/

University of Southern California Dissertations and Theses

/

Insights from mouse models on the origin of ovarian cancer and its predisposing mechanisms

(USC Thesis Other)

Insights from mouse models on the origin of ovarian cancer and its predisposing mechanisms

PDF

Transcript (if available)

Content

INSIGHTS FROM MOUSE MODELS ON THE ORIGIN OF OVARIAN
CANCER AND ITS PREDISPOSING MECHANISMS

by

Ying Liu

_______________________________________________

A Dissertation Presented to the
FACULTY OF THE USC GRADUATE SCHOOL
UNIVERSITY OF SOUTHERN CALIFORNIA
In Partial Fulfillment of the
Requirements for the Degree
DOCTOR OF PHILOSOPHY
(PATHOBIOLOGY)

May 2013

Copyright 2013 Ying Liu

ii

DEDICATION

This is dedicated to my family: Dad, Mom, husband and sweetheart Michelle. I
would not have been able to accomplish this Ph.D. without their unconditional love
and support.

iii

ACKNOWLEDGEMENTS
I would like to thank my mentor Dr. Louis Dubeau for the opportunity to work in his
laboratory. I sincerely and deeply appreciate his patience, motivation and endless
encouragement throughout my thesis work. His enthusiasm, inspiration, supports and
guidance has meant a lot to me over the years and I am very fortunate to have him as
my mentor.
I would also like to thank my committee members: Dr. Clive R Taylor, Dr.
Chengming Chuong and Dr. Robert Maxson for their encouragement, insightful
comments and suggestions. It has been a pleasure having them on my committee
over the past few years.
I am heartily thankful to past and present members of the Dubeau lab for providing a
stimulating and fun environment in which to learn and grow. It has truly been a
remarkable journey and I am so thankful to have shared it with all of you: Christine
Marion, Dr. Elena Enbom, Theresa Austria, Yuang Tang, Emily Zhang, Dr. Sara
Mucowski and Dr. Jennifer Yeh, Dr. Vanessa Yu, Dr. Hai-Yun Yen, Dr. Hao Hong.
I would also give special thank to Nancy Wu for her helping with the mice surgery
and James Burford for animal imaging.
Finally, to my colleagues and my friends, thank you for all your encouragement and
great advice over the years.

Ying Liu

iv

TABLE OF CONTENTS

Dedication ii
Acknowledgements iii
List of Tables v
List of Figures vi
Abstract viii

Chapter 1: Background 1
Chapter 1 References 16

Chapter 2: Contributions of the müllerian ducts to potential sites 21
of origin of ovarian serous, endometrioid, mucinous,
clear cell tumors
Chapter 2 References 51

Chapter 3: Tumor predisposition in the Mis2r-Cre; Fshr-Cre; 55
Brca1 flox/flox; P53 flox/flox mouse model
Chapter 3 References 67

Chapter 4: Novel role of olfactory receptors in controlling mice 70
estrous cycle contributes to ovarian tumor predisposition
Chapter 4 References 107

Chapter 5: Significance of heterozygous Brca1 mutation in 112
ovarian granulosa cells
Chapter 5 References 123

Chapter 6: Summary 124
Future direction 126

Bibliography 133

v

LIST OF TABLES

Table 1-1: Influence of parity and oral contraceptive use 5
on ovarian cancer risk

Table 2-1: Strategy for distinguishing between current and past 31
Mis2r promoter activity based on outcome of
β-galactosidase (β-Gal) colorimetric assay

Table 4-1: Genes showing the highest expression 89
in microarray in mutant mice

Table 4-2: Differences between wild type and mutant mice 95
in their response to male scent

Table 4-3: Summary of differences between wild type and 96
mutant mice in their sensitivity to male scent

Table 4-4: Differences between ovary transplantation mice 102
in their response to male scent

vi

LIST OF FIGURES

Fig. 2-1: Distribution of Mis2r promoter activity in reproductive 33
organs known to be derived from the Müllerian Ducts
in Mis2r-LacZ transgenic mice

Fig. 2-2: Tissue Specific Distribution of Mis2r promoter in 34
Mis2r-Cre;R26R
LacZ
transgenic mice

Fig. 2-3: Distribution of Mis2r promoter activity in ovarian 36
and peri-ovarian tissues

Fig. 2-4: Evaluation of Cre-mediated rearrangement by PCR 39
in ovarian and peri-ovarian tissues

Fig. 2-5: Evidence that a segment of the renal collecting system 42
is embryologically derived from the müllerian ducts

Fig. 2-6: PCR-based evidence of Mis2r-Cre-mediated 45
rearrangement in renal tissues

Fig. 3-1: Examples of tumor lesions observed in mutant mice 63
and immunohistochemical characterization

Fig. 4-1: Histogene staining before and after microdissection 86
of granulosa cells

Fig. 4-2: Pearson correlation analysis of representative genes 87
validated by q-RT-PCR

Fig. 4-3: Immunohistochemical characterization of olfactory 91
receptor expression in ovarian granulosa cells

Fig. 4-4: Vaginal appearance and PAP smear before and 93
after exposure to male scent

Fig. 4-5: Ovarian transplantation into renal capsule 99

Fig. 4-6: Demonstration of ovary function after 100
ovary transplantation

vii

Fig. 4-7: Olfactory receptor expression in human granulosa cells 104
by RT-PCT

Fig. 5-1: Consequences of a heterozygous Brca1 mutation on 119
expression of aromatase and Hsd3-beta
by granulosa cells

Fig. 5-2: Further evidence of the phenotype of heterozygous mutant 121
is intermediate of wild type and homozygous mutant

viii

ABSTRACT

Ovarian cancers are the leading cause of death from gynecological cancer in the U.S.
and more than 70% of the patients are diagnosed with disseminated disease. Thus,
the ability to detect ovarian cancer precursor lesions before they develop into fully
mature cancers would have a profound impact on the morbidity and mortality of the
disease. However, the exact site of origin of ovarian cancer is not fully understood.
The purpose of my thesis is to develop heritable mouse models for epithelial ovarian
tumors to answer key questions regarding ovarian cancer origin and address the
underlying predisposing mechanisms.
Dr. Dubeau has argued for many years, that the currently favoured hypothesis that
tumors lesions that are currently classified ovarian epithelial tumors do not arise
from the coelomic epithelium that covers the ovary, but from derivatives of the
müllerian ducts. In order to test our hypothesis, we generated transgenic constructs
where the Müllerian inhibiting substance type 2 receptor (Mis2r) promoter drives
expression of either β-galactosidase (Mis2r-β–Gal) or Cre recombinase (Mis2r-Cre),
we found no evidence of an embryological link between the müllerian ducts and
coelomic epithelium, however, a segment of the renal tubules specific for the female
gender might suggest an embryological link between the müllerian ducts and renal
development. This is important not only to a development point of view, but also
helped us understand histogenesis of clear cell ovarian carcinomas.

ix

We also created a mouse model by superimposing p53 knockout targeted specifically
to müllerian tract on the Brca1 mutation already present in Fshr-Cre; Brca1 flox/flox
mice. Tumors possibly from mammary glands were observed in 60% of mice with
double knockout, and they were epithelial in nature. This model would be a useful
tool to study the role of loss of function of p53 and Brca1 in cancers relevant to
ovary and mammary glands in origin, which will further augment our understanding
on human BRCA1-mutated related cancer.
The gene profiling changes between wide type and mutant mice with Brca1
inactivation in ovarian granulosa cells showed the gene family that was most
frequently influenced was that of olfactory receptor. We validated the presence of
olfactory receptors in mouse and human granulosa cells and further hypothesized
those olfactory receptors may play a role in signal transduction in granulosa cells and
contribute to ovarian tumor predisposition by regulating mice estrous cycle.
Our previous work has been using homozygous Brca1 mutation in ovarian granulosa
cells to maximize the effects of Brca1 inactivation, we also want to test our
hypothesis that the effects of a heterozygous mutation is similar due to the gene
dosage effect, such as present in human BRCA1 mutation carriers.

1

Chapter 1 BACKGROUND

2

Overview of ovarian cancer
Ovarian carcinomas are the most lethal tumors arising in female reproductive organ.
According to American Cancer Society in 2012, an estimated 15,500 women died of
ovarian cancer, and 22,280 new cases were diagnosed. Ovarian carcinomas occur
mostly in postmenopausal women(Parazzini, 1991). The lifetime risk for a woman to
develop ovarian cancer is approximately 1 in 70, compared to 1 in 8 for breast
cancer(Risch et al., 1994). However, ovarian cancers are highly insidious. In contrast
to breast cancer, where most cases are detected at an early stage, approximately 70%
of women with ovarian cancer are diagnosed at advanced stages when the cancers
have spread beyond the ovaries. Unfortunately, despite intensive clinical and
experimental research, effective and sensitive screening tests for early stage
detection are still unavailable. This progress was obstacle due to lack of
understanding of the nature of the pre-invasive or precursor lesions and genetic
alterations in these lesions for ovarian carcinoma, and uncertainty about the cell
origin. Therefore, epithelial ovarian cancer pathogenesis remains among the least
understood of all major cancers.

3

Familiar and sporadic ovarian cancer and predisposing risk factors
Ovarian cancer occurs sporadically in the population. 10% of cases with a strong
family history, but 90% are sporadic(Lacey and et al., 2002).
a) Familiar ovarian cancer
Most familial ovarian cancer is associated with mutations in BRCA1, BRCA2. Based
on analysis of women who have a mutation in the BRCA1 gene, the lifetime risk is
about 40% of developing ovarian cancer and 60% in developing breast cancer. With
mutation in BRCA2, the lifetime risk in developing ovarian cancer and breast cancer
is 27% and 87%, respectively. DNA mismatch repair (MMR) genes, causing
widespread genomic instability have been demonstrated in individuals with human
nonpolyposis colon cancer (HNPCC). HNPCC is commonly characterized by an
increased risk for non-polyposis colorectal cancer, endometrial cancer and
endometriod ovarian cancer(Berchuck et al., 1996; De Palo et al., 1995; Franceschi,
1991; Frank, 1998).
There have also been reportable cases of ovarian cancer associated with Li-Fraumini
syndrome that occurs due to p53 mutations in the germ line(De Palo et al., 2002).
b) Sporadic ovarian cancer
Epidemiology data suggested the number of ovulatory cycles appear to have the
greatest impact on development of sporadic serous ovarian carcinoma. The risk is
also increased with low parity, infertility, early menarche and late

4

menopause(Cramer, 1983). Continual ovulation, uninterrupted by pregnancy, may
predispose women to develop ovarian cancer(Franceschi, 1991).
Other risk factors include: breastfeeding, fertility treatment, tubal ligation, hormone
replacement therapy (HRT), talc use, body mass index (BMI), ovarian cysts and
endometriosis, and smoking also have been shown to have impact on ovarian cancer.
Previous work done by the lab has shown that disregulation of mice estous cycle is
associated with ovarian cancer formation. Similarly, interruption of human menstrual
cycle activity decreases ovarian cancer risk. For example, the impact of Parity and
Oral contraceptive use on ovarian cancer risk is showing in Table 1. Fathalla
proposed the famous “incessant ovulation hypothesis” in 1971. Briefly, he
hypothesized that the repeated rupture followed by rapid proliferation to repair the
ovarian surface epithelium at the site of ruptured follicle as occurs with repetitious
ovulation during menstrual cycle provide an opportunity for spontaneous mutations
in tumor suppressor or proto-oncogenes that might contribute to oncogenesis.

5

Table 1: Influence of Parity and Oral Contraceptive Use on Ovarian Cancer
Risk

Cancer Precursors: Epidemiology, Detection, and Prevention; Springer 2001

6

Screening for ovarian cancer
Screening tests particular groups of people to find cancer early before clinically
obvious, when the chance of cure is highest. Due to the asymptomatic nature of
ovarian cancer, development of such a test would greatly benefit the survival of
ovarian cancer patient. The test must be accurate and reliable in picking up cancers
while it must not give false positive results in people who do not have cancer.
At the moment, there is no screening test reliable enough to use to look for ovarian
cancer in the general population. Blood test for CA125 has been used in conjunction
with transvaginal ultrasound as two main screening protocols to detect ovarian
cancer.
a) CA125 blood test
CA125 is known as a tumor marker for ovarian cancer. Women with active ovarian
cancer tend to have higher levels of CA125 in their blood(Bast et al., 1983;
Helzlsouer Kj, 1993). But there are some problems that make the test unsuitable for
use as a screening test on its own: Under certain physiological conditions like
pregnancy and menstruation, CA125 could have raised. And only about 85 out of
every 100 women with ovarian cancer have raised CA125. Only 23-50 out of every
100 women with stage 1 ovarian cancer have elevated CA125 preoperatively(Mann
et al., 1988). Clearly, CA125 level alone is not reliable and we need to have another
test that can reliably show who has ovarian cancer and who hasn't.

7

b) Transvaginal ultrasound
Trans-vaginal ultrasonography scanning can be used to visualize the size and texture
of the ovaries and it gives a better picture of the ovaries than an ultrasound over the
abdomen. However, the similar abnormal ultrasound features can also occur in
benign tumors or other pelvic diseases. For instance, it can be difficult to tell whether
there is a cancer on the ovary or just a harmless cyst.
In early stage of ovarian cancer, only 25-50% of the cases can be identified with this
test. Nevertheless, ultrasound is an effective means of identifying late stage ovarian
malignancies.
Histological types of ovarian cancer
Ovarian carcinoma is a broad term used for a wide range of neoplasms that originate
in the ovary. They can be further classified into 3 broad groups according to the most
probable tissue of origin: Germ Cell Tumors, Sex Cord–Stromal Cell Tumors and
Epithelial ovarian tumors. Among them, epithelial ovarian tumor is the most
prevalent type, account for more than 90% of all ovarian cancers. The median age
for diagnosis of epithelial ovarian cancer is between 60 and 65 years. A major
challenge to improving early detection of Epithelial ovarian cancer (EOC) is that it is
not a single disease entity, but instead comprises a heterogeneous group of tumors.
These tumors are classified according to their patterns of histological differentiation.
The most common histological subtype serous constitutes 50% of EOCs. The
prognosis for women with serous EOC is much poorer than for those with

8

endometrioid and mucinous tumors. Serous carcinomas are often high-grade and
bilateral, resemble the glandular epithelium lining the fallopian tube, and are more
frequently detected at an advanced stage. Endometrioid and mucinous tumors
constitute 15–20% and 10% of EOCs, respectively. Less common EOC subtypes
include clear-cell and transitionalcell (Brenner) tumors.
Challenges to the formulation of a theory about the exact site of epithelial
ovarian cancer
One of the problems with early detection of ovarian cancer is that the nature of the
pre-invasive lesion for these tumors is unknown, and the exact site of origin is
unknown. A better understanding of ovarian cancer origin will help us look into the
biology of ovarian epithelial tumors, understand the mechanisms of risk factors, and
choose appropriate normal controls in experimental studies. Dr. Dubeau has argued,
nearly a decade ago, that the currently favored hypothesis that ovarian tumors arise
from the mesothelial cell layer lining the ovarian surface should be revised(Dubeau,
1999). However, there are some challenges to the formulation of a theory about the
exact site of origin of ovarian epithelial tumors(Dubeau, 2008).

9

a) Morphological arguments:
Evidence that ovarian carcinomas are made up of cell types not present in normal
ovaries. The ovary is covered by coelomic epithelium, which is continuous with the
similar single layer of epithelium that covers all abdominal and pelvic surfaces.
Neither these cells, nor any of those present within the ovarian parenchyma proper,
resemble the cells present in ovarian epithelial tumors, hence the question of where
these tumors actually arise. Ovarian epithelial neoplasms are instead remarkably
similar to epithelial cells from extra-ovarian sites in the female reproductive tract.
Serous ovarian carcinomas, which are the most common subtypes of these tumors,
are morphologically identical to carcinomas of the fallopian tube. Endometrioid and
mucinous ovarian carcinomas, two other major subtypes, are identical to carcinomas
of the endometrium and endocervix respectively. Ovarian epithelial tumors are
histologically and clinically indistinguishable from such neoplasms arise outside the
ovary.
b) Embryological arguments:
The embryological notions once believed the cell layer lines the ovarian surface is
made up of pluripotent cells, which thought to give rise to all cell types found within
the adult ovarian cortex, including germ cells and follicular cells, are no longer valid
now. But the term “germinal epithelium” continues to be still used today. And it is
well established that germ cells do not form from the coelomic epithelium and
although the exact origin of ovarian follicular cells continues to be debated, there are

10

strong morphological, functional, and molecular arguments that they are of
mesonephric origin(Rodriguez and Dubeau, 2001).
Ovarian epithelial tumors are morphologically identical to tumors arising in fallopian
tubes, endometrium, or endocervix, which share a common embryological origin
notably unrelated to the development of the ovary. They are derived from
embryological structures called müllerian ducts (also called paramesonephric ducts),
which first develop as a pair medial to the mesonephric ducts early during fetal
development. Similar ducts do not develop in males because the male testes secrete a
hormone called müllerian inhibiting substance (MIS) and it prevents the ducts
formation(Josso et al., 2001). The two müllerian ducts eventually fuse in their distal
portion to become the upper third of the vagina, cervix, and body of the uterus. The
proximal segments of the müllerian ducts remain unfused and become the fallopian
tubes. The lower two thirds of the vagina develop from an invagination of the skin
that eventually connects to the müllerian ducts. The stratified epithelium that lines
the lower vagina eventually expands upward, pushing its boundary with müllerian
epithelium, which marks the transition between endo- and exo-cervix in mature
individuals. It is surprising that tumors currently regarded as of primary ovarian
origin would resemble tumors derived from various segments of the müllerian tract
in spite of the fact that the ovary is not embryologically related to this tract.

11

c) Molecular biological arguments:
The notion that ovarian epithelial tumors resemble tumors derived from these other
segments of the reproductive tract is not only based on morphological arguments.
Cheng et al. reported that serous, endometrioid, and mucinous ovarian carcinomas
expressed the same set of HOX genes as epithelial cells from normal fallopian tube,
endometrium, and endocervix respectively(Cheng et al., 2005). These results are
highly supportive of the idea that these different ovarian tumor subtypes originate in
müllerian epithelium as opposed to coelomic epithelium.
Current theories about the cell of origin of ovarian epithelial tumors
The idea that ovarian epithelial tumors arise from the portion of the coelomic
epithelium that lines the ovarian surface is still favored by many. Proponents of the
theory account for the müllerian appearance of ovarian tumors by stipulating that the
coelomic epithelium is not the direct precursor of ovarian tumors, but must first
change into müllerian-like epithelium through a process known as metaplasia.
The coelomic hypothesis implies that ovarian carcinomas are better differentiated
than the cells from which they originate. Dr. Dubeau has argued for many years that
tumors lesions that are currently classified to come from ovarian epithelial tumors do
not arise from the ovary itself, but from derivatives of the müllerian ducts(Dubeau,
1999). The fallopian tube is an obvious müllerian site from which some tumors
classified as primary ovarian could originate. However, an origin from fallopian tube
cannot account for all tumors currently diagnosed as ovarian carcinomas. Not all

12

ovarian carcinomas, including those of serous origin, involve the fallopian tubes. A
large proportion develops from cystic structures for which there are no normal
counterpart in fallopian tubes. Microscopic cancers within small serous intra-ovarian
cysts not connected to the fallopian tubes have been described, providing strong
arguments for the notion that not all serous ovarian carcinomas arise in the fallopian
tube(Scully, 1995). BRCA1 and BRCA2 mutation carriers who undergo prophylactic
salpingo-oophorectomy continue to be at risk for primary serous peritoneal
carcinomas(Finch et al., 2006; Levine et al., 2003; Olivier et al., 2004), which are
identical to serous ovarian or tubal carcinomas except for the fact they do not involve
any of these two organs.
The endocervix, endometrium, and fallopian tubes are not the only sites where
epithelial cells derived from the müllerian ducts are found in adults. Microscopic
structures lined by müllerian epithelium are extremely common in the para-tubal and
para-ovarian areas. They also frequently impinge on the ovarian medulla and can
even be seen within the deeper portions of the ovarian cortex. These structures have
been grouped under the name “secondary müllerian system”(Lauchlan, 1994). They
include endosalpingiosis, which is defined as small cystic structures filled with
serous fluid and lined by cells similar to those lining the fallopian tubes;
endometriosis, defined as endometrial-like glands often filled with bloody material
outside the endometrium, and endocervicosis, defined as small cysts filled with
mucin and lined by cells similar to those lining the endocervix. Thus, the various
components of the secondary müllerian system provide a source for all the various

13

cell types that are present in the major subtypes of ovarian epithelial tumors and the
fact that they can develop into large extra-ovarian cysts that are morphologically
indistinguishable from serous or mucinous ovarian cystadenomas or endometriomas
is well documented.
Animal Models of ovarian tumors
Animal models for human diseases that could accurately describe the biological and
molecular processes inherent to the development of the disease are very important
for understanding the disease and for the development of intervention strategies. The
general lack of understanding of the biology and genetics underlying precursor
lesions of ovarian cancer is an obstacle in creating mouse models for this disease
simply because it is hard to determine which genetic pathways to target.
The first major mouse model in ovarian cancer was developed by Orsulic and
colleagues(Orsulic et al., 2002). One or more oncogenes were systematically
introduced by retroviral vector into dispersed mouse ovarian cells that were either
p53+/+ or p53−/−. They found that a p53-null background in combination with at
least two oncogenes from among C-MYC, K-RAS, or AKT were required for
efficient tumor development in immune-compromised mice and in transformed
ovarian surface epithelial cells with p53 deficiency in combination with all the above
three oncogenes were able to produce tumors in immune-competent syngeneic mice
with longer latency.

