University of Southern California Dissertations and Theses

Characterization of the progenitor cell zone in feather follicles

(USC Thesis Other)

Characterization of the progenitor cell zone in feather follicles

PDF

Download a page range

Download transcript

Copy asset link

Request this asset

Transcript (if available)

Content
Characterization of the progenitor cell
zone in feather follicles

By Weiqi Luo

A thesis presented to the
Faculty of the Graduate School
University of Southern California
In partial fulfillment of the
Requirements for the Degree
Master of Science
(Biochemistry and Molecular Biology)
May 2016

i
Table of contents
Abstract….………………………………………………………………………………………………………….……iii
Introduction……………………………………………………..…………………………………………………….1
Materials and Methods………………………….…………………….......…………………………………4
IdU/CldU double staining …………………………………….……….……………….………………………..4
RNA-seq ………………………….……………………..........................................................................................4
Primer design ………………………….…………………………….……………..………………………..........…5
Probes ………………………….…………………… …………………...……………………………………………..6
Sample processing ………………………….…………………… ………………………………………………...7
In situ hybridization (ISH) ………………………….…………..…………………………………….…………7
Embryos ………………………….…………………… ………………..………………………………….………..7
Virus production ………………………….……………….……. ……………………………………….……....7
Virus Injection ………………………….……………………….………………………………………….……….. 8
In ovo RCAS plasmids electroporation………………….……….………………………….…….………...8
Results……………………………………………..…………………….……….……………………...…………………..8
The identification of the progenitor cell zone….................................................................................8
Cellular characterization of LRCs and TACs in feather follicles...............................................10
Screen the genes specifically expressed in the progenitor cell zones ..................................13
Molecular analysis of papilla ectoderm specific genes …………………….....……………..…….14
Functional perturbations by gene over-expression with RCAS virus………...……..…….…18
Discussion ……………..……………………….…………………………..………………….………………………19
What is the role of the papilla ectoderm progenitor zone ………………………………...……...19
What potential roles might these differentially expressed genes play in the papilla
ectoderm? ……………………………………………………………………………………………….……………19
The multi-dimensional regulation of homeostasis of different cell populations in
feather follicles….……………………………… ………………….. …..………………….…………… …… …22
Future directions ……..………………………………………………………….………..…………………….23
References ……...…………………….…….…………………………………… ..…………………………………24

ii
List of Figures
Figure1. Feather follicle structure and the life cycle of feathers ………………………………...1
Figure2. The H&E and immunostaining patterns …………………….……………………………...10
Figure3. IdU/CldU transit amplifying cells (TAC) labeling and LRC (label retention
cells)/TAC double labeling ………………………………………………………………………12
Figure4. RNA-seq data pinpoint the changes of key molecules specifically expressed in
Papilla Ectoderm (PE) …………………………………………………………………………….14
Figure5. The mRNA expression patterns of Barx2b in feather follicle longitudinal
sections at Growth, Resting, Resting regeneration Day4 stages …………………15
Figure6. The mRNA expression patterns of Tp63 in feather follicle longitudinal
sections at Growth, Resting, Resting regeneration Day4 stages ………...……….17
Figure7. The mRNA expression patterns of Col17a in feather follicle longitudinal
sections at Growth, Resting, Resting regeneration Day4 stages …………………18

iii
Abstract
Cell proliferation is a basic cellular event, which exists in all multicellular animals. Cell
proliferation plays a role in mediating developmental processes and is regulated by many key
molecules represented by Cyclin dependent kinase (CDK) and transcription factors like Tumor
protein 63 (Tp63). A cell proliferation zone has been proposed to reside within the papilla
ectoderm region of the feather follicle during the growth phase and resting phase of the feather
cycle. The presence of this progenitor cell zone was confirmed and shown to play a role in initiating
the anagen phase of the feather cycle. BrdU labeling previously has been used to trace stem cells
and their progeny within this region. Here we further used the IdU/CldU double labeling method to
investigate the distribution, and proliferation of stem cells (SC) and transit amplifying (TA) cells. To
date, the molecular mechanism regulating stem cells and progenitor cells in feather follicle papilla
ectoderm is largely unknown. Based on RNA-seq data, we chose several highly expressed candidate
molecules in the progenitor cell zone and validated their expression pattern by in situ
Hybridization. We further characterized the functions of two important transcription factors, Tp63
and Barx2b, in maintaining stem cell identity in the feather papilla ectoderm. These data will
provide cellular and molecular clues about the formation and maintenance of the cell proliferation
zone.

1
Introduction
Since feathers regenerate periodically throughout the life of each bird, they are a good model
in which to study the behaviors of stem cells and their progeny. The typical feather follicle structure
is illustrated as Fig 1A (adapted from Yue, et al, 2005). These cellular behaviors include
proliferation, differentiation and migration, which are all key cellular processes in the development
of any multicellular organ. In adult birds, feathers can naturally molt and regenerate. Feathers are
formed from epithelial placodes which overlie mesenchymal condensations form during early
stages of feather morphogenesis. The feathers grow and form symmetric short feather buds which
later elongate to form asymmetric feather buds. This is followed by invagination to form a feather
follicle (Fig 1B). Feathers undergo natural cycles composed of four phases: initiation, growth, rest
and molting prior to a new cycle. These are analogous to the anagen, telogen and catagen phases
found in the hair cycle (Stenn and Paus, 2001). Hence, feathers can be regarded as good models for
stem cell research. Largely, the entire feather cycle could be divided into 2 phases: growth and rest
phases (Chen, et al, 2015).

Fig1. Feather follicle structure and the life cycle of feathers. (A) The structure of a feather
follicle. The papilla ectoderm (PE), upper follicle sheath (upper), lower follicle sheath (lower) and

2
dermal papilla (DP) were each examined by the RNA-seq analysis (see Methods). (B) Illustration of
the follicle structure and the feather cycle used in feather formation and regeneration.
The two-dimensional feather follicle displays a cylinder shaped structure. It is composed of
two major parts with different origins during ectoderm development: the epithelium and the
mesenchyme (Fig 1A) (Yu, et al, 2002; Yu, et al, 2004; Yue, et al, 2005; Lin, et al, 2013a). The
mesenchyme component of the follicle includes the dermal papilla (DP) and the pulp (Yu, et al,
2004), while the epithelial part is composed of the collar bulge, the papilla ectoderm, the ramogenic
zone, barbs and the follicle sheath, which enwrap the mesenchyme. The dermal papilla is a
permanent structure, while the pulp cyclically grows in the growing phase and regresses as
feathers enter a resting phase (Lin, et al, 2013). Interactions between the epithelium and
mesenchyme are essential for feather regeneration.
An important question in developmental biology and regenerative medicine is how different
organs ‘manage’ their epithelial stem cells (Yue, et al, 2005). The ectoderm organs are regulated by
the equilibrium among three major cell groups: stem cells, and differentiated cells. The journey of
an organ’s stem cells toward differentiation and determination is analogous to a trip along a river
that is influenced by the local topology of the landscape (Chuong and Widelitz, 2009). The natural
and topological configuration of epithelial stem cells in feather follicles enables the convenient
resupply of cells needed for regeneration, growth and differentiation. The collar feather stem cell
niche forms an epithelial ring slightly above the dermal papilla (Yue, et al, 2005). Using long-term
label retention, Cotsarelis et al. (1990) identified slow cycling cells within the hair bulge.
Slow-cycling cells with an ability to retain label were also characterized in the feather collar bulge
(Yue, et al, 2005). Using other thymidine analogs to label these cells at different times or for
different durations we are now able to distinguish between different proliferating cell populations.
Using this approach, in addition to the stem cells within the collar bulge, our lab identified a second
zone present in the papilla ectoderm that is enriched in stem cells and progenitor cells (TA cells)
that coordinate to endow feathers with a fast growth rate. Label retaining cells (LRCs) in this region
proliferate infrequently, which define them as a quiescent cell population. When the feather grows,
some LRCs are activated to divide producing a stem cell and a TA cell (TAC) which leaves the
progenitor cell zone. In this study, we first label the LRCs with CldU after 3 week chasing period.
Some of these LRCs are also positive with IdU which only labeled 3 hours before collecting the
feather follicle. This double labeling suggests that this LRC was converted to a TAC. Our lab has
generated additional evidence pertaining to the relationship between LRCs and TACs. During

