Male-female conflict after mating: function and dynamics of the copulatory plug in mice (Mus domesticus)

PDF

Download

Open document

Flip pages

Download a page range

Download transcript

Copy asset link

Request this asset

Transcript (if available)

Content
Male-female conflict after mating; function and
dynamics of the copulatory plug in mice (Mus domesticus)
by
Rachel Mangels

A Dissertation Presented to the
FACULTY OF THE GRADUATE SCHOOL UNIVERSITY OF
SOUTHERN CALIFORNIA
In Partial Fulfillment of the
Requirements for the Degree
DOCTOR OF PHILOSOPHY
(Molecular Biology)

May 2016

Copyright 2016 Rachel Mangels

ii
Acknowledgements
Foremost, I would like to express my gratitude to my advisor Dr. Matt Dean for
the continuous support of my PhD and introducing me to the field of copulatory plugs. I
am thankful for your guidance and interest in my project and studies, leading to my
development as a scientist and critical thinker.
In addition to my advisor, I would like to thank the rest of my thesis committee,
both past and present: Dr. Sergey Nuzhdin, Dr. David Conti, Dr. Xuelin Wu and Dr.
Norm Arnheim; for their insightful comments, but also the questions which improved my
research and understanding.
I would like to thank my fellow labmates especially Lorraine Provencio and Brent
Young for their advice and friendship. Also, while we no longer have our weekly dinners,
I would like to thank my whole first year class for the comradely during our first years.
As iron sharpens iron, I am grateful for my collaborators and everyone I have
encountered in Ray Irani Hall.
Thanks to my parents and sister, Kate, for their tremendous support during both
my time at USC and leading up to it along (becoming experts in copulatory plugs along
with me). Especially, my parents for bringing me around the world, inspiring my desire
to study biology. Mostly, this PhD is dedicated to my support team behind the scenes
supporting me and cheering me along the way.

iii
Table of Contents
1 Chapter 1: Introduction ........................................................................................ 1
1.1 Sexual Selection .......................................................................................... 1
1.2 Male Adaptation to Sperm Competitions .................................................... 3
1.2.1 Sperm Production ................................................................................ 3
1.2.2 Seminal Fluid ...................................................................................... 5
1.3 Function of the Copulatory Plug ................................................................. 7
1.3.1 Fertility ................................................................................................ 7
1.3.2 Mate Guarding .................................................................................... 8
1.4 Sexual Conflict .......................................................................................... 11
1.5 Model Organism ........................................................................................ 12
1.6 Goals of Thesis .......................................................................................... 13
2 Chapter 2: Copulatory plugs inhibit the reproductive success of rival males .... 15
2.1 Abstract ...................................................................................................... 15
2.2 Introduction ............................................................................................... 16
2.3 Material and Methods ................................................................................ 19
2.3.1 Study Organisms ............................................................................... 19
2.3.2 Experiment 1: Serial Mating ............................................................. 20
2.3.3 Experiment 2: Serial Mating, First Male Vasectomized ................... 21
2.3.4 Paternity Assignment ........................................................................ 21
2.3.5 Statistical Analysis ............................................................................ 23
2.4 Results ....................................................................................................... 23
2.4.1 Experiment 1 ..................................................................................... 23
2.4.2 Experiment 2 ..................................................................................... 25
2.5 Discussion .................................................................................................. 25
2.5.1 Evidence that plug-forming species still show multiple paternity .... 26
2.6 Conclusions ............................................................................................... 28
3 Chapter 3: Genetic and phenotypic influences on copulatory plug survival ..... 30
3.1 Abstract ...................................................................................................... 30
3.2 Introduction ............................................................................................... 31
3.3 Materials and Methods .............................................................................. 33
3.3.1 Study Organisms ............................................................................... 33
3.3.2 Experimental Matings and Plug Survival ......................................... 35
3.3.3 Male Morphology ............................................................................. 36
3.3.4 Proteomic Analyses .......................................................................... 36
3.3.5 Thrombin Assays .............................................................................. 37
3.3.6 Exome Sequencing ............................................................................ 39
3.4 Results ....................................................................................................... 41
3.4.1 Plug Survival ..................................................................................... 41
3.4.2 Male Morphology ............................................................................. 44
3.4.3 Proteomic Analyses .......................................................................... 46
3.4.4 Thrombin Assays .............................................................................. 47
iv
3.4.5 Exome Variation ............................................................................... 47
3.5 Discussion .................................................................................................. 49
3.5.1 Plug Survival ..................................................................................... 49
3.5.2 Why would males make large plugs? ............................................... 51
3.6 Conclusions ............................................................................................... 53
4 Chapter 4: Male and female control over copulatory plug survival .................. 54
4.1 Abstract ...................................................................................................... 54
4.2 Introduction ............................................................................................... 54
4.3 Methods ..................................................................................................... 58
4.3.1 Study Organism ................................................................................ 58
4.3.2 Exposure Groups and Experimental Mating ..................................... 59
4.3.3 Thrombin Assays .............................................................................. 60
4.4 Results ....................................................................................................... 61
4.5 Discussion .................................................................................................. 64
4.6 Conclusions ............................................................................................... 66
5 Chapter 5: Conclusion ........................................................................................ 67
5.1 Future directions ........................................................................................ 67
5.1.1 Is there a link between plug size and fitness? ................................... 68
5.1.2 Is the effectiveness of copulatory plugs dependent on ecology? ...... 69
5.1.3 Does sperm competition risk affect copulatory plug function? ........ 70
5.1.4 How is human semen coagulation linked to fertility? ...................... 71
5.2 Final Remarks ............................................................................................ 72
6 Appendix A: Male Morphological Data ............................................................ 74
7 Appendix B: Thrombin Assay Recipes and Protocol ........................................ 77
8 References .......................................................................................................... 79

v
List of figures
Figure 3.1 Methods for thrombin-induced fluorescence ................................................... 38
Figure 3.2 Plug mass by male genotype ........................................................................... 42
Figure 3.3 Proportion of plugs present (24 hours) by plug mass. ..................................... 43
Figure 3.4 DGA and DJO plug mass ................................................................................ 44
Figure 3.5 An example of a coomassie-stained polyacrylamide gel ................................ 45
Figure 3.6 Protease activity correlated with plug size ...................................................... 48
Figure 3.7 No thrombin controls. ...................................................................................... 51
Figure 4.1 Results of the thrombin assay .......................................................................... 61
Figure 4.2 Results of the thrombin assay using preference as a factor. ............................ 63
Figure A.1 Proportion of plug present by residual seminal vesicle weight ...................... 74
Figure A.2 Proportion of plug present by residual testes weight ...................................... 75

vi
List of tables
Table 2.1 Distribution of pregnancies sired by first or second males.. ............................. 24
Table 3.1 Generalized linear models testing factors of plug survival ............................... 41
Table 3.2 Principal Components of proportions of the four main protein bands ............. 46
Table 3.3 Linear model of the factors of proteolytic activity ........................................... 47
Table 4.1 Genotype based results of linear model on protease activity ............................ 62
Table 4.2 Preference based results of linear model on protease activity .......................... 63
Table A.1 Seminal vesicle protein quantification across genotype .................................. 75
Table A.2 Male morphological data ................................................................................. 76
Table B.1 Example plate setup ......................................................................................... 78

vii
Abstract
Sexual selection is a strong evolutionary force affecting numerous aspects of
reproduction. In many internally fertilizing species, females mate with multiple males
during a reproductive cycle, leading to sperm competition. Although multiple mating
likely benefits females, it decreases any one male’s potential for reproductive success,
resulting in sexual conflict over remating. Consistent with this hypothesis of sexual
conflict, males of many species have evolved countermeasures to prevent multiple
mating. Chapter 1 introduces these countermeasures, and the resulting conflict over
female remating, focusing on the male derived copulatory plug. In mice (Mus
domesticus), a male’s seminal fluid coagulates inside of the female’s vaginal-cervical
space to form a copulatory plug. The copulatory plug has multiple proposed functions,
but a large body of research suggests that this structure evolved as a male’s defensive
adaptation to sperm competition to impede future mating opportunities for females.
The research-based chapters of this thesis quantify the copulatory plug’s role in
preventing female remating and investigate the influence of sexual conflict on copulatory
plug dynamics. In Chapter 2, I use a one-female-two-male serial mating design to
quantify the role of the copulatory plug in mate guarding. By using a knockout model
that is unable to form a copulatory plug, I am able to directly and noninvasively
determine the effectiveness of copulatory plug for the first time, showing that the second
male sired significantly fewer pregnancies when the first male could form a copulatory
plug. This chapter is currently in review at the journal Evolution.
Although chapter 2 shows the plug has a strong effect on female remating, it
remained unknown whether the efficacy of the plug varied across male and female
viii
genotypes. Chapter 3 contains the first systematic examination of copulatory plug
dynamics in mice, which is key to understanding the phenotypic and genetic bases of
copulatory plug breakdown. Using 8 genetically distinct strains of males and 2
genetically distinct female genotypes of house mice (Mus domesticus), I uncovered
significant influence of male genotype on the length of time that the copulatory plug
remained intact in the female’s reproductive tract. Counter intuitively, males that
produced small plugs tended to produce long-lasting plugs, potentially providing insight
into the mechanisms by which females clear them. This chapter has been published as a
research article in Heredity.
In Chapter 4, I investigated whether females adjusted plug clearance
according to whether they mated with preferred or unpreferred males. A model of
sexual conflict predicts that females will clear plugs more rapidly when mated to
unpreferred males, especially when pre-exposed to the scents of both preferred and
unpreferred males. I did not find support for these predictions, and discuss potential
reasons why. In Chapter 5, I place my results in the context of future experiments that
will aid our understanding of the fitness implications of the variation observed and
highlight the importance of studying the effect of seminal fluid after mating.