14

Another major advance came from the studies of Flesken-Nikitin et al. They used an
adenoviral vector expressing cytomegalovirus-Cre recombinase under the ovarian
bursal sac of mice expressing conditional knockout of p53, Rb, or both. Although
only a few tumors were observed when either p53 or Rb was disrupted, depletion of
both the p53 and Rb genes significantly contributed to epithelial ovarian tumor
formation at 7 months old. Those tumors have various phenotypes, from serous to
poorly differentiated phenotypes, and many of the mice with tumors also developed
ascites and metastatic disease in the liver and lungs(Flesken-Nikitin et al., 2003).
Connolly et al reported the first successful genetically sporadic epithelial ovarian
cancer model in immunocompetent mice. The transgenic mice expressed SV40 were
put under the control of Mis2r promoter. Approximately 50% of the mice developed
poorly differentiated ovarian carcinomas with peritoneal dissemination, which is
similar to the features of human advanced epithelial ovarian cancer. However, the
exact origin of these tumors was not clear as Mis2r is also expressed in the granulosa
cells of the ovary(Connolly et al., 2003).
Pten/PI3K and Kras pathways have been reported previously play a role in high-
grade and low-grade serous adenocarcinomas. Recent studies showed in Pten/Kras
mutant mouse model, with Pten gene disrupted and an oncogenic form of KrasG12D
presence driven by Mis2r promoter using Cre-Loxp system. The resulting mice
developed low-grade, invasive serous adenocarcinomas with high penetrance at 2
month of age(Bast et al., 2009; Fan et al., 2009; Network, 2011).

15

Brca1 flox/flox; Fshr-Cre mouse model
Our lab has reported earlier that two thirds of mice carrying a conditional Brca1
mutation targeted to their ovarian granulosa cells develop epithelial tumors cancer in
their ovaries and uterine horns. Those cysts are similar to human ovarian serous
cystadenomas, which are the benign counterpart of the most common histological
subtype of epithelial ovarian cancer. Ovarian and/or uterine cysts develop in the
mutant mice when they reach 14-15 months. These tumors did not originate from
granulosa cells but instead they were epithelial in nature. Moreover, these tumor
cells contain wild type non-recombined Brca1 allele indicating the tumors were the
indirect results of Brca1 mutation.
We will utilize this model in my thesis work and the principal goal of the research is
to provide important clues that will help us understand the concepts of ovarian tumor
biology. The objectives of this research are as following:
• To find out the exact contribution of müllerian ducts and test our hypothesis
that ovarian epithelial tumors are of müllerian but not coelomic origin.
• To construct and characterize an animal model with P53 mutation
superimposed on Brca1 conditional knockout mice for ovarian tumors to
address key questions in ovarian cancer origin and tumorigenesis.
• To study predisposing mechanisms to ovarian tumor and the association with
estrous/menstrual cycle activity.

16

REFERENCES
Bast, R.C., Hennessy, B., and Mills, G.B. (2009). The biology of ovarian cancer:
new opportunities for translation. Nat Rev Cancer 9, 415-428.
Bast, R.C., Klug, T.L., John, E.S., Jenison, E., Niloff, J.M., Lazarus, H., Berkowitz,
R.S., Leavitt, T., Griffiths, C.T., Parker, L., et al. (1983). A Radioimmunoassay
Using a Monoclonal Antibody to Monitor the Course of Epithelial Ovarian Cancer.
New England Journal of Medicine 309, 883-887.
Berchuck, Cirisano, Lancaster, Schildkraut, Wiseman, Futreal, and Marks (1996).
Role of BRCA1 mutation screening in the management of familial ovarian cancer.
American Journal of Obstetrics and Gynecology 175, 738-746.
Cheng, W., Liu, J., Yoshida, H., Rosen, D., and Naora, H. (2005). Lineage infidelity
of epithelial ovarian cancers is controlled by HOX genes that specify regional
identity in the reproductive tract. Nat Med 11, 531-537.
Connolly, D.C., Bao, R., Nikitin, A.Y., Stephens, K.C., Poole, T.W., Hua, X., Harris,
S.S., Vanderhyden, B.C., and Hamilton, T.C. (2003). Female mice chimeric for
expression of the simian virus 40 TAg under control of the MISIIR promoter develop
epithelial ovarian cancer. Cancer Res 63, 1389-1397.
Cramer, D.W. (1983). Mumps, menarche, menopause, and ovarian cancer. American
journal of obstetrics and gynecology 147, 1-6.

17

De Palo, G., Mariani, L., Camerini, T., Marubini, E., Formelli, F., Pasini, B., Decensi,
A., and Veronesi, U. (2002). Effect of Fenretinide on Ovarian Carcinoma
Occurrence. Gynecologic Oncology 86, 24-27.
De Palo, G., Veronesi, U., Camerini, T., Formelli, F., Mascotti, G., Boni, C., Fosser,
V., Vecchio, M.D., Campa, T., Costa, A., et al. (1995). Can Fenretinide Protect
Women Against Ovarian Cancer? Journal of the National Cancer Institute 87, 146-
147.
Dubeau, L. (1999). The cell of origin of ovarian epithelial tumors and the ovarian
surface epithelium dogma: does the emperor have no clothes? Gynecol Oncol 72,
437-442.
Dubeau, L. (2008). The cell of origin of ovarian epithelial tumors. Lancet Oncol 9,
1191-1197.
Fan, H.Y., Liu, Z., Paquet, M., Wang, J., Lydon, J.P., DeMayo, F.J., and Richards,
J.S. (2009). Cell type-specific targeted mutations of Kras and Pten document
proliferation arrest in granulosa cells versus oncogenic insult to ovarian surface
epithelial cells. Cancer Res 69, 6463-6472.
Finch, A., Beiner, M., Lubinski, J., Lynch, H.T., Moller, P., Rosen, B., Murphy, J.,
Ghadirian, P., Friedman, E., Foulkes, W.D., et al. (2006). Salpingo-oophorectomy
and the risk of ovarian, fallopian tube, and peritoneal cancers in women with a
BRCA1 or BRCA2 Mutation. JAMA 296, 185-192.

18

Flesken-Nikitin, A., Choi, K.C., Eng, J.P., Shmidt, E.N., and Nikitin, A.Y. (2003).
Induction of carcinogenesis by concurrent inactivation of p53 and Rb1 in the mouse
ovarian surface epithelium. Cancer Res 63, 3459-3463.
Franceschi, S. (1991). Pooled analysis of 3 European case-control studies of
epithelial ovarian cancer: III. Oral contraceptive use. International journal of cancer
49, 61-65.
Frank, T.S. (1998). Sequence analysis of BRCA1 and BRCA2: correlation of
mutations with family history and ovarian cancer risk. Journal of clinical oncology
16, 2417-2425.
Helzlsouer Kj, B.T.L.A.A.J.B.K.Z.H.C.G.W. (1993). PRospective study of serum ca-
125 levels as markers of ovarian cancer. JAMA 269, 1123-1126.
Josso, N., di Clemente, N., and Gouédard, L. (2001). Anti-Müllerian hormone and its
receptors. Mol Cell Endocrinol 179, 25-32.
Lacey, J.J.V.M.P.J.L.J.H., and et al. (2002). Menopausal hormone replacement
therapy and risk of ovarian cancer. JAMA 288, 334-341.
Lauchlan, S.C. (1994). The secondary müllerian system revisited. Int J Gynecol
Pathol 13, 73-79.
Levine, D.A., Argenta, P.A., Yee, C.J., Marshall, D.S., Olvera, N., Bogomolniy, F.,
Rahaman, J.A., Robson, M.E., Offit, K., Barakat, R.R., et al. (2003). Fallopian tube

19

and primary peritoneal carcinomas associated with BRCA mutations. J Clin Oncol
21, 4222-4227.
Mann, W.J., Patsner, B., Cohen, H., and Loesch, M. (1988). Preoperative Serum CA-
125 Levels in Patients With Surgical Stage I Invasive Ovarian Adenocarcinoma.
Journal of the National Cancer Institute 80, 208-209.
Network, C.G.A.R. (2011). Integrated genomic analyses of ovarian carcinoma.
Nature 474, 609-615.
Olivier, R.I., van Beurden, M., Lubsen, M.A., Rookus, M.A., Mooij, T.M., van de
Vijver, M.J., and van't Veer, L.J. (2004). Clinical outcome of prophylactic
oophorectomy in BRCA1/BRCA2 mutation carriers and events during follow-up. Br
J Cancer 90, 1492-1497.
Orsulic, S., Li, Y., Soslow, R.A., Vitale-Cross, L.A., Gutkind, J.S., and Varmus, H.E.
(2002). Induction of ovarian cancer by defined multiple genetic changes in a mouse
model system. Cancer Cell 1, 53-62.
Parazzini, F. (1991). The epidemiology of ovarian cancer. Gynecologic Oncology 43,
15.
Risch, H.A., Marrett, L.D., and Howe, G.R. (1994). Parity, contraception, infertility,
and the risk of epithelial ovarian cancer. Am J Epidemiol 140, 585-597.
Rodriguez, M., and Dubeau, L. (2001). Ovarian tumor development: insights from
ovarian embryogenesis. Eur J Gynaecol Oncol 22, 175-183.

20

Scully, R.E. (1995). Pathology of ovarian cancer precursors. J Cell Biochem Suppl
23, 208-218.

21

Chapter 2
CONTRIBUTIONS OF THE MüLLERIAN DUCTS TO POTENTIAL SITES
OF ORIGIN OF OVARIAN SEROUS, ENDOMETRIOID, MUCINOUS, AND
CLEAR CELL TUMORS

22

ABSTRACT
We previously hypothesized that tumors traditionally classified as ovarian, tubal, or
primary peritoneal arise exclusively from extra uterine müllerian epithelium, defined
as fallopian tubes fimbriae, endosalpingiosis, endometriosis, and endocervicosis. We
used a combination of transgenic constructs where the Müllerian inhibiting substance
type 2 receptor (Mis2r) promoter drives expression of either b-galactosidase (Mis2r-
β–Gal) or Cre recombinase (Mis2r-Cre) to support our hypothesis from a
developmental viewpoint. The Mis2r-β–Gal line shows LacZ positivity in cells
where this promoter is currently active while the Mis2r-Cre line, when crossed with
the R26R
b-Gal
reporter line, shows LacZ positivity in cells derived from ancestors that
expressed this receptor at any time during development, even if the promoter is no
longer active.
We found no evidence of an embryological link between the müllerian ducts and
coelomic epithelium using these reporter mice. Although pre-ovulatory ovarian
follicles showed strong Mis2r promoter activity as evidenced by LacZ positivity in
the Mis2r-β–Gal line, this reflects acquisition of gene expression during follicular
development as opposed to embryological derivation from the müllerian ducts
because there was no evidence of LacZ positivity in Mis2r-Cre;R26R
b-Gal
fetal
ovaries. Evidence of such rearrangement could be demonstrated in this line in
epithelial structures outside the ovaries, uterus, and oviducts supporting the concept
of extra-uterine müllerian tissues. Another interesting observation was that a segment

23

of the renal tubules of female Mis2r-Cre; R26R
b-Gal
mice demonstrated Cre-mediated
rearrangement, indicating an embryological link between the müllerian ducts and
renal development. This is not only relevant to the understanding of gender specific
differences in normal and diseased kidney function, but also suggests that
mesonephric remnants, which are common in the paratubal and paraovarian regions,
should be regarded as components of extra uterine müllerian epithelium and this
structure may be the normal counterpart for clear cell ovarian carcinoma.

24

INTRODUCTION
Most of the internal female reproductive organs are derived from embryological
structures called Müllerian ducts, which first appear as 2 separate tubular structures
lateral to the mesonephros during the first trimester of pregnancy. Eventually, the
most distal segments of each Müllerian duct migrate toward the midline, where they
fuse, subsequently giving rise to the upper third of the vagina, cervix, and uterine
corpus. The more proximal segments remain unfused in human, giving rise to the
fallopian tubes. The extent of fusion varies among species. For example, the uterine
body consists of 2 separate uterine horns in rodents because fusion of the müllerian
ducts in this species is confined to the most distal portions.
Unlike the other internal female reproductive organs, the ovary is not derived from
the müllerian ducts. It is intriguing therefore that epithelial tumors that have been
traditionally regarded as of primary ovarian origin are morphologically identical to
tumors arising from organs derived from the müllerian ducts. Indeed, the most
common subtype of ovarian epithelial tumors are similar to either normal fallopian
tube epithelium if benign (ovarian serous cystadenomas) or, if malignant (ovarian
serous carcinomas), to tubal carcinomas. Similar arguments can be made for benign
and malignant mucinous ovarian tumors, which resemble normal and neoplastic
endocervical tissue, or endometrioid tumors, which resemble tumors arising from
endometrium. Another ovarian carcinoma subtype, clear cell carcinoma, has
currently no known normal counterpart in any of the reproductive organs.

25

The classical view, favored through most of the last century, is that ovarian epithelial
tumors are derived from the ovarian coelomic epithelium. This theory accounts for
the resemblance of these tumors to tissues derived from the müllerian ducts by
stipulating that the coelomic epithelium first changes its differentiation lineage from
mesothelial to müllerian through a process called müllerian metaplasia before
undergoing malignant transformation. We argued that ovarian epithelial tumors
instead develop exclusively in tissues derived from the müllerian ducts and
suggested recently that the term extra-uterine müllerian cystadenomas or carcinomas
would be a more accurate nomenclature for these tumors (Dubeau, 1999, 2008).
The finding of early serous carcinomas in the fallopian tube fimbriae of patients
undergoing prophylactic surgical procedures due to familial ovarian cancer
predisposition led to the more recent concept that serous ovarian carcinomas
originate primarily from the fallopian tube (Crum et al., 2007). Most authors still
favor the view that serous carcinomas arise from 2 distinct sites, fallopian tube
fimbriae and coelomic epithelium and, in part because of the irrefutable fact that
benign ovarian epithelial tumors (cystadenomas) can be confined to the ovary, argue
that low grade serous carcinoms most often originate in the coelomic epithelium. In
addition, the coelomic epithelium remains a strong candidate for the origin of other
ovarian carcinoma subtypes. A favored argument is that the müllerian ducts develop
through invagination of the peritoneal coelomic epithelium and are thus
embryologically related to this epithelium. This notion, however, has been
challenged in light of recent evidence suggesting that the müllerian ducts are instead

26

formed from an epithelial anlage near the anterior aspect of the mesonephros, from
where they expand caudally (Guioli et al., 2007; Orvis and Behringer, 2007). Not
only is the origin of ovarian surface epithelium controversial, questions regarding the
development of follicular cells within the ovary and their relationship with the
müllerian ducts also needs to be elucidated.
In this study, we will be focusing on two specific aims:
AIM1: To trace the fate of the müllerian ducts in female reproductive organs
AIM2: To test the hypothesis that ovarian epithelial tumors are of müllerian origin
rather than coelomic origin, and these two structures are not embryological related.
Our data provided evidence that ovarian surface epithelium is not embryologically
related to the müllerian ducts. However, we did provide a novel embryological
relationship between the müllerian duct and kidney collecting duct system, which
might ready to explain some of the confounding clinical observations: unilateral
renal aplasia are often associated with absence of fallopian tube on the same side; the
similarities between the kidney clear cell tumor and one of the counterpart in the
ovary-the clear cell subtype of ovarian epithelial tumor.

27

MATERIALS AND METHODS
Generation and characterization of transgenic mice
We used a 1.2kb fragment of the Mis2r promoter provided by Dr. Connolly, Fox
Chase Cancer Center (Connolly et al., 2003), that we placed upstream of either a
1.2kb fragment of the LacZ gene or a 1.1kb Cre recombinase gene fragment,
followed by a 2.1 kb SV40 polyA tail. For the Mis2r-LacZ construct, a 0.9kb
fragment of the hsp68 minimal promotor (Kothary et al., 1989) was also placed
downstream of the Mis2r promoter in a Bluescript KS vector backbone (Brugger et
al., 2004). The linear purified construct was injected into the pronulei of fertilized
oocytes of B6D2F1 animals and the injected embryos were transferred into
pseudopregnant mice according to standard protocols. Pups were analyzed for the
presence of the transgene by PCR amplification of tail DNA using the following
primers: Cre Forward: CTCTGGTGTAGCTGATGATC; Cre Reverse:
TAATCGCCATCTTCCAGCAG. Mis2r Forward:
ACAGAGACCGGGATAGGACAGA; LacZ Reverse:
CAAACGGCGGATTGACCGTA. Founder mice were backcrossed with B6 animals
to generate transgenic lines. Two independent transgenic lines were generated using
each construct. Mis2r-Cre transgenic mice were crossed with the R26R reporter line,
which carries a LacZ gene whose expression requires excision of loxP-flanked stop
sequences (Soriano, 1999). Signal to noise ratio and tissue specific expression were
evaluated and compared in the various lines. The one with the highest level of tissue

28

specific transgene expression was selected. Distribution of promotor activity was
similar in transgenic lines generated independently from the same transgenic
constructs.
Cre-Mediated Recombination Analysis
Demonstration of LacZ recombination was achieved first by enzymatic amplification
of DNA from the organs of interest using 5’-AAAGTCGCTCTGAGTTGTTAT-3’
and 5’-CAAACGGCGGATTGACCGTA-3’ as forward and reverse primers
respectively, followed by re-amplification with 5’-
AGTAAGGGAGCTGCAGTGGAGTA-3’ and 5’-
ATGGGATAGGTTACGTTGGTGTAGAT-3’ as nested forward and reverse
primers. Forward and reverse primers for detection of the unrearranged sequence
were 5’- TTGCGCAGCTGTGCTCGACG-3’ and 5’-
AAGGCGATGCGCTGCGAATC-3’.
Colorimetric β-Galactosidase assay
Tissue samples were fixed in cold 4% paraformaldehyde, washed with cold
phosphate buffered saline, dehydrated in 30% sucrose. Ten micron cryostat sections
were fixed in cold 0.2% glutaraldehyde. The sections were washed with cold
phosphate buffered saline, preincubated in the same buffer containing 2mM
magnesium chloride, 0.01% sodium deoxycholate, 0.02% Nonidet P-40 for 10 mins,
and incubated overnight at 37°C in 5mM K
3
Fe(CN)
6
, 5mM K
4
Fe(CN)
6
, 2mM MgCl
2
,
0.01% sodium deoxycholate, 0.02% Nonidet P-40, 1mg/ml X-gal (Sigma) in PBS

29

[pH 7.4]). The sections were postfixed in 4% paraformaldehyde and counter stained
with Nuclear Fast Red (Sigma).
Fluorescence imaging
Mis2r-Cre mice were crossed with R26R
GFP
mice. Newborn transgenic animals
harbored Mis2r-Cre; R26R
GFP
alleles were prepared for cryostat sections. Sections
were washed briefly with 1XPBS and fixed with 4% paraformaldehyde (PFA) for 15
minutes before applying the cover slip. GFP fluorescence in renal tissue sections was
visualized with a Leica DMI 6000 inverted microscope and a 63X glycerol
immersion objective (NA 1.4) and imaged using a Leica TCS SP5 AOBS confocal
fluorescence imaging system powered by a Chameleon Ultra-II MP laser (Coherent
Inc.) or a 488 nm Ar laser (Leica Microsystems). Fluorescence excitation and
detector settings were the same for imaging transgenic and wild type tissue sections.
Laser Capture Microdissection
We used a PIXCELL II Instrument purchased from Arcturus BioScience Inc.,
Mountain View, California.

30

RESULTS
In this study, we make two transgenic mouse models: Mis2r-Cre and Mis2r-β–Gal to
differentiate tissues expressed Mis2r earlier during development from those currently
expressing this receptor. The Mis2r is active in the müllerian ducts, but does not
necessarily continue to be active in adult tissues derived from such ducts. In addition,
demonstration of Mis2r promoter activity in any given tissue does not necessarily
imply an embryological link to the müllerian ducts because such activity may also be
acquired later during development. We used the strategy outlined in Table 1, based
on transgenic constructs harboring 2 different reporter genes, to help distinguishing
between these possibilities. The β-galactosidase enzyme is encoded by the LacZ
gene sequence. An active β-galactosidase enzyme is only present in cells in which
the Mis2r promoter is currently active in mice carrying the Mis2r-LacZ transgene.
The Mis2r promoter in the Mis2r-Cre; R26R
LacZ
mouse line controls the Cre
recombinase enzyme. LacZ is present downstream to the constitutively active ROSA
26 promoter and contains an insert with a stop codon. The insert can be deleted by
Cre-mediated recombination. Once such recombination has taken place in any given
cell, not only does it persist in the same cell even if Cre is no longer expressed, but it
is also transmitted to daughter cells, which continue to express a functional β-
galactosidase in all future generations. Having these mouse models in hand, we are
going to answer key questions regarding the exact contribution of the müllerian ducts
and cell of origin of ovarian cancer.