3
growth phase, cell proliferation is high and the papilla ectoderm thickens (Lab unpublished data).
During rest phase, as the width of the feather follicle shrinks in size (Yue, et al, 2005), the stem cells
in the ring region move down to become the papilla ectoderm that surrounds the dermal papilla.
During the molting phase, the feather is shed, leaving the papilla ectoderm behind. Some stem cells
in the progenitor cell zone become activated to initiate a new feather cycle during anagen phase in
normal cycling or in the presence of appropriate stimuli like feather plucking.
The molecular mechanism regulating stem cell activation and tissue homeostasis has entered
the limelight of developmental biology research. Many studies in recent years investigated genes
regulating stem cell behavior in adult tissues in a variety of model animals. By characterizing the
specific hair follicle stem cell gene expression profiles via microarray approaches or screening the
long-term stemness factor via RNAi, some key factors such as Sox9 and Tbx5 were identified and
verified (Greco, et al, 2009;Chen,et al,2012). Studies in tissues other than hairs or feathers also
revealed key factors that regulate cell proliferation or stem cell identity, such as Tumor protein
63(Tp63) (Senoo, et al, 2007). Our lab employed the RNA-seq approach to acquire the
transcriptomic profiles from cells in different regions of the feather follicle including the papilla
ectoderm, dermal papilla, upper follicle sheath and lower follicle sheath. These experiments
provide the whole gene expression profiles of the cells within the progenitor cell zone. The next
step is to identify factors that specify those progenitor cells (identified as LRCs) and regulate their
proliferation, which is the main focus of this study.
We identified many candidate molecules based on their enhanced expression in the papilla
ectoderm. However, 5 of these met our criteria for further examination. These include Frizzle 1
(Fzd1), Collagen XVIIa1 (Col17a1), Cyclin dependent kinase 1 (CDK1), Bar-like homeobox 2b
(Barx2b) and Tp63. Evidence from recent studies on these factors provides clues for us to perform
the further functional study. For instance, Tp63 is a member of the p53 transcription factor family,
which also contains a homeodomain. Two forms of Tp63 or Trp63 were discovered in mice; a
transactivation form (TAp63) and a delta N form (DNp63) (Yang, et al, 1999). The former one
contains an intact N-terminal transactivation domain (TAD), DNA binding domain and C-terminal
oligomerization domain, while the delta N form lacks the TAD. By aligning the reads from our
RNA-seq data to the reference gallus genome (Ensemble Galgal4), we found that the DNp63 isoform
but not the TAp63 form is expressed in chicken skin. The expression pattern and functional role of
this isoform in feathers has not been studied yet. Neither do we know whether DNp63 or other
stem cell factors like Col17a1 and Barx2b regulate cell proliferation within the progenitor cell zone

4
for homeostasis of the feather follicle stem cell population. Therefore in this thesis, I will explore
the cell behavior and molecular aspects in the progenitor cell zone of the feather follicle.

Materials and methods

IdU/CldU double staining
To label 2 distinct TAC populations, white Leghorn chickens were labeled with 0.1% IdU
(Sigma) beginning from the starting time point (Hour 0) and with 0.5% CldU (Sigma) at 24th hours.
Samples were collected at the 26 th hour. To independently label LRCs and TA cells, chickens were
labeled with CldU using a long (7 days) labeling period with one injection per day. This is followed
by a 3-week chase period. Then IdU was injected to label TA cells 3 hours before sampling. The
collected follicles were dissected,treated with 4% paraformaldehyde(PFA, dehydrated through an
ethanol gradient, sectioned and placed on a glass slide (the same process was used in the In situ
hybridization (ISH) part below). Samples were washed 4 times for 15 min with PBT. Then the
samples were treated with 20 ug/ml Proteinase K in PBT for 10 minutes, followed by the antigen
retrieval (AR) process via heating in a microwave oven in the presence of antigen retrieval buffer
(10 mM citric in dH2O). The buffer is heated for 2 minutes 15 seconds at Power 10, then the slides
were inserted into the fluid and heated for 5 minutes at Power 5. After washing with PBT samples
were pre-blocked in Zeller’s blocking solution, and then sequentially treated with mouse anti-IdU
antibody, anti-mouse 546 (fluorescent-labeled secondary antibody), rat anti-CldU and anti-rat 488
for 2hrs, 1hr, 2hrs and 1hr, respectively. Slides were mounted with “gold’ signal protection solution
(Invitrogen) in 50% glycerol and imaged using a Zeiss 510 confocal LSM microscope or
epifluorescent microscope (Nikon TE-300 Diaphot imaging system in the Cell and Tissue Imaging
Core of the USC Research Center for Liver Disease).
RNA-seq
RNA-seq was performed on replicate samples from embryonic skin and from adult white
leghorn chicken feathers. For the adult samples, epidermis and dermis were separated by
treatment with 2XCMF (calcium magnesium-free tyrodes solution) and RNA was extracted

5
exclusively from the epidermis. RNA was extracted using Trizol reagent (Invitrogen). For each
sample, 2 ug of total RNA was used to construct the RNA-seq library using the TruSeq RNA sample
preparation v2 kit (Illumina). Sequencing (50 cycles single read) was performed using Hi-seq 2000
at the USC Epigenome Center. Normalized gene expression levels were measured in fragments per
kilobase of exon per million fragments mapped (FPKMs) (Mortazavi et al. 2008), using Cufflinks
version 2.0.2 (http://cufflinks.cbcb.umd.edu/) (Trapnell et al. 2013). We first categorized
fragments into two groups: “unique” fragments, each of which was mapped to a single position in
the genome, and “multiple-hit” fragments, each of which was mapped to more than one position in
the genome. To calculate the expression levels, unique fragments were assigned to an individual
gene first for initial abundance estimation, and the multiple-hit fragments were then redistributed
to those genes based on the relative abundances of uniquely mapped fragments. Total mappable
fragments on each chromosome were calculated by SAMtools (Trapnell et al. 2010).
Primer design
The mRNA coding sequence was submitted to the PCR design program, Primer3.The promoter
sequences for T7 RNA Polymerase were added on the 5’end of the antisense primer.
Table 1 Primers used to make RNA probes and RCAS expression plasmids
Primer
name
Primer Primer sequences
Size
(bp)
Accession
Number
Primers used to make RNA probes for section in situ hybridization
Fzd1 Forward 5’-ATCCCCTGCCCCAATAAC-3’ 474 NM_001030337.1
Reverse
5’-CTAATACGACTCACTATAGGGTCTGCAAA
CGGGTTAAAAATG-3

Col17a1 Forward 5’- GCCAGGTGGAAATGATAGG-3’ 528 XM_421744.4|
Reverse
5’-CTAATACGACTCACTATAGGGGCTGATCG
ACTCCCTTTCAG-3’