1
1Chapter 1: Introduction
1.1 Sexual Selection
Sexual selection was first described by Charles Darwin as "the advantages that
certain individuals have over others of the same sex … in exclusive relation to
reproduction"(Darwin, 1871). While natural selection favors traits that increase an
individual’s fitness, sexual selection selects for traits that enhance an individual's
reproductive success, however, in the end both forces favor individuals that contribute
more heritable traits to the next generation. The theory of sexual selection was
controversial, especially the fitness benefits of conspicuous ornamental traits, when first
discussed in the Descent of Man and Selection in Relation to Sex, however it has been
shown to be an important evolutionary force (Darwin, 1871, Andersson, 1994, Møller &
Birkhead, 1989).
Sexual selection can be divided into non-mutually exclusive categories,
(Andersson, 1994). First, sexual selection favors traits that cause an individual of one sex
to be viewed as an attractive partner to the opposite sex. These mating preferences or
intersexual competition can select for elaborate secondary sexual adornments and
displays of sexual attractiveness (Kodric-Brown & Brown, 1984, Endler & Houde, 1995,
Endler, 1992). Second, selection can favor traits that enhance an individual's success in
same sex competition to gain mating opportunities. Mating competition or intrasexual
competition can select for secondary traits such as weaponry used in precopulatory
competition (Preston et al., 2003, Emlen, 2008, Clutton-Brock, 1982). These two
processes can be exercised by either sex. However in most taxa a males’ mating success
2
depends on their access and monopolization of mates, while females invest more in their
gametes and provides greater parental investment than males, causing females to be the
choosier sex (Bateman, 1948, Robert, 1972, Burley, 1977).
A female can exercise choice at different stages of mating including before
mating, during copulation, and after mating (Birkhead & Møller, 1993). Before mating,
females exercise choice behaviorally by not mating indiscriminately (Houde, 1987, Zuk
et al., 1990, Mossman & Drickamer, 1996). Females can also exercise choice after
mating, for example through differential abortion of certain embryos (Gosling, 1986,
Bruce, 1960). Female mate preference results in a higher reproductive output and
increased offspring growth rate (Reynolds & Gross, 1992). Evidence from multiple taxa
indicates that females use multiple mating to exercise choice by using post copulatory
mechanisms to manipulate offspring paternity and in turn enhance the fitness of their
offspring (Zeh & Zeh, 2001, Jennions & Petrie, 2000, Tregenza & Wedell, 2000).
Females can increase their fitness by mating with high quality males, or males that are
genetically compatible (Brown, 1997, Drickamer et al., 2000, Fisher et al., 2006, Zeh &
Zeh, 2001, Birkhead & Pizzari, 2002, Mays & Hill, 2004). Specifically, in the field
cricket, Gryllus bimaculatus, egg viability is correlated to number of mates (Tregenza &
Wedell, 1998). In psuedoscorpions, Cordylochernes scorpioides, females who mated
with multiple males had lower embryo failure (Zeh, 1997). These studies suggest that
multiple mating enables female to bias fertilization toward preferred males and increases
the likelihood of mating with a genetically superior or compatible male (Birkhead &
Moller, 1998, Jennions & Petrie, 2000). Benefits of multiple mating not only include
genetic benefits (Birkhead & Pizzari, 2002), but alternatively non-genetic benefits
3
including preventing harassment of other males or for material benefits such as food
resources (Rubenstein, 1984, Reynolds, 1996, Stone, 1995). While Darwin first described
mating competition as a process that occurred before mating, multiple mating sets up a
new arena for male-male competition, selecting for multitude of male adaptations
(Birkhead & Moller, 1998).
1.2 Male Adaptation to Sperm Competitions
From the males’ perspective, males benefit by preventing females from remating.
Male-male competition for fertilization occurs after mating via sperm competition, which
occurs when ejaculates from multiple males overlap in a female’s reproductive tract
(Parker, 1970, Simmons, 2001, Parker, 1998). Multiple mating by females is common in
many taxa causing sperm competition to be a key evolutionary force affecting male
reproductive morphology, physiology, and behavior (Birkhead & Moller, 1998, Birkhead,
2000).
1.2.1 Sperm Production
Post copulatory sexual selection such as sperm competition favors adaptations
that increases a males reproductive success such as increased sperm production
(Simmons, 2001, Moller, 1989). Sperm competition favors an increased number of sperm
per ejaculate due to a “raffle principle” (Parker, 1998) whereby male fertilization success
increases with the amount of sperm transferred to the female. In vivo laboratory studies
have shown that males with a higher number of sperm have a fertilization advantage over
their rivals (Martin et al., 1974). This fitness advantage for an increased number of sperm
has resulted in the selection for increased sperm production favoring the evolution of
4
larger testes (Parker & Pizzari, 2010, Firman et al., 2015, Harcourt et al., 1981). For
example, males from species with low levels of multiple mating have smaller testes than
males from species with an inferred high level of sperm competition (Ramm et al., 2005,
Firman & Simmons, 2008). This positive correlation between sperm competition and
testes size has been shown between species in many taxa including primates (Møller,
1988, Harcourt et al., 1981), birds (Pitcher et al., 2005), insects (Gage, 1994) and frogs
(Byrne et al., 2002). In addition to testes size, post copulatory sexual selection selects for
an increased amount or proportion of seminiferous tubules, the sperm producing tissue
(Firman et al., 2015, Montoto et al., 2012).
Strategic sperm allocation strategies are an important male adaptation to sperm
competition, but sperm competition has also been shown to select for increased sperm
viability, quality and the ability to fertilize eggs (Firman & Simmons, 2010a, Gomendio
et al., 2006, Dorus et al., 2010, Young et al., 2013, Moller, 1989). A high level of sperm
competition is associated with faster sperm swimming speed, which may enhance the
ability of sperm to reach the ova before rival’s (Gage et al., 2004, Malo et al., 2006,
Birkhead et al., 1999, Fitzpatrick et al., 2009). Modifications in sperm morphology may
result in improvements of sperm velocity, for example, sperm competition selects for
altered sperm head morphology (Montoto et al., 2011) and for longer sperm (Gomendio
& Roldan, 1991, Gage & Freckleton, 2003). Sperm length, specifically midpiece length,
is correlated to sperm velocity, perhaps due to a increase in energy reserves (Firman &
Simmons, 2010b).
5
1.2.2 Seminal Fluid
Recent studies have shown that in addition to sperm traits, sperm competition can
affect other components of male’s ejaculate (Ramm et al., 2015, Wigby et al., 2009).
Non-sperm components of the ejaculate, including seminal fluids, can have significant
effects on male reproductive fitness and may influence the outcome of sperm competition
(Simmons, 2001). In mammals, this mixture of proteins, amino acids, enzymes,
carbohydrates, and mRNA is produced in the accessory reproductive glands including
seminal vesicles and the prostate gland and transferred along with sperm (McGraw et al.,
2015). Seminal fluid has a variety of functions, including modification of pH in the
female environment (Arienti et al., 1999), suppression of the female immune response
(Robertson, 2007, Thaler, 1989), and protection of sperm from oxidative stress (Chen et
al., 2002, Wai-Sum et al., 2006, Sharma et al., 1999, Helfenstein et al., 2010). In insects,
components of seminal fluid induce egg production and can change the behavior of a
female by decreasing her receptivity to future matings (Rubinstein & Wolfner, 2013,
Heifetz et al., 2000, Chen et al., 1988, Wolfner, 1997). Seminal fluid can also modulate
the outcome of sperm competition by directly influencing sperm phenotypes such as
motility or through interaction with a competitor male’s sperm (Price et al., 1999, Zhu et
al., 2006, Poiani, 2006). Overall, seminal fluid may improve a male’s chance of gaining
paternity under competitive conditions, both through direct advantage such as protection
from oxidative stress as well as indirect affect such as reducing receptivity in females.
1.2.2.1 Copulatory Plug
In many species, a large portion of male seminal fluid coagulates to form a
copulatory plug, which is a hardened mass deposited in or around the female reproductive
6
tract during mating. This structure (or structures that appear to play a similar role) has
been described from a diversity of taxa, including insects (Rogers et al., 2009, Orr &
Rutowski, 1991, Parker, 1970, Dickinson & Rutowski, 1989) reptiles (Devine, 1975,
Herman, 1994), arachnids (Austad, 1984, Masumoto, 1993, Uhl et al., 2010) and
nematodes (Abele & Gilchrist, 1977, Barker, 1994, Palopoli et al., 2008).
The copulatory plug's existence in multiple taxa emphasizes its adaptive
advantage, since a copulatory plug is formed in different ways between taxa, but seems to
have a common role of blocking the female reproductive tract. Some male spiders,
including the funnel web spider, Agelena limbata, either produce a amorphous secretion
which blocks the females’ copulatory duct or leave behind the whole copulatory organ in
the female genital opening (Uhl et al., 2010, Snow et al., 2006, Masumoto, 1993, Suhm et
al., 1996). The copulatory plug of some male reptiles is produced from secretions of the
kidney, not seminal fluid (Devine, 1975, Herman, 1994). In some strains of
Caenorhabditis elegans males produce a gelatinous copulatory plug that covers the
genital opening of the female after mating (Barker, 1994) made from a secreted mucin
(Palopoli et al., 2008).
Donald Dewsbury (1978) performed one of the earliest comparative studies of
copulatory plugs in rodents. He found that males of 7 species of rodents (mice, hamsters,
rats, voles, gerbils) all formed copulatory plugs when mated. Dewsbury described the
copulatory plug as having a rubbery consistence, which completely filled the vagina. In
mice, perhaps 1/3 of all ejaculated proteins contribute to copulatory plug formation (Dean
et al., 2009), specifically proteins from the seminal vesicle and prostate (Fawell &
Higgins, 1987). The prostate-derived protein, Transglutaminase IV, crosslinks seminal
7
vesicle-derived proteins (SVS1, SVS2, SVS4, SVS5 among others) to form a hardened
structure once they mix inside the female reproductive tract (Peter et al., 1997, Lin et al.,
2002). Copulatory plugs in primates are formed in similar manner with seminal vesicle
and prostate proteins mixing inside the female reproductive tract with the degree of
coagulation varying between species (Dixson & Anderson, 2002). In chimpanzees and
ringtail lemurs, which have high levels of multiple mating, this coagulum hardens to a
firm consistency (Dixson & Anderson, 2002). In humans, seminal vesicle proteins form a
viscous gel (reminiscent of a plug) after ejaculation, which quickly liquefies (Huggins &
Neal, 1942). This variation of consistency related to mating system lends support to the
role of sperm competition favoring the evolution and maintenance of the copulatory plug
1.3 Function of the Copulatory Plug
The copulatory plug is proposed to have multiple functions, all of which have
variable support in the literature but none of which have been tested directly and
noninvasively.
1.3.1 Fertility
Copulatory plugs are hypothesized to increase the fertility of the male through
multiple mechanisms. The copulatory plug forms a strong seal in the female reproductive
tract blocking off the vagina, which prevents sperm loss through backflow (Michener,
1984). However this might not be as important in rodents that directly deposit their sperm
into the uterus, not the vagina, since the cervical muscles retain the sperm inside the
uterus (Blandau, 1945b, Carballada & Esponda, 1997). The tight seal of the copulatory
plug may also induce contractions to aid in the passage of sperm through the female
8
reproductive tract by stimulating sperm transport (Cukierski et al., 1991). Consistent with
this hypothesis, rats that have ill formed or no copulatory plugs have less sperm in the
female reproductive tract (Blandau, 1945b, Toner et al., 1987, Matthews Jr & Adler,
1978). Knockout mice that are not able to form a copulatory plug also suffer reduced
fertility in non-competitive meetings, even though they have normal sperm morphology,
reproductive anatomy and fertilize oocytes in vitro. (Dean, 2013). In addition, studies in
primates demonstrate how the copulatory plug benefits the passage of sperm through the
cervix by improving conditions in the female reproductive tract (Hernández-López et al.,
2008). Specifically, copulatory plugs may buffer vaginal pH and raise the temperature of
the vagina, increasing sperm survival in the female reproductive tract (Arienti et al.,
1999, Hernández-López et al., 2008). Lastly, the presence of the copulatory could cause
physical stimulation, which shifts the female into a state of pseudo-pregnancy thereby
allowing successful implantation (Ball, 1934).
Another less probable hypothesis is that the copulatory plug may permit a gradual
release of sperm as it dissolves in the female reproductive tract, since sperm has been
found in the copulatory plug (Asdell & Hubbs, 1964). However, placing copulatory plugs
in unmated females never resulted in successful fertilization in guinea pigs (Martan &
Shepherd, 1976). The sperm found in the copulatory plug may simply be trapped due to
the quick coagulation of the plug.
1.3.2 Mate Guarding
In addition to the copulatory plug's role in paternity under non-competitive
conditions, it may have evolved to inhibit remating of females to a rival male (Devine,
1975, Parker, 1970, Barker, 1994), a hypothesis that is supported by a combination of
9
molecular studies, experimental evolution, and comparative studies. In guinea pigs,
second males to mate gained paternity upon experimental removal of the copulatory plug
but never sired any offspring when the plug remained (Martan & Shepherd, 1976),
showing the copulatory plug as an effective barrier. Experimental plug removal did not
affect paternity in the deer mouse, Peromyscus maniculatus (Dewsbury, 1988). Males
have also been shown to remove plugs of a rival male (Parga, 2003, Wallach & Hart,
1983) and mixed paternity litters in plug forming mammals do arise in nature (Dean et
al., 2006, Eberle & Kappeler, 2004, Searle, 1990, Birdsall & Nash, 1973). Furthermore,
some monogamous species still form a copulatory plug, even though males will not be
selected to prevent remating of females (Ribble, 1991, Baumgardner et al., 1982,
Gubernick, 1988, Foltz, 1981). Taken together, these studies suggest that the plug has
multiple roles.
Comparative studies have shown that plugs coagulate more strongly in species
with higher inferred levels of sperm competition (Hartung & Dewsbury, 1978, Dixson &
Anderson, 2002, Ramm et al., 2005). In particular, a comparative study of 40 primate
species with different mating strategies indicated a correlation of the coagulation of
seminal fluid with mating ecology; with stronger coagulation in primates with high levels
of multiple mating (Dixson & Anderson, 2002). Copulatory plugs have been lost in
gorillas, which experience low levels of sperm competition (Carnahan & Jensen-Seaman,
2008, Jensen-Seaman & Li, 2003). These results would be predicted if sperm competition
were driving or maintaining copulatory plug formation. It should be noted that even
monogamous primates have some form of coagulation, but the copulatory plug’s
proposed role in fertility offers an explanation for the maintenance of some coagulation.
10
In the Dewsbury study discussed above, four of the 11 rodents tested did not form a
copulatory plug, however, all of these species have a locking pattern of reproduction, a
prolonged tie between the penis and vagina after mating, which may act as an alternative
way to prevent the female from remating (Hartung & Dewsbury, 1978). This trend is not
just limited to rodents, as species of snakes that do not form copulatory plugs have
evolved other mechanisms to prevent re-mating. In V. berus, the renal secretion does not
form a plug but instead induces contraction of the sphincter muscles of the uteri
preventing rival sperm from entering the uterus (Nilson & Andrén, 1982).
Few studies have directly investigated how the copulatory plug prevents or delays
female remating. In rodents, there is a correlation between plug and vaginal length,
suggesting the copulatory plug physically blocks rival sperm (Baumgardner et al., 1982).
However, the copulatory plug may prevent remating in multiple ways: the plug can act as
a physical barrier to sperm, it can prevent the male from gaining proper mating
orientation, or it can act as a physical cue to a rival male that the female has already
mated. In C. elegans strains where the copulatory plug persisted, the plug has been shown
to interfere with the remating of the female by making it harder for the male to retain
contact with the female during mating (Barker, 1994). In a study in chalcedon
checkerspot butterflies, Euphydryas chalcedona, researchers transplanted copulatory
plugs to receptive virgin females and showed that these plugs prevented copulation by
preventing rival males from properly gripping the female genitalia (Dickinson &
Rutowski, 1989).
Evidence suggests that males avoid mating with females with deposited
copulatory plugs, which may be either through pheromone cues or through the plug
11
acting as a visual cue (Ramm & Stockley, 2014, Ross & Crews, 1977). Observations in
garter snakes have shown that female attractiveness declines after mating and males are
often not interested in females that have a deposited copulatory plug. However, removal
of the copulatory plug can re-establish interest (Devine, 1977). Cressida cressida forms a
large external mating plug, which may act as a physical cue of the females mating status,
since a male will pursue mated females briefly but not make physical contact or attempt
to mate with them once they observe the deposited plug (Orr & Rutowski, 1991).
1.4 Sexual Conflict
Although the function of the plug is not fully known, the evidence presented
suggests it plays at least some role in impeding subsequent mating by a female. While the
copulatory plug would benefit males by securing their reproductive investment, it would
potentially harm females as they likely benefit from remating (Jennions & Petrie, 2000,
Fedorka & Mousseau, 2002, Zeh & Zeh, 2001, Slatyer et al., 2012). Although there is no
direct evidence of the cost of the copulatory plug to a female, females have been
observed removing deposited copulatory plugs suggesting a conflict over remating
(Koprowski, 1992, Fenton, 1984). In addition, females produce serine endopeptidases
(Dean et al., 2011) and begin sloughing off their epithelium shortly after mating (personal
observation), which may lead to loosening of the plug and allow for its expulsion. In
contrast, male seminal fluid is enriched for serine endopeptidase inhibitors, potentially
revealing a molecular basis of sexual conflict over the ultimate fate of the copulatory
plug. Consistent with this hypothesis of sexual conflict (Stockley, 1997), plug-forming
proteins, proteases, and protease inhibitors tend to evolve very rapidly (Ramm et al.,
2008, Dean et al., 2009, Dean et al., 2011). In some species, the rate of protein evolution
12
among copulatory plug genes is positively correlated with the inferred intensity of sexual
conflict in a species’ mating ecology (Dorus et al., 2004, Ramm et al., 2009).
1.5 Model Organism
Mus domesticus provides a powerful system to investigate the function, fate and
dynamics of the copulatory plug. Mice have been used as model organisms for years
leading to a large body of information about their development, reproduction, physiology,
and genetics. Institutions have hundreds of defined strains of mice, which are genetically
identical because of multiple generations of inbreeding (Beck et al., 2000), allowing for
more accurate and repeatable experiments. Inbred strains can carry random or engineered
mutations on a fixed background which allows us to study genotype-phenotype
relationships for many traits (Peters et al., 2007). Multiple genetic resources and
experimental tools have been developed including the mouse knockout model (Austin et
al., 2004, Testa et al., 2004). Additional mouse resources include a sequenced genome
(Keane et al., 2011, Wong et al., 2012, Chinwalla et al., 2002), a dense microsatellite map
(Schalkwyk et al., 1999, Dietrich et al., 1992), gene expression database (Finger et al.,
2011, Su et al., 2004, Schultz et al., 2003), and SNP databases (Blake et al., 2011, Wade
et al., 2002, Ideraabdullah et al., 2004). Mice and humans share 95 percent of the same
genes and the genetic basis for many diseases are similar, making mice an ideal model to
study complex disease such as cancer (Peters et al., 2007). Moreover mice have a short
gestation period and are relatively easy to maintain and manipulate in a laboratory setting
with well-established protocols.
In addition, in nature female house mice regularly mate with multiple males in a
single estrus, creating ample opportunity for sperm competition and sexual conflict in
13
nature (Dean et al., 2006, Firman & Simmons, 2008). In natural populations, between 10-
70% of pregnant female house mice carry offspring sired by more than one male (Dean et
al., 2006, Firman & Simmons, 2008), indicating that the copulatory plug is not
completely effective, however the exact effectiveness of the copulatory plug is not
known.
1.6 Goals of Thesis
The goal of this research is to better understand the function and dynamics of the
copulatory plug. Different functional hypotheses have never been tested with direct and
non-invasive experiments. In Chapter 2, I utilize a one-female-two-male serial mating
design to examine the proposed yet understudied function of the copulatory plug in
preventing the female from remating. Taking advantage of a knockout model, which is
unable to form a copulatory plug, I show that the first male to mate sires all of the offspring
if he can form a plug, but none of the offspring if he cannot.
Sexual conflict could preserve the genetic variation of copulatory plug genes and
phenotypes, for example different male alleles of copulatory plug genes could be better at
avoiding degradation in some but not all females. Understanding the genetic basis of the
copulatory plug requires a systematic investigation of the fate of the plug following
mating. In Chapter 3, I cross males from 8 genetically distinct strains of mice to females
of 2 genetically distinct strains to investigate the phenotypic correlation and genetic
basis of copulatory plug survival. A model of sexual conflict predicts a male-female
interaction in the dynamics of copulatory plug survival and degradation. I show that plug
survival is significantly affected by male genotype and, against intuition; plug survival
time is negatively correlated with plug size. While the copulatory plug is expected to
14
harm females that have mated to unpreferred males, it may actually benefit females that
have mated to preferred males, and in this case females may preserve the plug. In
Chapter 4, I employ an experiment designed specifically to test for a male-female
interaction in protease activity, following the prediction that females will clear plugs
more rapidly when mated to unpreferred males, especially when pre-exposed to the
scents of both preferred and unpreferred males. Although a model of sexual conflict
supports these predictions, I did not detect an interaction term. Chapter 5 places my
results in the context of future experiments to increase our understanding of the fitness
effects of the variation observed and discussing the wider impact of my work.