31

Table 1. Strategy for distinguishing between current and past Mis2r promoter
activity based on outcome of b-galactosidase (b-Gal) colorimetric assay

Mis2r Promoter
Activity status
Promoter
was never
active

Promoter is currently
active

Promoter used
to be, but is no
longer active
Transgene #1:
Mis2r- LacZ

Transgene #2:
Mis2r-Cre;R26R
LacZ

b-Gal
negative

b-Gal
negative

b-Gal positive

b-Gal positive

b-Gal negative

b-Gal positive

32

Validation of transgenic vectors
The first thing we sought to verify our ability to document Mis2r promoter activity in
organs known to be derived from the müllerian ducts in order to assess the
authenticity of our transgenic constructs. Strong b-galactosidase activity is shown in
both uterine horns (arrows) of Mis2r-LacZ mice in Fig. 1A. A close up view of a
cross section of a uterine horn showing such activity in the endometrium is shown in
Fig. 1B while a cross section of the cervical-vaginal junction showing b-
galactosidase activity in vaginal epithelium and adjacent uterine horns is shown in
Fig. 1C. In contrast, the uterus of a non-trangenic female littermate control (Fig. 1D)
stained negative for b-galactosidase. Oviducts, the equivalent of the human fallopian
tubes in mice, were positive (not shown). Similarly, 2 month old female Mis2r-Cre;
R26R mice were stained for beta-galactosidase in order to evaluate intensity and
distribution of promoter activity. The results (Fig. 2) confirmed the presence of
diffuse promoter activity along the uterine horns and in the oviducts in transgenic
females.

33

Figure 1: Distribution of Mis2r promoter Activity in Reproductive Organs
Known to be Derived from the Müllerian Ducts in Mis2r-LacZ transgenic mice.
Reproductive organs from 2-month old Mis2r-LacZ transgenic mice and littermate
controls were stained for b-galactosidase, resulting in either green of blue reaction
products. (A): Uterine horns (arrows) with attached ovaries from a transgenic animal.
(B): Cross-section of uterine horns from the specimen shown in A. (C): Cross-
section upper part of vagina with attached segments of both uterine horns of a
transgenic animal. (D): Segment of a uterine horn with attached ovary (arrow) from a
non-transgenic control. Scale bars: 1 mm

A
D
C
B

34

Figure 2: Tissue Specific Distribution of Mis2r promoter in Mis2r-Cre;R26R
LacZ

transgenic mice. A transgenic mouse line harboring the Mis2r-Cre transgene was
crossed with the R26R reporter line. Transgenic offspring and littermate controls
were sacrificed when they reached 2 months old. The reproductive organs were
stained for LacZ. (A) Transgenic uterine horn with attached upper vaginal wall
stained for LacZ. (B) Uterus from a non-transgenic littermate control stained for
LacZ. Histological section of (C) endometrial glands and stroma and of (D) oviducts
from transgenic animals are stained for LacZ and counterstained with nuclear fast
red. Scale bars: 1 mm in A and B, 50 µm in C and D.

A
B
C
D

35

Is the ovarian surface epithelium embryologically related to the müllerian ducts?

To answer that question, we did b-galactosidase activity in Mis2r-Cre;R26R
LacZ

mice, ovarian (Fig. 3A and 3B, thin arrows) and extra-ovarian (not shown) coelomic
epithelium clearly showed no evidence of b-galactosidase.
The absence of detectable b-Galactosidase in the ovarian surface epithelium
contrasts sharply with the strong positivity seen in pre-ovulatory ovarian follicles in
Mis2r-Cre;R26R
LacZ
mice (thick arrows in Figs 3A and 3B). Such enzyme activity
was also detected in Mis2r-LacZ mice (not shown), indicating that the Mis2r
promoter is active during follicular development as previously reported in other
laboratories (Baarends et al., 1995).

36

Figure 3: Distribution of Mis2r promoter activity in ovarian and peri-ovarian
tissues. Gross (A) and microscopic (B) photographs of ovaries from two 2-month-
old Mis2r-Cre transgenic mice crossed with the R26RLacZ reporter strain and
stained for b-Galactosidase activity. Thick arrows indicate Galactosidase positive
pre-ovulatory ovarian follicles while thin arrows indicate Galactosidase negative
ovarian surface mesothelium. C: Histological photograph of an ovary and adjacent
uterine horn from a 3 days old Mis2r-Cre; R26RLacZ mouse stained with
hematoxylin and eosin. Short arrow: uterine horn; long arrow: ovary; the area within
the rectangle contains extra-ovarian Müllerian-like structures and is enlarged in D.
Scale bars: 200 µm.
ovid
uct
ova
ry
C

D

A
B

37

We considered the possibility that absence of detectable activity was due to low
sensitivity of our detection method because of possible diffusion of the reaction
products outside this single cell layer. We microdissected this epithelium in Mis2r-
Cre; R26R
LacZ
and used PCR-based approaches to document the presence or absence
of rearrangement of the LacZ locus. No Cre mediated genomic DNA rearrangement
was detectable in the coelomic epithelium of newborn female mice, although such a
sequence was readily amplifiable from the uterus of the same animals (Fig. 4A).
Primordial follicular cells showed no detectable b-Galactosidase activity in either
transgenic line, but Cre-mediated excision of the stop sequence in Mis2r-
Cre;R26R
LacZ
was demonstrated using the appropriate PCR primers in
microdissected ovarian cortex as early as 3 days after birth (Fig. 4B). However, no
rearranged allele was detectable in ovaries of mice harvested 2 days before birth
(E18.5), indicating that neither primordial follicular cells, which are abundant at that
age, nor any other cell type within ovarian cortex, are derived from the müllerian
ducts (Fig. 4B). The uterus of the same mouse, which was used as positive control,
showed a strong signal for the rearrangement. We conclude that the strong promoter
activity seen in adult ovarian follicles is acquired early as primordial follicles mature
into primary follicles, but does not reflect a müllerian origin.

38

Are tissues surrounded by ovary and uterus, referred to as “extra-uterine
Müllerian tissues” derived from müllerian ducts?
We recently proposed that all tumors traditionally classified as ovarian, tubal, or
primary peritoneal arise from a single tissue source, which we called extra-uterine
müllerian tissues (Dubeau, 2008). Extra-ovarian tubular structures compatible with
extra-ovarian müllerian epithelium are shown near the ovarian hilum in Fig 3C and
magnified in Fig. 3D. Such structures were microdissected from Mis2r-Cre;R26R
LacZ

mice and subjected to enzymatic amplification using primers specific for Cre-
mediated rearrangement. The results confirmed the presence of such rearrangement
in strong support of a müllerian origin (Fig. 4A).

39

Figure 4: Evaluation of Cre-mediated rearrangement by PCR in ovarian and
peri-ovarian tissues. A: Genomic DNA samples from tissues of interest were
extracted from Mis2r-Cre; R26R
LacZ
reporter mice either 2 month old (A) or peri-
natal (B) using PCR primers specific for either the rearranged or unrearranged Beta-
galactosidase sequence. The PCR products were electrophoresed on 1% agarose gels
containing ethidium bromide and visualized under UV.

40

Are any portions of the coelomic epithelium that are embryologically related to
the müllerian ducts?

After carefully examining any b-Galactosidase positivity in coelomic epithelium in
Mis2r-Cre; R26R
LacZ
mice, none could be identified. And actrually the Mis2r showed
restricted activity in reproductive organs and some adjacent tissues during
development as well as in mature animals activity. A notable exception was the
finding of strong activity in a portion of the renal cortex near the cortico-medullary
junction in transgenic female mice (Fig. 5A). Male transgenic littermates showed
very little, if any, detectable b-Galactosidase activity in the same organ (Fig. 5A).
Such activity was likewise undetectable in male and female Mis2r-LacZ mice (not
shown).
We used 2 independent approaches to confirm that Mis2r-driven, Cre-mediated
rearrangement had indeed occurred in the kidney of transgenic female animals. The
first was to cross Mis2r-Cre transgenic mice with a R26R line similar to the one
described in Table 1 except for replacement of the sequence encoding b-
Galactosidase with one encoding Green fluorescence protein (GFP). Cre expression
in this reporter mouse results in green fluorescence emission due to excision of a
floxed stop codon (Belteki et al., 2005). Kidneys of Mis2r-Cre; R26R
GFP
showed
strong fluorescence emission with a distribution mimicking that of b-Galactosidase
expression in female Mis2r-Cre; R26R
LacZ
mice (Fig. 4B). Weak fluorescence was

41

also detected in male transgenic littermates, but the intensity was substantially
weaker in this gender (Fig. 5B).

42

Figure 5: Evidence that a segment of the renal collecting system is
embryologically derived from the müllerian ducts. (A): Pelvic and lower
abdominal tissues from male and female newborn R26R
LacZ
reporter mice that either
carried or did not carry the Mis2r-Cre transgene were exenterated and embedded as
whole mounts, sectioned with a microtome, subjected to the LacZ staining protocol,
A
B
Male transgenic
Female wild type Male wild type
Female transgenic
Female transgenic Male transgenic
Female wild type Male wild type

43

and examined by light microscopy after counter staining with Nuclear Fast Red. (B):
Similar experiment as shown in (A) except that R26R
GFP
reporter mice were used
instead of R26R
LacZ
and the renal histological sections were examined under a
fluorescence microscope instead of a light microscope. Scale bar: 500 µm

44

Microdissection of renal tissues from newborn female Mis2r-Cre; R26R
LacZ
mice
followed by PCR analyses using primers specific for the rearranged and
unrearranged LacZ sequence provided an additional independent confirmation of
Cre-mediated rearrangement (Fig. 6). A weak signal demonstrating such
rearrangement was occasionally seen in rare male transgenic littermates (not shown)
consistent with the weak fluorescence signal seen in male transgenic kidney shown
in Fig. 5B.

45

Figure 6: PCR-based evidence of Mis2r-Cre-mediated rearrangement in renal
tissues. DNA was extracted from the kidneys of newborn Mis2r-Cre; R26R
LacZ

transgenic mice and from littermates lacking the Mis2r-Cre transgene. DNA
extracted from the uterus of Mis2r-Cre; R26R
LacZ
mice was used as positive control.
The presence or absence of rearrangement of the b-Galactosidase gene was
documented by enzymatic amplification with the same primers used in Fig. 3
followed by electrophoresis on 1% agarose gels containing ethidium bromide and
visualization of the PCR products under UV.

46

DISCUSSION
The morbidity and mortality of ovarian carcinoma is poor partly due to lack of
understanding of the origin of ovarian tumors. A long-standing argument in our
laboratory has been that those tumors arise from tissues that are embryological
derived from the müllerian ducts, whereas the currently favored view is that they
arise in the layer of coelomic epithelium that covers the ovarian surface. Proponents
of the coelomic epithelium hypothesis argue that müllerian ducts come from the
invagination of coelomic epithelium. Our results showed no evidence of past or
present müllerian differentiation in the ovarian and extra-ovarian coelomic
epithelium. The finding of such differentiation in coelomic epithelium using our
reporter mouse lines would have provided strong support for the widely held notion
that this epithelium is predisposed to undergo müllerian metaplasia in humans, which
in turn predisposes to cancer development.
In the current study of the exact contribution of the müllerian ducts, we can draw the
following conclusions: (1) ovarian stromal cells are not derived from the müllerian
ducts in spite of the fact that they express mis2r in pre-ovulatory follicles; (2) exra-
uterine tubular structures consistent with endosalpingiosis show müllerian
differentiation and are therefore most likely derived from the müllerian ducts; (3) a
segment of the collecting system of the adult kidney is embryologically linked to the
müllerian duct.

47

The question of whether or not the ovarian stroma harbors cells derived from the
müllerian ducts is relevant to the issue of the origin of ovarian epithelial tumors
because such derivation could account for the well-documented existence of intra-
ovarian müllerian cysts (often referred to as metaplastic cysts) in adult human
ovaries, which in turn could be precursors for carcinomas. However, no evidence of
past Mis2r promoter activity could be detected in cells dissected from the ovarian
cortex of E18.5 fetuses, ruling out a direct embryological link between the müllerian
ducts and ovarian follicles. The fact that activity of this promoter was detected in the
ovaries of mice as early as 3 days after birth is compatible with earlier reports that
some follicular cell differentiation beyond the stage of primordial follicles takes
place early after birth in mice (Lei et al., 2010).
Our laboratory has argued that tumors historically classified as of primary ovarian
origin arise exclusively from cells derived from the müllerian ducts. This led us to
propose term “extra uterine müllerian epithelium” as a unifying nomenclature for
ovarian, fimbrial, and primary peritoneal tumors (Dubeau, 2008). Our results show
that indeed, peri-ovarian microscopic structures can be identified that show
molecular biological evidence of an embryological link with the müllerian ducts. The
existence müllerian structures in the vicinity of the ovary such as in the ovarian
hilum may account for the not uncommon presence of benign müllerian epithelial
cysts within and outside the ovaries of adult women.

48

Müllerian ducts start forming at E11.75 at close to mesonephros and then extend
caudally of its own accord, by E13.5 they are completely formed and reach the
urogenital sinus. We also sought to look for any developmental link between
müllerian ducts and tissues outside reproductive organs. And that led to the
unexpected finding that a segment of the renal tubules, more specifically tubules
located in the deep cortical area, show evidence of past Mis2r activity. The finding
of strong gender-specific LacZ positivity in female Mis2r-Cre; R26R
LacZ
mice
strongly suggests that a portion of the renal tubular system development is
embryologically linked to the müllerian ducts. Our data may suggest a novel origin
of the müllerian ducts, however further investigation to unravel the molecular events
responsible for this phenomenon are needed and may shed light on new mechanisms
that control gene expression in cell fate changing.
Although this is the first demonstration of a direct link between renal and müllerian
development to our knowledge, this finding is also supported by the observation that
congenital disorders associated with unilateral renal aplasia are often associated with
absence of fallopian tube on the same side and unicornus uterus on the other side
(Grunwald, 1941). The presence of a developmental, embryological link between the
müllerian ducts and renal tubules may help explain gender differences in kidney
function in health and disease, which is a topic of great current interest in renal
(patho)physiology (Reckelhoff and Maric, 2010). Future work will likely explore
further details of this developmental link between organs of the female reproductive
system and the kidney.

49

The notion that the müllerian ducts and metanephric tubules are embryologically
related also has implications regarding the origin of a subtype of ovarian epithelial
tumors for which a normal müllerian counterpart has been difficult to assign, clear
cell tumors.
Clear cell renal cell carcinoma is a distinct subtype of renal cell carcinoma,
originating from the lining of the proximal convoluted and is morphologically
similar to ovarian clear cell carcinoma. Other major histological subtypes of ovarian
carcinomas can be readily associated with an extra uterine müllerian epithelial
structure of a similar differentiation lineage. For example, the epithelial lining of
fimbriae and of endosalpingiosis is similar to that of serous tumors while the lining
of endometriosis and endocervicosis resembles that of endometrioid and mucinous
tumors respectively. A normal extra uterine müllerian epithelial counterpart for clear
cell tumors, however, has so far not been identified.
Ovarian clear cell carcinomas not only show morphological resemblances to clear
cell carcinomas of the kidneys, but also their expression profile has been reported as
similar (Zorn et al., 2005). They also show some similarities in their response to
chemotherapy, as ovarian clear cell carcinomas that show poor response to regimens
based on platinum and taxane compounds may respond to sunitinib, a drug
commonly used for the treatment of clear cell carcinoma of the kidney (Anglesio et
al., 2011). The adult (metanephros) and fetal (mesonephros) kidneys are both derived
from the pronephric duct (Pietila and Vainio, 2005; Pole et al., 2002). In addition, the

50

mesonephric ureteric bud is a driver of metanephros development (Sainio et al.,
1997). Thus, the mesonephros and metanephros are embryologically linked.
Different signaling molecules and transcription factors, such as Lim, Pax2, and WT1,
are important regulators of both renal and müllerian duct development (Grote et al.,
2006; Mueller, 1994; Orvis and Behringer, 2007; Torres et al., 1995), providing
further evidence for a link between these 2 organs. We propose, based on this
evidence and on the results presented in the current study, that mesonephric remnants,
which are abundant in the para-ovarian and para-tubal areas, should be regarded as
integral components of extra uterine müllerian epithelium and that they may play a
role in the histogenesis of clear cell carcinomas.

51

REFERENCES
Anglesio, M.S., George, J., Kulbe, H., Friedlander, M., Rischin, D., Lemech, C.,
Power, J., Coward, J., Cowin, P.A., House, C.M., et al. (2011). IL6-STAT3-HIF
signaling and therapeutic response to the angiogenesis inhibitor sunitinib in ovarian
clear cell cancer. Clin Cancer Res 17, 2538-2548.
Baarends, W.M., Uilenbroek, J.T., Kramer, P., Hoogerbrugge, J.W., van Leeuwen,
E.C., Themmen, A.P., and Grootegoed, J.A. (1995). Anti-müllerian hormone and
anti-müllerian hormone type II receptor messenger ribonucleic acid expression in rat
ovaries during postnatal development, the estrous cycle, and gonadotropin-induced
follicle growth. Endocrinology 136, 4951-4962.
Belteki, G., Haigh, J., Kabacs, N., Haigh, K., Sison, K., Costantini, F., Whitsett, J.,
Quaggin, S.E., and Nagy, A. (2005). Conditional and inducible transgene expression
in mice through the combinatorial use of Cre-mediated recombination and
tetracycline induction Nucleic Acids Res 33, e51.
Brugger, S.M., Merrill, A.E., Torres-Vazquez, J., Wu, N., Ting, M.C., Cho, J.Y.,
Dobias, S.L., Yi, S.E., Lyons, K., Bell, J.R., et al. (2004). A phylogenetically
conserved cis-regulatory module in the Msx2 promoter is sufficient for BMP-
dependent transcription in murine and Drosophila embryos. Development 131, 5153-
5165.

52

Connolly, D.C., Bao, R., Nikitin, A.Y., Stephens, K.C., Poole, T.W., Hua, X., Harris,
S.S., Vanderhyden, B.C., and Hamilton, T.C. (2003). Female mice chimeric for
expression of the simian virus 40 TAg under control of the MISIIR promoter develop
epithelial ovarian cancer. Cancer Res 63, 1389-1397.
Crum, C.P., Drapkin, R., Miron, A., Ince, T.A., Muto, M., Kindelberger, D.W., and
Lee, Y. (2007). The distal fallopian tube: a new model for pelvic serous
carcinogenesis. Opinion Obstet Gynecol 19, 3-9.
Dubeau, L. (1999). The cell of origin of ovarian epithelial tumors and the ovarian
surface epithelium dogma: does the emperor have no clothes? Gynecol Oncol 72,
437-442.
Dubeau, L. (2008). The cell of origin of ovarian epithelial tumors. Lancet Oncol 9,
1191-1197.
Grote, D., Souabni, A., Busslinger, M., and Bouchard, M. (2006). Pax 2/8-regulated
Gata 3 expression is necessary for morphogenesis and guidance of the nephric duct
in the developing kidney. Development 133, 53-61.
Grunwald, P. (1941). The relation of the growing mullerian duct to the wolffian duct
and its importance for the genesis of malformations. Anat Rec 81, 1-19.
Guioli, S., Sekido, R., and Lovell-Badge, R. (2007). The origin of the Mullerian duct
in chick and mouse. Dev Biol 302, 389-398.

53

Kothary, R., Clapoff, S., Darling, S., Perry, M.D., Moran, L.A., and Rossant, J.
(1989). Inducible expression of an hsp68-lacZ hybrid gene in transgenic mice.
Development 105, 707-714.
Lei, L., Jin, S., Mayo, K.E., and Woodruff, T.K. (2010). The interactions between
the stimulatory effect of follicle-stimulating hormone and the inhibitory effect of
estrogen on mouse primordial folliculogenesis. Biol Reprod 82, 13-22.
Mueller, R.F. (1994). The Denys-Drash syndrome. J Med Genet 31, 471-477.
Orvis, G.D., and Behringer, R.R. (2007). Cellular mechanisms of Mullerian duct
formation in the mouse. Dev Biol 306, 493-504.
Pietila, I., and Vainio, S. (2005). The embryonic aorta-gonad-mesonephros region as
a generator of haematopoietic stem cells. APMIS 113, 804-812.
Pole, R.J., Qi, B.Q., and Beasley, S.W. (2002). Patterns of apoptosis during
degeneration of the pronephros and mesonephros. J Urol 167, 269-271.
Reckelhoff, J.F., and Maric, C. (2010). Sex and gender differences in
cardiovascular–renal physiology and pathophysiology. Steroids 75, 745-746.
Sainio, K., Hellstedt, P., Kreidberg, J.A., Saxen, L., and Sariola, H. (1997).
Differential regulation of two sets of mesonephric tubules by WT-1. Development
124, 1293-1299.