Cdk1 Forward 5’-TGGGGAAGGTACCTATGGTG-3’ 529 NM_205314.1|

6
Reverse
5’-CTAATACGACTCACTATAGGGCTGAGTCCC
CCTGGAAAAGT-3’

Barx2b Forward 5’- CGACGAAATTCTCTCCAAGG-3’ 566 NM_204896.1
Reverse
5’-CTAATACGACTCACTATAGGGTTTCCTCTG
AGGTGGGAATG-3’

Tp63 Forward 5’-GAAACAGCCATGCCCAGTAT-3’ 574 NM_204351.1
Reverse
5’-CATTAACGACTCACTATAGGGGGTGAGTT
GGAGCCATAGGA-3’

Primers used for the construction of RCAS expression plasmids
RCAS-
DNp63
Forward
5’-GGGGACAAGTTTGTACAAAAAAGCAGGCT
TCACCATGTTGTACCTGGAAAACAA-3’
1749
Reverse
5’-GGGGACCACTTTGTACAAGAAAGCTGGGT
CTCACTCCCCTTCCTCCTTG-3’

RCAS-
Barx2b
Forward 5GGGGACAAGTTTGTACAAAAAAGCAGGCTT
CACCatgcactgcccgccgcag-3’
804
Reverse 5’-GGGGACCACTTTGTACAAGAAAGCTGGGT
Cttaacttaatggcgtaacct

RCAS-
TAp63
Forward 5-GGGGACAAGTTTGTACAAAAAAGCAGGCT
TCACC ATGTTTGTAGAAACTCCGAGC-3’
1983
Reverse 5’-GGGGACCACTTTGTACAAGAAAGCTGGGT
CcTCACTCCCCTTCCTCCTTG-3’

Probes
Gene products around 500bp were cloned from chicken embryo cDNAs. The cloned cDNAs
were sequenced to ensure the products were correct. The cDNAs were transcribed with T7 RNA
polymerases to obtain the antisense probes, and labeled with digoxigenin.

7
Sample processing
Adult and regenerating feather follicles were collected in Diethyl pyrocarbonate (DEPC)
treated phosphate buffered saline (PBS), fixed with 4% paraformaldehyde (PFA) at 4oC overnight,
and then subsequently dehydrated through an ethanol gradient. Dehydrated samples were stored
at -20oC. Samples are cleared with xylene and embedded in paraffin.7um sections were collected on
glass slides.
In situ hybridization (ISH)
Sectioned samples were rehydrated through ethanol gradients. Following treatment with 20
ug/ml Proteinase K, tissues were post-fixed in 4% paraformaldehyde (PFA) / 0.25% glutaradehyde,
and placed in hybridization buffer (50% formamide, 25% 5X SSC, 2g blocking powder (Roche),
0.1% Tween 20 (Sigma), 0.1g CHAPS (Sigma), 0.5M EDTA (Invitrogen), 50ug/ml Yeast tRNA,
10mg/ml Heparin (Sigma), all dissolved in DEPC water,per 100ml, total volume), the
digoxygenin-labeled probe was applied to the samples at 65 oC overnight. The samples then
underwent 5X Sodium Chloride and Citric Acid Buffer (SSC) (300mM NaCl and 30mM sodium
citrate) and 2X SSC washes before being pre-blocked with 10% goat serum (GS) that have been
heated to inactivate at 65 oC. Then antibody to detect digoxygenin (DIG) was applied at 4 oC
overnight. The samples were then washed in PBT containing 0.5 mg/mL levamisole followed by
NTMT (100mM NaCl. 100mM Tris-HCl, 50mM MgCl2, and 0.08% Tween 20) washes containing
0.5mg/ml Levamisole. For visualization, color was developed with NBT/BCIP (Promega)
chromogen substrate until desired color intensity. The reaction is stopped by dH2O.
Embryos
Specific pathogen-free eggs (called SPAFAS eggs) used in the virus experiments were
purchased from Charles River. The eggs were cultured at 38.5 oC in a humidified chamber until the
desired stages were reached.
Virus production
Replication competent avian sarcoma virus (RCAS) producing plasmids expressing chicken
Barx2b, chicken DNp63 and chicken TAp63 were made for the overexpression of related genes in
chicken embryos. High fidelity PCR reactions were run with chicken cDNA from different tissues as
templates (NEB phusion high fidelity DNA polymerase kit) and BP and LR reactions were
performed (Gateway BP clonase and LR clonase kit, Invitrogen) to make RCAS plasmids.

8
RCAS-chicken DNp63 was transfected into the chicken dermal fibroblast (DF1) cell line with
Lipofectamine 2000 (LifeTechnologies). When the transfected cells reached 80% confluence, the
cells were passaged 1:4 with a media consisting of DMEM with 1%FBS, 0.2% CS and 1:1000
gentamycin. After 24 hours, the media was collected and filtered through syringe filters with
0.45um pores and centrifuged at 26000rpm at 4oC for 2 hours. The pellet was resuspended with
300uL media described above and 50uL aliquots were transferred to each tube at -80 aliquoted
until use.
Virus Injection
50ul aliquots of virus were thawed briefly at 37oC and mixed with 5ul Fast Green. Volumes of 3
to 8 uL were injected into the amniotic cavity near the E3 chicken embryos.
In ovo RCAS plasmids electroporation
The RCAS plasmids were prepared with Maxi Prep (reagents from Macherey Nagel). Right
before use, a small drop of Fast Green was added to the stock for use at the highest concentration.
4-6uL of RCAS-chicken Barx2b and TAp63 plasmids were injected into the lower limb buds of E3
embryos. Electrodes were placed on flanking sides of the embryos, and 3 pulses of 12V at 30 -
50mA were delivered using a BTX ECM830 electroporator.

Results

The identification of the progenitor cell zone
Our labs previous work to identify stem cells and TACs in feather follicles found several
molecular markers that were helpful to specify these 2 cell populations in feather follicles (Yue et al.,
2005). Here, I first used H&E staining to show the entire follicle structure (Fig 2 A, A’, A”). The cell
proliferation of a feather follicle was assessed by PCNA (proliferating cell nuclei antigen) staining
(Fig 2 B, B’, B”). In feather epithelia, the PCNA positive cells are restricted to a region close to the

9
pulp (red arrows in Fig 2B’). I also use Integrin-alpha 6, a specific marker for hair follicle stem cells
(Greco, et al, 2009) to identify stem cells or progenitor cells in the feather follicle (Fig 2 C, C’, C”).
The Integrin-alpha 6 positive cells also are restricted to an area close to the pulp (blue arrow in Fig
2 C’), which suggests that the proximity of the epithelial progenitor cell zone to the adjacent dermis
is important for proper feather morphogenesis. Therefore, my study focused on this progenitor cell
zone in the feather follicle using the papilla ectoderm as an example.