15

2Chapter 2: Copulatory plugs inhibit the reproductive success
of rival males
This work has been submitted for publication as below:
R. Mangels, K. Tsung, K. Kwan, M. Dean. Copulatory plugs inhibit the reproductive
success of rival males.
2.1 Abstract
In many species, females gain fitness from mating with multiple males during a
single fertile period, but males have evolved means to inhibit such remating. The
copulatory plug, which in mice forms from coagulated seminal fluid, presumably
functions to inhibit female remating. In spite of this intuitive explanation, there has been
no direct, non-invasive, estimate of the plug’s efficacy in the context of male-male
competition. We employed a mouse knockout model for an important coagulatory protein
(as well as their wild type brothers), in one-female-two-male serial matings in mice.
When the first male formed a plug normally, he sired nearly all the embryos. In contrast,
when the first male could not form a plug, the second male sired nearly all of the
embryos. Interestingly, even when first males were vasectomized, they still prevented
100% of second-male paternity if they could form a plug, demonstrating the plug can
impede remating even in the absence of fertility. We discuss our results in the context of
natural populations, where in spite of the strong effects seen here, pregnant female mice
regularly carry litters fertilized by more than one male.
16
2.2 Introduction
The theory of sexual selection is based on the principal of enhancing reproductive
success by excluding rivals (intrasexual selection) and/or by attracting mates (intersexual
selection) (Darwin, 1871). One predominant view is that male reproductive success
increases with the number of mates and therefore depends on access to and
monopolization of females (Bateman, 1948). Prior to copulation, males of many species
compete for access to females via larger body size or weaponry (Andersson, 1994,
Emlen, 2008, Lincoln, 1994, Preston et al., 2003). Over the past 40 years, it has become
increasingly apparent that males also compete after copulation, a phenomenon that is
generally referred to as sperm competition (Birkhead & Moller, 1998, Parker, 1970).
In many internally fertilizing species, females mate with more that one male in a
reproductive cycle, but males seem to have evolved countermeasures to bias paternity in
their favor (Møller & Birkhead, 1989, Birkhead & Moller, 1998, Eberhard, 1996). For
example, increased intensity of sperm competition has been shown to select for larger
testes and spermatogenic capacity (Ramm et al., 2005, Stockley et al., 1997, Hosken &
Ward, 2001, Moller, 1989, Harcourt et al., 1981, Firman et al., 2015), increased sperm
viability, physiological performance, or ability to fertilize eggs (Firman & Simmons,
2010a, Gomendio et al., 2006, Dorus et al., 2010, Young et al., 2013) and variation in
male reproductive strategies (Parker, 1998, Parker & Pizzari, 2010, Dziminski et al.,
2009, Taborsky, 1998, Gross, 1996, Wigby et al., 2009). Males are also capable of
dynamically adjusting ejaculated allocation or composition based on their perceived risk
and intensity of sperm competition (Ramm et al., 2015, Wigby et al., 2009, Delbarco-
17
Trillo & Ferkin, 2004, Firman et al., 2013, Preston & Stockley, 2006, Kelly & Jennions,
2011, Delbarco‐Trillo, 2011, Fuller, 1998).
In many species, a male’s ejaculate coagulates inside the female reproductive tract
to form a copulatory plug (Williams-Ashman, 1984, Dixson & Anderson, 2002, Devine,
1975, Masumoto, 1993, Hartung & Dewsbury, 1978, Voss, 1979). Copulatory plugs and
structures that appear to play a similar role have been described from a diversity of taxa,
including insects (Rogers et al., 2009, Orr & Rutowski, 1991, Parker, 1970, Dickinson &
Rutowski, 1989) reptiles (Devine, 1975, Herman, 1994), arachnids (Austad, 1984,
Masumoto, 1993, Uhl et al., 2010) and nematodes (Abele & Gilchrist, 1977, Barker,
1994, Palopoli et al., 2008). Multiple lines of evidence suggest a major function of the
copulatory plug is to inhibit future matings (Voss, 1979, Parker, 1979, Mosig &
Dewsbury, 1970, Hartung & Dewsbury, 1978). Namely, copulatory plugs are more
prominent in species with relatively intense sperm competition (Hartung & Dewsbury,
1978) with stronger coagulation in species with high levels of inferred sperm competition
(Dixson & Anderson, 2002), and species with relatively intense sperm competition
develop relatively larger seminal vesicles (Ramm et al., 2005), which is the primary
source of copulatory plug proteins (Dean et al., 2009, Dean et al., 2011). In addition,
gorillas, a species with very little sperm competition, have lost the ability to make plugs,
which is accompanied by genetic degradation of copulatory plug genes (Dixson, 1998a,
Jensen-Seaman & Li, 2003, Carnahan & Jensen-Seaman, 2008, Kingan et al., 2003).
Although the copulatory plug is likely to benefit males, they potentially harm
female fitness. Accordingly, females may influence the effectiveness of the copulatory
plugs by not allowing proper orientation of the copulating male (Matthews Jr & Adler,
18
1978) or by removing deposited plugs (Koprowski, 1992, Parga, 2003). Female mice
upregulate proteases in response to mating, a potential indication that females degrade or
dislodge the plug shortly after mating (Dean et al., 2009). Interestingly, male seminal
fluid is enriched for protease inhibitors (Dean et al., 2009, Dean et al., 2011).
Furthermore, copulatory plug forming proteins tend to evolve rapidly (Dorus et al., 2004,
Ramm et al., 2008, Clark & Swanson, 2005, Karn et al., 2008, Ramm & Stockley, 2009)
consistent with an arms race model by which male-derived proteins evolve rapidly over
time to avoid the degradation machinery of the female.
Previous experiments indirectly suggested the copulatory plug inhibits female
remating. Copulatory plugs were shown to delay copulation of receptive females in
butterflies (Dickinson & Rutowski, 1989). Upon experimental removal of the plug from a
first male to mate, second males gained paternity (Martan & Shepherd, 1976). However,
plug removal is an invasive method and it is possible that the effects of the plug have
already manifested themselves before its removal. A more recent experiment
demonstrated that first males to mate were less able to inhibit second male paternity if
they had mated recently, presumably because they were unable to reconstitute sufficient
seminal fluid proteins with shorter refractory periods (Sutter et al., 2015).
Here we directly quantified the role of the copulatory plug in inhibiting second
male paternity with minimal invasiveness and maximal efficacy. We employed a mouse
model that is knocked out for Transglutaminase IV (Tgm4), a protein that has only been
detected in male prostate (Dubbink et al., 1998, Su et al., 2002, Su et al., 2004) and
crosslinks other ejaculated proteins to form the copulatory plug (Notides & Williams-
Ashman, 1967, Williams-Ashman, 1984). Tgm4 knockout males appear phenotypically
19
normal, including sperm count and sperm motility (Dean, 2013). However, they do not
form a copulatory plug (Dean, 2013), offering a powerful model for testing its role in
sperm competition in a direct, non-invasive manner. Using a serial mating design, we
show that the plug is almost 100% effective at inhibiting females from mating with a
second male, even when the first male is vasectomized. We discuss these results in the
context of natural mating ecology of house mice.
2.3 Material and Methods
2.3.1 Study Organisms
All husbandry and experimental methods, as well as all personnel involved were
approved by the University of Southern California's Institute for Animal Care and Use
Committee, protocols #11394 and #11777.
Four strains of mice were used in this study: 1) wildtype males of the C57BL/6N
strain (6N wildtype), 2) Tgm4 knockout (6N knockout) mice acquired from the Knockout
Mouse Project (Austin et al., 2004, Testa et al., 2004), which are genetically identical to
6N wildtype except for a ~7kb “knockout first” cassette that spans exons 2-3 of Tgm4, 3)
a closely related strain, C57BL/10J (10J), acquired from Jackson Labs (Bar Harbor,
Maine), and 4) the highly fecund FVB/NJ (FVB).
We employed a serial mating design where one female mated in succession to two
males. The first male to mate was always either a 6N wildtype male, which can form a
copulatory plug, or a 6N knockout male, which cannot. Females were always FVB, and
second males to mate were always the common competitor genotype, 10J. The second
male (10J) was chosen because it is genetically similar to the first male (6N knockout or
6N wildtype), thus minimizing the Bruce effect, which occurs when females block
20
implantation upon exposure to genetically distinct males (Bruce, 1960). We were still
able to determine paternity since 10J is genetically distinguishable from 6N.
To breed experimental mice, sire and dam were paired for two weeks, then
separated so that the dam could give birth in isolation. Males and females were weaned at
21-28 days postpartum. Females were weaned with up to three individuals per cage and
were used in experiments at 6-8 weeks of age. Males were housed singly to avoid
dominance interactions (Snyder, 1967), and used in experiments at 60-90 days of age.
The colony was kept at 14:10 hours of dark:light and provided food ad libitum.
2.3.2 Experiment 1: Serial Mating
At 6-8 weeks of age, individual FVB virgin female mice were induced into estrus
using established protocols. Briefly, an intraperitoneal injection of 5 U Pregnant Male
Serum Gonadotropin (PMSG), followed approximately 48 hours later with an
intraperitoneal injection of 5 U Human Chorionic Gonadotropin (hCG), ensured
ovulation approximately 12 hours later (Nagy, 2003). Approximately 14 hours after the
hCG injection, each female was placed in a randomly assigned male cage with either a
6N knockout or 6N wildtype for four hours. After four hours, females were removed and
placed in a 10J male’s cage for another four hours. When 6N wildtype males were first to
mate, successful mating of the first male could be scored by visual inspection for a
copulatory plug. Successful mating of the second male could not be confirmed because
any plug deposited by the second male would be indistinguishable from the first. We
note, however, that this does not alter the interpretation of our experiment, as inhibiting
female remating could take the form of reduced mating attempts of the second male.
When 6N knockout males were first to mate, we could not confirm successful mating
21
visually since they do not form a copulatory plug. Therefore, for a subset of these crosses,
we observed the first mating for the entire four-hour period. Ejaculation was confirmed
from characteristic behaviors, including increasing intromissions which slow down closer
to ejaculation, and a final shudder of the male and phase of immobility during which the
pair often fall over onto their sides (McGill, 1962, McGill et al., 1978).
2.3.3 Experiment 2: Serial Mating, First Male Vasectomized
The above experiment provided direct quantification of the effectiveness of the
copulatory plug in inhibiting female remating. However, in the case of first male
paternity, it is not clear if the second male could have sired embryos. For example, if the
first male fertilized all oocytes by the time that the second male mated, then the second
male would never achieve paternity regardless of mating success. To investigate this
question, we repeated the above experiment with vasectomized 6N knockout and 6N
wildtype males. Vasectomized males do not transfer sperm but still transfer seminal fluid,
and vasectomized 6N wildtype males produce normal copulatory plugs.
Mice were vasectomized using the “scrotal entry” technique, initially
anesthetizing them with 4-5% mg/kg isoflurane followed by~1.5% for maintenance
during surgery (Nagy, 2003). Briefly, once the mouse was anesthetized, a small incision
was made in the scrotum, and approximately 3 mm of the vas deferens was removed.
Second male paternity was scored as the proportion of times that a female became
pregnant, and confirmed with genetic assays as described next.
2.3.4 Paternity Assignment
Females were euthanized at 12-14 days post-coitum (gestation in mice is
generally 21 days) and embryos dissected for genetic assignment of paternity. DNA was
22
extracted from a small piece of embryonic tissue, purified using a Master-Pure complete
DNA extraction kit (Epicentre, Madison, WI). We only performed paternity analysis on
fully formed embryos to avoid resorption sites. Each embryo had a known mother (FVB),
and was sired by either the first male (either 6N knockout or 6N wildtype) or the second
male (10J). Using published genomes of these three strains (Wong et al., 2012, Keane et
al., 2011, McClive et al., 1994), we designed genotype-specific PCR reactions to
distinguish between the 3 genotypes. A 6N-specific forward primer (5'-
CCACAGACATTGAGAGTGTCAGCA-3') amplified a 346 bp fragment, or a 10J-
specific forward primer (5'-AGACACCAGGAGAGCCAACAGTCCC-3') amplified a
230 bp fragment, when used with a common reverse primer (5'-
CAGCAGAATGTTCCCAGATACCCT-3'). The latter primer pair also amplified a
fragment from the maternal (FVB) DNA. Therefore, paternity was assigned to the 6N
male if two bands were observed (one band indicating 6N, the other indicating FVB)
while paternity was assigned to the 10J male if one band was observed (corresponding to
the 10J and FVB fragments of the same length). All three primers were added to each
PCR reaction.
Since the band produced by FVB and 10J genotype were indistinguishable, we
designed a 10J-specific forward primer (5'-GCTAGAGAGGCCCCATGGGAG -3') that
amplified a 116 bp fragment, and a FVB-specific forward primer (5'-
AAGGACAGGGAGAAGGGCCC -3') that amplified a 220 bp fragment, when used in
combination with a common reverse primer (5'-CCTGACTTTGCTCTGTCCTTC-3'). All
three primers were added to each PCR reaction. We tested a subset of reactions where we
23
observed a single band in the first PCR reaction, and always observed two bands in this
second PCR reaction as expected.
DNA was amplified with the same parameters for both sets: 11 cycles of
denaturation (94 C, 30 seconds), annealing (65 C, 30 seconds, lowered 1 C every cycle)
and extension (72 C and 60 seconds) followed by 19 cycles of denaturation (94 C, 30
seconds), annealing (52 C, 30 seconds) and extension (72 C and 60 seconds). All PCR
reactions used Fermentas 2X master mix. PCR products were scored on a 3% agarose gel.
2.3.5 Statistical Analysis
Across all experiments, 54 pregnancies were collected. Fifty-one of these were
sired entirely by one male. For the other three, we either 1) excluded them, 2) assigned
them to the male that sired more individual embryos in those pregnancies, or 3) assigned
them to the male that sired the minority of the embryos (which increased our chance of
losing statistical significance). Our conclusions remained the same regardless of which
strategy we employed; we present the third strategy since it is the most conservative. We
performed a Fisher’s Exact Test (FET) to determine if the number of pregnancies sired by
the second male depended on the first male’s ability to form a copulatory plug.
2.4 Results
Across both experiments, 96 successful crosses yielded 54 pregnancies.
2.4.1 Experiment 1
Twenty-six females successfully mated with 15 6N wildtype males and were
subsequently paired with a 10J male, resulting in 20 pregnancies (Table 2.1). Of these 20
pregnancies (average number of embryos= 12.55 +/-7.19), 19 were sired exclusively by
24
the 6N wildtype male. One pregnancy was multiply sired with nine embryos sired by the
6N wildtype male and one embryo sired by the 10J male. These 20 pregnancies were
sired by 13 different individual males.
1st Male to Mate Successful matings 1st Male Paternity 2nd Male Paternity
6N wild type 26 19 1
6N knockout 40 (18) 0 (0) 25 (13)
Table 2.1 Distribution of pregnancies sired by first or second males. Numbers in parentheses indicate confirmed
ejaculations (see text). Multiply sired pregnancies are assigned to the male that sired the minority of the
embryos.
Forty females were paired with 6N knockout males first then successfully mated
with a 10J male. Out of these 40 females, 25 resulted in pregnancies, 23 of which were
sired by the second male (average number of embryos=10.53 ±6.55). Two pregnancies
were multiply sired; one had 17 embryos sired by 6N and one sired by 10J, the other had
7 sired by 6N and 5 sired by 10J. There was no statistical difference in the number of
embryos per pregnancy between the two treatments (Wilcox test, p=0.42).
Second male paternity was significantly related to the ability of the first male to
form a copulatory plug (Table 2.1, FET=10
-12
). It has been reported previously that 6N
knockout male mating behavior do not differ from 6N wildtype, they have normal sperm
count and sperm motility, and they are able to fertilize oocytes (Dean, 2013).
Nevertheless, we repeated our analysis after only including crosses where ejaculation by
6N knockout males was visually confirmed, and statistical significance remained
(numbers in parentheses of Table 2.1, FET=10
-8
). In sum, first males achieved nearly
100% paternity if they could form a plug, but nearly 0% paternity if they were unable to
form a plug, even when ejaculation was visually confirmed in the latter case.
25
2.4.2 Experiment 2
Thirteen females successfully mated with a vasectomized 6N wildtype male, as
confirmed by the presence of a copulatory plug, and were subsequently placed with a 10J
male. None of these females were pregnant 14 days post-coitum. Seventeen females were
paired with vasectomized 6N knockout males then subsequently placed with a 10J male,
of which 9 resulted in a pregnancy (average number of embryos= 8.11±5.06), all of
which were sired by the second male (as expected since the first male was vasectomized).
The ability of a second male to impregnate a female was significantly correlated with the
first male’s ability to form a plug (FET=0.003).
2.5 Discussion
We employed a powerful knockout mouse model to directly and non-invasively
quantify the ability of a first male’s copulatory plug to inhibit reproductive success of a
second male. If the first male could form a plug, the second male sired almost no
embryos, even when the first male was vasectomized. This effect could arise through
physical prevention of mating (Parker, 1970, Devine, 1975, Voss, 1979, Shine et al.,
2000), or by discouraging second males from mating through visual or olfactory cues
(Ramm & Stockley, 2014). In mice, the first male to mate has an advantage (Levine,
1967), which may select for males to avoid mating in second position (Ramm &
Stockley, 2014). Along with indirect evidence that mating and ejaculation is energetically
costly for males (Pizzari et al., 2003, Lüpold et al., 2010, Friesen et al., 2015, Drickamer
et al., 2003, Gowaty et al., 2003, Drickamer et al., 2000), males may be selected to
conserve ejaculates when possible (Ramm & Stockley, 2007, Parker, 1998). In sum,
26
copulatory plugs inhibit remating, either by directly blocking access to the female’s
reproductive tract, or indirectly by discouraging second males from attempting to mate.
Dean (2013) showed that the same 6N knockout males used here suffer reduced
fertility in non-competitive matings, even though they show normal sperm count, sperm
motility, reproductive anatomy and seem to fertilize oocytes without difficulty. An
alternate mechanism of the role of the copulatory plug is to promote movement of sperm
through the female reproductive tract (Dean, 2013). Therefore our results could be
interpreted as the copulatory plug facilitating passage of the first male’s sperm rather than
blocking the second male’s sperm. This hypothesis cannot fully explain the data,
however, since vasectomized 6N wildtype males (no sperm ejaculated) still prevented
fertilization of the second male.
2.5.1 Evidence that plug-forming species still show multiple paternity
In apparent contrast to the very strong effects we observed in this study, 10-70%
of pregnant female house mice carry offspring sired by more than one male in natural
populations (Dean et al., 2006, Firman & Simmons, 2008). Many other plug-forming
species also show high rates of multiple paternity (Eberle & Kappeler, 2004, Schwartz et
al., 1989, Searle, 1990, Birdsall & Nash, 1973, Birkhead & Moller, 1998, Uhl et al.,
2010). Several hypotheses could reconcile the strong inhibitory effects of the plug,
observed here, with the common observation of multiple paternity in nature.
We did not vary several aspects of mating ecology that might influence paternity;
such as the number of males a female encountered during a single fertile period. The
opportunities for multiple mating may not be confined to two males presented in
succession, as occurred here, if the females actively pursue multiple mating in natural
27
populations. For example, multiple paternity is more common in relatively dense
populations (Dean, 2013), and we may not be capturing such important variation in our
serial mating design. Furthermore, we did not vary the time each male spent with the
female. Here, the first male was left with the female for 4 hours. The sooner a second
male is able to dislodge a first male’s plug, the more effective he is at gaining paternity
(Wallach & Hart, 1983) since position of the copulatory plug is critical in sperm
transportation (Toner et al., 1987, Matthews Jr & Adler, 1978). It is possible that our
four-hour time window biased paternity towards the first male, and this was amplified
when the first male could form a plug.
In the present study, ovulation and behavioral estrus were experimentally
controlled through hormonal manipulation, and copulation was likely to have occurred
very close to ovulation. In nature, the time between copulation and estrus is likely to be
more variable. For example, if first males mate “too early”, their plug might not survive
long enough to inhibit later, better-timed matings of second males (Firman & Simmons,
2009, Breedveld & Fitze, 2016, Coria-Avila et al., 2004). Copulatory plugs get smaller
and less adhered to the vaginal-cervical canal over time (Mangels et al., 2015),
suggesting that the efficacy of the plug decreases over time. Furthermore, not all matings
result in a well-formed and properly seated copulatory plug (Matthews Jr & Adler, 1978,
Masumoto, 1993, Hartung & Dewsbury, 1978). In fact, females may exert some control
in this context, by not allowing proper orientation of the copulating male (Matthews Jr &
Adler, 1978) or by removing plugs (Koprowski, 1992, Parga, 2003). In our study, such
females may have been excluded, because crossing to 6N wildtype males was deemed
28
successful only after observing a well-formed plug. By potentially excluding females that
had already removed plugs, we might be overestimating success of 6N wildtype males.
Subsequent males may also affect the efficiency of the plug by actively removing
the copulatory plug before copulation (Parga, 2003, Parga et al., 2006) or dislodging the
copulatory plug through multiple intromissions before ejaculation (Dewsbury, 1981,
Wallach & Hart, 1983). We observed trials in our experimental design where the second
male was able to remove the copulatory plug of the first male, which can be interpreted
as the second male attempting to gain fertilization. However, these trials did not result in
the second male gaining fertilization, suggesting the plug lasted long enough to inhibit
second male paternity.
Lastly, we did not vary male or female genotypes in the current study. It is
possible that the 6N wildtype males used here make especially strong plugs, that the 10J
males (always second to mate) were unable to remove previously deposited plugs, or that
the FVB females were unusually resistant to remating if a plug-forming male was first to
mate. Mangels et al. (2015) showed that different male genotypes vary in both the size
and survival of copulatory plugs they form.
2.6 Conclusions
The current study provides the first rigorous, non-invasive, quantification of the
role this structure has in inhibiting second males from achieving paternity. Although our
study confirms the importance of the copulatory plug in inhibiting second male paternity,
it does not reject its role in other aspects of fertility. For example, at least one socially
and genetically monogamous species, Peromyscus polionotus, still forms a copulatory
29
plug (Foltz, 1981, Baumgardner et al., 1982). Future studies should place lessons learned
here in the context of the many variables