54

Soriano, P. (1999). Generalized lacZ expression with the ROSA26 Cre reporter
strain. Nat Genet 21, 70-71.
Torres, M., Gomez-Pardo, E., Dressler, G.R., and Gruss, P. (1995). Pax-2 controls
multiple steps of urogenital development. Development 121, 4057-4065.
Zorn, K.K., Bonome, T., Gangi, L., Chandramouli, G.V., Awtrey, C.S., Gardner,
G.J., Barrett, J.C., Boyd, J., and Birrer, M.J. (2005). Gene expression profiles of
serous, endometrioid, and clear cell subtypes of ovarian and endometrial cancer. Clin
Cancer Res 11, 6422-6430.

55

Chapter 3
TUMOR PREDISPOSITION IN THE Mis2r-Cre; Fshr-Cre; Brca1 flox/flox;
P53 flox/flox MOUSE MODEL

56

ABSTRACT
We have published the Fshr-Cre; Brca1 flox/flox mouse model previously. Ovarian
and/or uterine cysts develop in about two thirds of the mutant mice by the time they
reach 14-15 months. The morphological appearance of all cysts is strongly
suggestive of an epithelial nature, which we confirmed using immunohistochemical
stains for epithelial cell markers such as cytokeratin(Chodankar et al., 2005). We
propose to introduce further genetic alterations in our mouse model based on
inactivation of Brca1 in ovarian granulosa cells in order to increase the malignant
potential of the lesions.
Majority of breast and ovarian cancer in humans BRCA1 carriers have p53
mutation(Schuyer and Berns, 1999; Smith et al., 1992). Studies have also shown
that Brca1 associates with p53 and stimulates transcription in both a p53-
dependant and a p53-independent manner(Chai et al., 1999; Ouchi et al., 1998).
In order to test the hypothesis that the introduction of p53 mutation will promote the
cystic lesions in our Brca1 knockout mouse models to malignant transformation, we
created double mutants animals Mis2r-Cre; p53 flox/flox; Fshr-cre; Brca1 flox/flox,
that carry Brca1 and p53 mutations in granulosa cells and mullerian tissues.
Our preliminary data have shown that 60% of 18 mice harboring double mutants

developed epithelial tumors at the age of 8 month to 14 month, and most of them
were limited in the flank area, tending to overlay the mammary glands, without
visible abnormalities in the reproductive organs. In comparison, none of the wide

57

type mice developed visible tumors in the same observation time. Microscopy
examination revealed abundant malignant cells forming glandular structures
surrounding the tumor tissue and the tumors were confirmed by
immunohistochemistry that they are epithelial in nature. DNA extracted from tumors
suggested the presence of Cre-mediated recombination of p53 and Brca1 genes.
Although no visible abnormalities in the reproductive organs were found in our
mouse model, the location of the tumors made mammary glands an appealing site for
the origin of these tumors. This model, will give us insights into the role of the
mullerian tract in BRCA1-induced tumorigenesis as well as providing us with a tool
to investigate how the estrus/menstrual cycle predispose to tumor development.

58

BACKGROUND
In order to find the exact origin of ovarian cancer, our lab has been working on
establishing an ovarian cancer mouse model and studying the underlying
predisposing mechanisms:
Tumor predisposition in the Brca1 flox/flox; Fshr-Cre mouse model. This model
carries a Brca1 gene knock out in ovarian granulosa cells specifically, develops
benign epithelial cysts similar to human cystadenomas in the hilar region of the
ovary as well as in the uterine horns(Chodankar et al., 2005). Unpublished data from
the lab also suggested that the ductal structure in mutant animal breast are dilated,
and some of the mice developed epithelial cysts similar to human fibrocystic disease.
Malignant potential of tumors in Brca1-/-; p53-/- double mutant mice. The
lesions observed in our Brca1 flox/flox; Fshr-Cre mouse model have been invariably
benign. Several studies suggest p53 are associated with progression of benign
ovarian epithelial cysts to malignant tumors in the general human population. In
order to test for a cooperative interaction between p53 and Brca1 in ovarian
tumorigenesis, we proposed to generate Brca1 and p53 double knockout mice.
Previous lab members tried crossing Brca1 flox/flox; Fshr-Cre mice with mice
carrying a knock out of p53 in order to increase the malignant potential of the
epithelial lesions. Two out of ten double mutant mice developed more aggressive
ovarian tumors. Both tumors developed in mice that were about 1 year old without
metastasis. However, most of the mice carrying a p53 knock out develop lymphomas

59

or sarcomas before 1 year old, which is the age at which the cystic lesions in Brca1
flox/flox; Fshr-Cre mice are first seen.
Superimpose p53 and Brca1 gene knockouts targeted specifically to mullerian
tract on the Brca1 mutation already present in Fshr-Cre; Brca1 flox/flox mice
We designed experiments to test our hypothesis that serous tumors currently
categorized as ovarian, fimbrial, or primary peritoneal are all exclusively of
mullerian origin and could be appropriately re-named “serous extra-uterine mullerian
tumors”(Dubeau, 2008). We proposed to introduce further genetic alterations in our
mouse model based on inactivation of Brca1 in ovarian granulosa cells in order to
increase the malignant potential of the lesions and test our hypothesis. We will
created double mutants carrying a Brca1 mutation in granulosa cells and a p53
mutation in the mullerian tract, will allow further testing of the importance of a cell
non-autonomous mechanism. In order to do that, We crossed Mis2r-Cre ltransgenic
line with a commercially available p53 flox/flox line to generate a conditional p53
mutation targeted to the mullerian tract. The mice are then crossed with Fshr-cre;
Brca1 flox/flox mice, resulting in animals that carry Brca1 and p53 mutations in both,
granulosa cells and mullerian tissues.

60

MATERIALS AND METHODS
Experimental animals
Mis2r-Cre mice was described earlier in Chapter 2 were crossed with p53 flox/flox
mice (Exon 2 to 10 are flanked by loxP sites of the p53 gene were obtained from the
Jackson laboratory). Transgenic Mis2r-Cre; p53 flox/flox; Fshr-cre; Brca1 flox/flox
mice were generated by crossing Fshr-cre; Brca1 flox/flox with Mis2r-Cre; p53
flox/flox. All Mice were cared for in accordance with institutional guidelines under
the protocols approved by the University of Southern California Institutional Animal
Care and Use Committee.The resulting transgenic mice were maintained on a mixed
background. All mice were genotyped by PCR using tail DNA as described in
chapter 2 and previously(Chodankar et al., 2005). The presence of wild-type Brca1
and p53 was determined using primers (Brca1-e: 5′-ATC AGT AGT AGA AAT
CCA AGC CCA CC-3′; Brca1-f: 5′-TGC CAC TCC CAG CAT TGT TAG-3′; p53-
for: 5′-GGT TAA ACC CAG CTT GAC CA-3′; p53-rev: 5′- GGA GGC AGA GAC
AGT TGG AG-3′).
Our initial Fshr-cre transgenic line was in a C57xBlack 6 background. The floxed
Brca1 allele was first introduced in a I29xBlack 6 background. The floxed p53 and
Mis2r-Cre were from a C57xBlack 6 and I29xBlack 6 background, respectively. We
did not notice any phenotypic change across generations.

61

Histology and Immunohistochemistry staining
Mice with tumors and and controls were sacrificed. Tumors and their counterpart
normal tissues were dissected. Immunostaining using pan-cytokeratin, CK8, CK19
(Developmental Studies Hybridoma Bank) PAX8 (Proteintech) antibodies were
performed on formalin fixed, paraffin embedded ovarian tumor sections using
standard protocols. Briefly, tissue sections were deparrafinized in xylene and
rehydrated through a series of ethanol washes. Endogenous peroxidase activity was
blocked with 3% hydrogen peroxide for 10 mins. After blocking with normal goat
serum for 1 hour, the slides were incubated with primary monoclonal antibodies. The
secondary antibody used was biotinylated anti Rabbit IgG for 30 mins. The slides
were incubated with the ABC complex prior to the development of color reaction
using the DBA substrate. Slides were counterstained with hematoxylin.
Confirmation of gene recombination
Genomic DNA extracted from tumors or normal tissues of the female reproductive
tract was used to detect Cre-mediated recombination of the p53 and Brca1 genes.
Cre-mediated deletion of p53 displayed a 612-bp PCR product amplified with
primers p53-a (5′-CAC AAA AAC AGG TTA AAC CCA-3′) and p53-c (5′-GAA
GAC AGA AAA GGG GAG GG-3′). PCR amplification of the recombined Brca1
gene resulted in a 621-bp product using the primers Brca1-d (5′-CTG GGT AGT
TTG TAA GCA TCC-3′) and Brca1-g (5′-CTG CGA GCA GTC TTC AGA AAG-
3′), which flanked Brca1 exon 11.

62

PRELIMINARY RESULTS AND DISCUSSION
We have observed 60% of 20 mice harboring Mis2r-Cre; p53 flox/flox; Fshr-cre;
Brca1 flox/flox developed tumors, and most of them tend to overlay the mammary
glands, but do not invade the abdominal wall, and no visible abnormalities within the
reproductive organs were observed. Immunostaining showing high expression of pan
cytokeratin and CK8 suggested that those tumors are epithelial in nature. The tumors
developed in this model were frequently found in the same area where the 5 pairs of
mammary glands are. We planned to confirm the histological type of the tumor
compared to the adjacent normal breast tissue. Another interesting finding is in the
areas surrounding the epithelial tumors; we found abundance of tumors cells forming
glandular structures in the peri-tumor area(Figure 1). None of the wide type (no Cre
activity) mice developed any visible tumors.
Genomic DNA extracted from tumors and normal tissues were used to detect the
Cre-mediated recombination of p53 and Brca1 genes. As expected, p53 and Brca1
rearangement were found in tumor tissues. And we also showed the rearrangement
also took place in targeted tissues in mutant mice such as uterus and ovary.

63

Figure 1: Examples of tumor lesions observed in mutant mice and
immunohistochemical characterization.
Shown are histological sections of tumors observed in Mis2r-Cre; p53 flox/flox;
Fshr-cre; Brca1 flox/flox mice. (A) shows the epithelial nature of the tumors
evidenced by immunohistochemistry against pan-cytokeratin. (B) HE staining shows
a higher magnification with abundance of glandular structures surround the tumors.
Scale bars: 50 µm and 200 µm for A and B, respectively.

A B

64

Although the idea that ovarian carcinomas are not derived from the ovarian surface
was widely rejected as recently, an increasing number of scientists now believe that
these serous tumors, at least when they develop in BRCA mutation carriers, always
arise in the fimbriated end of the fallopian tube. However, fallopian tube origin does
not count for all ovarian carcinomas. Around 50% of serous ovarian carcinoma and
all benign serous ovarian tumors are enclosed within cystic structures for which there
are no normal counterpart in fallopian tubes. Our view is that cystic tumors arise in
foci of endosalpingiosis, either within or outside the ovary while non-cystic tumors
usually arise in the fimbriae. Actually, all of the benign tumors observed in Fshr-Cre;
Brca1 flox/flox mice are cystic. And the abundance of cystic structures observed
around the tumors developed in Mis2r-Cre; p53 flox/flox; Fshr-cre; Brca1 flox/flox
mice also made foci of endosalpingiosis, a component of secondary mullerian ducts a
possible site of origin for these tumors. Immnunohistochemistry staining showing
high expression of CK8 and PAX8 also supported an ovarian origin of these tumors.
The tumors developed in our mouse model present some of the morphological
feature of human ovarian tumors and it will provide us with an opportunity to
investigate the precancerous lesion and cystic differentiation.
However, the tumors overlaying the mammary glands but outside the abdominal wall
made mammary glands an appealing site of origin of these tumors. In our Mis2r-Cre;
p53 flox/flox; Fshr-cre; Brca1 flox/flox mouse model, mice carry Brca1 and p53
mutations are driven by both, Mis2r-Cre and Fshr-cre. Actually, the expression of
Mis2r has also been reported in breast cancer cell lines(Segev et al., 2001). And

65

previous unpublished results from our lab also showed evidence of Fshr expression
in mammary glands. Dissected mammary glands from 18-20 months old Fshr-cre;
Brca1 flox/flox mice showed significant large dilated ducts alternating with areas
showing small, inactive ducts. These morphological features are reminiscent of the
dilated ducts seen in the human fibrocystic disease. This is not surprising since Brca1
and p53 loss has been shown collaborating in mouse mammary tumorigenesis in
conditional mammary tumor model in genetic engineered mouse models(Liu et al.,
2007).
Studies to demenstrate cooperation of p53 and Brca1 on ovarian tumorigenesis have
recently been reported. Studies have shown that conditional inactivation of Brca1,
P53, and Rb or inactivation of Brca1 and P53 in mouse ovaries using the
Ad5CMVCre result in development of leiomyosarcomas(Clark-Knowles et al., 2009;
Quinn et al., 2009). A similar study utilizing a knockin Mis2r-Cre model, crossed
with conditional Brca1 and P53 knockout also result in uterine
leiomyosarcoma(Xing et al., 2009). Here, in our model, synergic expression of Fshr-
cre and Mis2r-Cre in p53 and Brca1 knockout mice predisposed mammary glands
tumorigenisis before visible abnormalities could be seen in the reproductive organs.
The higher incidence of tumors seen in mammary glands than those found in
oviducts could be well explained if we take the area and volume sizes of those two
organs into consideration. In mice, there are 5 pairs of developed mammary glands in
sexually matured mice whereas only 1 pair of oviducts that sometimes only visible
with the aid of microscope. Cre-mediated Brca1 and p53 knockout in the much

66

bigger bulk of tissue of mammary glands put them at higher risk for tumorigenesis
than any other target organs.
The genetic manipulations underlying cancer predisposition in this model will be
relevant to human familial cancer predisposition in BRCA1 mutation carriers, as the
majority of the tumors that develop in women with such mutations also carry p53
mutations in addition to showing total absence of a functional BRCA1(Cornelis et al.,
1995; Neuhausen and Marshall, 1994). This model could also be a useful tool to
study the early events during ovarian tumor formation and may augment our
understanding on precancerous lesion and ultimately help in early detection of
ovarian epithelial tumors.

67

REFERENCES
Chai, Y.L., Cui, J., Shao, N., Shyam, E., Reddy, P., and Rao, V.N. (1999). The
second BRCT domain of BRCA1 proteins interacts with p53 and stimulates
transcription from the p21WAF1/CIP1 promoter. Oncogene 18, 263-268.
Chodankar, R., Kwang, S., Sangiorgi, F., Hong, H., Yen, H.Y., Deng, C., Pike, M.C.,
Shuler, C.F., Maxson, R., and Dubeau, L. (2005). Cell-nonautonomous induction of
ovarian and uterine serous cystadenomas in mice lacking a functional Brca1 in
ovarian granulosa cells. Curr Biol 15, 561-565.
Clark-Knowles, K.V., Senterman, M.K., Collins, O., and Vanderhyden, B.C. (2009).
Conditional inactivation of Brca1, p53 and Rb in mouse ovaries results in the
development of leiomyosarcomas. PLoS One 4, e8534.
Cornelis, R.S., Neuhausen, S.L., Johansson, O., Arason, A., Kelsell, D., Ponder, B.A.,
Tonin, P., Hamann, U., Lindblom, A., and Lalle, P. (1995). High allele loss rates at
17q12-q21 in breast and ovarian tumors from BRCAl-linked families. The Breast
Cancer Linkage Consortium. Genes Chromosomes Cancer 13, 203-210.
Dubeau, L. (2008). The cell of origin of ovarian epithelial tumors. Lancet Oncol 9,
1191-1197.
Liu, X., Holstege, H., van der Gulden, H., Treur-Mulder, M., Zevenhoven, J., Velds,
A., Kerkhoven, R.M., van Vliet, M.H., Wessels, L.F.A., Peterse, J.L., et al. (2007).
Somatic loss of BRCA1 and p53 in mice induces mammary tumors with features of

68

human BRCA1-mutated basal-like breast cancer. Proceedings of the National
Academy of Sciences 104, 12111-12116.
Neuhausen, S.L., and Marshall, C.J. (1994). Loss of heterozygosity in familial
tumors from three BRCA1-linked kindreds. Cancer Res 54, 6069-6072.
Ouchi, T., Monteiro, A.N., August, A., Aaronson, S.A., and Hanafusa, H. (1998).
BRCA1 regulates p53-dependent gene expression. Proc Natl Acad Sci U S A 95,
2302-2306.
Quinn, B.A., Brake, T., Hua, X., Baxter-Jones, K., Litwin, S., Ellenson, L.H., and
Connolly, D.C. (2009). Induction of ovarian leiomyosarcomas in mice by conditional
inactivation of Brca1 and p53. PLoS One 4, e8404.
Schuyer, M., and Berns, E.M.J.J. (1999). Is TP53 dysfunction required for BRCA1-
associated carcinogenesis? Molecular and Cellular Endocrinology 155, 143-152.
Segev, D.L., Hoshiya, Y., Stephen, A.E., Hoshiya, M., Tran, T.T., MacLaughlin,
D.T., Donahoe, P.K., and Maheswaran, S. (2001). MÃ¼llerian Inhibiting Substance
Regulates NFÎºB Signaling and Growth of Mammary Epithelial Cells in Vivo.
Journal of Biological Chemistry 276, 26799-26806.
Smith, S.A., Easton, D.F., Evans, D.G., and Ponder, B.A. (1992). Allele losses in the
region 17q12-21 in familial breast and ovarian cancer involve the wild-type
chromosome. Nat Genet 2, 128-131.

69

Xing, D., Scangas, G., Nitta, M., He, L., Xu, X., Ioffe, Y.J., Aspuria, P.J., Hedvat,
C.Y., Anderson, M.L., Oliva, E., et al. (2009). A role for BRCA1 in uterine
leiomyosarcoma. Cancer Res 69, 8231-8235.

70

Chapter 4
NOVEL ROLE OF OLFACTORY RECEPTORS IN CONTROLLING MICE
ESTROUS CYCLE CONTRIBUTES TO OVARIAN TUMOR
PREDISPOSITION

71

ABSTRACT
We previously developed a benign epithelial ovarian tumor model with conditional
inactivation of Brca1 in ovarian granulosa cells(Chodankar et al., 2005). We also
showed prolongation of pro-estrus phase of the estrus cycle and higher circulating
levels of estradiol were instrumental in mediating tumor predisposition in this mouse
model(Hong et al., 2010; Yen et al., 2012). To further gain insight into the
consequences of Brca1 inactivation on gene expression in ovarian granulosa cells,
we did mouse all-exon arrays on microdissected granulosa cells from 8 month old
mutant and wild type mice that were previously synchronized in pro-estrus (the
equivalent of the follicular phase in the human menstrual cycle). Quantitative RT-
PCR validation showed an excellent correlation with microarray, Pearson's
correlation coefficient (r) of 0.92 and p<0.0001. Here we reported the gene family
that was most frequently influenced by Brca1 inactivation in ovarian granulosa cells
was that of olfactory receptors (ORs). It is the second most significant difference
based on magnitude of changes in expression level between the 2 groups of mice,
and counted for ten of the first thirty genes that showed the highest fold increase in
expression in mutant animals involved an olfactory receptors. Among the first thirty
genes that differently expressed, there is 3 to 6 folds change in olfactory receptor
expression in mutant compared to wide type granulosa cells. Immunostaining using
olfactory receptor specific antibody olfactory receptor 68/9 showed expression of the
OR in the membrane of granulosa cells in premature and mature follicles, but not in
the corpus luteum. Here we hypothesized that signaling through olfactory receptors

72

may play an important role in the biology of ovarian follicles, which control the
cycle, and in turn influences ovarian epithelial tumor predisposition.
To test our hypothesis, we stimulated wild type and mutant female mice that have
previously been isolated and confirmed no cycling with male scent by introducing
male urine. We then documented timing of resumption of cycling activity by vaginal
appearance and confirmed by PAP smear. Our data suggested mutant female
changed into cycling status faster than wild type female and the difference was more
pronounced 9hrs after stimulation. The experiment was repeated 3 times and
MANTEL-HAENSZEL combined test showed p<0.0001. To further exclude the
possibility that the stimulation of the estrus cycle in mutant female were influenced
by Brca1 inactivation in the olfactory bulb or other cell types in which low levels of
Brca1 inactivation could also have occurred, we performed ovary transplantation.
The 2 ovaries from donor mice were put under the kidney capsule of recipient mice
that has previously undergone ovariectomy. All female underwent surgery were
evaluated for estrous cycling ability by observation of PAP smear for 30 days.
Previously cycling mice were isolated from males; those confirmed noncycling were
used for stimulation experiments as previously described. Our results suggested,
compared with mutant mice harboring wild type ovaries, wild type mice harboring
mutant ovaries mice got into cycling status faster and the difference was more
pronounced 3hrs after stimulation. The experiment was repeated 3 times and
MANTEL-HAENSZEL combined test showed p<0.0001. These results showed that
inactivation of Brca1 in ovaries can fasten mice response to male scent even in the

73

presence of a functional Brca1 in the olfactory bulb. The difference in response
further emphasized the relative importance of the ovary versus the olfactory bulb in
driving the mutant phenotype. Our data suggested that olfactory receptors may play
an important role in signal transduction in granulosa cells, contributing to ovarian
tumor predisposition by regulating mice estrous cycle activity or increasing
production of estrogen.