10
Fig2. H&E (A, A’, A”) and immunostaining patterns (B, C, enlarged in B’, B”, C’, C”). The
progenitor cell zone in the papilla ectoderm region is enriched in PCNA (proliferation cell nuclei
antigen) and Integrin-alpha 6 (stem cell marker). The red and blue arrows indicate the range of the
progenitor cell zone. Scale bars, 500um for A, B, C, 100um for others.
Cellular characterization of LRCs and TACs in feather follicles
Advances in the Bromodeoxyurdine (BrdU) immunohistochemistry method to study cellular
label retention (Nowakowski, et al, 1989), enable the use of two nucleotide analog labels-
iododexyuridine (IdU) and chlorodeoxyuridine (CldU) to label two cell populations with different
proliferating properties in a sequential time series (Costarelis, et al, 1990). TACs can be labeled
with a short, 2-3 hour pulse. By beginning labeling with IdU at time 0 and labeling with CldU at the
24th hour and then collecting the sample at the 26th hour, we can trace the migration of TACs. The
labeling scheme is shown in Fig 3B. Specific antibodies can distinguish between the IdU (red) and
CldU (green) labeled nucleotides. Thus, the double labeling method can independently detect these
2 TAC populations. Our confocal imaging results show two “stripes” of cells with two distinct colors
in the progenitor cell zone. They reveal the position of proliferating cells at these 2 time points. In
epithelium, the green cells are close to the pulp and the red cells have migrated away toward the
outside (Fig 3B’). This data suggests that the feather follicle epithelia TAC zone is only restricted
within ~2 cells distance from the pulp. After these cells exit the S phase of the cell cycle, they
migrate out and may start to differentiate.
A previous study has proposed the heterogeneity of cell types and concepts (LRCs) in feathers
using the BrdU pulse-chase method (Yue et al, 2005). The dual labeling method described above
can also be used to visualize the relationship between LRCs and TACs. For this experiment the
labeling procedure is shown schematically in Fig 3C. To label LRCs, chickens were labeled with CldU
using a long (7 day) labeling period with one injection per day. This was followed by a 3-week chase
period. If populations of cells are relatively quiescent (divide infrequently), they can retain the label
for a significantly long time. In contrast, if cells divide rapidly during the chase period, the
previously injected labels will be diluted as unlabeled nucleotides become incorporated in their
place. In this scenario, only stem cells should retain the label. We then can relabel the epithelial
cells with a short pulse of IdU. We also can use IdU to label LRC and use CldU to label TAC. Four
samples from three regions (several flight feathers, tail feathers and sickle feathers) of 2 different
chickens were studied (LRCs and TACs labeled, see Fig 3 D-D”, E-E” and the legend).

11
I provide 2 examples of double labeling for LRCs and TA cells. The first is for White Leghorn
chicken sickle feather follicles. LRCs (red) reside within the bulge regions (D, D’, enlarged in D’’).
These cells are seldom double labeled with the short IdU pulse labeling (TACs, green). The other
example is the long-tail sickle feather follicles from Phoenix chickens (E, E’, enlarged in E’’). Here,
the LRCs are labeled by CldU (green) and the TA cells with IdU (red). These cells not only reside in
the collar bulge region but also range over a greater distance to below the bulge. Moreover, many of
these LRCs are double labeled with the short TAC label (red) which produces a yellow color. This
result suggests that feather follicles with different lengths may result by establishing a different
homeostasis of the stem cells and TACs.

12

Fig3. IdU/CldU transit amplifying cells (TAC) labeling and LRC (label retention cells)/TAC
double labeling. (A) Feather follicle structure; (B) IdU/CldU Labeling procedure for two types of
TACs and (B’) TAC1 (red) and TAC2 (green) distribution in feather follicle of White Leghorn chicken
No.7 sample 6. (C) labeling procedure for LRCs and TACs; (D,D’,D”) LRC (red) and TAC (green)
distribution in sickle feather at growth stage follicle of Long-tail Phoenix chicken (E,E’,E”) LRC
(green) and TAC (red) distribution in feather follicle of Long-tail Phoenix chicken. Scale bars,
100um.

13
Screen genes specifically expressed in the progenitor cell zones
In order to comprehensively characterize the molecular expression in LRC and TAC
populations, the whole transcriptomes of progenitor cells in the PE region were characterized using
the RNA-seq method. RNA samples were prepared from different regions within the feather follicle
including the PE, the DP, the upper (Upper) and lower (Lower) parts of the follicle sheath. These
RNA samples were collected at different stages in the feather cycle (growth stages (G), resting
stages (R) and regeneration stages 1 and 3 days after plucking (R1, R3) (Fig 4) Several criteria were
employed to screen for candidate genes specifically expression in the PE region: (1) at a particular
stage, the normalized expression value (RPKM) in the PE was significantly higher than other
regions by about two fold; (2) their up-regulation and down-regulation is largely consistent with
the progression of the feather cycle, i.e., increased expression throughout the anagen phase that
remains stable or is decreased during the telogen phase; (3) known functions assessed by the
PANTHER gene ontology tool pertain to stem cell regulation in other tissues (Mi,H, et al,2013).
Hence, some genes stand out including the cell cycle regulator Cdk1, transcription factors as master
regulators in stem cell maintenance such as Tp63 and Barx2b; signaling molecules and cell
adhesion molecules like Fzd1 and Col17a1.These selected genes not only imply that possible and
conserved regulation modules exist in feather follicles but also suggest that there is an integration
regulation network concerning genes with different functions and different positions in various
pathways.

14

Fig4. RNA-seq data pinpoint the changes of key molecules specifically expressed in the PE.
Tp63, Barx2b, Col17a1, Fzd1 expressed in the Day 0, Day 1, Day3 after plucking in feathers at
growth and resting states. Upper: upper follicle sheath; Lower: lower follicle sheath; DP: Dermal
Papilla; PE, Papilla ectoderm. All the expression values are normalized by the reads per kilobases
per million mapped reads (RPKM) method.

Molecular analysis of papilla ectoderm specific genes
To validate the RNA-seq data and to identify the spatial expression pattern in the feather
follicles at different stages, we designed primers to make anti-sense probes that are complementary
to the mRNA of the candidate genes (Table 1) and employed the mRNA in situ hybridization with
DIG-labeled probes. Though ISH is not a quantitative approach, it provides “snapshots” of spatial
expression information showing changing patterns at particular times on the sectioned tissues.

15

Fig5. The mRNA expression patterns of Barx2b in feather follicle longitudinal sections at
Growth (panel A-C’), Resting (panels D-F’), Resting regeneration Day4 stages (panels G-H’). Scale
Bar, 100um.
Barx2b
Barx2b is a homeodomain-containing transcription factor of the Bar family. Barx2b in the
chicken is related to Barx2 in the mouse; they share significant sequence homology (Smith and
Tabin, 1999). ISH data shows that the expression pattern of Barx2b mRNA is highly confined to the
PE epithelium at the growth stage (Fig 5, A-C, enlarged in B’, C’), consistent with the RPKM value
(increasing from 153.6 to 155.2 during the anagen) from RNA-seq data. However, it displays little to
moderate expression in the PE region at resting stages with an RPKM value of only 19.6 one day
after the resting phase begins. This low level of expression makes it difficult to be detected by our
ISH method (Fig 5, D-F, enlarged in E’, F’).