30
3Chapter 3: Genetic and phenotypic influences on copulatory
plug survival
This chapter has been published as a research article in:
R. Mangels, B. Young, S. Keeble, R. Ardekani, C. Meslin, Z. Ferreira, N. Clark, J. Good
and M. Dean (2015). Genetic and phenotypic influences on copulatory plug survival in
mice. Heredity.115: 496-502.
3.1 Abstract
Across a diversity of animals, male seminal fluid coagulates upon ejaculation to
form a hardened structure known as a copulatory plug. Previous studies suggest that
copulatory plugs evolved as a mechanism for males to impede remating by females, but
detailed investigations into the time course over which plugs survive in the female’s
reproductive tract are lacking. Here, we cross males from 8 inbred strains to females from
2 inbred strains of house mice (Mus musculus domesticus). Plug survival was
significantly affected by male genotype. Against intuition, plug survival time was
negatively correlated with plug size: long-lasting plugs were small and relatively more
susceptible to proteolysis. Plug size was associated with divergence in major protein
composition of seminal vesicle fluid, suggesting that changes in gene expression may
play an important role in plug dynamics. In contrast, we found no correlation to genetic
variation in the protein-coding regions of five genes thought to be important in
copulatory plug formation (Tgm4, Svs1, Svs2, Svs4, and Svs5). Our study demonstrates a
complex relationship between copulatory plug characteristics and survival. We discuss
several models to explain unexpected variation in plug phenotypes.
31
3.2 Introduction
Sexual selection is thought to play a central role in driving the rapid evolution of
animal reproductive traits (Andersson, 1994, Eberhard, 2010). Diverse aspects of
ejaculate composition (volume, sperm count, abundance of accessory proteins) and
biochemical function (coagulation, induction of female immune response) can evolve
rapidly, especially in species where females mate with multiple males (Cameron et al.,
2007, Pilch & Mann, 2006, Robertson, 2007, Poiani, 2006). These patterns suggest that
characteristics of the ejaculate mediate outcomes of female choice, sperm competition
among males, and/or antagonistic conflict between males and females (Arnqvist & Rowe,
2013, Birkhead & Pizzari, 2002, Chapman, 2001).
In many mammals, a large portion of the male’s seminal fluid coagulates to form
a hardened plug that fills the vaginal-cervical region (Devine, 1975, Martan & Shepherd,
1976, Voss, 1979, Williams-Ashman, 1984, Dixson & Anderson, 2002). A large body of
data suggests that plugs evolved to impede remating by females (Hartung & Dewsbury,
1978, Mosig & Dewsbury, 1970, Voss, 1979, Martan & Shepherd, 1976) although
additional plug functions may include ejaculate transport through the female’s
reproductive tract (Blandau, 1945b, Rogers et al., 2009, Toner et al., 1987, Carballada &
Esponda, 1992, Blandau, 1945a, Matthews Jr & Adler, 1978), stimulation required for
proper implantation and pregnancy (Ball, 1934, Dean, 2013), and slow release of sperm
(Asdell, 1946).
As remating likely benefits females (Fedorka & Mousseau, 2002, Jennions &
Petrie, 2000, Slatyer et al., 2012, Zeh & Zeh, 2001), but see (Bilde et al., 2009), the
copulatory plug may exist as a source of sexual conflict. Consistent with a hypothesis of
32
sexual conflict (Stockley, 1997), recently-mated females up-regulate proteases thought to
assist in plug degradation (Dean et al., 2011, Kelleher & Pennington, 2009), while male
seminal fluid is enriched for protease inhibitors (Dean et al., 2009), although proteases
and their inhibitors have additional roles in reproduction (Wolfner, 2002, Kawano et al.,
2010). Also plug-forming proteins, proteases, and protease inhibitors all tend to evolve
rapidly (Kelleher et al., 2007, Wong et al., 2008, Clark & Swanson, 2005, Lawniczak &
Begun, 2007, Ramm et al., 2008, Dean et al., 2009, Dean et al., 2011, Dorus et al., 2004)
as predicted for genes involved in sexual conflict (Clark et al., 2006, Swanson &
Vacquier, 2002). In primates, the evolutionary rate of a key copulatory plug gene,
SEMG2, is positively correlated with the inferred intensity of sexual selection (Dorus et
al., 2004, Ramm et al., 2009).
In both rodents (Ramm et al., 2005) and primates (Dixson, 1998b), males from
species inferred to experience relatively intense sperm competition develop relatively
large seminal vesicles compared to their body mass, which has been associated with large
copulatory plugs (Ramm et al., 2005). Plugs are more prominent, and molecular studies
suggest are more durable, in species that experience relatively intense sperm competition
(Dixson & Anderson, 2002, Ramm et al., 2009). Males with relatively larger seminal
vesicles were more successful under sperm competition (Stockley et al., 2013 ). In
contrast, some primarily monogamous species have lost the ability to make plugs
(Dixson, 1998a, Jensen-Seaman & Li, 2003, Carnahan & Jensen-Seaman, 2008, Kingan
et al., 2003). Traditionally, these data have suggested that under intense sperm
competition, males are selected to make larger, more durable plugs, but such hypotheses
33
remain speculative because we do not know the genetic basis or functional consequences
of standing variation in plug phenotypes.
House mice provide a powerful system to investigate the formation, function, and
evolutionary dynamics of copulatory plugs. Female house mice regularly mate with
multiple males while in estrus, creating ample opportunity for sperm competition and
sexual conflict in nature (Dean et al., 2006, Firman & Simmons, 2008). Anecdotal
accounts suggest that copulatory plugs last around 24 hours after mating (Silver, 1995,
Stockard & Papanicolaou, 1919, Parkes, 1926), but it remains unknown if and how this
time scale varies. Here we use crosses between 8 inbred strains of mice to better
understand the genetic contributions to and phenotypic correlates of copulatory plug
survival in mice. These experiments represent the first systematic examination of
copulatory plug dynamics in mice.
3.3 Materials and Methods
3.3.1 Study Organisms
All husbandry and experimental methods, as well as all personnel involved were
approved by the University of Southern California's Institute for Animal Care and Use
Committee, protocols #11394 and #11777. Males were derived from eight genetically
distinct strains of mice. Six of these - BIK, DCA, DGA, DIK, DJO, and DOT – were
originally founded from natural populations – Kefar Galim Israel, Akrotiri Cyprus,
Ajdarie Georgia, Keshet Israel, Orcetto Italy, and Tahiti, respectively – and maintained
under brother-sister mating for more than 20 generations by F. Bonhomme and
colleagues (U. of Montpellier). The probability of an initially heterozygous site
remaining heterozygous after 20 generations of inbreeding is less than 10
-6
, so individuals
34
from within a strain are considered genetically identical. Since any two of these
collection localities are more than 100 km away from each other, the strains are unrelated
and can be viewed as independent snapshots of genetic diversity from those particular
places and times. We also included two classical inbred strains, FVB/NJ (hereafter FVB)
and C57BL/6N (hereafter C57) available from Jackson Labs (Bar Harbor, Maine). Males
from all eight strains were crossed to female FVB and C57. The latter two strains were
chosen as females because they respond well to hormonal induction of estrus (Byers et
al., 2006). Furthermore, they carry divergent serotypes at the major histocompatibility
complex locus, which has been shown to affect female choice dynamics (Leinders-Zufall
et al., 2004, Roberts & Gosling, 2003, Potts et al., 1991) probably through chemical
signals in the urine (Yamaguchi et al., 1981). Specifically, FVB carries the q serotype and
C57 carries the b serotype. Though females were not given a choice between males in our
crosses, cryptic female choice acting after copulation could in principle affect copulatory
plug characteristics, for example through adjustment of proteolytic responses.
To breed experimental mice, sire and dam were paired for 1-2 weeks, then
separated so that the dam could give birth in isolation. Males and females were weaned at
3-4 weeks postpartum. Females were weaned with up to three individuals per cage and
were used in experiments at 4-6 weeks of age. Males were weaned with one individual
per cage to avoid dominance interactions and reduced fertility (Snyder, 1967), and were
used in experiments at 8-12 weeks of age. The colony was kept at 14:10 hours of
dark:light and provided food ad libitum.
35
3.3.2 Experimental Matings and Plug Survival
At 4-6 weeks of age, virgin female mice (FVB or C57) were induced into estrus
using established protocols (Nagy, 2003). Briefly, an intraperitoneal injection of 5 U
Pregnant Mare’s Serum Gonadotropin, followed approximately 48 hours later with an
intraperitoneal injection of 5 U Human Chorionic Gonadotropin (hCG), ensured
ovulation approximately 12 hours later. Approximately 14 hours after the hCG injection,
each female was placed into the cage of a randomly assigned experimental male for 4
hours. Mating was confirmed by the presence of a copulatory plug in the vaginal-cervical
region, observed visually or after very slight probing. Once mating was confirmed,
females were randomly assigned to an early (24 hours) or late (48 hours) time point and
housed alone. After the assigned time period, females were euthanized via carbon dioxide
overexposure and copulatory plugs dissected and weighed. Experimental males mated no
more than once per week to allow rejuvenation of seminal fluid and sperm stores. We
scored 418 successful matings across the entire experiment, roughly 40 crosses per male
genotype (10 crosses per male genotype per time point [24h vs. 48h] per female genotype
[FVB vs. C57]), plus additional follow-up experiments.
Some studies regressed plug mass onto female body mass to control for
differently sized female reproductive tracts (Ramm et al., 2005). However, plug mass was
not significantly correlated to female body mass in our study, so we instead analyzed
absolute plug mass. Conclusions remain unaltered if we instead analyze residual plug
mass, but we present analyses based on absolute plug mass for simplicity. The proportion
of successful matings which still had a plug was analyzed with a binomial model with
logit link, using the Generalized Linear Model implemented in the GLM function in R
36
(Dalgaard, 2008). Factors included time (24h vs. 48h), male genotype (8 genotypes),
female genotype (2 genotypes), and the male*female interaction term.
We compared plug mass from the 24 hour time point using several linear mixed
models implemented in the LMER function of the R package LME4, followed by likelihood
ratio tests. The most complex model included male and female genotypes and their
interaction as fixed effects, and individual male as a random effect.
3.3.3 Male Morphology
To test whether plug survival correlated with morphological features, we raised
approximately five 8 week old virgin males from each strain, then took full body
measurements including the mass of the testes and one lobe of the paired seminal vesicles
(excluding the anterior lobe of the prostate, also known as the coagulating gland)
(Appendix A). In a linear model that incorporated male genotype, both seminal vesicle
mass and testes mass correlated to male body mass (F
1,31
=78.37, F
1,31
=221.94, p<10
-9
,
p<10
-15
, respectively). To control for differences in male body size, seminal vesicle and
testes mass were separately regressed onto male body mass using the LM function in R,
with genotypes weighted by the inverse of their sample size. Residual seminal vesicle and
testes mass were employed in downstream analyses. Although these males were not the
same individuals as used in the experimental matings, they were genetically identical
since they derived from the same respective strains.
3.3.4 Proteomic Analyses
The relative abundance of copulatory plug proteins might play an important role
in the length of time the plug lasts. From the same males used for anatomical
measurements, we dissected the other lobe of the paired seminal vesicles (excluding the
37
anterior lobe of the prostate) into 100 µl 8 M guanidine and carefully pushed out the
luminal fluids to minimize any cellular damage. Proteins were then quantified using
a Qubit 3.0 Fluorometer (Life Technologies, Carlsbad, CA, USA). 5 µg was mixed with
sample buffer (Urea 8M, Tris-HCl pH6.8 200mM, EDTA pH8.0 0.1mM, DTT 100mM,
Tris Base 100mM), heated at 37°C for 15min and then run in 12% polyacrylamide gel
containing 3.5mM SDS at 110V for 90min in SDS-Tris-Glycin buffer pH8.8 and stained
with Coomassie blue. Increasing amounts of BSA were run the same way to produce a
standard curve for quantification. Gels were scanned and protein bands were quantified
with IMAGEJ (Schneider et al., 2012) by two different observers (CM and ZF); the
average of these two measurements was taken. To adjust for slight differences in absolute
protein amount, we calculated the proportion of protein bands rather than their absolute
amount. Using the PRCOMP function in R, with the scale option set to True, Principal
Component Analysis was employed to remove the correlation of abundances among
protein bands.
3.3.5 Thrombin Assays
In mice, serine endopeptidases are upregulated by females in response to mating,
and serine endopeptidase inhibitors are enriched in male seminal fluid (Dean et al., 2009,
Dean et al., 2011). Thrombin is a serine endopeptidase that mimics such proteolytic
activity. We modified a previously published thrombin fluorescence assay to quantify the
amount of serine endopeptidase activity in copulatory plugs (Murer et al., 2001, Hengst et
al., 2001)(Appendix B). Individual copulatory plugs were homogenized into a fine
powder using a mortar and pestle with liquid nitrogen.
38