74

INTRODUCTION
Menstrual cycle activity is the most important risk factor for sporadic serous ovarian
carcinoma. We previously reported that conditional inactivation of Brca1 in ovarian
granulosa cells leads to the development of benign epithelial tumors. Microarray
study of gene profiling changes of Brca1 inactivation in ovarian granulosa cells
showed the gene family that was most frequently influenced by Brca1 inactivation in
ovarian granulosa cells was that of olfactory receptors. It is the second most
significant difference based on magnitude of changes in expression level between the
wildtype and mutant mice and counted for ten of the thirty genes that showed the
highest fold increases in expression in mutant animals. What are the functions of
those olfactory receptors in ovary granulosa cells?
Olfactory receptors (ORs) are the largest gene family in the human genome. They
were known to be expressed in cell membrane of olfactory neurons, responsible for
detection of odor molecules. After OR was first identified in 1991(Buck and Axel,
1991), 853 human OR genes have been found in the human genome(Olender et al.,
2004), and 1490 been found in the mouse genome(Young et al., 2002; Zhang and
Firestein, 2002). Upon Olfactory receptor binding to odorant, OR structure changes,
binds and activates olfactory-type G protein on the inside of OR neuron, this cause
depolaring in olfactory receptor neuron, the action potential carry information to
brain, produce a nerve impulse, initiates a cas- cade of signal transduction events
leading to smell perception(Firestein, 2001; Mombaerts, 2001).

75

Although Olfactory receptors are expected to be expressed specifically in olfactory
tissues, recently, some ectopic expression has been reported: Sperm cells express
odor receptors, which might be involved in chemotaxis to find egg cells(Spehr et al.,
2006) and also oocytes express OR(Goto et al., 2001). OR was reported to be
expressed in renal distal nephron and may play a sensory role in the macula densa to
modulate both renin secretion and Glomerular Filtration Rate(Pluznick et al., 2009).
Another group examined the impact of diet and fetal sex on placental gene
expression in mice fed either a very-high-fat, low-fat diet and found most of the
known ORs expressed in placenta, allowing it to sense odorant molecules and
influence the offspring(Mao et al., 2010). Feldmesser et al systematically explores
the expression patterns of OR genes in a large number of tissues and suggested that
small OR subsets might play functional roles in different tissues(Feldmesser et al.,
2006). However, OR expression in the ovary has not been previously reported.
The human ovary is a very complex organ, with many of its functions yet to be
elucidated. Previous data focused on evaluating menstrual changes and olfactory
sensory has shown variations in olfactory sensatory throughout menstral cycle and a
decrease in olfactory thresholds was observed during the time of ovulation. Not only
in olfaction, actually menstrual changes in sensory functioning in 5 modalities:
vision, olfaction, audition, taste, and tactile sensoring(Parlee, 1983). There is also
some evidence that women with hyposmia present more frequently in patient with
primary amenorrhea and oocyte and menstrual abnormalities(Marshall and Henkin,
1971).

76

As we know that menstrual cycle activity is the greatest risk factor for sporadic
ovarian cancer, but what makes them more vulnerable to have more frequent cycling
activities remains unknown. Here we used an ovarian serous cystadenomas mouse
model with the conditional inactivation of Brca1 in ovarian granulosa cells and
reported for the first time OR expression in the ovary, also that their level of
expression is increased in mutant mice. We hypothesized that signaling through
olfactory receptors may play an important role in the biology of ovarian follicles,
which control the cycling activities or estrogen production, and in turn influences
ovarian epithelial tumor predisposition. In our mouse model, the higher expression
levels of OR in ovary may be responsible for the frequent cycling activity observed
in those mice. Our data is interesting in light of Kallmann syndrome, which is
characterized by the presence of anosmia and hyposmia. These patients usually
present with delayed growth and sexual development and infertility.

77

MATERIALS AND METHODS
Experimental animals
Conditional Brca1 mutant mice were generated and characterized as described
earlier(Chodankar et al., 2005). The mice were housed under standard 12 h of light
alternating with 12 h of dark conditions; with automatic lighting changes occurring
at 6 a.m. and 6 p.m. Female mice used for Male urine stimulation test were housed in
an isolated room with no male mice present. All Mice were cared for in accordance
with institutional guidelines under the protocols approved by the University of
Southern California Institutional Animal Care and Use Committee.
Microdissection of granulosa cells and Microarray
We used laser capture microdissection (PIXCELL II Instrument purchased from
Arcturus BioScience Inc., Mountain View, California)to isolate granulosa cells from
8 month old mutant and wild type mice. All mice were synchronized in pro-estrus,
the equivalent of the follicular phase in the human menstrual cycle, with 5IU of
Pregnant Mare Serum Gonadotropin inoculated 48 hours before they were harvested.
mRNAs were extracted with the mirVana™ miRNA Isolation Kit (Ambion, Austin,
TX) according to the manufacturer's protocol. Granulosa cell mRNA from each
group was pooled and analyzed using mouse all-exon arrays.

78

Validation of gene expression array by quantitative RT-PCR
Granulosa cell mRNAs were reverse-transcribed into cDNAs by using SuperScript™
First-Strand (Invitrogen life technologies). Ten genes were randomly picked and
their relative mRNA levels in Wild type and Mutant granulosa cells were examined
using real-time RT-PCR. The real-time PCR was performed using a SYBR super
mix kit (Fermenters), running for 40 cycles at 95 °C for 15 s and 60 °C for 45 s. The
melting curve data were collected to check the PCR specificity. Each cDNA sample
was analyzed in triplicate. The threshold cycle (CT) was defined as the fractional
cycle number. Gene expression values (relative mRNA levels) are expressed as
ratios (differences between the Ct values; ΔCt = Ct
interest
− Ct
Gapdh
) between the genes
of interest and an internal reference gene (Gapdh) that provides a normalization
factor for the amount of RNA isolated from a specimen. By using the Δ(ΔCt) method,
the fold change 2
− Δ(ΔCt)
was calculated for each control and mutant samples. All data
are shown as mean ± SD, Student's t-test was applied for statistical analysis. A p
value of less than 0.05 was considered statistically significant. Pearson correlation
analysis was used to calculate Pearson's correlation coefficient indicating the
correlation between q-RT-PCR and microarray data.
Primers used in the quantitative RT-PCR were as follows:
Mouse GAPDH forward primer: 5'- GCACAGTCAAGGCCGAGAAT-3'
Mouse GAPDH reverse primer: 5'- GCCTTCTCCATGGTGGTGAA-3'

79

Mouse Cyp17a1 forward primer: 5'-GCCCAAGTCAAAGACACCTAAT -3'
Mouse Cyp17a1 reverse primer: 5'-GTACCCAGGCGAAGAGAATAGA-3'
Mouse HSD3b forward primer: 5'-AGTGCTAAATAGCGTGTTTACCA-3'
Mouse HSD3b reverse primer: 5'- ACTTTTTGTGTAGTGTCTCCCTG-3'
Mouse Hsd17b1 forward primer: 5'- ACTTGGCTGTTCGCCTAGC-3'
Mouse Hsd17b1 reverse primer: 5'- GAGGGCATCCTTGAGTCCTG-3'
Mouse S100a8 forward primer: 5'-AAATCACCATGCCCTCTACAAG-3'
Mouse S100a8 reverse primer: 5'-CCCACTTTTATCACCATCGCAA-3'
Mouse Olfr149 forward primer: 5'- TGCAGGTTGTGTGTCCCAG-3'
Mouse Olfr149 reverse primer: 5'- TGAGTAGCGTAGAGGGTAGCA-3'
Mouse Olfr62 forward primer: 5'-AGAAACCGCAGCTCTCTTACC -3'
Mouse Olfr62 reverse primer: 5'- GGCGGGAATCCATGTGTATCA-3'
Mouse Olfr666 forward primer: 5'- CTTCCTGGCTTTACTTTCCTTCA-3'
Mouse Olfr666 reverse primer: 5'- CCAGACTCCAGGCCAGTCAACA-3'
Mouse Olfr1383 forward primer: 5'-ACAATCTCACGAATGGATCAGC -3'
Mouse Olfr1383 reverse primer: 5'-CACCCAGCATAGCTCATGGT -3'

80

Mouse Cyp11a1 forward primer: 5'-AGGTCCTTCAATGAGATCCCTT -3'
Mouse Cyp11a1 reverse primer: 5'- TCCCTGTAAATGGGGCCATAC-3'
Estrus cycle determination by vaginal appearance
After a 2-3 week adaptation period, the estrous state of female mice was determined
daily at the same time for 3-4weeks by both the vaginal appearance and vaginal
smears descried below. Two investigators performed the two procedures blindly.
Determination of the estrous stage by vaginal appearance was based the vaginal
appearance changes during the estrous cycle: the size of the vaginal opening, the
presence or absence of visible cellular debris in the vagina, and the degree of vaginal
swelling, particularly the dorsal lip, the color and moistness of the tissues, are all
taken into considered in identifying the stages of the estrous cycle.
Collection of vaginal samples
Vaginal smears were taken daily at the same hour between 10AM and 12PM.
Disposable Pasteur pipets loaded with small amount of (about 100ul) sterile PBS;
Lift the mouse out of her cage and place her on the cage lid with her rear end
towards you; firmly grasp the tail and elevate the rear end with only her front paws
grasping the lid; Place the end of the PBS-filled Pasteur pipets tip at the opening of
the vaginal canal and gently depress the bulb so PBS was expelled into the vagina
and aspirated back into the tip twice; the lavages were smeared on glass slides and
allowed to air dry followed by Papanicolou (PAP) staining. Daily vaginal lavages

81

were obtained over a continued 30-days period spanning several consecutive cycles
PAP Staining
The air dried slides are fixed in 95% alcohol for 1 minute then rehydrated through 80%
alcohol for 30 second, then water rinsed, Harris Haematoxylin stain for 1 minute,
Bluing agent for 1 minute, water rinsed. The slides are then dehydrated again
through 80% and 95% alcohol solution, then counterstained in OG-6 for 1 minute,
then 95% alcohol again twice, then counterstained again in EA-50 solution. The
slides are rinsed through 95% and 100% alcohol, finally cleared with clearite 3
solution. The slides are mounted with secure mount mounting medium and allowed
to air dry in the hood.
Male scent stimulation test
Male beddings used as stimuli were collected from normal C57BL/6J mice, aged 4-6
months, and equal number to the female mice to be stimulated were used. Female
mice (2-4 months old at the start of the experiments) were kept in an isolated room
for this experiment. Following the 2-3 weeks adaptation period, the animals were
exposed to male bedding. Vaginal appearance before the stimulation was
documented and only those confirmed in noncycling status were used in the
stimulation study. After introducing male bedding, Vaginal appearance were
observed every 3 hours until the change was documented, then PAP smear was done
to confirm the cycling status. This is to avoid the stimulation the mice estrous cycle
by frequent PAP smear manipulation.

82

Ovarian transplantation procedures
Mice were anaesthetized by i.p. injection of Avidin. The ovaries and kidneys were
exposed through dorsolateral incisions. Bilateral oophorectomies were performed in
all recipients. A small incision was made into the capsule of left kidney in each
recipient using spring scissor. Two intact ovaries were inserted beneath the capsule
through the small incision. After recovery period, vaginal cytological examination
were performed in transplant recipients, success rate of the transplantation procedure
were calculated and those had regular estrus cycles were included in our studies.
Olfactory receptor expression in the mouse ovary
Immunostaining using an anti-olfr68 antibody was performed on formalin fixed,
paraffin embedded ovarian tumor sections using standard protocols. Briefly, tissue
sections were deparrafinized in xylene and rehydrated through a series of ethanol
washes. Endogenous peroxidase activity was blocked with 3% hydrogen peroxide for
10 mins. After blocking with normal goat serum for 1 hour, the slides were incubated
with primary polyclonal antibody (Abcam, Cat# 62606). The secondary antibody
used was biotinylated anti Rabbit IgG for 30 mins. The slides were incubated with
the ABC complex prior to the development of color reaction using the DBA
substrate. Slides were counterstained with hematoxylin.

83

Statistical analyses
Male urine stimulation analyses were performed using the Fisher’s exact test.
Statistical significance levels (P values) were calculated with the MANTEL-
HAENSZEL combined test. All P values quoted are two-sided.
Human Granulosa cell extraction
After informed consent was obtained, follicular fluid was obtained at the time of
follicle aspiration from women undergoing controlled ovarian hyperstimulation for
in vitro fertilization as approved by the Institutional Review Board of the University
of Southern California. After the eggs were removed from the fluid, which contains
granulosa cells, was transported on ice to the laboratory. Briefly, samples were
added to Ficoll reagent in a 2:1 fashion and centrifuged at 400g for 20minutes at 4°C
to remove contaminating red blood cells. The granulosa cell layer was then aspirated
and centrifuged at 400g for 5 min. Supernatant was discarded and the pellet was
resuspended in PBS and washed twice to remove the Ficoll, as previously
described(Jabara et al., 2003; Yamamoto et al., 2002). The final pellet was
resuspended in 1mL PBS and frozen at -80°C for later use for isolation of protein
and RNA samples.
Primers used to amplify reverse transcribed cDNA products were as follows:
Human GAPDH forward primer: 5'- GGAGCGAGATCCCTCCAAAAT-3'
Human GAPDH reverse primer: 5'- GGCTGTTGTCATACTTCTCATGG-3'

84

Human OLFR8G2 forward primer: 5'-CAATTCACACCGGCTTTATGTTG -3'
Human OLFR8G2 reverse primer: 5'-GGCAGGCGTCAGGATGTTA-3'
Human OLFR52N2 forward primer: 5'-ATCATTGCTGTCGTGGGGAAC -3'
Human OLFR52N2 reverse primer: 5'- GGCAGGCGTTAAAGTCAATCTC -3'

85

RESULTS
Effect of Brca1 knockout on gene expression in mouse ovarian granulosa cells
We sought to gain further insight into the consequences of Brca1 inactivation on
gene expression in ovarian granulosa cells. We used laser capture microdissection to
isolate granulosa cells from 8 month old mutant and wild type mice (Figure 1).
There are 2,972 genes was changed more than 2-fold in the two groups. Selected
genes showing different expression levels in wild type versus mutant animals were
further analysed by quantitative RT-PCR to verify the authenticity of the differential
expression. Pearson correlation analysis shows excellent correlation between the q-
RT-PCR and microarray data with a Pearson's correlation coefficient (r) of 0.92 and
p<0.0001 (Figure 2).

86

Figure 1: Histogene Staining Before and After Microdissection of Granulosa
Cells. We used laser capture microdissection to isolate granulosa cells from mutant
and wild type mice at the age of 8 months when the mutant mice displayed most
significant elongation in pro-estrus phase. Histogene staining before (A) and after (B)
microdissection showed granulosa cells were extracted from the follicles. Scale bars:
50 µm

A
B
Undissected
follicle
Dissected follicle

87

Figure 2: Pearson Correlation Analysis of Representative Genes Validated by q-
RT-PCR. Validation of gene expression array data by q-RT-PCR. (A) Ten genes
were randomly picked and their relative mRNA levels in Wild type and Mutant
granulosa cells were examined using real-time RT-PCR. (B) Pearson correlation
analysis shows excellent correlation between the q-RT-PCR and microarray data
with a Pearson's correlation coefficient (r) of 0.92 and p<0.0001

88

We observed that the gene family that was most frequently influenced by Brca1
inactivation in ovarian granulosa cells was that of olfactory receptors. The second
most significant difference based on magnitude of changes in expression level
between the 2 groups of mice involved an olfactory receptor. Ten of the thirty genes
that showed the highest fold increases in expression in mutant animals were
olfactory receptors (Table 1).

89

Table 1: Genes Showing the Highest Expression in Microarray in Mutant Mice

Gene symbol Gene description
Fold change Regulation
1
4921509C19Rik|LOC381390
RIKEN
cDNA
4921509C19
gene

15.48181
up

2
Olfr1383|Olfr1372-‐ps1
olfactory
receptor
1383
|
1372

6.2076635
up

3
Apol7b|Apol7e
apolipoprotein
L
7b
|
apolipoprotein
L
7e

5.8377657
up

4
S100a8
S100
calcium
binding
protein
A8

5.829469
up

5
Dub2a
deubiquitinating
enzyme
2a

5.3082666
up

6
Olfr149
olfactory
receptor
149

5.14012
up

7
A130014H13Rik
RIKEN
cDNA
A130014H13
gene

5.019434
up

8
Olfr666
olfactory
receptor
666

4.7805824
up

9
5031438A03Rik
RIKEN
cDNA
5031438A03
gene

4.6938324
up

10
Olfr575
olfactory
receptor
575

4.348001
up

11
Defb2|Defb11
defensin
beta
2
|
defensin
beta
11

4.2127724
up

12
Sprr4
small
proline-‐rich
protein
4

3.9863122
up

13
Olfr62
olfactory
receptor
62

3.9137306
up

14
Lss
lanosterol
synthase

3.8208654
up

15
Olfr498
olfactory
receptor
498

3.735642
up

16
Pla2g5
phospholipase
A2,
group
V

3.7238865
up

17
Fabp5
fatty
acid
binding
protein
5,
epidermal

3.6968615
up

18
Sprr1a
small
proline-‐rich
protein
1A

3.6524174
up

19
Znrf4
zinc
and
ring
finger
4

3.6402836
up

20
Olfr144
olfactory
receptor
144

3.5219624
up

21
LOC100042767
similar
to
ribosomal
protein
L21

3.4977264
up

22
Olfr1505|Olfr1502
olfactory
receptor
1505
|
1502

3.4783664
up

23
Scd1
stearoyl-‐Coenzyme
A
desaturase
1

3.4679742
up

24
Olfr102|Olfr100
olfactory
receptor
102
|
100

3.4002094
up

25
Gstm6|Gstm7|Gstm3
glutathione
S-‐transferase,
mu
7

3.3993642
up

26
Lce1m
late
cornified
envelope
1M

3.212659
up

27
Smcp

sperm
mitochondria-‐associated

cysteine-‐rich
protein

3.178735
up

28
Defb12|Defb35
defensin
beta
12
|
defensin
beta
35

3.1166632
up

29
Olfr1471
|
1474
|1472
|1475

olfactory
receptor
1471
|
1474
|1472

|1475

3.0305643
up

30
Sprr2b|Sprr2a
small
proline-‐rich
protein
2B
|
2A

3.0058913
up

90

Expression of Olfactory receptor in the ovary
Since olfactory receptor expression was found in the ovary follicles in the RNA
level, it was important to confirm that the expression histologically and further more
to identify any other structures in the follicles also express the receptor.
Immunohistochemistry was performed using an anti-olfr68 antibody (specific for
olfactory receptor expression). Not only granulosa cells in the mature follicles
showed positive membrane staining for anti-olfr68, confirming the expression we
saw in the RNA level (Figure 3 A and B), granulosa cells in primary follicles also
demonstrate a same pattern (Figure 3 C and D). The corpus luteum does not express
olfr68; neither do the theca cells. One of the other interesting observation is that
although positive membrane staining was observed throughout the different layers of
granulosa cells, the cells closed to the oocyte showed stronger signal compared to the
ones in the peripheral of the follicles. And this was consistently observed in the
mature and premature follicles. This distribution is in line with one of the important
functions of granulosa cells utilizing gap junctions to communicate with the oocyte
for the purpose of metabolic exchange and transport of signaling molecules.

91

Figure 3: Immunohistochemical characterization of olfactory receptor
expression in ovarian granulosa cells. (A, B) Membrane staining of preovulatory
granulosa cells using polyclonal olfr68 antibody. (C, D) Olfr 68 expression was also
observed in primary ovarian follicles. The staining was stronger in the center of the
follicles compared to the peripheral. Scale bars: 10 µm

A
C
B
D

92

Demonstration of Estrous cycle by vaginal appearance and PAP smear
Estrus cycle in mouse is comparable to menstrual cycle in human, both are hormone-
induced process and is very important in ovarian follicular development(Schedin et
al., 2000; Smith et al., 1975; Walmer et al., 1992; Wood et al., 2007). The estrus
cycle is usually subdivided into four phases: proestrus, estrus, metestrus, and
diestrus, based on the cytological appearance of cells recovered from mouse vaginal
as previously described(Hong et al., 2010). Whereas, the appearance of the vagina
induced by hormonal changes throughout the estrous cycle can be used as a direct
visual method. We evaluate the size of the vaginal opening, the presence or absence
of visible cellular debris in the vagina, and the degree of vaginal swelling,
particularly the dorsal lip, the color and moistness of the tissues. The criteria to
determine the stage of estrous cycle has been described by Champlin et al(Champlin
et al., 1973), and was utilized to evaluate the mice before and after estrous
stimulation (Figure 4).