16
As the feather progresses into the regeneration period, the Barx2b expression correspondingly,
is up-regulated again with a much stronger signal in ISH images, as well as the RPKM value of
91.4,comparable to the expression level in the growth phase, at the Day4 after regeneration starts
(Fig 5, G, H, enlarged in H’). This result, compared to the mouse Barx2 mRNA distribution in the hair
follicle, is consistent with the previous study that Barx2 expression is more than 2 fold higher in the
bulge stem cells than their differentiated progeny. Hence, Barx2 is considered to be a bulge factor
(Tumbar, et al, 2004). It is likely that Barx2b in the feather follicle also plays a role in activating
feather stem cells or the progenitors in the PE region when the anagen phase begins and initiates
the end the telogen phase.
Tp 63
It is known that Tp63, a p53 family transcription factor, plays critical roles in the epidermal
stratification and differentiation (Yang, et al, 1999). In mouse and zebrafish, there are two isoforms:
TAp63 and DNp63 from several mRNAs transcribed from 3q27-29 loci in the mouse (Yang, et al,
1998). From our follicle RNA-seq data, we could not detect reads that aligned to the 5’ upstream
regions in the gallus genome that correspond to the Tp63 N terminal transactivation domain. Form
the mRNA expression pattern (Fig 6), p63 is clearly expressed in the PE region as well as the lower
bulge in the growth stage. As the collar bulge is known to house feather stem cells (Yue, et al, 2005),
Tp63 is actually expressed in both feather stem cells and progenitor cells. Expression of this Delta N
form is also observed in the epidermis of the hair follicle (Yi, et al, 2008). The conserved expression
pattern in hair and feather may suggest that Tp63 plays a similar role in feather follicle progenitor
cells.
In my study, like Barx2b, at growth stage, Tp63 is highly expressed in the feather follicle PE
region, consistent with the RNA-seq data RPKM value (increasing from 13.5 to 26.5 during the
anagen) (Fig 6, A-C, enlarged in B’, C’). However, it displays little to moderate expression in the PE
region at resting stages with an RPKM value of only 4.9 one day after the resting phase begins. (Fig
6, D-F, enlarged in E’, F’). This is difficult to detect by our ISH method. As the feather progresses into
the regeneration period, Tp63 expression, correspondingly, is up-regulated again providing a much
stronger ISH signal, as well as the RPKM value of 21.7 at the Day4 after regeneration starts (Fig 6 G,
enlarged in H, H’, H”)

17

Fig6. Tp63 mRNA expression patterns in feather follicle longitudinal sections at Growth (A-C’),
Resting (panels D-F’), and Regeneration Day 4 stages (panels G-H’’). Scale Bar, 100um
Col17a1
The Col17a1 gene encodes typeXVII collagen. A mutation in this gene results in epidermolysis
bullosa in which diminished epidermal adhesion produces skin blistering in response to minimal
shear forces (Zillikens, 1999). ISH data shows that the expression pattern of Col17a1 mRNA is
highly confined to the PE epithelium at the growth stage (Fig 7, A-C, enlarged in B’, C’), consistent
with the RNA-seq data RPKM value (increasing from 232.9 to 339.5 during anagen; However, it
displays little to moderate expression in the PE region at resting stages ( Fig 7, D-F, enlarged in E’, F’)
with an RPKM value of only 82.7 one day after the resting phase begins. As the feather progresses
into the regeneration period, the expression of Col17a1, correspondingly, is up-regulated again
with much a stronger ISH signal, as well as the RPKM value of 210.1, comparable to the expression
level in the growth phase, at the Day4 after regeneration starts (Fig 7, G, enlarged in H, H’, H”). In
the hair follicle, Col17a1 in the hair bulge is needed for hair follicle stem cell and melanocyte stem

18
cell self-renewal (Tanimura, et al 2011). In our previous feather study, pigmentation pattern caused
by melanocyte progenitor cells. These progenitor cells reside the PE region (Lin, et al, 2013b). Our
result suggests Col17a1 may also be involved in the melanocyte stem cell homeostasis.

Fig7. The mRNA expression patterns of Col17a1 in feather follicle longitudinal sections at
Growth (A-C’), Resting (panels D-F’), Resting regeneration Day4 stages (panels G-H’’). Scale Bar, 100
um.
Functional perturbations by gene over-expression with RCAS virus
In order to explore the functions of Barx2b and Tp63 in feather follicle development and
regeneration, we sought to manipulate their expression in vivo. We tried to do this using RCAS
virus mediated gene expression and by RCAS plasmid electroporation in chicken embryos.
Considering that there are two forms of p63 proteins expressed in chicken (DNp63 is proved to
exist in feathers), we used a cDNA library prepared from a different tissue (brain) to isolate a
chicken TAp63. The expression of TAp63 in chicken brain tissues was also seen in the mouse (Yang,
et al, 1998). Chicken TAp63 was cloned into the RCAS BP vectors. As TAp63 does not exist in

19
feather follicles, we are curious to see the effects of the transactivation domain. We are interested in
the possible function of TAp63 and Barx2b in the feather follicles. Now we are trying to improve the
electroporation efficiency and survival rate of electroporated chicken embryos. Hopefully,
introduction of these constructs to E3 chicken will produce several obvious feather phenotypes at
later stages. This work is still in progress.

Discussion
In this study I explored differentially expressed genes found within a specialized region of the
feather follicle, the papilla ectoderm. The PE region is immediately adjacent to the DP, a signaling
center. I expect that there may be some molecular interactions between the mesenchymal cells in
the DP and stem cells or TACs in the PE region when the stem cells are activated at the beginning of
anagen.
What is the role of the papilla ectoderm progenitor zone
A study focusing on the two-step activation of stem cells in hair follicles, revealed the hair germ
region mainly made up of TACs (Greco, et al, 2009). The hair germ seems to be located in close
proximity to the dermal papilla. The chicken papilla ectoderm is also located close to the dermal
papilla in feathers. Though further evidence is needed, I speculate that the papilla ectoderm may be
quite similar to the hair germ. Both are enriched for TACs, which are less pluripotent than stem
cells and divide rapidly in the presence of stimuli or at the anagen stage in the hair/feather cycles.
They are also have similar molecular expression profiles implying that they are conserved bridges
connecting the stem cells and differentiated cells. To fully understand whether the role of the
papilla ectoderm is critical for feather formation and regeneration we must first understand key
intermediate events that are required for feather stem cell activation.
What potential roles might these differentially expressed genes
play in the papilla ectoderm?
Using RNA-seq analysis this study identified 5 differentially expressed genes. All are
upregulated in the papilla ectoderm at the beginning of the feather cycles. Their expression level
changed with the feather cycle during feather formation and regeneration. The next two sections I
will discuss the possible roles of two of these differentially expressed genes.

20
Two p63 isoforms (TAp63 and DNp63) are expressed in mouse or other model animals, while
only DNp63 is detected in chicken skin and its appendages. The chicken genome has loci for both
isotypes and we could detect chicken TAp63 in brain tissue and were able to clone it. The functions
of both DNp63 and TAp63 are complicated in well-studied animal models like mouse, which reflects
the hub role of this kind of transcription factor. Interested in the various roles in diverse tissues in
different animals, people have employed multiple tools to dissect its biological functions. Almost
two decades ago, p63-depleted mice were made through homologous recombination methods.
When exons in the DNA binding domain (exon 6, 7 and 8) that are common in both forms, the p63
knock out mice displayed defects in epithelial differentiation and stratification (Yang, et al
1999).The non-regenerative differentiation of epidermis with the absence of squamous epithelia
and mammary, lacrymal and salivary glands indicate the loss of the progenitor cell population.
However, as both isoforms were perturbed, it is not clear which isoform caused the phenotypes in
transgenic mice. A subsequent study reveals that p63 is regulated by certain kinds of miRNA like
miR 203 (Yi, et al, 2008) and miR 205 (Jackson, et al 2013) when stemness needs to be repressed
for epidermal differentiation. The 3’ UTR of DNp63 mRNA, which is the main isoform expressed in
the epidermis in mouse (Yi, et al, 2008), harbors the MiR203 target sites, which is supported by the
luciferase assay and antagomir inhibitions. A paper focused on the hair stem cell activation (Greco,
et al, 2009) also regards DNp63 as a hair follicle stem cell marker because of its significantly higher
expression in the anagen bulge, telogen bulge and especially hair germ (P69) than the hair matrix.
Moreover, a new role for p63 in regulating high order chromatin structure within the epidermal
differentiation complex (EDC) locus has also been revealed (Mardaryev, et al, 2014). In terms of the
other isoform, Delta N p63 blocks acquiring multipotency in mouse keratinocytes by targeting the
DCGR8 promoter (Chakravarti, et al, 2014). From this study, even though TAp63 with a
transactivation domain is more structurally similar to p53, DNp63 without that domain blocks
reprogramming of differentiated keratinocytes to become multipotent stem cells. Similarly, TAp63
cannot bind to the DCGR8 promoter and therefore DNp63 is the isoform that can activate the
DCGR8, the enzyme that processes miRNAs. The study not only pointed out that DNp63 somehow
manages to repress the expression of pluripotency markers like Oct4, Sox2 and Nanog, but also
further demonstrate the connections between DNp63 and its downstream miRNAs. From findings
described above, the differentiation potential and “stemness” property of epidermal progenitor
cells or hair follicle stem cells are elegantly controlled by different isotypes of Tp63 in a
context-dependent manner, DNp63 maintains the self-renewal property within epithelial lineages
while blocks the ground pluripotency like iPS. The miRNA mediated DNp63 mRNA downregulation