Figure 3.1 Thrombin-induced fluorescence (y axis) measured every minute for 150 minutes (x axis) for two
representative samples: DGA_4315, plug 1_1 from plate RP1 (red) and DJO_2668, plug 1_4 from plate RP1
(blue). The duplicated standards are shown in green. Our method is specifically designed to ignore the
asymptotic parts of the fluorescence and only estimate the slope for the respective lines indicated. Thrombin
activity (i.e., the y-axis of Fig. 3.6) is measured as the estimated slope for a plug minus the average of the two
slopes estimated from the standard curves of that particular plate. As shown, the red slope is steeper than the
standards, suggesting that DGA plugs have endogenous protease activity.
Plug homogenate was collected into a pre-weighed 1.7 ml Eppendorf tube
(Hauppauge, NY, USA), then 0.01 g plug powder added to 400 µl thrombin assay buffer
(50 mM Trizma Base, 130 mM Sodium Chloride, pH 8.3), combined and vortexed for 1
minute. Homogenates were then incubated at room temperature for 30 minutes, with
tubes inverted 10 times at 10-minute intervals. After incubation, samples were
centrifuged at 29,700 g for 3 minutes and supernatant collected.
39
We added 15 µl human α-thrombin (0.431 µg/ml;Sigma-Aldrich, St. Louis,
MO,USA) to 80 µl of each plug homogenate and incubated for 30 minutes at 37°C. After
incubation, 5 µl of chromogenic substrate for thrombin, S-2238 (Chromogenix, Bedford,
MA, 1.25 mg/ml) was added. Amidolytic activity was quantified by recording
fluorescence at 405 nm at 37°C every minute over 2.5 hours with a BioTek ELx808 plate
reader (BioTek, Winooski, VT). Higher fluorescence indicates higher hydrolysis of the
chromogenic substrate, which in turn indicates higher activity of serine endopeptidases
and/or reduced serine endopeptidase inhibition. Each plate assay was accompanied by
two replicate standards, where 80 µl of thrombin assay buffer (no plug homogenate) was
added. Fluorescence plotted against time (1-150 minutes) asymptotes at varying rates
(Figure 3.1). Using customized R scripts, we estimated the slope of the line prior to the
asymptote and then subtracted the average slope of the two standard curves from each
plug’s estimated slope. These methods are presented visually in Figure 3.1.
3.3.6 Exome Sequencing
For the six wild-derived strains, we characterized DNA sequence variation at five
genes thought to be important in copulatory plug formation – Tgm4, Svs1, Svs2, Svs4, and
Svs5 – using an exome enrichment and resequencing strategy. The full exomes will be
published as part of a larger study elsewhere, but we focus here on these five genes since
they are either necessary for copulatory plug formation or present in seminal vesicles and
plugs at high abundance (Kawano et al., 2014, Dean, 2013, Lundwall et al., 1997, Dean
et al., 2011, Dean et al., 2009). DNA was sheared using a Bioruptor UCD-200
(Diagenode, Denville, NJ, USA) with 7 rounds of sonication (7 minutes per round on
high, 30s on 30s off) and genomic DNA libraries were constructed using a previously
40
described protocol designed to facilitate multiplexed exome capture (Rohland & Reich,
2012). To reduce molecular interference during enrichment, we used truncated adaptors
containing unique P5 “internal” barcodes (Rohland & Reich, 2012). PCR primers were
designed according to Rohland and Reich (2012).
In-solution sequence capture was performed using Nimblegen SeqCap EZ Mouse
Exome probes (Roche NimbleGen, Madison, WI, USA) as described in Nimblegen’s
SeqCap EZ Lbrary User’s Guide. Libraries were pooled equally to obtain 1 µg total DNA
for each hybridization experiment. Libraries were then enriched using two separate
capture reactions with eight libraries each, including blocking oligonucleotides specific to
our custom adapters (Rohland & Reich, 2012) and mouse COT-1 DNA (Invitrogen,
Carlsbad, CA,USA) to reduce non-specific hybridization. The capture reactions
hybridized for 68 hours at 47˚C in an Eppendorf Mastercycler Pro (Eppendorf) then
washed, eluted, and PCR-enriched. Capture enrichment success was verified using qPCR
analysis of three targeted regions on pre- and post-capture library pools. Sequencing was
performed using the Illumina Hi-seq 2000 platform (San Diego, CA, USA) at the
Epigenome Center at the University of Southern California.
Sequences were mapped to the mm10 reference genome with BWA (Li & Durbin,
2009), allowing for 7 mismatches. Samtools (Li et al., 2009) was used to remove PCR
duplicates and filter reads mapping with a quality score of at least 20, then varscan
(Koboldt et al., 2009) was used to call variants from the pileup files. To exclude
sequencing error, bases different from reference were only accepted if they had a depth of
at least two reads, each with a Phred score of at least 20. We did not observe any
heterozygous sites, as expected given we were using inbred strains. Gene and transcript
41
annotations were downloaded from Ensembl version 78 (www.ensembl.org). Sequences
from FVB (Wong et al., 2012) and C57 (Keane et al., 2011) were downloaded and added
to our dataset. We applied Mantel’s tests to assess whether pairwise DNA distance
matrices were correlated to pairwise phenotype distance matrices, using the MANTEL.TEST
function in the APE package in R (Paradis et al., 2004).
3.4 Results
3.4.1 Plug Survival
Across the whole dataset, 48.8% (102/209) of copulatory plugs were present after
24 hours of incubation in the female, and 15.4% (29/188) after 48 hours. Time and male
genotype had significant effects on plug survival (χ
2
=62.8, 45.7, df=1, 7, p=10
-7
, 10
-14
,
respectively), but neither female genotype nor the male x female interaction term did
(χ
2
=0.09, 8.81, df=1, 7, p=0.76, 0.27, respectively; Table 3.1).
Model Df Deviance (χ2) Residual Df Residual Deviance p-value
Null

31 131.49

Male Genotype 7 45.74 24 85.75 9.83E-08
Female Genotype 1 0.09 23 85.66 0.76
Time 1 62.82 22 22.84 2.23E-15
Male*Female 7 8.81 15 14.03 0.27
Table 3.1 Generalized linear models testing factors of plug survival
A Hosmer-Lemeshow Test (Hosmer & Lemeshow, 2000) showed that a binomial
model including only male and time as factors fit the data well, with no significant over-
dispersion (χ
2
=20.07, df=14, p=0.13). To further test for a male*female interaction term,
we repeated the analyses using only FVB and C57 males and females. We did not detect
an interaction term in this subset of data.
42

Figure 3.2 Plug mass by male genotype. Sample sizes shown above boxplots
Plug mass after 24 hours of incubation differed between male and female
genotypes. Male genotype had a significant effect on plug mass (LRT, χ
2
=33.2, df=7,
p=10
-4
) (Figure 3.2). Including female in addition to male genotype fit the data
significantly better than male genotype alone (LRT, χ
2
=6.56, df=1, p=0.01), but
including a male*female interaction term did not (LRT, χ
2
=8.28, df=7, p=0.31).

43

Figure 3.3 The proportion of plugs present at 24 hours post-mating was negatively correlated with plug mass.
Mouse genotype (text) and the number of plugs present (numerator) out of the total number of successful
matings (denominator) indicated. The exact location of each strain on the plot is the center of all text.
The proportion of plugs present at 24 hours was negatively correlated with plug
size (Figure 3.3, F
1,6
=5.78, p=0.05). In other words, male genotypes that made smaller
plugs also produced plugs that tended to last longer. To further clarify this result, we
repeated this portion of the experiment with two extreme genotypes: DGA (N=13
crosses), a genotype that makes relatively long-lasting and small plugs, and DJO (N=8
crosses), a genotype that makes relatively short-lasting and large plugs. For this
experiment we dissected plugs immediately following mating rather than 24 or 48 hours
later thus minimizing the potential influence of female degradation on plug size. As
above, DGA males made significantly smaller plugs than DJO males (Figure 3.4,
Welch’s t-test=2.74, df=16.95, p=0.01, accounting for unequal variance since an F-test
for equal variances [F=0.12, df=7, p=0.01] was rejected). Plug survival could be
44
influenced by plug density, for example small plugs may be denser and more difficult for
females to degrade. We lack the data to evaluate this hypothesis.