93

Figure 4: Vaginal appearance and PAP smear before and after exposure to
male scent. Examples of Vaginal appreance (A, B) and the corresponding PAP
smear (C, D) before and after male urine stimulation study were shown as indicated.

94

Consequences of Brca1 inactivation in ovarian granulosa cells on their response
to male scent
The Whitten effect is a phenomenon first described by Wesley K.
Whitten(WHITTEN, 1956, 1958), he observed that male mouse pheromone-laden
urine synchronizes the estrus cycle "among unisexually grouped females.” In
contrast, the Lee–Boot effect observed in female mice does the opposite; when
female mice housed together and isolated from males their estrous cycle gradually
decreases(VAN DER LEE and BOOT, 1956). We took the advantage of this
knowledge and stimulated female mice estrus cycle through exposure to male scent
by introducing male urine to female mice that have previously been isolated and
confirmed in non-cycling stage. We then documented timing of resumption of
cycling activity by vaginal appearance and confirmed by PAP smear. Our data
suggested mutant female changed into cycling status faster than wild type female and
the difference was more pronounced 9hrs after stimulation (Table 2). The experiment
was repeated 3 times and MANTEL-HAENSZEL combined test showed p<0.0001
(Table 3).

95

Table 2: Differences between Wild type and Mutant mice in their response to
male scent

Time after
Exposure
Cycling
mice
Non-Cycling
mice
Total
Fisher’s
exact test
6 h
WT 3 (30.0%) 7 (70.0%) 10
P=0.03
MT 9 (81.8%) 2 (18.2%) 11
9h
WT 4 (40.0%) 6 (60.0%) 10
P=0.02
MT 10 (90.9%) 1 (9.1%) 11
24h
WT 10 (100%) 0 (0%) 10
P=1.0
MT 11 (100%) 0 (0%) 11

96

Table 3: Summary of differences between Wild type and Mutant mice in their
sensitivity to Male scent

9h after
exposure
Cycling
mice
Non-cycling
mice
Total
Fisher’s
exact test
Exp. 1
WT 4 (40%) 6 (60%) 10
P=0.02
MT 10 (90.9%) 1 (9.1%) 11
Exp. 2
WT 2 (15.4%) 11 (84.6%) 13
P=0.02
MT 5 (71.4%) 2 (28.6%) 7
Exp. 3
WT 1 (12.5%) 7 (87.5%) 8
P=0.04
MT 6 (75%) 2 (25%) 8
MANTEL-HAENSZEL combined test p<0.0001

97

Relative importance of Brca1 inactivation in ovarian granulosa cells compared
with olfactory bulb in estrus cycle regulation
In our conditional Brca1 inactivation mouse model, Brca1 flox/flox

mice were
crossed with a transgenic line carrying a Cre recombinase under a truncated form of
the Fshr promoter. This promoter had previously been reported to be specific for
granulosa cells in females(Griswold et al., 1995) and we have previously confirmed
that indeed it showed a high degree of specificity in female pelvic and abdominal
organs. We also observed that the truncated Fshr promoter driving Brca1 inactivation
in our mouse model was expressed in a subset of anterior pituitary cells was obtained
from the identification of β-galactosidase–positive cells in histologic sections of this
organ obtained from R26R reporter mice carrying the Fshr-Cre transgene(Hong et
al., 2010), Also, a subset of cells in the olfactory bulb also show positivity in β-
galactosidase staining. These results raised the possibility that the stimulation of the
estrus cycle in mutant mice were influenced by Brca1 inactivation in the olfactory
bulb or other cell types in which low levels of Brca1 inactivation could also have
occurred. To further exclude the possibility that the stimulation of the estrus cycle in
mutant female were influenced by Brca1 inactivation in the olfactory bulb or other
cell types in which low levels of Brca1 inactivation could also have occurred, we
performed ovary transplantation. Two ovaries of mutant mice were removed and
replaced by two ovaries obtained from wild-type donors, which were placed under
the renal capsule of mutant mice (Figure 5). Reciprocal experiments in which wild-
type ovaries were replaced with grafts obtained from mutant donors were also

98

performed. Transplantations of wild-type ovaries into wild-type animals and of
mutant ovaries into mutant animals were used as controls. All transplantation
procedures were performed using donors and recipients that were 2-4 months old.
After a period of recovery time, we performed PAP smear to evaluate the
transplanted ovary function for 30 days. Seventeen mutant mice harboring wild type
ovaries and Seventeen wild-type mice harboring mutant ovaries undergone surgery
all survive and they all demonstrate a dynamic estrous cyclic change in the
observation time, which proves the transplanted ovaries were functional (Figure 6).

99

Figure 5: Ovarian transplantation into renal capsule.

WT donor
Bilaterally
ovariectomized
MT recipient

100

Figure 6: Demonstration of ovary function after ovary transplantation. (A) Two
ovaries from donor mouse were put under kidney capsule of recipient mouse, which
provides an ideal environment for survival and functionality of the ovaries. Scale bar:
5mm (B, C) Vaginal appearance and PAP smear of the mouse after a recovery period
undergone ovary transplantation procedure demonstrated resuming ovary
functionality after the procedure.

A
C
B

101

Those cycling mice were then isolated and after a period of time, those confirmed in
non cycling status were evaluated for their response to male scent by vaginal
appearance and confirmed by PAP smear. Our results suggested, compared with
mutant mice harboring wild type ovaries, wild type mice harboring mutant ovaries
mice got into cycling status faster and the difference was more pronounced 3hrs after
stimulation. The experiment was repeated 3 times and MANTEL-HAENSZEL
combined test showed p<0.0001 (Table 4). These results not only confirmed those
obtained earlier with mice not subjected to any transplantation procedure but also
showed that inactivation of Brca1 in ovaries can fasten mice response to male urine
even in the presence of a functional Brca1 in the olfactory bulb. The difference in
response further emphasized the relative importance of the ovary versus the olfactory
bulb in driving the mutant phenotype.

102

Table 4: Differences between ovary transplantation mice in their response to
male scent
3h after
exposure
Cycling
mice
Non-cycling
mice
Total
Fisher’s
exact test
Exp. 1

8 (57.0%) 6 (43.0%) 14
P=0.06

2 (16.0%) 10 (84.0%) 12
Exp. 2

11 (78.6%) 3 (21.4%) 14
P=0.02

3 (25.0%) 9 (75.0%) 12
Exp. 3

8 (88.8%) 1 (11.2%) 9
P=0.02

3 (30.0%) 7 (70.0%) 10

MANTEL-HAENSZEL combined test P < 0.0001

WT mice harboring MT ovarian grafts

MT mice harboring WT ovarian grafts

103

Olfactory receptor expression in the human granulosa cells
Granulosa cells were isolated and purified from In vitro Fertilization patient with
informed consent as previously described. RNA was extracted and transcribed into
cDNA, and tested for expression of human Olfactory receptors. We found human
granulosa cells express OLFR8G2, OLFR52N2 (Figure 7); human GAPDH was used
as an internal control, while no reverse transcriptase was used as negative control.
PCR results were sent for sequencing as an evidence of an authentic band. Whole
cell protein extracts from human granulosa cells were used for western blot using
olfactory antibodies and the results are pending.

104

Figure 7: Olfactory receptor expression in human granulosa cells by RT-PCR.
Granulosa cells RNA was extracted from In vitro fertilization clinic patient and then
transcribed into cDNA. PCR amplification products of human olfactory receptors
were analyzed by 1% agarose gel.

Molecular
weight
ladder
OLFR
8G2
OLFR
8G2
w/o
RT
OLFR
52N2

OLFR
52N2
w/o
RT
0.5
kb
-‐
1
kb
-‐
blank

105

DISCUSSION
The mammalian olfactory receptor family was first discovered in the early 1990s and
is comprised of a family of G-protein receptors that are structurally related to one
another(Buck and Axel, 1991). Although OR expression was first observed in the
olfactory bulb, recent microarray data suggested that OR can be found in majority of
mammalian tissues(Feldmesser et al., 2006), the widespread expression of ORs
suggested that function of these proteins are not restricted to olfaction but may also
regulate novel functions in other tissues.
Ferrand et al reported a complete functional olfactory-like signalling pathway in the
heart. Olfactory receptors, together with signalling partners Gαolf and AC3 express
in the mouse heart. Although the identity and source of the ligands for these
olfactory receptors remain unknown, application of a panel of known odorant
chemicals is sufficient to produce robust Ca
2+
transients in Fluo-4 loaded cardiac
fibroblasts(Ferrand et al., 1999).
Human OR51E2, also known as the prostate-specific G-protein coupled receptor was
reported upregulated in prostate cancer but not any function within normal prostate
cells was identified. Odorant β-ionone has been identified as a ligand for the
receptor. Activation of OR51E2 in prostate cancer cells by this ligand yielded an
increase in intracellular Ca
2+
, activation of members of the MAPK family and
inhibition of cell proliferation(Neuhaus et al., 2009).
We reported, for the first time, the novel expression of olfactory receptors in the

106

ovary. The gene expression comparison between wild type mice and mutant mice
harboring a Brca1 gene knockout in their ovarian granulosa cells indicated the
olfactory receptor family was among those showing highest differential expression
between those 2 groups. Olfactory receptor upregulation in granulosa cells could
allow the ovary to “sense” changes in the level of chemo taxis molecules and thus
influence the ovary function by either increasing estrogen production or interfering
with cycling activity. Thus signaling through olfactory receptors may play an
important role in ovarian cancer formation. In order to test the role of olfactory
receptor in regulating estrous cycle activity, we performed male urine stimulation
study utilizing the Whitten effect. We clearly showed mutant mice harboring a Brca1
gene knockout in their ovarian granulosa cells showed quicker response to the
stimuli compared to wild type mice. And this was not driven by Brca1 inactivation in
cells other than granulosa cells based on the observation that wild type mice
harboring mutant ovarian grafts still showed a quicker response than mutant mice
harboring wild type ovarian grafts.
From a broader point of view, an association between olfactory receptor expression
and ovarian functions in human is further suggested by the interesting phenomenon
that women lived in same college dormitories gradually get their menstrual cycles
synchronized. In patients with Kallmann syndrome, they lose their sense of smell
and also develop hypogonadism. Expression of the OR in the ovary will increase our
knowledge in ovarian function, while future work of identifying a ligand for these
receptors may ultimately lead to treatment of sexual dysfunction and infertility.

107

REFERENCES

Buck, L., and Axel, R. (1991). A novel multigene family may encode odorant
receptors: a molecular basis for odor recognition. Cell 65, 175-187.
Champlin, A.K., Dorr, D.L., and Gates, A.H. (1973). Determining the stage of the
estrous cycle in the mouse by the appearance of the vagina. Biol Reprod 8, 491-494.
Chodankar, R., Kwang, S., Sangiorgi, F., Hong, H., Yen, H.Y., Deng, C., Pike, M.C.,
Shuler, C.F., Maxson, R., and Dubeau, L. (2005). Cell-nonautonomous induction of
ovarian and uterine serous cystadenomas in mice lacking a functional Brca1 in
ovarian granulosa cells. Curr Biol 15, 561-565.
Feldmesser, E., Olender, T., Khen, M., Yanai, I., Ophir, R., and Lancet, D. (2006).
Widespread ectopic expression of olfactory receptor genes. BMC Genomics 7, 121.
Ferrand, N., Pessah, M., Frayon, S., Marais, J., and Garel, J.M. (1999). Olfactory
receptors, Golf alpha and adenylyl cyclase mRNA expressions in the rat heart during
ontogenic development. J Mol Cell Cardiol 31, 1137-1142.
Firestein, S. (2001). How the olfactory system makes sense of scents. Nature 413,
211-218.
Goto, T., Salpekar, A., and Monk, M. (2001). Expression of a testis-specific member
of the olfactory receptor gene family in human primordial germ cells. Mol Hum
Reprod 7, 553-558.

108

Griswold, M.D., Heckert, L., and Linder, C. (1995). The molecular biology of the
FSH receptor. J Steroid Biochem Mol Biol 53, 215-218.
Hong, H., Yen, H.Y., Brockmeyer, A., Liu, Y., Chodankar, R., Pike, M.C., Stanczyk,
F.Z., Maxson, R., and Dubeau, L. (2010). Changes in the mouse estrus cycle in
response to BRCA1 inactivation suggest a potential link between risk factors for
familial and sporadic ovarian cancer. Cancer Res 70, 221-228.
Jabara, S., Christenson, L.K., Wang, C.Y., McAllister, J.M., Javitt, N.B., Dunaif, A.,
and Strauss, J.F. (2003). Stromal cells of the human postmenopausal ovary display a
distinctive biochemical and molecular phenotype. J Clin Endocrinol Metab 88, 484-
492.
Jemiolo, B., Harvey, S., and Novotny, M. (1986). Promotion of the Whitten effect in
female mice by synthetic analogs of male urinary constituents. Proc Natl Acad Sci U
S A 83, 4576-4579.
Mao, J., Zhang, X., Sieli, P.T., Falduto, M.T., Torres, K.E., and Rosenfeld, C.S.
(2010). Contrasting effects of different maternal diets on sexually dimorphic gene
expression in the murine placenta. Proc Natl Acad Sci U S A 107, 5557-5562.
Marshall, J.R., and Henkin, R.I. (1971). Olfactory acuity, menstrual abnormalities,
and oocyte status. Ann Intern Med 75, 207-211.
Mombaerts, P. (2001). The human repertoire of odorant receptor genes and
pseudogenes. Annu Rev Genomics Hum Genet 2, 493-510.

109

Neuhaus, E.M., Zhang, W., Gelis, L., Deng, Y., Noldus, J., and Hatt, H. (2009).
Activation of an olfactory receptor inhibits proliferation of prostate cancer cells. J
Biol Chem 284, 16218-16225.
Olender, T., Feldmesser, E., Atarot, T., Eisenstein, M., and Lancet, D. (2004). The
olfactory receptor universe--from whole genome analysis to structure and evolution.
Genet Mol Res 3, 545-553.
Parlee, M.B. (1983). Menstrual rhythms in sensory processes: a review of
fluctuations in vision, olfaction, audition, taste, and touch. Psychol Bull 93, 539-548.
Pluznick, J.L., Zou, D.J., Zhang, X., Yan, Q., Rodriguez-Gil, D.J., Eisner, C., Wells,
E., Greer, C.A., Wang, T., Firestein, S., et al. (2009). Functional expression of the
olfactory signaling system in the kidney. Proc Natl Acad Sci U S A 106, 2059-2064.
Schedin, P., Mitrenga, T., and Kaeck, M. (2000). Estrous cycle regulation of
mammary epithelial cell proliferation, differentiation, and death in the Sprague-
Dawley rat: a model for investigating the role of estrous cycling in mammary
carcinogenesis. J Mammary Gland Biol Neoplasia 5, 211-225.
Smith, M.S., Freeman, M.E., and Neill, J.D. (1975). The control of progesterone
secretion during the estrous cycle and early pseudopregnancy in the rat: prolactin,
gonadotropin and steroid levels associated with rescue of the corpus luteum of
pseudopregnancy. Endocrinology 96, 219-226.

110

Spehr, M., Schwane, K., Riffell, J.A., Zimmer, R.K., and Hatt, H. (2006). Odorant
receptors and olfactory-like signaling mechanisms in mammalian sperm. Mol Cell
Endocrinol 250, 128-136.
VAN DER LEE, S., and BOOT, L.M. (1956). Spontaneous pseudopregnancy in
mice. II. Acta Physiol Pharmacol Neerl 5, 213-215.
Walmer, D.K., Wrona, M.A., Hughes, C.L., and Nelson, K.G. (1992). Lactoferrin
expression in the mouse reproductive tract during the natural estrous cycle:
correlation with circulating estradiol and progesterone. Endocrinology 131, 1458-
1466.
WHITTEN, W.K. (1956). Modification of the oestrous cycle of the mouse by
external stimuli associated with the male. J Endocrinol 13, 399-404.
WHITTEN, W.K. (1958). Modification of the oestrous cycle of the mouse by
external stimuli associated with the male; changes in the oestrous cycle determined
by vaginal smears. J Endocrinol 17, 307-313.
Wood, G.A., Fata, J.E., Watson, K.L., and Khokha, R. (2007). Circulating hormones
and estrous stage predict cellular and stromal remodeling in murine uterus.
Reproduction 133, 1035-1044.
Yamamoto, N., Christenson, L.K., McAllister, J.M., and Strauss, J.F. (2002). Growth
differentiation factor-9 inhibits 3'5'-adenosine monophosphate-stimulated

111

steroidogenesis in human granulosa and theca cells. J Clin Endocrinol Metab 87,
2849-2856.
Yen, H.Y., Gabet, Y., Liu, Y., Martin, A., Wu, N.L., Pike, M.C., Frenkel, B.,
Maxson, R., and Dubeau, L. (2012). Alterations in Brca1 expression in mouse
ovarian granulosa cells have short-term and long-term consequences on estrogen-
responsive organs. Lab Invest 92, 802-811.
Young, J.M., Friedman, C., Williams, E.M., Ross, J.A., Tonnes-Priddy, L., and
Trask, B.J. (2002). Different evolutionary processes shaped the mouse and human
olfactory receptor gene families. Hum Mol Genet 11, 535-546.
Zhang, X., and Firestein, S. (2002). The olfactory receptor gene superfamily of the
mouse. Nat Neurosci 5, 124-133.

112

Chapter 5
SIGNIFICANCE OF HETEROZYGOUS BRCA1 MUTATION IN OVARIAN
GRANULOSA CELLS

113

INTRODUCTION
We have previously observed that mice carrying a Brca1 mutation in their ovarian
granulosa cells are not only exposed to higher estradiol levels during the proestrus
phase of the cycle, but are also subjected to prolonged estradiol exposure, unopposed
by progesterone due to increased proestrus over metestrus length ratio(Hong et al.,
2010). Previous PhD student Hai-Yun Yen then compared hormone target tissues
from mutant and wild type mice to further investigate the biological significance of
the increased estrogen exposure(Yen et al., 2012).
We are using homozygous Brca1 mutation in our experiment to to maximize the
effects of Brca1 inactivation. Whereas in human, germline BRCA1 mutation carriers
are invariably heterozygous. We hypothesized that the effects of a heterozygous
mutation such as present in human BRCA1 mutation carriers would be similar,
although of lesser magnitude, due to decreased gene dosage.
We evaluated the relative effects of heterozygous versus homozygous Brca1
mutations by measuring the expression of enzymes involved in estradiol biosynthesis
in granulosa cells. Protein expression of aromatase and Hsd3B was higher in
granulosa cells of mice carrying a heterozygous mutation in their ovarian granulosa
cells compared to wild type littermates. Further observation that heterozygous
mutant mice showed olfactory receptor gene expression levels that were intermediate
between wild type and homozygous mutant mice at several loci also supported this
idea. Our results indicate although our studies were performed using mice that

114

carried a homozygous Brca1 mutation, the results are relevant to human BRCA1
mutation carriers because our results also show that heterozygous inactivation of
Brca1 is sufficient to increase estrogen biosynthesis by ovarian granulosa cells.

115

MATERIALS AND METHODS
Experimental animals
Animals used for this study were maintained and genotyped as previously
described(Chodankar et al., 2005; Hong et al., 2010).
Measurement of aromatase and Hsd3B expression in ovarian granulosa cells
Mice were inoculated with 5 IU of Pregnant Mare Serum Gonadotropin (PMSG) and
sacrificed after either 24 or 48 hours. Total cellular protein extracts were obtained
from homogenized ovaries, electrophoresed on SDS-gels, and transferred to PVDF
membranes (Biorad) that were hybridized to the following antibodies: polyclonal
goat anti-human 3beta-HSD antibody (Santa Cruz Biotechnology); polyclonal rabbit
anti-human CYP19A antibody (Santa Cruz Biotechnology); and polyclonal rabbit
anti-human GAPDH antibody (Santa Cruz Biotechnology). IRDye 800 CW anti-goat
antibody (LI-COR Biosciences) and IRDye 680 anti-rabbit antibody (LI-COR
Biosciences) were used as secondary antibodies. The membranes were scanned using
the Odyssey Imaging System (LI-COR Biosciences) and infrared signal intensity
was determined using the software package that came with this instrument. Three
determinations of aromatase and Hsd3B expression were made for each experimental
mouse.

116

Measurement of olfactory receptor expression in ovarian granulosa cells
RNAs from Granulosa cells of wide type, heterozygous and homozygous Brca1
mutation mice were extracted, olfactory receptor expression in different groups were
compared as previously described.
Statistical analyses
For differences in aromatase and Hsd3B the data were analyzed by mixed-model
analysis of variance to account for the repeated measurements on each mouse. All
statistical calculations were made using the statistical package Stata 11 (StataCorp,
College Station, TX). All P values quoted are 2-sided.