21
is a reasonable way for epidermal stem cells to get rid of the “gatekeeper” --DNp63 and progress in
the track of epidermal differentiation. Meanwhile DNp63 also represses some iPS-specific miRNA
expression in the keratinocytes, which exemplifies the mutual interaction between transcription
factors and miRNAs. Moreover, in terms of TAp63, TAp63 is necessary for wound healing and it can
prevent epidermal progenitors in SKP spheres from senescence by maintaining their self-renewal
and proliferation. (Su, et al, 2009). Thus Tp63 plays a vital role as a Hub in the regulation network
of tissue homeostasis. The conserved structure of DNp63 in chicken and mouse and the specific
expression pattern of DNp63 may imply some similar but vital roles of Tp63 in feather follicles.
TAp63 is absent in the feather follicles that are capable of periodically regenerating, so it is
plausible that DNp63 or other factors have the role in maintaining feather stem cells self-renewal.
As LRCs identified in the papilla ectoderm or in the progenitor cell zone, are always regarded as
quiescent feather stem cells. They may only contribute to identical LRCs and TACs when the feather
begins regeneration rather than continuous proliferation like neural stem cells in other adult
tissues. That may be the importance of DNp63 in the feather: feather stem cells need a genetic
program to self-renew without aberrant loss of their quiescence. However, the genomic binding
sites of DNp63, the downstream targets of DNp63 and the possibly involved miRNA interacting
with DNp63 in feathers require further experiments. Also the effects of ectopic expression of TAp63
in feather needs further RCAS virus experiments to determine. Due to the complex regulation
nature of Tp63, it is intriguing to perturb the normal expression of DNp63 completely with genome
editing tools like CRISPR/Cas9 specifically in the cells residing in the progenitor cell zone. If the
DNp63 deficient mutants are achieved, it is possible to measure the possible changes in gene
expression profiling, miRNA profiling or even high order chromatin conformation.
Collagen XVII (Col17a1) is a hemidesmosomal transmembrane collagen and long known
structural component to mediate anchorage and Col17a1 deficiency is the cause of a subtype of
epidermal bullosa (EB) disease (McGrath, et al, 1995). The expression pattern of Col17a1 in the
progenitor cell zone in feathers arouses our curiosity about its function. This is quite consistent
with a previous report (Tanimura, et al, 2011) in mouse hair follicle stem cells (HFSC). They
employed Col17a1 knockout mice to study the effects of Col17a1 depletion. It turns out that
Col17a1 deficiency leads to a significantly decreased number of CD34 and alpha6 integrin positive
HFSCs and impaired in vivo proliferation capacity and in vitro colony formation ability. Especially,
the mutant mice hair cycles show an abnormal and shortened resting stage, implying the impaired
HFSC quiescence. The Col17a1-/- mice displayed grey hair due to an insufficient number of
melanocyte stem cells (MSC) where Col17a1 itself is not expressed. The paper (Tanimura, et al,

22
2011) demonstrates the TGF-beta secreted by HFSCs in a Col17a1-dependent manner is required
for MSC maintenance. The mechanism to preserve MSCs relies on HFSCs, which not only serve as
stem cells in the hair homeostasis and regeneration but as niche cells as well. In feathers,
melanocyte progenitor cells reside in the papilla ectoderm regions in the resting phase and in the
lower bulge during the growth stage. The topological distribution forms a ring in the plane below
the lower bulge (Lin, et al, 2013). Our data showed significant expression of Col17a1 in both the
lower bulge and papilla ectoderm. It is possible that a similar feather stem cell and melanocyte
progenitor relationship exists in feathers, which needs further investigation. Overexpressing a
dominant negative mutant form of Col17a1 with RCAS virus or Col17a1 knock down with lentiviral
vectors may be helpful to identify the phenotype of feather cycles and colors after Col17a1
perturbation. The subcellular location of Col17a1 in the hemidemosomal structure may be
characterized by transmission electron microscopy as in a previous study (Tanimura, et al, 2011).
In addition, a systematic characterization of the epigenetic landscapes of HFSCs and TACs (Adam, et
al, 2015) reveals that like Tp63, Col17a1 gene is driven by an in vivo associated super-enhancer (SE)
in HFSC, which is marked by enriched H3K27Ac peaks in ChIP profiling. In TACs, however, the SE
regulating Col17a1 undergoes complete decommissioning, which indicates that Col17a1, as a HFSC
factor, is subject to cell-type-specific dynamic enhancer remodeling during lineage progression.
Whether a similar mechanism epigenetically regulates feather stem cell activity through the
expression level of several stem cell specific genes is largely unknown and needs further
characterization.
The multi-dimensional regulation of homeostasis of different cell
populations in feather follicles
Feather follicles are a good model to study tissue homeostasis and organ growth. Multiple cell
types with different division and differentiation potential are present within feather follicles.
Among these, the feather stem cells or progenitor cells (LRCs) provide the major power to replenish
the TAC pool when the feather is undergoing regeneration. LRCs demonstrate label retention ability
due to their quiescent proliferation status. They have progenitor properties and have the potential
to differentiate into every cell fate within the non-neural ectoderm lineage. Adult feather follicle
stem cells are in an undifferentiated state that is capable of self-renewal, multipotency and
quiescence rather than proliferation. Feather regeneration requires self-renewal and activation of
these LRCs. So the switch from quiescence to self-renewal or possibly asymmetric division is
necessary and under some unknown molecular control. The homeostasis between LRCs and TACs

23
may regulate cell proliferation changes and bulge stem cell activation when a new anagen initiates.
Previous studies employed various tools to determine the stemness or proliferation ability of
certain types of cell subpopulations with Fluorescent Activated Cell Sorting (FACS) methods using
available specific cell surface lineage markers. Many studies performed on cultured cells in vitro
examine the ability for stemness at different cell passages using a colony formation assay, where
the size and number of colonies formed are correlated with the proliferation potential.
Examining the growth rate and size of regenerating feathers after perturbation of key factors,
such as DNp63 or Barx2b may indicate the role of these molecules in progenitor cell zone activity. I
speculate that a new connection between feather bulge stem cells and melanocyte or adipocyte
progenitor cells may be revealed by such a study. This should enhance our understanding of how
such a complex network might reach its balance. Therefore, the same population of cells can
become the stem cells and the niche cells supporting other types of stem cells at the same time,
Moreover, multiple genetic pathways are proved to be involved, including those functioning for
stem cell maintenance and self–renewal like Tp63 and; for cell cycle regulation like Cdk1 and for
cell adhesion like Col17a1. Also studies in hair follicles and other tissues suggest that PE specific
genes are subject to multiple levels of regulation. Hence, regulation may occur through some
transcription factors that may activate or repress their target genes (Kouwenhoven, et al, 2010);
some regulatory genes may be subject to miRNA control (Yi, et al, 2008); some regulators may be
subject to epigenetic regulation by stem cell specific super-enhancers. Hence the interaction
between different cell types or extrinsic regulation as well as genetic and epigenetic regulation
within a particular type of cell form a comprehensive network that specifies the progenitor cell
zone in feather follicles.