Figure 3.4 In a focused experiment of two extreme genotypes, DGA and DJO, plug size differed significantly
when plugs were collected immediately following mating (0 hours).
3.4.2 Male Morphology
Although male genotypes differ in the size of their seminal vesicles, they did not
vary in a way related to plug survival. Residual seminal vesicle mass differed
significantly among male genotypes (F
7,32
=3.76, p=0.004), but residual seminal vesicle
mass did not covary with the proportion of plugs present at 24 hours (F
1,6
=0.049,
45
p=0.83). Similarly, although residual testes mass differed significantly among male
genotypes (F
7,32
=39.78, p <10
-14
), it did not co-vary with the proportion of plugs present
at 24 hours (F1,6=0.125, p=0.735). Plug mass did not correlate with residual seminal
vesicle mass or residual testes mass (F
1,6
=0.43, 0.08, p=0.54, 0.79, respectively)
(Appendix A).

Figure 3.5 A) An example of a coomassie-stained polyacrylamide gel. Strain names (i.e., DIK, DCA, DOT) plus
individual identification number are shown as lane headers. There are four abundant proteins (numbered 1-4),
which based on previous studies (Lin et al., 2002, Dean et al., 2011, Lundwall et al., 1997, Tseng et al., 2011) and
the match to molecular mass according to Ensembl version 78 (www.ensembl.org), are likely SVS1 (93.5 kDa),
SVS2 (40.8 kDa), SVS5 (13.0 kDa), and SVS4 (12.5 kDa). B) Protein Standard
46
3.4.3 Proteomic Analyses
The major protein composition of plugs was correlated to plug mass. Coomassie-
stained polyacrylamide gels of seminal vesicle fluids revealed four very abundant
proteins (Figure 3.5, Appendix A). We did not attempt to identify these four bands using
mass spectrometry, but based on previous studies (Lin et al., 2002, Dean et al., 2011,
Lundwall et al., 1997, Tseng et al., 2011) and the match to known molecular mass, these
four bands most likely consisted of the seminal vesicle-secreted proteins Svs1, Svs2,
Svs4, and Svs5 (Figure 3.5). The exact identity of the proteins is not critical since we are
only using them as a biomarker of plug composition.
PC1 (0.84) PC2 (0.13)
SVS1-like -0.801 0.329
SVS2-like -0.037 -0.827
SVS4-like 0.362 0.045
SVS5-like 0.476 0.454
Table 3.2 Principal Components of proportions of the four main protein bands
The proportions of these four protein bands (abundance of each protein band
divided by the sum of the abundances of the four main protein bands) were reduced to
two principal components that explained 84% and 13% of the variance, respectively
(Table 3.2). The loadings of the Svs1-like, Svs4-like, and Svs5-like proteins (-0.801,
0.362, and 0.476, respectively) indicated these three protein bands contributed highly to
PC1, with the proportion of Svs1-like negatively correlated with the proportion of Svs4-
like and Svs5-like. PC2 primarily consisted of remaining variation in Svs1-like, Svs2-
like, and Svs5-like proteins (loadings=0.329, -0.827, and 0.454, respectively). Plug mass
was negatively correlated to PC1 (F
1,6
=10.3, p=0.02), but not PC2 (F
1,6
=1.87, p=0.22).
Plug survival was not correlated with either PC1 or PC2 (F
1,6
=4.25, 1.55; p=0.09, 0.26,
47
respectively). Variation in Svs2 did not seem to explain variation in plug mass, which is
surprising given its importance in plug formation (Kawano et al., 2014).
Factor Df SumSq F-value P-value
Male Genotype 7 3.89E-04 4.06 0.001
Female Genotype 1 7.00E-08 0.005 0.94
Male*Female 6 7.80E-05 0.95 0.47
Residuals 53 7.26E-04
Table 3.3 Linear model of the factors of proteolytic activity
3.4.4 Thrombin Assays
Small plugs showed more protease activity. There was a significant effect of male
genotype on protease activity (F
7,53
=4.06, p=0.001) but neither female genotype
(F
1,53
=0.005, p=0.94) nor the male x female interaction term (F
6,53
=0.95, p=0.47) had an
effect (Table 3.3). Protease activity was significantly negatively correlated with plug size
(Figure 3.6, F
1,6
=29.26, p=0.002). Since plug size was negatively correlated to plug
survival (Figure 3.3), we predicted that protease activity correlated to plug survival,
however this was not the case (F
1,6
=3.37, p=0.11).
Across 19 technical replicates (9 replicated standard curves, 10 replicated plugs),
the median coefficient of variation of the estimated slopes of fluorescence (unbiased
standard deviation divided by the mean) was 0.058, indicating a high level of
repeatability.
3.4.5 Exome Variation
There was no variation at five copulatory plug genes that related to plug survival.
The proportion of bases in the coding part of the transcript that were covered by at least
at least two (one) reads averaged 0.80 (0.91), 0.73 (0.88), 0.76 (0.81), 0.33 (0.53), and
0.76 (0.84) for Tgm4, Svs1, Svs2, Svs4 and Svs5, respectively.
48

Figure 3.6 Protease activity was significantly negatively correlated with plug size. Mouse genotype indicated by
text; the exact location of each strain on the plot is the center of all text.
The number of nonsynonymous (synonymous) variants observed in 7 of our 8
genotypes was 0 (2), 4 (8), 1 (2), 1 (0), 0 (3) for the five genes, respectively. Due to
technical difficulties, we were unable to generate sequence from DJO. Plugs form when
Tgm4 crosslinks glutamine and lysine residues in Svs2 (Williams-Ashman, 1984). The
single nonsynonymous site in Svs2 led to a tyrosine/phenylalanine polymorphism,
suggesting it did not contribute to variation in plug survival. There was no association
between pairwise genetic distance and pairwise phenotypic difference in plug size or
survival (all Mantel’s tests, p>0.05).
49
Two proteases, Ltf and Klk14, were previously shown to be produced by females
in response to mating (Dean et al., 2011) and could be important in plug degradation. The
two female strains used here, FVB and C57, are identical at both genes
(http://www.informatics.jax.org). Therefore, genetic variation at plug genes or genes that
potentially degrade plugs cannot explain variation in plug survival.
3.5 Discussion
Copulatory plugs are a prominent feature in many internally fertilizing organisms,
including nematodes (Barker, 1994, Palopoli et al., 2008), insects (Rogers et al., 2009),
reptiles (Devine, 1977, Devine, 1975, Moreira & Birkhead, 2004), rodents (Dewsbury,
1984, Voss, 1979), and primates (Hartung & Dewsbury, 1978, Dixson & Anderson,
2002). Comparative studies suggest plugs evolved in the context of sperm competition, as
a means for males to inhibit remating by females. The goal of the present study was to
better understand survival dynamics of copulatory plugs. Our primary finding was that
variation at several copulatory plug phenotypes (size, major protein composition,
protease activity, and survival) co-varied with male genotype, revealing standing genetic
variation for diverse male traits that are likely to play important roles in mouse
reproductive ecology.
3.5.1 Plug Survival
If large plugs are indeed adaptive responses to sperm competition (see
Introduction), then we might expect that larger plugs survive longer in the female’s
reproductive tract. In contrast to this prediction, our study revealed that male genotypes
that make long-lasting plugs tended to make smaller plugs. Furthermore, these small but
50
long-lasting plugs were less able to inhibit thrombin proteolysis. In other words, smaller
plugs that seemed more susceptible to proteolytic degradation actually survived longer in
the female’s reproductive tract. There are at least two hypotheses to explain why small
plugs survived longer in the female’s reproductive tract.
First, it is possible that smaller plugs trigger a less intense female proteolytic
response. To address this possibility, we analyzed an additional thrombin assay where no
thrombin was added prior to fluorescence detection (instead of 15 µl). Any fluorescence
in this “no thrombin” assay must arise from endogenous thrombin-like proteases already
present in the plug extract, which could be either male- or female-derived. If smaller
plugs triggered a less intense female response, we would predict smaller plugs have less
fluorescence in these “no thrombin” assays. However this was not the case, small plugs
actually had more protease activity immediately after copulation than large plugs (Figure
3.7), just as they did after 24 hours of incubation (Figure 3.6). Thus, small plugs do not
induce a less intense proteolytic response from the female.
Second, small plugs may last longer in the female because they are more difficult
to remove. In some rodents, females bite the plug and actively remove it (Koprowski,
1992). In house mice, the plug tightly adheres to the female’s epithelium in the vaginal-
cervical region. Over time, the epithelium begins to slough off and the fact that plugs can
often be found in the bottom of cages suggests that it is not fully degraded in situ but
perhaps degraded to a point where it can be expelled (RM, MDD, pers. obs.) and
sometimes eaten (Dewsbury, 1984). It is possible that small plugs are more difficult for
females to remove through contractions of her reproductive tract, if they provide less
traction for female contractions.
51

Figure 3.7 “No thrombin” controls. Any fluorescence above zero indicates endogenous protease activity, which
could be either male-derived or female-derived. DGA plugs, which were smaller than DJO plugs, did not elicit
less fluorescence, arguing against the hypothesis that small plugs induce a less severe female proteolytic response
3.5.2 Why would males make large plugs?
Male mate choice (Dewsbury, 1982, Drickamer et al., 2003, Ramm & Stockley,
2014, Edward & Chapman, 2011) and the dynamic adjustment of ejaculate allocation
(Wedell et al., 2002, Delbarco-Trillo & Ferkin, 2004) suggest that ejaculates are costly to
produce and conserved when possible. Plug-forming proteins account for nearly one third
of the total protein abundance of the ejaculate, suggesting that this structure is a major
reproductive investment for males (Lin et al., 2002, Dean et al., 2011, Lundwall et al.,
52
1997). Since large plugs also seem to survive shorter periods of time, and ejaculates are
likely to be costly, our study begs the question of why males would ever invest in large
plugs. Answering this question requires further experimentation since our study did not
specifically link copulatory plug characteristics to fitness traits like number of offspring
sired, but potential explanations include trade offs between plug size and other aspects of
reproductive fitness. For example, small plugs may be more difficult for females to
remove, as suggested here, but easier for competitor males to remove. Spines on the penis
as well as repeated intromissions without ejaculation may be male adaptations to remove
other males’ plugs (Dewsbury, 1984, O'Hanlon & Sachs, 1986, Wallach & Hart, 1983).
The intensity of sperm competition varies across populations of house mice (Firman &
Simmons, 2008), and probably across time as a function of fluctuations in density (Dean
et al., 2006), which could potentially sway the balance of selection towards plugs with
different benefits. Spatial or temporal variation in the intensity or form of sperm
competition could lead to standing variation (Felsenstein, 1976, Bell, 2010, Siepielski et
al., 2009).
Sexual conflict could also preserve genetic variation in copulatory plug
characteristics. For example, different alleles of copulatory plug genes could be better at
avoiding degradation in some but not all females in the population. Statistically, this type
of dynamic predicts a male x female interaction term. Although we did not detect such an
interaction term in any of our assays, the female genotypes used here did not differ at two
candidate protease genes (Results), and our study was probably underpowered to detect
it.
53
3.6 Conclusions
The genetic basis of male reproductive phenotypes that are targets of sexual
selection remain poorly characterized. We found that male genotype explained a
significant amount of variation in plug size and plug survival, demonstrating there is
standing genetic variation in this ecologically important trait. Interestingly, small plugs
tended to last longer in the female reproductive tract, opposite to the predictions derived
from previous comparative studies. Our study reveals that the dynamics of copulatory
plugs are more complex than previously appreciated, and suggests that there could be
tradeoffs between plug size and specific aspects of house mouse reproductive ecology.