117

RESULTS AND DISCUSSION
Significance of heterozygous Brca1 mutations in ovarian granulosa cells
aromatase and Hsd3-beta expression
We have already known that two enzymes involved in estradiol biosynthesis,
aromatase and Hsd3B, were expressed at higher levels in the granulosa cells of
mutant mice compared to wild type mice. To test our hypothesis that heterozygous
mutation in granulosa cells would have similar gene dosage effect, we compared the
levels of these enzymes in heterozygous mutant mice to those in either wild type or
mice that carried a homozygous Brca1 mutation. Age-matched mice were inoculated
with PMSG for 24 and 48 hours. Total protein extracts were obtained from the
ovaries of 5 mice in each group at each of these time points and analyzed by
quantitative western blotting using antibodies for Aromatase and Hsd3B. These
studies were repeated in 3 independent experiments, each using 5 mice per group.
The results were normalized to levels of GAPDH, a house-keeping gene used as
control (Figure 3). The difference in expression of either aromatase or Hsd3B
between wild type and heterozygous mutant mice was significant (2-sided P = .019
and .006 respectively) and intermediate between that of wild type and homozygous
mutant mice for both proteins at the 24 hour time point. The differences at the 48
hour time point were only of borderline significance (2-sided P = .089 and .054
respectively) because of increased mouse to mouse variation, possibly due to
clearing of some of the inoculated gonadotropins at this time point. The trend for a

118

correlation between increased expression of Aromatase and Hsd3B and decreased
Brca1 gene dosage remained significant at both time points 2-sided P
aromatase- 24 hours

= .005; 2-sided P
aromatase- 48 hours
< .0001; 2-sided P
Hsd3B- 24 hours
< .00001; 2-sided
P
Hsd3B- 48 hours
= .019).

119

Figure 1: Consequences of a heterozygous Brca1 mutation on expression of
aromatase and Hsd3-beta by granulosa cells. Mice carrying either zero (Brca1
+/+
),
one (Brca1
+/-
), or two (Brca1
-/-
) mutant alleles of Brca1 in their ovarian granulosa
cells were inoculated with 5 IU PMSG for either 24 (left panel) or 48 (right panel)
hours. Five mice were used in each group. The ovaries were collected, homogenized
and total cellular proteins were extracted. Aromatase (top) and Hsd3-beta (bottom)
protein levels were measured by quantitative western blot analyses as detailed in the
methodology section. Each bar represents the average of 3 independent experiments,
each using 5 different sets of mice in each group.

120

Significance of heterozygous Brca1 mutations in ovarian granulosa cells
olfactory receptors RNA expression at different loci
Similarly, granulosa cells from wild type, heterozygous and homozygous Brca1
knockout age matched littermates were microdissected and RNAs were extracted,
expression of olfactory receptors at different loci were compared using q-RT-PCR,
GAPDH was used as internal control. As shown in Figure 2, expression of olfactory
receptors in heterozygous Brca1 knockout was in between wild type and
homozygous Brca1 knockout group. These results show that heterozygous
inactivation of Brca1 is sufficient to influence the enzymatic machinery underlying
estrogen metabolism and thus support the view that heterozygous mutations in
human BRCA1 mutation carriers are biologically significant, even in cancer-free
individuals.

121

Figure 2: Further evidence of the phenotype of heterozygous mutant is
intermediate of wild type and homozygous mutant. The mRNA levels of
representative olfactory receptor loci from Wild type, Heterzygous mutant and
homozygous mutant groups were analyzed by real-time quantitative RT-PCR. The
real-time PCR was performed using a SYBR super mix kit. The melting curve data
were collected to check the PCR specificity. Each cDNA sample was analyzed in
triplicate. Gene expression values (relative mRNA levels) are expressed as ratios
between the genes of interest and an internal reference gene (GAPDH) that provides
a normalization factor for the amount of RNA isolated from a specimen. All data are
shown as mean ± SD, Student's t-test was applied for statistical analysis. All p values
quoted are two-sided. The results show for each locus, expression in heterozygous
mutant mice is intermediate between wild type and homozygous mutant.

122

Our results show that, mice carrying a heterozygous granulosa cell specific Brca1
mutation showed expression levels of two enzymes important for estradiol
biosynthesis that were significantly different from the levels in wild type mice and
that were intermediate between those in wild type and homozygous mutant mice.
This is also evidenced by the fact that the intermediate expression level of olfactory
receptors of heterozygous Brca1 knockout mice between wild type and homozygous
mutant mice. In addition to supporting our hypothesis, these results imply that the
heterozygous mutation present in the germline of BRCA1 mutation carriers is not
only associated with cancer predisposition, but results in measurable phenotypic
manifestations even in people who do not develop cancer. An understanding of the
full biological implications of the BRCA1 mutation carrier state in humans may have
a profound impact on approaches to evaluate breast and ovarian cancer
predisposition in selected populations as well as on the clinical management of
BRCA1 mutation carriers.

123

REFERENCES
Chodankar, R., Kwang, S., Sangiorgi, F., Hong, H., Yen, H.Y., Deng, C., Pike, M.C.,
Shuler, C.F., Maxson, R., and Dubeau, L. (2005). Cell-nonautonomous induction of
ovarian and uterine serous cystadenomas in mice lacking a functional Brca1 in
ovarian granulosa cells. Curr Biol 15, 561-565.
Hong, H., Yen, H.Y., Brockmeyer, A., Liu, Y., Chodankar, R., Pike, M.C., Stanczyk,
F.Z., Maxson, R., and Dubeau, L. (2010). Changes in the mouse estrus cycle in
response to BRCA1 inactivation suggest a potential link between risk factors for
familial and sporadic ovarian cancer. Cancer Res 70, 221-228.
Yen, H.Y., Gabet, Y., Liu, Y., Martin, A., Wu, N.L., Pike, M.C., Frenkel, B.,
Maxson, R., and Dubeau, L. (2012). Alterations in Brca1 expression in mouse
ovarian granulosa cells have short-term and long-term consequences on estrogen-
responsive organs. Lab Invest 92, 802-811.

124

SUMMARY
Ovarian cancers are notoriously difficult to treat and are the leading cause of death
from gynecological cancers in the U.S. More than 70% of the patients are diagnosed
with disseminated disease and early diagnosis is crucial for increasing survival.
Progress in elucidating early events in tumor genesis has been hampered by the lack
of a good animal model and the exact site of origin is unknown.
In this thesis work we examined the exact contribution of mullerian ducts. Our data
suggested ovarian surface epithelium is not embryologically related to the mullerian
ducts. However, we did provide a novel embryological relationship between the
mullerian duct and kidney collecting duct system. This is relevant to the
understanding of gender specific differences in kidney function, and it also suggested
that mesonephric remnants, which are common in the paratubal and paraovarian
regions, should be regarded as components of extra uterine mullerian epithelium and
may play a role in the histogenesis of clear cell ovarian carcinoma.
We also created Fshr-Cre; Brca1 flox/flox; Mis2r-Cre; p53 flox/flox mice to test for
a cooperative interaction between p53 and Brca1 in ovarian tumorigenesis. Rather
than leiomyosarcoma developed in mouse models created by other research groups,
60% of the double conditional knockout mice in our model developed flank tumor
that is epithelial in nature. Our mouse model is interesting not only because it is
relevant to human familial cancer predisposition in BRCA1 mutation carriers as
majority of them also carry p53 mutation, but the morphological features of the

125

tumors resemble human serous carcinoma make it a useful tool to study the early
events during ovarian tumor formation.
Another novel finding came from gene profiling study in mice with Brca1
inactivation in ovarian granulosa cells. Here for the first time, we reported the
expression of olfactory receptors in granulosa cells from mice and human. Our data
also suggested that frequency of menstral/estrous cycle activity, and estrogen
production may be regulated by olfactory receptors expression in the ovary, and
these may contribute to ovarian tumor formation in our animal model.
In our studies, we used homozygous Brca1 mutation in granulosa cells to maximize
the effects of Brca1 inactivation. Our data also suggested although of a lesser
magnitude, the effects of heterozygous mutation such as present in human BRCA1
mutation carriers would be similar. This implies heterozygous mutation in human
BRCA1 mutation carriers is not only associated with cancer predisposition, but
results in measurable phenotypic manifestations even in people who do not develop
cancer.

126

FUTURE DIRECTIONS
To demonstrate the physical link between müllerian duct and mesonephros and
to further test our hypothesis that ovarian clear cell carcinoma and renal clear
cell carcinoma are embryologically related
Our result showed that the müllerian ducts and metanephric tubules are
embryologically related also has implications regarding the origin of a subtype of
ovarian epithelial tumors-clear cell tumors, for which a normal müllerian counterpart
has been difficult to assign. Ovarian clear cell carcinoma is not only morphologically
similar to clear cell renal cell carcinoma, which is a distinct subtype of renal cell
carcinoma originating from the lining of the proximal convoluted of kidney. Recent
studies also showed that their expression profile and response to chemotherapy
regimens are similar (Zorn et al., 2005; Anglesio et al., 2011).
Finding out the exact link between the two structures will not only increase our
knowledge in müllerian ducts and kidney development, but more importantly, help
us to explain gender differences in kidney function and disease, and identify the
normal counterpart for ovarian clear cell carcinomas. We will use a ksp16-Cre
transgene crossed with R26R GFP mice to visualize and demonstrate the physical
link. ksp16-Cre is a kidney specific Cre and recent data suggested it also expressed
in the müllerian duct(Shao et al., 2002; Wertz and Herrmann, 1999). We will collect
embryos at different stages during müllerian ducts development and look carefully
for any physical link between the two structures.

127

There is already molecular evidence supporting other major histological subtypes of
ovarian carcinomas are associated with an extra uterine müllerian epithelial structure
(Cheng et al., 2005). Thus we will also compare gene expression profile of ovarian
clear cell carcinomas with that of the collecting duct and mesonephric remnants in
the para-ovarian and para-tubal areas (which we believe are components of extra
uterine müllerian epithelium-the origin of ovarian carcinomas) to test whether they
are of the similar differentiation lineage.
To test the hypothesis that ovarian epithelial tumors are of müllerian origin and
not of coelomic origin using the mouse model based on a Brca1 gene knockout
targeted to ovarian granulosa cells
We are going to take the advantage of the mouse model carrying a conditional Brca1
mutation targeted to their ovarian granulosa cells (Fshr-Cre; Brca1 flox/flox). We
will test the müllerian hypothesis or coelomic hypothesis by crossing the mice with
R26R reporter mice, then crossed with Mis2r-Cre and Mis2r-β–Gal or inoculated
with a lentiviral construct expressing Cre recombinase under the control of CMV
promoter either in the ovarian bursa or peri-uterine spaces. The viruses inoculated
into the bursa will infect the coelomic epithelium lining the ovarian surface while the
viruses inoculated around the uterine horns will infect peritoneal surfaces
surrounding the uterus and ovaries. Mice will be sacrificed at 14-15 months and the
anticipated tumors will be stained for LacZ to trace their site of origin.

128

We would conclude the epithelial tumors we observed in this mouse model are
indeed derived from müllerian epithelium if lacZ staining was consistently observed
in tumors crossed with mice expressing Mis2r-Cre transgene when R26R allele is
present (Mis2r-Cre; R26R
lacZ
). If the lacZ staining was seen in tumors crossed with
Mis2r-Cre; R26R
lacZ
mice, but not seen with Mis2r-β–Gal transgene, that would
indicate the tumors although arising in müllerian derived tissues, do not necessarily
arise from cells that retain full differentiation in adults. Similarly, we would
conclude the tumors are of ovarian coelomic origin if lacZ staining was observed in
tumors of mice with lentivirus inoculated in the ovarian bursa or of peritoneal origin
with lentivirus inoculated in peri-uterine and peri-ovary region.
To test the hypothesis cooperation of p53 and Brca1 will result in ovarian
carcinomas similar to human serous ovarian carcinoma and to further test the
exact site of origin of the tumors
Due to the fact that majority of breast and ovarian cancer in humans BRCA1 carriers
have p53 mutation (Schuyer and Berns, 1999; Smith et al., 1992), we hypothesized
that additional mutations involve the müllerian duct will be needed for ovarian
carcinoma development. Also due to the long tumor latency period and benign nature
of the epithelial tumors developed in mice carrying Brca1 mutation in ovarian
granulosa cells, we introduce p53 mutation in müllerian ducts derived tissues, which
we believe are the cell of origin of ovarian tumors to achieve malignant
transformation. In our mouse model, Mis2r-Cre; p53 flox/flox; Fshr-cre; Brca1

129

flox/flox, mice carry P53 and Brca1 mutations in both granulosa cells and müllerian
tissues. The fact that sixty percent of double knockout mice developed epithelial
tumors in mice carrying the additional mutations in their müllerian tract, which was
further evidenced by the p53 and Brca1 rearrangement in müllerian derived tissues
suggested the importance of müllerian ducts over coelomic epithelium in ovarian
tumorigenesis.
We can further take the advantage of lentiviral construct to target p53 and Brca1
mutations to coelomic epithelium covering either the ovarian epithelial surface or the
para-uterine and para-ovarian tissues, in order to directly test the coelomic
epithelium hypothesis.
To characterize the response of the oviduct to the hormonal fluctuations
associated with estrous cycle and to investigate the predisposing mechanisms to
ovarian tumorigenesis regulated by hormonal changes
We will compare microarray-based global gene expression in oviducts (more
scientists believe the human counterpart-fimbrial of fallopian tube is an important
site of human serous ovarian carcinoma) and tumor samples in mice synchronized
with either PMSG (pregnant mare's serum gonadotropin) or PMSG+hCG (human
chorionic gonadotropin). PMSG will induce follicular growth and mimic the
proestrus phase in murine estrus cycle; while PMSG+hCG will induce ovulation and
mimic the metestrus phase. The information gathered will not only augment our
understanding of the biology of oviductal (fimbrial) epithelium, but also will provide

130

us insights into the mechanisms of ovarian tumorigenesis in sporadic population as
menstral cycle activity is the most important risk factor for ovarian cancer.
We will collect tumors from 14 months old Mis2r-Cre; p53 flox/flox; Fshr-cre;
Brca1 flox/flox mice and normal oviducts from their littermate controls carrying only
one or none of the two mutations. The mice were inoculated with 10IU PMSG 48hrs
or followed by another 10IU hCG 24 hrs before they were sacrificed. Epithelial cells
from different tissues were microdissected using a laser capture microdissection
instrument, RNA was extracted using mirVana mirRNA isolation kit from Ambion,
which will allow recovery of microRNA in addition to high molecular weight RNA.
We will use Affymetrix GeneChips Mouse Exon 1.0 ST Array and the results will be
analyzed using the Genetrix software program which is designed to detect
differences in individual signaling pathways between cells, and to allow mapping of
these genes to both established and user-defined signaling pathways. We are going to
focus on the individual genes and pathways with the greatest magnitude of change at
different phases of the estrus cycle, possibly those associated with steroid hormone
metabolism or signaling. Once the gene or pathway of interest has been identified
differentially regulated at different stages of estrus cycles, we will confirm the
microarray data by quantitative RT-PCR, western blot, immunohistochemistry etc.
We can then follow up and investigate the mechanisms of regulation by hormonal
changes and their potential roles in ovarian tumorigenesis. This global assessment of

131

molecular changes in this model will lead to identification of key gene functions
implicated in human ovarian cancer.
MicroRNAs (miRNA), are known to be dysregulated in many tumors and associated
with aggressive or poor prognosis phenotypes, they can negatively regulate gene
expression either by degradation of target mRNAs or by posttranscriptional
repression. It has also been shown that miRNA suppress proliferation and soft-agar
colony formation in neoplastic epithelial ovarian cells. This made it interesting for us
to examine the miRNA alteration in our mouse model (Miles et al., 2012).
Other approaches to develop mouse model of serous ovarian carcinomas by
incorporating p53 mutation in müllerian ducts derived tissue in mice carrying
Brca1 mutation in granulosa cells
As previously mentioned, when Mis2r-Cre knock in mice were crossed with Brca1
flox/flox and p53 flox/flox mice; the resulting mice develop uterine leiomyosarcoma
rather than ovarian epithelial tumors. This could be explained by activation of Cre
recombinase driven by expression of Mis2r at any time after the mouse was
conceived. P53 and Brca1 knockout took place once the Mis2r has ever been
expressed. One of the other strategies is to generate a mouse model in which HPV
E6 was directly under control of Mis2r. In the final construct only the cells currently
express Mis2r can drive the expression of E6 and thus inactivate p53, not any cells
during development.

132

To further investigate the role of olfactory receptors in ovary function and
tumorigenesis
Our preliminary data suggested the presence of olfactory receptors in human
granulosa cells at RNA level. We sought to further determine the activity and
function of these olfactory receptors.
We will culture primary human granulosa cells, and perform series of experiments to
determine the signaling pathway involved in olfactory receptor functioning. We can
stimulate cells with two synthetic mouse-pheromone candidates: 2 dihydrothiazole
and dehydro-exo-brevicomin, which have been previously identified to be
responsible for the Whitten effect. We can assay for estrogen production and Fshr
receptor expression before and after odorant stimulation.
Olfactory receptor expression profile in BRCA1 mutation carriers and general
population stratified with age, ethnicity, cancer history, cycle history etc. may help
us determine whether olfactory receptor(s) expression can be used as a potential
predictor for ovarian tumor formation.
We can also perform immunoprecipitation followed by mass spectrometry to identify
the ligands for olfactory receptors; the ligand agonist can be potentially used as
pharmaceutical target to block the tumorigenesis pathway in the ovary. Components
of the signaling pathway involved can also be identified and used as a treatment
targets not only for ovarian tumor but also for developmental sexual dysfunction of
puberty and fertility.

133

BIBLIOGRAPHY

Anglesio, M.S., George, J., Kulbe, H., Friedlander, M., Rischin, D., Lemech, C.,
Power, J., Coward, J., Cowin, P.A., House, C.M., et al. (2011). IL6-STAT3-HIF
signaling and therapeutic response to the angiogenesis inhibitor sunitinib in ovarian
clear cell cancer. Clin Cancer Res 17, 2538-2548.
Baarends, W.M., Uilenbroek, J.T., Kramer, P., Hoogerbrugge, J.W., van Leeuwen,
E.C., Themmen, A.P., and Grootegoed, J.A. (1995). Anti-mullerian hormone and
anti-mullerian hormone type II receptor messenger ribonucleic acid expression in rat
ovaries during postnatal development, the estrous cycle, and gonadotropin-induced
follicle growth. Endocrinology 136, 4951-4962.
Bast, R.C., Hennessy, B., and Mills, G.B. (2009). The biology of ovarian cancer:
new opportunities for translation. Nat Rev Cancer 9, 415-428.
Bast, R.C., Klug, T.L., John, E.S., Jenison, E., Niloff, J.M., Lazarus, H., Berkowitz,
R.S., Leavitt, T., Griffiths, C.T., Parker, L., et al. (1983). A Radioimmunoassay
Using a Monoclonal Antibody to Monitor the Course of Epithelial Ovarian Cancer.
New England Journal of Medicine 309, 883-887.
Belteki, G., Haigh, J., Kabacs, N., Haigh, K., Sison, K., Costantini, F., Whitsett, J.,
Quaggin, S.E., and Nagy, A. (2005). Conditional and inducible transgene expression
in mice through the combinatorial use of Cre-mediated recombination and
tetracycline induction Nucleic Acids Res 33, e51.

