn1, and Bmp signaling in specifying distinct skeletal fates along the DV facial axis. Taken all together, our findings are the first to show how Jagged is involved in regional patterning of the face. Mutations in Jagged are found in patients with Alagille syndrome who often have a characteristic facial dysmorphology. Thus determining how Jagged patterns the face will lead us closer in understanding how a disruption in this pathway results in facial anomalies in humans.