54
4Chapter 4: Male and female control over copulatory plug
survival
4.1 Abstract
The copulatory plug is hypothesized to be a source of sexual conflict between
males and females since it may prevent the female from remating. Since polyandry
increases the fitness of the female, the copulatory plug is not beneficial for females as
they will not be able to exercise postcopulatory choice. Consistent with the hypothesis,
females produce proteases and begin sloughing off their epithelium shortly after mating,
which may lead to loosening of the plug and allow for its expulsion. In contrast, male
seminal fluid is enriched for protease inhibitors, potentially revealing a molecular basis of
sexual conflict over the fate of the copulatory plug. However, while the male-derived
plug is expected to harm females that have mated to unpreferred males, it may actually
benefit females that have mated to preferred males. In the first case, females should be
selected to clear the plug in preparation for remating, while in the second females may
actually benefit from preserving the plug. Here I investigate if protease activity varies
with mate preference. While our previous study did not detect an interaction term, this
study utilizes a more powerful design by focused sampling of two serologically divergent
genotypes, and by exposing females to males’ odors prior to mating so that potential
mates can be assessed.
4.2 Introduction
The evolution of extravagant secondary sexual characteristics such as a peacock’s
plumage cannot be explained by natural selection since the characteristic may confer a
55
fitness disadvantage. However, sexual selection via mate choice explains these traits if
they enhance the individual’s success in reproduction by increasing attractiveness to the
opposite sex (Darwin, 1871, Fisher, 1915, Bateman, 1948, Robert, 1972, Andersson,
1994). Since Darwin first proposed the theory of intersexual selection, or mate choice,
there has been growing evidence that exercising choice does not just select for secondary
sexual traits but these traits signal direct material fitness benefits or indirect genetic
fitness benefits (Andersson, 1994, Birkhead & Moller, 1998, Møller & Jennions, 2001,
Kokko et al., 2003).
Mate choice can be exercised by either sex, however, since females invest more in
their gametes and provide a greater parental investment than males, they are generally the
choosier sex (Bateman, 1948, Robert, 1972, Burley, 1977). Female choice is not only
restricted to precopulatory mechanisms where a female selects a mate (or resists an
unpreferred mate) but also continues during and after copulation (Kokko et al., 2003,
Birkhead & Møller, 1993, Eberhard, 1996). Females may base their choice on direct
material benefits such as the quality of the male’s territory (Møller & Jennions, 2001,
Hoelzer, 1989, Kokko et al., 2003, Kirkpatrick, 1996). Additionally, females may prefer
high quality males in order to obtain good genes for their offspring (Eberhard, 1996,
Jennions & Petrie, 2000). A female’s choice for high quality males allows females to
accrue viability benefits for their offspring (Drickamer et al., 2000) including higher
growth rates and reproductive output (Reynolds & Gross, 1992). Alternatively, there is
increasing evidence of females using genetic compatibility or the interaction between the
male and female’s genotype as criteria for mate choice (Tregenza & Wedell, 2000, Mays
& Hill, 2004, Brown, 1997).
56
One mechanism by which females may choose their mates is via assessment of
male quality or compatibility at the major histocompatibility complex (MHC) (Potts et
al., 1991, Yamazaki et al., 1976). Females may bias fertilization towards MHC-dissimilar
males to increase heterozygosity of offspring or to prevent inbreeding. Specifically,
mating with a dissimilar individual leads to offspring with a varied set of MHC alleles,
hypothesized to lead to more effective pathogen resistance in offspring (Hedrick &
Poulin, 2002). A preference for dissimilar MHC can act as a mechanism for inbreeding
avoidance, which will maintain genome diversity and prevent expression of deleterious
alleles (Potts et al., 1991, Manning et al., 1992, Potts & Wakeland, 1993). MHC-based
mate choice has direct fitness effects since fertilization success can be dependent on the
combination of MHC alleles (Rülicke et al., 1998). A majority of studies in inbred mice
demonstrate a pattern of MHC-dissimilar mating (Beauchamp et al., 1988, Yamazaki et
al., 1988, Potts et al., 1991, Yamazaki et al., 1978). These studies suggest that we can use
MHC-dissimilarity as a proxy for mate preference.
As discussed in Chapter 1, females use multiple mating to exercise choice by
utilizing post copulatory mechanisms to manipulate offspring paternity, resulting in
potential fitness benefits. In contrast, males’ reproductive success is primarily determined
by the number of females he can monopolize, which leads to several adaptations to
prevent or delay future mating of females (Parker & Pizzari, 2010). As presented in
Chapter 1, multiple lines of evidence suggest that the copulatory plug evolved as a means
for males to inhibit female remating (Dixson & Anderson, 2002, Devine, 1975, Voss,
1979, Parker, 1970, Simmons, 2001). Therefore, the copulatory plug can be a source of
conflict due to the differing reproductive strategies of males and females. The fate of the
57
male-derived copulatory plug is a model of this conflict as discussed in section 1.4.
Females will be selected to evolve counter adaptions against the male derived copulatory
plug. Specifically, in mice, females up regulate serine endopeptidases, which is thought
to assist in plug degradation. In contrast, endopeptidase inhibitors are enriched in male
seminal fluid (Dean et al., 2011, Dean et al., 2009).
The level of conflict may vary depending on mate preference due to the fitness
advantages of mating with a preferred mate. Mutual mate preference studies show that
pairs of mice that preferred one another had enhanced fitness from increased number of
offspring and offspring performance in comparison with pairs of mice in which neither
preferred the other (Drickamer et al., 2003). Mate preference may affect copulatory
breakdown dynamics as a female mated with a preferred male may benefit from
preserving the plug i.e. slower plug breakdown. If preferences vary across genotypes, we
predict a male-female interaction in protease activity.
Our previous study where we used multiple male genotypes did not detect a
interaction term (Mangels et al., 2015). This study used two female strains, C57 and
FVB, which are genetically divergent (Keane et al., 2011, Wong et al., 2012) and carry
different MHC serotypes, which as discussed above are known to modulate female
choice dynamics (Roberts & Gosling, 2003, Potts et al., 1991). However, we did not give
cues to females of available males (visual, odor), which may have impeded their
decision-making ability since the females were unaware of potential mates. Here, we
present a more powerful design to investigate the role of female preference in protease
activity by exposing females to available males. Specifically, by exposing females to
male’s bedding prior to mating, we provide information to females about available males.
58
This is a key modification since females use odor cues in urine to detect MHC serotypes
(Yamaguchi et al., 1981). By using C57 and FVB, which differ at a MHC locus, we
predict a difference in preference between the two strains based on MHC similarity. We
predict that females mated to MHC-dissimilar (presumably preferred) males will clear
plugs more slowly than females mated to MHC-similar (presumably unpreferred) males,
but that difference might depend on pre-exposure to the scents of both males.
4.3 Methods
4.3.1 Study Organism
All husbandry and experimental methods, as well as all personnel involved were
approved by the University of Southern California's Institute for Animal Care and Use
Committee, protocols #11394 and #11777.
We used two classical inbred strains, FVB/NJ (FVB) and C57BL/6N (C57)
available from Jackson Labs (Bar Harbor, Maine). These two strains were chosen since
the females respond well to hormonal induction of estrus (Byers et al., 2006).
Furthermore, they carry divergent serotypes at the MHC locus, which has been shown to
affect female choice dynamics (Leinders-Zufall et al., 2004, Roberts & Gosling, 2003,
Potts et al., 1991) likely through chemical signals in the urine (Yamaguchi et al., 1981).
Specifically, FVB carries the q serotype and C57 carries the b serotype (Petkov et al.,
2004).
To breed experimental mice, sire and dam were paired for 1-2 weeks, then
separated so that the dam could give birth in isolation. Males and females were weaned at
3-4 weeks postpartum. Females were weaned with up to three individuals per cage and
were used in experiments at 4-6 weeks of age. Males were weaned with one individual
59
per cage to avoid dominance interactions and reduced fertility (Snyder, 1967), and were
used in experiments at 8-12 weeks of age. Experimental males mated no more than once
per week to allow rejuvenation of seminal fluid and sperm stores. The colony was kept at
14:10 hours of dark:light and provided food ad libitum. We employed techniques in
husbandry to prevent the mice from being exposed to unwanted odors, since rodents may
vary their ejaculate under a perceived risk of sperm competition (Delbarco-Trillo &
Ferkin, 2004, Ramm & Stockley, 2007, Delbarco ‐Trillo, 2011, Preston & Stockley,
2006, Firman et al., 2013, Ramm & Stockley, 2009). Aforementioned studies used both
exposure and exposure prevention of male odors to manipulate level of sperm
competition. We took similar precautions, during handling; gloves were changed between
strains of mice to prevent exposure to other strains. Furthermore, our facility employs
positive air pressure to prevent odors spreading.
4.3.2 Exposure Groups and Experimental Mating
At 4-6 weeks of age, virgin female mice (FVB or C57) were induced into estrus
using established protocols (Nagy, 2003). First, the females received an intraperitoneal
injection of 5 U Pregnant Mare’s Serum Gonadotropin (PMSG). At this point, females
were randomly assigned into 2 groups, referred to as exposed and non-exposed. The
exposed group of females received soiled bedding from one sexually mature FVB male
and one sexually mature C57 male in order to simulate a scenario where the female is
able to use odor cues to determine there are multiple males in her environment (one
preferred, one unpreferred). A single male from each strain provided soiled bedding for
the entire experiment in order to prevent difference in male phenotypes such as
dominance, which has been shown to affect female choice dynamics (Shapiro &
60
Dewsbury, 1986, Horne & Ylönen, 1996). Approximately 48 hours after PMSG injection,
the females received an intraperitoneal injection of 5 U Human Chorionic Gonadotropin
(hCG), to ensure ovulation approximately 12 hours later. Females in the exposure group
received soiled bedding from both focal males at the time of PMSG injection. Females
were not exposed prior to PMSG injection since male odors may induce estrus at this
stage (Ma et al., 1999).
Approximately 14 hours after the hCG injection, each female was placed into the
cage of a randomly assigned FVB or C57 experimental male for 4 hours. Crosses were
performed in every combination in respect to exposure group, male genotype, and female
genotype resulting in 8 categories. Mating was confirmed by the presence of a copulatory
plug in the vaginal-cervical region, observed visually or after very slight probing. Once
mating was confirmed, females were housed alone for 6 hours. The 6-hour time point was
selected to ensure that all plugs were still present and that none of the plugs were fully
dissolved (Mangels et al., 2015). Females were then euthanized via carbon dioxide
overexposure and copulatory plugs were dissected and weighed. In total we collected 40
copulatory plugs, which included 5 plugs from each of the 8 categories.
4.3.3 Thrombin Assays
Experimental methods follow section 3.3.5. Briefly, supernatant was collected
from homogenized plugs, and then thrombin was added to the supernatant and incubated
followed by addition of S-228. Amidolytic activity was quantified with a higher
fluorescence indicating higher hydrolysis of the chromogenic substrate, which infers
higher activity of serine endopeptidases and/or reduced serine endopeptidase inhibition.
61
Each plate assay was accompanied by two replicate standards. All plugs were run in
replicate in our assay and replicates were averaged for our statistical analysis.
4.4 Results
We assayed 40 plugs in total, which included 5 plugs from each of the 8
categories (Figure 4.1).

Figure 4.1 Results of the thrombin assay summarizing the overall thrombin activity of all plugs, 5 plugs in each
of the 8 categories. The X-axis denotes the Males by Female genotypes. Blue indicates females that were exposed
to male odors, red indicated females that were not exposed.
A larger value of thrombin activity indicates a higher hydrolysis of the
chromogenic substrate, which we interpret as higher activity of serine endopeptidases
and/or reduced serine endopeptidase inhibition. These two opposing forces cannot be
62
separated in our assay; but we predict a male-female interaction term especially within
the exposure treatment, since unexposed females might be “unaware” of her potential
mates.
Factor d.f SumSq F-value P-value
Female genotype 1 3.51E-06 0.71 0.4
Male genotype 1 2.30E-05 4.67 0.04
Exposure 1 1.42E-05 2.88 0.1
Male X Female 1 9.17E-06 1.86 0.18
Residuals 35 1.72E-04
Table 4.1 Genotype based results of linear model on protease activity
There was a significant effect of male genotype on protease activity (F
1,35
=0.04)
but neither female genotype (F
1,35
=0.4), exposure (F
1,35
=0.1), nor the male-female
interaction term (F
1,35
=0.18) had an effect (Table 4.1). A significant effect of male on
protease activity was also shown in our previous work (Mangels et al., 2015).
We repeated the analyses after pooling our data according to preferred vs.
unpreferred (Fig. 4.2). An unpreferred pairing consists of a male and a female with the
same MHC genotype and a preferred paring consists of a male and a female with a
different MHC genotype. The results of the linear model show that neither preference
(F
1,36
=0.2), exposure (F
1,36
=0.11) nor the interaction of the two had an effect (F
1,36
= 0.95)
on protease activity (Table 4.2).

63

Figure 4.2 Merging the results of the thrombin assay using preference as a factor. ‘U’ denotes an unpreferred
pairing of male and female genotypes (FVBXFVB and C57XC57), while ‘P’ denotes our prediction of a
preferred mating (FVBXC57 and C57XFVB). Each category contains 10 plugs. Blue indicates females that were
exposed to male odors, blue indicated females that were not exposed
Factor d.f SumSq F-value P-value
Preference 1 9.17E-06 1.66 0.206
Exposure 1 1.42E-05 2.57 0.118
Preference X Exposure 1 2.00E-08 0.003 0.954
Residuals 36 1.99E-04
Table 4.2 Preference based results of linear model on protease activity
We used a one-way analysis of variance power calculation within our exposure
group to determine our power in detecting if preference (male-female interaction)
affected protease activity. We focused on our exposure group since this predicted to show
the greatest effect. Using the unpreferred and preferred categories in our exposed group,
64
we determined that our experimental design had a power of 0.15 to detect an interaction
term if there was one. In order to fully reject our null hypothesis of there being no
interaction term (power=0.8), we would need a sample size of n=50 in each group while
this study only employed n=10.
Furthermore, we repeated the analysis using either FVB male or C57 males since
male genotype was found to be significant. The results of the linear model for FVB males
show that neither preference (F
1,16
=0.25), exposure (F
1,16
=0.07) nor the interaction of the
two had an effect (F
1,16
= 0.60) on protease activity. In addition neither preference
(F
1,16
=0.42), exposure (F
1,16
=0.71) nor the interaction of the two had an effect (F
1,16
=
0.09) on protease activity significant for C57 males.
4.5 Discussion
Here, we modified our previous experimental design (Mangels et al., 2015) to
specifically test for a male-female interaction of the enzymes involved in copulatory plug
breakdown. However, as in our previous study, we did not detect an interaction term but
confirmed male genotype as a significant factor in protease activity. We now discuss
several hypotheses for why we did not detect a male-female interaction term.
First, as discussed in the Chapter 1, females exercise choice and paternity control
during many phases of mating including before copulation, during copulation, before
fertilization and following fertilization (Birkhead & Møller, 1993). Our study’s aim was
to detect female choice dynamics after copulation in regards to plug breakdown.
However female may not exercise choice by breakdown or removal of the copulatory
plug, preventing us from detecting an interaction term. Females may exercise choice past
65
this phase by blocking implantation of fertilized embryos, investing differently in
embryos, or even infanticide.
Second, female mate choice may not be solely dependent on MHC. Although a
long series of studies show that mice make mate choice decisions based on individual
genotype at MHC (reviewed in (Jordan & Bruford, 1998, Tregenza & Wedell, 2000,
Penn & Potts, 1999), its influence in mate preference may vary. Females have been
shown to base preference on male scent marking and scent marking rate (Roberts &
Gosling, 2003), which is a cue of overall genetic quality (Rich & Hurst, 1998). Female
mate choice is context dependent, therefore some situations may select for genetic quality
while other select for genetic dissimilarity (Schantz et al., 1997) which could explain why
some studies show MHC-disassortative mating while others do not (Roberts & Gosling,
2003). The degree of variability between genetic quality and genetic dissimilarity of
available males can further increase inconsistencies in female choice.
Lastly, limitations of our experimental design may prevent us from detecting an
interaction term. For example, although using soiled bedding for urinary cues is
employed in many mice studies (Drickamer, 1992, Firman & Simmons, 2012), including
MHC studies (Yamazaki et al., 2000), exposure via urinary cues may not be enough to
influence female choice dynamics. Additionally, we only used two genotypes in the
current study. It is possible that the C57 or FVB males used here make especially strong
plugs regardless of female choice. In contrast, C57 or FVB females may be unable to
break down copulatory plugs effectively. Furthermore even though the ability to
discriminate between MHC and a MHC-dissimilar mating preference has been shown in
inbred strains of mice, most of the classical experiments focus on strains of mice not
66
employed in our study such as BALB (Yamazaki et al., 1976, Brown & Eklund, 1994,
Yamazaki et al., 1978, Jordan & Bruford, 1998).
4.6 Conclusions
In this chapter, we looked at the copulatory plug as an arena for sexual conflict. If
preferences vary across genotypes, then reproductive phenotypes involved in sexual
conflict should show a male- female interaction term, including the interaction between
enzymes involved in copulatory plug degradation. However, we did not detect a male-
female interaction term on the breakdown of the copulatory plug, even after exposing
females to males with different predicted attractiveness. Future experiments can build on
our methods by directly measuring female preference in order to examine how sexual
conflict is shaping copulatory plug dynamics.