134

Berchuck, Cirisano, Lancaster, Schildkraut, Wiseman, Futreal, and Marks (1996).
Role of BRCA1 mutation screening in the management of familial ovarian cancer.
American Journal of Obstetrics and Gynecology 175, 738-746.
Brugger, S.M., Merrill, A.E., Torres-Vazquez, J., Wu, N., Ting, M.C., Cho, J.Y.,
Dobias, S.L., Yi, S.E., Lyons, K., Bell, J.R., et al. (2004). A phylogenetically
conserved cis-regulatory module in the Msx2 promoter is sufficient for BMP-
dependent transcription in murine and Drosophila embryos. Development 131, 5153-
5165.
Buck, L., and Axel, R. (1991). A novel multigene family may encode odorant
receptors: a molecular basis for odor recognition. Cell 65, 175-187.
Chai, Y.L., Cui, J., Shao, N., Shyam, E., Reddy, P., and Rao, V.N. (1999). The
second BRCT domain of BRCA1 proteins interacts with p53 and stimulates
transcription from the p21WAF1/CIP1 promoter. Oncogene 18, 263-268.
Champlin, A.K., Dorr, D.L., and Gates, A.H. (1973). Determining the stage of the
estrous cycle in the mouse by the appearance of the vagina. Biol Reprod 8, 491-494.
Cheng, W., Liu, J., Yoshida, H., Rosen, D., and Naora, H. (2005). Lineage infidelity
of epithelial ovarian cancers is controlled by HOX genes that specify regional
identity in the reproductive tract. Nat Med 11, 531-537.
Chodankar, R., Kwang, S., Sangiorgi, F., Hong, H., Yen, H.Y., Deng, C., Pike, M.C.,
Shuler, C.F., Maxson, R., and Dubeau, L. (2005). Cell-nonautonomous induction of

135

ovarian and uterine serous cystadenomas in mice lacking a functional Brca1 in
ovarian granulosa cells. Curr Biol 15, 561-565.
Clark-Knowles, K.V., Senterman, M.K., Collins, O., and Vanderhyden, B.C. (2009).
Conditional inactivation of Brca1, p53 and Rb in mouse ovaries results in the
development of leiomyosarcomas. PLoS One 4, e8534.
Connolly, D.C., Bao, R., Nikitin, A.Y., Stephens, K.C., Poole, T.W., Hua, X., Harris,
S.S., Vanderhyden, B.C., and Hamilton, T.C. (2003). Female mice chimeric for
expression of the simian virus 40 TAg under control of the MISIIR promoter develop
epithelial ovarian cancer. Cancer Res 63, 1389-1397.
Cornelis, R.S., Neuhausen, S.L., Johansson, O., Arason, A., Kelsell, D., Ponder, B.A.,
Tonin, P., Hamann, U., Lindblom, A., and Lalle, P. (1995). High allele loss rates at
17q12-q21 in breast and ovarian tumors from BRCAl-linked families. The Breast
Cancer Linkage Consortium. Genes Chromosomes Cancer 13, 203-210.
Cramer, D.W. (1983). Mumps, menarche, menopause, and ovarian cancer. American
journal of obstetrics and gynecology 147, 1-6.
Crum, C.P., Drapkin, R., Miron, A., Ince, T.A., Muto, M., Kindelberger, D.W., and
Lee, Y. (2007). The distal fallopian tube: a new model for pelvic serous
carcinogenesis. Opinion Obstet Gynecol 19, 3-9.

136

De Palo, G., Mariani, L., Camerini, T., Marubini, E., Formelli, F., Pasini, B., Decensi,
A., and Veronesi, U. (2002). Effect of Fenretinide on Ovarian Carcinoma
Occurrence. Gynecologic Oncology 86, 24-27.
De Palo, G., Veronesi, U., Camerini, T., Formelli, F., Mascotti, G., Boni, C., Fosser,
V., Vecchio, M.D., Campa, T., Costa, A., et al. (1995). Can Fenretinide Protect
Women Against Ovarian Cancer? Journal of the National Cancer Institute 87, 146-
147.
Dubeau, L. (1999). The cell of origin of ovarian epithelial tumors and the ovarian
surface epithelium dogma: does the emperor have no clothes? Gynecol Oncol 72,
437-442.
Dubeau, L. (2008). The cell of origin of ovarian epithelial tumours. Lancet Oncol 9,
1191-1197.
Fan, H.Y., Liu, Z., Paquet, M., Wang, J., Lydon, J.P., DeMayo, F.J., and Richards,
J.S. (2009). Cell type-specific targeted mutations of Kras and Pten document
proliferation arrest in granulosa cells versus oncogenic insult to ovarian surface
epithelial cells. Cancer Res 69, 6463-6472.
Feldmesser, E., Olender, T., Khen, M., Yanai, I., Ophir, R., and Lancet, D. (2006).
Widespread ectopic expression of olfactory receptor genes. BMC Genomics 7, 121.

137

Ferrand, N., Pessah, M., Frayon, S., Marais, J., and Garel, J.M. (1999). Olfactory
receptors, Golf alpha and adenylyl cyclase mRNA expressions in the rat heart during
ontogenic development. J Mol Cell Cardiol 31, 1137-1142.
Finch, A., Beiner, M., Lubinski, J., Lynch, H.T., Moller, P., Rosen, B., Murphy, J.,
Ghadirian, P., Friedman, E., Foulkes, W.D., et al. (2006). Salpingo-oophorectomy
and the risk of ovarian, fallopian tube, and peritoneal cancers in women with a
BRCA1 or BRCA2 Mutation. JAMA 296, 185-192.
Firestein, S. (2001). How the olfactory system makes sense of scents. Nature 413,
211-218.
Flesken-Nikitin, A., Choi, K.C., Eng, J.P., Shmidt, E.N., and Nikitin, A.Y. (2003).
Induction of carcinogenesis by concurrent inactivation of p53 and Rb1 in the mouse
ovarian surface epithelium. Cancer Res 63, 3459-3463.
Franceschi, S. (1991). Pooled analysis of 3 European case-control studies of
epithelial ovarian cancer: III. Oral contraceptive use. International journal of cancer
49, 61-65.
Frank, T.S. (1998). Sequence analysis of BRCA1 and BRCA2: correlation of
mutations with family history and ovarian cancer risk. Journal of clinical oncology
16, 2417-2425.

138

Goto, T., Salpekar, A., and Monk, M. (2001). Expression of a testis-specific member
of the olfactory receptor gene family in human primordial germ cells. Mol Hum
Reprod 7, 553-558.
Griswold, M.D., Heckert, L., and Linder, C. (1995). The molecular biology of the
FSH receptor. J Steroid Biochem Mol Biol 53, 215-218.
Grote, D., Souabni, A., Busslinger, M., and Bouchard, M. (2006). Pax 2/8-regulated
Gata 3 expression is necessary for morphogenesis and guidance of the nephric duct
in the developing kidney. Development 133, 53-61.
Grunwald, P. (1941). The relation of the growing mullerian duct to the wolffian duct
and its importance for the genesis of malformations. Anat Rec 81, 1-19.
Guioli, S., Sekido, R., and Lovell-Badge, R. (2007). The origin of the Mullerian duct
in chick and mouse. Dev Biol 302, 389-398.
Helzlsouer Kj, B.T.L.A.A.J.B.K.Z.H.C.G.W. (1993). PRospective study of serum ca-
125 levels as markers of ovarian cancer. JAMA 269, 1123-1126.
Hong, H., Yen, H.Y., Brockmeyer, A., Liu, Y., Chodankar, R., Pike, M.C., Stanczyk,
F.Z., Maxson, R., and Dubeau, L. (2010). Changes in the mouse estrus cycle in
response to BRCA1 inactivation suggest a potential link between risk factors for
familial and sporadic ovarian cancer. Cancer Res 70, 221-228.
Jabara, S., Christenson, L.K., Wang, C.Y., McAllister, J.M., Javitt, N.B., Dunaif, A.,
and Strauss, J.F. (2003). Stromal cells of the human postmenopausal ovary display a

139

distinctive biochemical and molecular phenotype. J Clin Endocrinol Metab 88, 484-
492.
Jemiolo, B., Harvey, S., and Novotny, M. (1986). Promotion of the Whitten effect in
female mice by synthetic analogs of male urinary constituents. Proc Natl Acad Sci U
S A 83, 4576-4579.
Josso, N., di Clemente, N., and Gouédard, L. (2001). Anti-Müllerian hormone and its
receptors. Mol Cell Endocrinol 179, 25-32.
Kothary, R., Clapoff, S., Darling, S., Perry, M.D., Moran, L.A., and Rossant, J.
(1989). Inducible expression of an hsp68-lacZ hybrid gene in transgenic mice.
Development 105, 707-714.
Lacey, J.J.V.M.P.J.L.J.H., and et al. (2002). MEnopausal hormone replacement
therapy and risk of ovarian cancer. JAMA 288, 334-341.
Lauchlan, S.C. (1994). The secondary müllerian system revisited. Int J Gynecol
Pathol 13, 73-79.
Lei, L., Jin, S., Mayo, K.E., and Woodruff, T.K. (2010). The interactions between
the stimulatory effect of follicle-stimulating hormone and the inhibitory effect of
estrogen on mouse primordial folliculogenesis. Biol Reprod 82, 13-22.
Levine, D.A., Argenta, P.A., Yee, C.J., Marshall, D.S., Olvera, N., Bogomolniy, F.,
Rahaman, J.A., Robson, M.E., Offit, K., Barakat, R.R., et al. (2003). Fallopian tube

140

and primary peritoneal carcinomas associated with BRCA mutations. J Clin Oncol
21, 4222-4227.
Liu, X., Holstege, H., van der Gulden, H., Treur-Mulder, M., Zevenhoven, J., Velds,
A., Kerkhoven, R.M., van Vliet, M.H., Wessels, L.F.A., Peterse, J.L., et al. (2007).
Somatic loss of BRCA1 and p53 in mice induces mammary tumors with features of
human BRCA1-mutated basal-like breast cancer. Proceedings of the National
Academy of Sciences 104, 12111-12116.
Mann, W.J., Patsner, B., Cohen, H., and Loesch, M. (1988). Preoperative Serum CA-
125 Levels in Patients With Surgical Stage I Invasive Ovarian Adenocarcinoma.
Journal of the National Cancer Institute 80, 208-209.
Mao, J., Zhang, X., Sieli, P.T., Falduto, M.T., Torres, K.E., and Rosenfeld, C.S.
(2010). Contrasting effects of different maternal diets on sexually dimorphic gene
expression in the murine placenta. Proc Natl Acad Sci U S A 107, 5557-5562.
Marshall, J.R., and Henkin, R.I. (1971). Olfactory acuity, menstrual abnormalities,
and oocyte status. Ann Intern Med 75, 207-211.
Mombaerts, P. (2001). The human repertoire of odorant receptor genes and
pseudogenes. Annu Rev Genomics Hum Genet 2, 493-510.
Mueller, R.F. (1994). The Denys-Drash syndrome. J Med Genet 31, 471-477.
Network, C.G.A.R. (2011). Integrated genomic analyses of ovarian carcinoma.
Nature 474, 609-615.

141

Neuhaus, E.M., Zhang, W., Gelis, L., Deng, Y., Noldus, J., and Hatt, H. (2009).
Activation of an olfactory receptor inhibits proliferation of prostate cancer cells. J
Biol Chem 284, 16218-16225.
Neuhausen, S.L., and Marshall, C.J. (1994). Loss of heterozygosity in familial
tumors from three BRCA1-linked kindreds. Cancer Res 54, 6069-6072.
Olender, T., Feldmesser, E., Atarot, T., Eisenstein, M., and Lancet, D. (2004). The
olfactory receptor universe--from whole genome analysis to structure and evolution.
Genet Mol Res 3, 545-553.
Olivier, R.I., van Beurden, M., Lubsen, M.A., Rookus, M.A., Mooij, T.M., van de
Vijver, M.J., and van't Veer, L.J. (2004). Clinical outcome of prophylactic
oophorectomy in BRCA1/BRCA2 mutation carriers and events during follow-up. Br
J Cancer 90, 1492-1497.
Orsulic, S., Li, Y., Soslow, R.A., Vitale-Cross, L.A., Gutkind, J.S., and Varmus, H.E.
(2002). Induction of ovarian cancer by defined multiple genetic changes in a mouse
model system. Cancer Cell 1, 53-62.
Orvis, G.D., and Behringer, R.R. (2007). Cellular mechanisms of Mullerian duct
formation in the mouse. Dev Biol 306, 493-504.
Ouchi, T., Monteiro, A.N., August, A., Aaronson, S.A., and Hanafusa, H. (1998).
BRCA1 regulates p53-dependent gene expression. Proc Natl Acad Sci U S A 95,
2302-2306.

142

Parazzini, F. (1991). The epidemiology of ovarian cancer. Gynecologic Oncology 43,
15.
Parlee, M.B. (1983). Menstrual rhythms in sensory processes: a review of
fluctuations in vision, olfaction, audition, taste, and touch. Psychol Bull 93, 539-548.
Pietila, I., and Vainio, S. (2005). The embryonic aorta-gonad-mesonephros region as
a generator of haematopoietic stem cells. APMIS 113, 804-812.
Pluznick, J.L., Zou, D.J., Zhang, X., Yan, Q., Rodriguez-Gil, D.J., Eisner, C., Wells,
E., Greer, C.A., Wang, T., Firestein, S., et al. (2009). Functional expression of the
olfactory signaling system in the kidney. Proc Natl Acad Sci U S A 106, 2059-2064.
Pole, R.J., Qi, B.Q., and Beasley, S.W. (2002). Patterns of apoptosis during
degeneration of the pronephros and mesonephros. J Urol 167, 269-271.
Quinn, B.A., Brake, T., Hua, X., Baxter-Jones, K., Litwin, S., Ellenson, L.H., and
Connolly, D.C. (2009). Induction of ovarian leiomyosarcomas in mice by conditional
inactivation of Brca1 and p53. PLoS One 4, e8404.
Reckelhoff, J.F., and Maric, C. (2010). Sex and gender differences in
cardiovascular–renal physiology and pathophysiology. Steroids 75, 745-746.
Risch, H.A., Marrett, L.D., and Howe, G.R. (1994). Parity, contraception, infertility,
and the risk of epithelial ovarian cancer. Am J Epidemiol 140, 585-597.

143

Rodriguez, M., and Dubeau, L. (2001). Ovarian tumor development: insights from
ovarian embryogenesis. Eur J Gynaecol Oncol 22, 175-183.
Sainio, K., Hellstedt, P., Kreidberg, J.A., Saxen, L., and Sariola, H. (1997).
Differential regulation of two sets of mesonephric tubules by WT-1. Development
124, 1293-1299.
Schedin, P., Mitrenga, T., and Kaeck, M. (2000). Estrous cycle regulation of
mammary epithelial cell proliferation, differentiation, and death in the Sprague-
Dawley rat: a model for investigating the role of estrous cycling in mammary
carcinogenesis. J Mammary Gland Biol Neoplasia 5, 211-225.
Schuyer, M., and Berns, E.M.J.J. (1999). Is TP53 dysfunction required for BRCA1-
associated carcinogenesis? Molecular and Cellular Endocrinology 155, 143-152.
Scully, R.E. (1995). Pathology of ovarian cancer precursors. J Cell Biochem Suppl
23, 208-218.
Segev, D.L., Hoshiya, Y., Stephen, A.E., Hoshiya, M., Tran, T.T., MacLaughlin,
D.T., Donahoe, P.K., and Maheswaran, S. (2001). MÃ¼llerian Inhibiting Substance
Regulates NFKB Signaling and Growth of Mammary Epithelial Cells in Vivo.
Journal of Biological Chemistry 276, 26799-26806.
Shao, X., Somlo, S., and Igarashi, P. (2002). Epithelial-specific Cre/lox
recombination in the developing kidney and genitourinary tract. J Am Soc Nephrol
13, 1837-1846.

144

Smith, M.S., Freeman, M.E., and Neill, J.D. (1975). The control of progesterone
secretion during the estrous cycle and early pseudopregnancy in the rat: prolactin,
gonadotropin and steroid levels associated with rescue of the corpus luteum of
pseudopregnancy. Endocrinology 96, 219-226.
Smith, S.A., Easton, D.F., Evans, D.G., and Ponder, B.A. (1992). Allele losses in the
region 17q12-21 in familial breast and ovarian cancer involve the wild-type
chromosome. Nat Genet 2, 128-131.
Soriano, P. (1999). Generalized lacZ expression with the ROSA26 Cre reporter
strain. Nat Genet 21, 70-71.
Spehr, M., Schwane, K., Riffell, J.A., Zimmer, R.K., and Hatt, H. (2006). Odorant
receptors and olfactory-like signaling mechanisms in mammalian sperm. Mol Cell
Endocrinol 250, 128-136.
Torres, M., Gomez-Pardo, E., Dressler, G.R., and Gruss, P. (1995). Pax-2 controls
multiple steps of urogenital development. Development 121, 4057-4065.
VAN DER LEE, S., and BOOT, L.M. (1956). Spontaneous pseudopregnancy in
mice. II. Acta Physiol Pharmacol Neerl 5, 213-215.
Walmer, D.K., Wrona, M.A., Hughes, C.L., and Nelson, K.G. (1992). Lactoferrin
expression in the mouse reproductive tract during the natural estrous cycle:
correlation with circulating estradiol and progesterone. Endocrinology 131, 1458-
1466.

145

Wertz, K., and Herrmann, B.G. (1999). Kidney-specific cadherin (cdh16) is
expressed in embryonic kidney, lung, and sex ducts. Mech Dev 84, 185-188.
WHITTEN, W.K. (1956). Modification of the oestrous cycle of the mouse by
external stimuli associated with the male. J Endocrinol 13, 399-404.
WHITTEN, W.K. (1958). Modification of the oestrous cycle of the mouse by
external stimuli associated with the male; changes in the oestrous cycle determined
by vaginal smears. J Endocrinol 17, 307-313.
Wood, G.A., Fata, J.E., Watson, K.L., and Khokha, R. (2007). Circulating hormones
and estrous stage predict cellular and stromal remodeling in murine uterus.
Reproduction 133, 1035-1044.
Xing, D., Scangas, G., Nitta, M., He, L., Xu, X., Ioffe, Y.J., Aspuria, P.J., Hedvat,
C.Y., Anderson, M.L., Oliva, E., et al. (2009). A role for BRCA1 in uterine
leiomyosarcoma. Cancer Res 69, 8231-8235.
Yamamoto, N., Christenson, L.K., McAllister, J.M., and Strauss, J.F. (2002). Growth
differentiation factor-9 inhibits 3'5'-adenosine monophosphate-stimulated
steroidogenesis in human granulosa and theca cells. J Clin Endocrinol Metab 87,
2849-2856.
Yen, H.Y., Gabet, Y., Liu, Y., Martin, A., Wu, N.L., Pike, M.C., Frenkel, B.,
Maxson, R., and Dubeau, L. (2012). Alterations in Brca1 expression in mouse

146

ovarian granulosa cells have short-term and long-term consequences on estrogen-
responsive organs. Lab Invest 92, 802-811.
Young, J.M., Friedman, C., Williams, E.M., Ross, J.A., Tonnes-Priddy, L., and
Trask, B.J. (2002). Different evolutionary processes shaped the mouse and human
olfactory receptor gene families. Hum Mol Genet 11, 535-546.
Zhang, X., and Firestein, S. (2002). The olfactory receptor gene superfamily of the
mouse. Nat Neurosci 5, 124-133.
Zorn, K.K., Bonome, T., Gangi, L., Chandramouli, G.V., Awtrey, C.S., Gardner,
G.J., Barrett, J.C., Boyd, J., and Birrer, M.J. (2005). Gene expression profiles of
serous, endometrioid, and clear cell subtypes of ovarian and endometrial cancer. Clin
Cancer Res 11, 6422-6430.

Abstract (if available)

Abstract Ovarian cancers are the leading cause of death from gynecological cancer in the U.S. and more than 70% of the patients are diagnosed with disseminated disease. Thus, the ability to detect ovarian cancer precursor lesions before they develop into fully mature cancers would have a profound impact on the morbidity and mortality of the disease. However, the exact site of origin of ovarian cancer is not fully understood. The purpose of my thesis is to develop heritable mouse models for epithelial ovarian tumors to answer key questions regarding ovarian cancer origin and address the underlying predisposing mechanisms. ❧ Dr. Dubeau has argued for many years, that the currently favoured hypothesis that tumors lesions that are currently classified ovarian epithelial tumors do not arise from the coelomic epithelium that covers the ovary, but from derivatives of the müllerian ducts. In order to test our hypothesis, we generated transgenic constructs where the Müllerian inhibiting substance type 2 receptor (Mis2r) promoter drives expression of either β-galactosidase (Mis2r-β–Gal) or Cre recombinase (Mis2r-Cre), we found no evidence of an embryological link between the müllerian ducts and coelomic epithelium, however, a segment of the renal tubules specific for the female gender might suggest an embryological link between the müllerian ducts and renal development. This is important not only to a development point of view, but also helped us understand histogenesis of clear cell ovarian carcinomas. ❧ We also created a mouse model by superimposing p53 knockout targeted specifically to müllerian tract on the Brca1 mutation already present in Fshr-Cre

Linked assets

University of Southern California Dissertations and Theses

Conceptually similar

PDF

Mechanisms of ovarian cancer predisposition in BRCA1 mutation carriers

PDF

Homologous cell systems for the study of progression of androgen-dependent prostate cancer to castration-resistant prostate cancer

PDF

Investigating the role of SASH1 gene located on chromosome 6 in ovarian cancer

PDF

The role of endoplasmic reticulum chaperones in adipogenesis, liver cancer and mammary gland development

PDF

POLR2B and its contributions to cancer cell growth

PDF

Mitotic regulation in ovarian epithelial tumors approaching in vitro crisis

PDF

The role of PAX8 in epithelial ovarian carcinoma

PDF

The discovery of a novel 105kDa complex comprised of BUB3, C-JUN and SUMO-1 and its relationship to ovarian cancer development

PDF

Exploring the molecular and cellular underpinnings of organ polarization using feather as the model system

PDF

Studies of murine prostate cancer stem / progenitor cells

PDF

Understanding and controlling mitotic errors leading to aneuploidy in early ovarian cancer development

PDF

Epigenetic and genetic reprogramming during embryonic chicken feather bud morphogenesis, hair morphogenesis, and de novo hair regeneration

PDF

Cancer of the psyche: antenatal maternal stress accentuates functional brain responses and neuronal endangerment during conditioned fear in adult offspring