Future directions

The major work of this study is to identify candidate molecules specifically expressed in the PE
regions since they may confer proliferation and self-renewal properties to the progenitor cells. In
the future, to determine the functions of these molecules at both the cellular and molecular level, it
is important to integrate them from different gene ontology categories into a unified network,

24
which may also involve other types of cells. This can be done through a series of experiments. First,
we need to identify the target genes of those transcription factors (such as Tp63 and Barx2b).
Second, we need to examine proteins interacting with other gene products like Col17a1 or the
kinase activity changes associated with Cdk1 to determine their effects on progenitor cell cycling.
Another interesting question is whether Col17a1 is involved in the cellular communication between
different progenitor cell types (epithelial stem cells, melanocyte stem cells) within the PE region or
feather collar bulge. We would want to determine whether this process affects the pigmentation of
different feathers. Also it is important to understand whether any cellular and molecular
differences exist between the progenitor cell zones in different bird strains, such as Long-tail
Phoenix chickens vs White Leghorn chickens. It is also important to see how these factors might
regulate differences in feather size in different feather tracts (sickle feathers vs flight wing feathers).
Answers to these questions may underlie the fundamental mechanism controlling organ size and
regional specificities.
It is worth noting that we also found some genes that are specifically down-regulated in the pe
compared to other regions (dermal papilla, lower follicle shealth, etc.). One of them is Sostdc1
(Sclerostin domain-containing protein 1), a known inhibitor or both BMP and Wnt signaling
(Yanagita, 2006; Ahn et al., 2010). It is thus possible that BMP plays a certain role in the PE region.
More experiments are required to dissect interactions between these genes that are
down-regulated in the PE and the five up-regulated genes that are characterized in this study.

References
1. Adam, R. C., Yang, H., Rockowitz, S., Larsen, S. B., Nikolova, M., Oristian, D. S., ... & Fuchs, E. (2015).
Pioneer factors govern super-enhancer dynamics in stem cell plasticity and lineage
choice. Nature, 521(7552), 366-370.
2. Ahn, Y., Sanderson, B. W., Klein, O. D., & Krumlauf, R. (2010). Inhibition of Wnt signaling by Wise
(Sostdc1) and negative feedback from Shh controls tooth number and
patterning. Development, 137(19), 3221-3231.
3. Chakravarti, D., Su, X., Cho, M. S., Bui, N. H. B., Coarfa, C., Venkatanarayan, A., ... & Flores, E. R.
(2014). Induced multipotency in adult keratinocytes through down-regulation of ΔNp63 or
DGCR8. Proceedings of the National Academy of Sciences, 111(5), E572-E581.

25
4. Chen, C. F., Foley, J., Tang, P. C., Li, A., Jiang, T. X., Wu, P., ... & Chuong, C. M. (2015). Development,
regeneration, and evolution of feathers. Annu. Rev. Anim. Biosci., 3(1), 169-195.
5. Chen, T., Heller, E., Beronja, S., Oshimori, N., Stokes, N., & Fuchs, E. (2012). An RNA interference
screen uncovers a new molecule in stem cell self-renewal and long-term
regeneration. Nature, 485(7396), 104-108.
6. Chuong, C. M., & Widelitz, R. B. (2009). The river of stem cells. Cell stem cell, 4(2), 100-102.
7. Chuong, C. M., Randall, V. A., Widelitz, R. B., Wu, P., & Jiang, T. X. (2012). Physiological
regeneration of skin appendages and implications for regenerative medicine. Physiology, 27(2),
61-72.
8. Cotsarelis, G., Sun, T. T., & Lavker, R. M. (1990). Label-retaining cells reside in the bulge area of
pilosebaceous unit: implications for follicular stem cells, hair cycle, and skin
carcinogenesis. Cell, 61(7), 1329-1337.
9. Greco, V., Chen, T., Rendl, M., Schober, M., Pasolli, H. A., Stokes, N., ... & Fuchs, E. (2009). A two-step
mechanism for stem cell activation during hair regeneration. Cell stem cell, 4(2), 155-169.
10. Jackson, S. J., Zhang, Z., Feng, D., Flagg, M., O’Loughlin, E., Wang, D., ... & Yi, R. (2013). Rapid and
widespread suppression of self-renewal by microRNA-203 during epidermal
differentiation. Development, 140(9), 1882-1891.
11. Kouwenhoven, E. N., Van Heeringen, S. J., Tena, J. J., Oti, M., Dutilh, B. E., Alonso, M. E., ... & Zhou,
H. (2010). Genome-wide profiling of p63 DNA-binding sites identifies an element that regulates
gene expression during limb development in the 7q21 SHFM1 locus. PLoS Genet, 6(8), e1001065.
12. Lin, S. J., Wideliz, R. B., Yue, Z., Li, A., Wu, X., Jiang, T. X., ... & Chuong, C. M. (2013a). Feather
regeneration as a model for organogenesis. Development, growth & differentiation, 55(1), 139-148.
13. Lin, S. J., Foley, J., Jiang, T. X., Yeh, C. Y., Wu, P., Foley, A., ... & Chuong, C. M. (2013b). Topology of
feather melanocyte progenitor niche allows complex pigment patterns to
emerge. Science, 340(6139), 1442-1445.
14. Mardaryev, A. N., Gdula, M. R., Yarker, J. L., Emelianov, V. N., Poterlowicz, K., Sharov, A. A., ... &
Fessing, M. Y. (2014). p63 and Brg1 control developmentally regulated higher-order chromatin
remodelling at the epidermal differentiation complex locus in epidermal progenitor
cells.Development, 141(1), 101-111.

26
15. Mi, H., Muruganujan, A., Casagrande, J. T., & Thomas, P. D. (2013). Large-scale gene function
analysis with the PANTHER classification system.Nature protocols, 8(8), 1551-1566.
16. Mortazavi, A., Williams, B. A., McCue, K., Schaeffer, L., & Wold, B. (2008). Mapping and
quantifying mammalian transcriptomes by RNA-Seq. Nature methods, 5(7), 621-628.
17. Nowakowski, R. S., Lewin, S. B., & Miller, M. W. (1989). Bromodeoxyuridine
immunohistochemical determination of the lengths of the cell cycle and the DNA-synthetic phase
for an anatomically defined population. Journal of neurocytology, 18(3), 311-318.
18. Senoo, M., Pinto, F., Crum, C. P., & McKeon, F. (2007). p63 Is essential for the proliferative
potential of stem cells in stratified epithelia. Cell, 129(3), 523-536.
19. Smith, D. M., & Tabin, C. J. (1999). Chick Barx2b, a marker for myogenic cells also expressed in
branchial arches and neural structures. Mechanisms of development, 80(2), 203-206.
20. Stenn, K. S., & Paus, R. (2001). Controls of hair follicle cycling. Physiological reviews, 81(1),
449-494.
21. Su, X., Paris, M., Gi, Y. J., Tsai, K. Y., Cho, M. S., Lin, Y. L., ... & Flores, E. R. (2009). TAp63 prevents
premature aging by promoting adult stem cell maintenance. Cell stem cell, 5(1), 64-75.
22. Tanimura, S., Tadokoro, Y., Inomata, K., Binh, N. T., Nishie, W., Yamazaki, S., ... & Nishimura, E. K.
(2011). Hair follicle stem cells provide a functional niche for melanocyte stem cells. Cell Stem
Cell, 8(2), 177-187.
23. rapnell, C., Williams, B. A., Pertea, G., Mortazavi, A., Kwan, G., Van Baren, M. J., ... & Pachter, L.
(2010). Transcript assembly and quantification by RNA-Seq reveals unannotated transcripts and
isoform switching during cell differentiation. Nature biotechnology, 28(5), 511-515.
24. Trapnell, C., Hendrickson, D. G., Sauvageau, M., Goff, L., Rinn, J. L., & Pachter, L. (2013).
Differential analysis of gene regulation at transcript resolution with RNA-seq. Nature
biotechnology, 31(1), 46-53.
25. Tumbar, T., Guasch, G., Greco, V., Blanpain, C., Lowry, W. E., Rendl, M., & Fuchs, E. (2004).
Defining the epithelial stem cell niche in skin. Science, 303(5656), 359-363.
26. Yanagita, M. (2005). BMP antagonists: their roles in development and involvement in
pathophysiology. Cytokine & growth factor reviews, 16(3), 309-317.

27
27. Yang, A., Schweitzer, R., Sun, D., Kaghad, M., Walker, N., Bronson, R. T., ... & McKeon, F. (1999).
P63 is essential for regenerative proliferation in limb, craniofacial and epithelial
development. Nature, 398(6729), 714-718.
28. Yi, R., Poy, M. N., Stoffel, M., & Fuchs, E. (2008). A skin microRNA promotes differentiation by
repressing ‘stemness’. Nature, 452(7184), 225-229.
29. Yu, M., Wu, P., Widelitz, R. B., & Chuong, C. M. (2002). The morphogenesis of
feathers. Nature, 420(6913), 308-312.
30. u, M., Yue, Z., Wu, P., Wu, D. Y., Mayer, J. A., Medina, M., ... & Chuong, C. M. (2004). The
developmental biology of feather follicles. The International journal of developmental biology, 48,
181.
31. Yue, Z., Jiang, T. X., Widelitz, R. B., & Chuong, C. M. (2005). Mapping stem cell activities in the
feather follicle. Nature, 438(7070), 1026-1029.
32. Zillikens, D. (1999). Acquired skin disease of hemidesmosomes. Journal of dermatological
science, 20(2), 134-154.

Abstract (if available)

Abstract Cell proliferation is a basic cellular event, which exists in all multicellular animals. Cell proliferation plays a role in mediating developmental processes and is regulated by many key molecules represented by Cyclin dependent kinase (CDK) and transcription factors like Tumor protein 63 (Tp63). A cell proliferation zone has been proposed to reside within the papilla ectoderm region of the feather follicle during the growth phase and resting phase of the feather cycle. The presence of this progenitor cell zone was confirmed and shown to play a role in initiating the anagen phase of the feather cycle. BrdU labeling previously has been used to trace stem cells and their progeny within this region. Here we further used the IdU/CldU double labeling method to investigate the distribution, and proliferation of stem cells (SC) and transit amplifying (TA) cells. To date, the molecular mechanism regulating stem cells and progenitor cells in feather follicle papilla ectoderm is largely unknown. Based on RNA-seq data, we chose several highly expressed candidate molecules in the progenitor cell zone and validated their expression pattern by in situ Hybridization. We further characterized the functions of two important transcription factors, Tp63 and Barx2b, in maintaining stem cell identity in the feather papilla ectoderm. These data will provide cellular and molecular clues about the formation and maintenance of the cell proliferation zone.

Linked assets

University of Southern California Dissertations and Theses

Conceptually similar

PDF

Shifting topology of stem cells and molecular expression during feather regenerative cycling

PDF

Characterization of new stem/progenitor cells in skin appendages

PDF

Macroenvironmental regulation of hair follicle stem cells

PDF

Connexins in feather morphogenesis

PDF

Canonical and non-canonical Wnt signaling in the patterning of multipotent stem cells during feather development

PDF

Functional analysis of a prostate cancer risk enhancer at 7p15.2

PDF

Pten deletion in adult pancreatic beta-cells induces cell proliferation and G1/S cell cycle progression

PDF

Fibroblast growth factors and notch signaling in a diethoxycarbonyl dihydrocollidine-induced hepatic progenitor cell liver injury model

PDF

The role of Prkci in stem cell maintenance and cell polarity using a 3-D culture system

PDF

Wnt/β-catenin/p300 induced transcription is critical for the differentiation and maintenance of Paneth cells

PDF

Characterization of the STARS (STochastic gene Activation with Regulated Sparseness) mouse line

PDF

Development of ECM for the preservation of adult mouse pancreatic islet function in vitro

PDF

Characterizing the role of Dnmt1 and its downstream factors in progressive alopecia

PDF

The role of Fgfr2 within Scx-expressing cells of the hair follicle

PDF

Identification and characterization of adult stem cells in the oral cavity

PDF

Cultured neuronal cells derived from the olfactory neuroepithelium growing in three dimensions as a model system for schizophrenia

PDF

Characterization of the retromer complex of proteins in gastric parietal cells

PDF

The noncanonical role of telomerase in prostate cancer cells: exploring a non-telomeric signaling role for telomerase protein (TERT) in a cancer cell line

PDF

Morphoregulation and cycling of ectodermal organs

PDF

Implications of constitutively active bone morphogenetic protein (BMP) signaling in skin morphogenesis and skin postnatal homeostasis

Asset Metadata

Creator Luo, Weiqi (author)

Core Title Characterization of the progenitor cell zone in feather follicles

School Keck School of Medicine

Degree Master of Science

Degree Program Biochemistry and Molecular Biology

Publication Date 04/22/2016

Defense Date 04/21/2016

Publisher University of Southern California (original), University of Southern California. Libraries (digital)

Tag cell,characterization,feather follicles,OAI-PMH Harvest

Format application/pdf (imt)

Language English

Contributor Electronically uploaded by the author (provenance)

Advisor Tokes, Zoltan (committee chair), Chuong, Cheng-Ming (committee member), Sucov, Henry (committee member), Wu, Ping (committee member)

Creator Email jxnclhj@126.com,weiqiluo@usc.edu

Permanent Link (DOI) https://doi.org/10.25549/usctheses-c40-242256

Unique identifier UC11277866

Identifier etd-LuoWeiqi-4361.pdf (filename),usctheses-c40-242256 (legacy record id)

Legacy Identifier etd-LuoWeiqi-4361-0.pdf

Dmrecord 242256

Document Type Thesis

Format application/pdf (imt)

Rights Luo, Weiqi

Type texts

Source University of Southern California (contributing entity), University of Southern California Dissertations and Theses (collection)

Access Conditions The author retains rights to his/her dissertation, thesis or other graduate work according to U.S. copyright law. Electronic access is being provided by the USC Libraries in agreement with the a...

Repository Name University of Southern California Digital Library

Repository Location USC Digital Library, University of Southern California, University Park Campus MC 2810, 3434 South Grand Avenue, 2nd Floor, Los Angeles, California 90089-2810, USA