67
5Chapter 5: Conclusion
This thesis addresses the interrelated evolution of male and female adaptations
and counter adaptations to sperm competition. My work builds on and underscores the
importance of previous copulatory plug studies ranging from Donald Dewsbury’s
comparative description of rodents (Dewsbury, 1988, Baumgardner et al., 1982, Hartung
& Dewsbury, 1978) to the recent studies in fertility (Dean, 2013, Kawano et al., 2014).
This thesis makes several important insights into the function and dynamics of the
copulatory plugs. In Chapter 2, I took a direct experimental approach to examine the
copulatory plug's role in mate guarding, in contrast with prior indirect studies. In doing
so, I demonstrated that the copulatory plug nearly completely inhibits second males from
achieving paternity. Next, in Chapter 3, I systematically investigated and documented the
length of copulatory plug survival in vivo, and revealed the influence of male genotype
on plug survival. Against intuition, I found that smaller plugs were longer lasting. In
Chapter 4, I built on the hypothesis of sexual conflict and designed an experiment to test
the prediction that females would adjust protease activity according to preference. I did
not find an interaction term.
5.1 Future directions
Continued research is required, not just due to seminal fluid's role in rodents, but
also the emerging understanding of the role of seminal fluid in human fertility. My work
naturally leads to several important experiments.
68
5.1.1 Is there a link between plug size and fitness?
Chapter 3 revealed genotypic and phenotypic variations in plug degradation,
including a variation in copulatory plug mass. Interestingly, males that made smaller
plugs tended to make plugs that lasted the longest time. However long-lasting plugs may
not indicate increased male fitness; for example smaller plugs may be less likely to
prevent subsequent remating by the female. In addition, if the copulatory plug is
necessary for fertility, smaller plugs may not be as efficient in maximizing sperm
transport. Future experiments considering these ideas will allow us to understand the
fitness implications of the plug size variation I observed. One component of fitness is
reproductive success, or the number of offspring sired. A future experiment could mate
the strains used in Chapter 3 to a common female background, but instead of euthanizing
females, allow the females to carry offspring to term. In such an experiment, one could
correlate the number of offspring weaned to copulatory plug mass to see if certain plug
masses have a fitness advantage. The rationale for using a common female is to account
for potential confounding factors such as different strains inherently having different size
litters. Another implication of a small or large plug could be that one size is easier to
remove by a subsequent male. In order to test if the size of the plug has any implication
on the plug removal by a rival male, a second male can be placed in the cage after
removing the first male. The researcher can then check the female at varying time-points
to determine if the plug has been removed. Based on personal observations during serial
mating experiments, the second male is able to remove the plug within a short time
frame. Using the same strains as Chapter 3, one could correlate time of removal to the
69
copulatory plug mass. These proposed experiments may begin to model the cost and
benefits of varying plug sizes.
5.1.2 Is the effectiveness of copulatory plugs dependent on ecology?
In my thesis, all of the experiments were done in a controlled environment,
therefore not suitable to evaluate the copulatory plug’s function in the context of
variations encountered in nature. One of the important variations is the time between
mating. Environmental variation in population densities may affect the time between
matings for both males and females. In high-density populations, males may experience
sperm and seminal fluid depletion from high rates of multiple mating, in turn affecting
size and perhaps efficiency of the copulatory plug. Fromhage (2012) modeled that in high
rates of remating, the plug is expected to decrease in size and efficiency, and Sutter et al
(2015) confirmed that copulatory plugs decrease in size with remating. Additional studies
are needed to examine the copulatory plug efficiency under different, more natural
densities, where the time between matings may vary. An experimental design could
mimic the methods in Chapter 2 with the key modification of remating females at
different intervals, such as 2, 6, or 8 hours after initial mating.
How long the copulatory plug function in terms of mate guarding is an appealing
question I attempted to pursue but was unable to due to protocol limitations, specifically
that I relied on induced estrus of females, where females are in estrus for a couple of
hours. In order to employ this modified experimental design, the female would need to be
in estrus during the entire procedure including the postponed second male mating. In
order to implement this design, future researchers would need to utilize natural estrus.
Natural estrus lasts up to 8- 12 hours and can be determined through visual observation
70
(Byers et al., 2012). This experiment is key to explain the inconsistencies of the rate of
multiple paternities seen in nature, which may be explained by differing population
densities.
5.1.3 Does sperm competition risk affect copulatory plug function?
In Chapter 2, I determined the efficiency of the copulatory plug in a serial mating
scheme, with males raised in isolation to prevent dominance effects. Previous studies
have shown rodents increase the size of their seminal vesicles in response to sperm
competition (Lemaître et al., 2011). One would predict that since the main product of the
seminal vesicles is the copulatory plug, the increased seminal vesicle size would increase
the size of the plug and result in a change of efficiency. Yet, previous studies in mice
showed that the size of the copulatory plug is not affected by sperm competition risk
(Ramm & Stockley, 2007). However, mate-guarding efficiency may not depend on just
copulatory size, but may also depend on other factors such as density or structure. Future
studies can use males with varying perceived risk of sperm competition in the serial
mating design presented in Chapter 2 to determine the effect of sperm competition on
copulatory plug efficiency. The male in the first to mate position would vary in amount of
perceived risk of sperm competition and the second male to mate would remain constant.
Manipulation of perceived risk of sperm competition can be achieved with visual,
olfactory, or physical contact with rival males for a short period of time (Lemaître et al.,
2011, Ramm & Stockley, 2007). Using males from these treatments with the serial-
mating design presented in Chapter 2, one can directly determine the effect of sperm
competition on mate guarding efficiency. Increased risk of sperm competition may select
for factors that increase efficiency either through changes in mass, density or structure.
71
5.1.4 How is human semen coagulation linked to fertility?
As discussed in Chapter 1, human semen goes through a coagulation phase
involving seminal vesicle proteins (Huggins & Neal, 1942) which are orthologs to the
proteins seen in mouse ejaculate (Dean et al., 2011). Human subfertility has been linked
to defects in the phases of coagulation and liquefaction, including increased semen
viscosity (Mikhailichenko & Esipov, 2005, Milardi et al., 2012). Abnormal semen
viscosity is observed in up to 32% of men with fertility issues (Gonzales et al., 1993).
Abnormal viscosity may be due to problems with a prostate serine protease, which
usually liquefies this coagulation (Schill, 1975, Koren & Lukač, 1979). However, the role
of the prostate in this process is not certain since some studies show no difference in
prostate enzymes between abnormal and normal semen viscosity (Aafjes et al., 1985,
Carpino & Siciliano, 1998). Studying copulatory plug protein orthologs in humans may
reveal genetic and proteomic variation associated with differences in human male
fertility.
A recent proteomic study in humans identified 83 seminal vesicle proteins that
may be involved in human fertility including lactotransferrin (Ltf) and semenogelin I and
II, functional homologs to SVS1 and SVS2 which are involved in mice copulatory plug
formation (Milardi et al., 2012). Ltf is a protease produced by female mice in response to
mating and could be playing a role in plug degradation (Dean et al., 2011). Genetic
variation in these genes could explain variation in coagulation in humans and should be
candidate genes for future mice knockout studies. Svs2 knockout mice are unable to make
a copulatory plug and have reduced fertility (Kawano et al., 2014). A similar study could
be preformed with Svs1 knockout mice, to determine if these mice could still form a
72
copulatory plug or had any degree of coagulation. One would predict a decrease of
coagulation or semen viscosity with an Svs1 knockout, and increased semen viscosity in
the case of Ltf knockout. The potential change in viscosity, i.e. degrees of coagulation,
can affect sperm migration through the female reproductive tract. Exploring this
hypothesis is important to understand human infertility since male with higher viscosity
have decreased sperm motility. To determine if coagulation affects sperm migration in
vivo, a knockout male can be mated to a female then sperm location determined by
dissection and examination of the female tract. In vitro sperm motility can be measured
using a Makler chamber where the media is the ejaculate of the different knockout males.
Even if these genes are not involved in semen viscosity, proteomic studies can help to
identify novel markers affecting human infertility.
5.2 Final Remarks
Currently the main indicator of male fertility that is used in humans is sperm
quality, including morphology, viability, and motility (Belsey et al., 1980). In fact,
seminal fluid is thought to be detrimental to successful fertilization in vitro since it
inhibits sperm capacitation, a reaction sperm must go through in order to fertilize eggs
(Bedford & Chang, 1962, Chang, 1957). As a result, in many modern assisted
reproductive technologies, seminal fluid is removed as it considered to be unnecessary
for successful fertilization (McGraw et al., 2015). However, researchers have begun to
understand the importance of seminal fluid in human fertility. Current research in mice
shows that seminal fluid, including the copulatory plug protein gene SVS2, is necessary
for sperm survival (Kawano et al., 2014). SVS2 protects sperm in the uterus, since the
female immune system is not able to distinguish between sperm and pathogens (Kawano
73
et al., 2014). Seminal fluid may further modulate the female's immune system by
inducing an inflammatory immune respond to prepare for implantation, improving the
chances of embryo implantation (Robertson, 2007, Avila et al., 2011). Additionally,
seminal fluid is necessary for female ovulation in some species, through the stimulating
secretion of luteinizing hormone (Chen et al., 1985). Even after fertilization, seminal
fluid affects fertility. A recent study in mice showed that a lack of exposure to seminal
plasma decreases the rate of pre-implantation embryo cleavage and leads to a reduction in
proportion of successfully transferred embryos (Bromfield et al., 2014). Taken together,
seminal fluid is not just a medium for sperm transport, and researchers should employ a
broader method to further understand seminal fluid’s role in fertility. Understanding the
fate and effects of seminal fluid, and the female response, is necessary to gain a more
comprehensive understanding of reproduction in humans.

74
6Appendix A: Male Morphological Data
Appendix A contains supplemental male morphological data and results from Chapter
3. Figure A.1 shows that the proportion of plug present (24 hours) by residual seminal
vesicle weight. Figure A.2 shows that the proportion of plug present (24 hours) by
testes weight. In both figures: mouse genotype indicated by text; the exact location of
each strain on the plot is the center of all text. Table A.1 contains calculated protein
abundances for each seminal vesicle proteins used in the PC analysis. Table A.2
contains the summary of male morphological measurements for all strains used.

Figure A.1 Male Morphology: Proportion of plug present is not correlated to residual seminal vesicle weight

−0.02 −0.01 0.00 0.01 0.02
0.2 0.3 0.4 0.5 0.6 0.7 0.8
Residual Seminal Vesicle Weight
Proportion of Plug Present (24 hours)
DGA
DJO
DCA
DIK
BIK
C57
FVB
DOT
75

Figure A.2 Male Morphology: Proportion of plug present is not correlated to residual testes weight

Male SVS1-like SVS2-like SVS4-like SVS5-like Total mass
DIK 0.228221278 0.313722814 0.198211313 0.259844595 8.790466746
DCA 0.221287616 0.309595007 0.223177516 0.245939861 9.850052481
DOT 0.186363449 0.303549207 0.211725307 0.298362037 8.726602612
BIK 0.273721756 0.31367509 0.200309729 0.212293425 11.33872881
FVB 0.268942193 0.31662217 0.189467402 0.224968235 11.49125891
C57 0.255300186 0.345260009 0.178522066 0.22091774 10.5692461
DGA 0.087360082 0.318946144 0.275164291 0.318529482 3.292207271
DJO 0.190114908 0.378170744 0.206362326 0.225352022 11.12299816
Table A.1 Seminal vesicle protein quantification across genotype. Column headers are as follows: Male = male
genotype; SVS1:SVS5= abundance of each protein band/sum of the abundances of the four protein bands;
Total= Absolute value of abundance of the 4 protein bands.

−0.010 −0.005 0.000 0.005 0.010
0.2 0.3 0.4 0.5 0.6 0.7 0.8
Residual Testes Weight
Proportion of Plug Present (24 hours)
DGA
DJO
DCA
DIK
BIK
C57
FVB
DOT
76
Male Male # DOB
Date of
Dissection
Body
Weight
(g)
Seminal
Vesicle
Weight (g)
Right Testis
Weight (g)
Left Testis
Weight (g)
BIK 5588 01/25/14 04/04/14 19.71 0.0666 0.0682 0.0752
BIK 5514 02/07/14 04/15/14 22.96 0.0491 0.08 0.0734
BIK 5558 02/07/14 04/15/14 22.14 0.0647 0.0666 0.0714
BIK 5515 02/07/14 04/15/14 23.03 0.0599 0.0742 0.072
BIK 5557 02/09/14 04/16/14 24.39 0.0748 0.0739 0.0712
C57 7138.1 03/07/14 05/26/14 24.82 0.1237 0.1032 0.0989
C57 7138.2 03/07/14 05/26/14 27.45 0.1303 0.108 0.1136
C57 7210 05/01/14 07/09/14 21.75 0.0861 0.0936 0.0883
C57 7301 05/01/14 07/09/14 27.39 0.1115 0.1037 0.0973
C57 7265 05/01/14 07/09/14 22.45 0.1863 0.0827 0.0918
C57 7267 05/01/14 07/09/14 23.89 0.0978 0.1008 0.088
C57 7211 05/01/14 07/09/14 22.08 0.05 0.093 0.0986
DCA 5501 08/09/13 10/15/13 14.53 0.0326 0.0645 0.0608
DCA 5527 08/09/13 10/15/13 18.29 0.0597 0.0815 0.0679
DCA 5528 08/09/13 10/16/13 16.74 0.0611 0.0652 0.0668
DCA 5563 10/12/13 12/18/13 14.88 0.0447 0.064 0.0611
DCA 5564 10/12/13 12/18/13 13.81 0.0295 0.0664 0.0634
DGA 6197 12/20/13 02/21/14 16.56 0.0068 0.0497 0.0469
DGA 6203 12/20/13 02/21/14 16.14 0.0071 0.0406 0.0412
DGA 6464 04/06/14 06/12/14 15.34 0.0104 0.0427 0.0418
DIK 5663 10/07/13 12/12/13 16.41 0.0515 0.0653 0.062
DIK 5662 10/07/13 12/12/13 18.7 0.0699 0.0864 0.0818
DIK 5653 10/07/13 12/12/13 21.63 0.0544 0.0834 0.0825
DIK 6140 11/18/13 02/05/14 17.16 0.0454 0.0776 0.081
DIK 6137 11/18/13 02/05/14 20.04 0.069 0.0888 0.0757
DIK 6141 11/18/13 02/05/14 18.86 0.0423 0.0874 0.0809
DJO 6452 03/31/14 05/28/14 18.45 0.0547 0.0645 0.0618
DJO 6461 03/31/14 05/28/14 13.91 0.0079 0.06 0.0561
DJO 6451 03/31/14 05/28/14 18.36 0.0488 0.0617 0.0557
DJO 6460 03/31/14 05/28/14 13.88 0.03125 0.0616 0.0611
DOT 5526 08/20/13 10/23/13 16.57 0.0179 0.0454 0.0474
DOT 5568 09/02/13 11/07/13 16.86 0.0373 0.0444 0.0427
DOT 5562 10/10/13 12/18/13 16.24 0.0149 0.0448 0.0451
DOT 5531 03/22/14 05/28/14 17.18 0.0375 0.0517 0.0614
FVB 6404.1 03/08/14 05/26/14 30.73 0.0827 0.0954 0.0909
FVB 6404.2 03/08/14 05/26/14 26.14 0.1097 0.0725 0.0742
FVB 7292 05/24/14 07/23/14 25.65 0.0635 0.1006 0.0968
FVB 7291 05/24/14 07/23/14 26.55 0.0768 0.0971 0.096
FVB 7293 05/24/14 07/23/14 26.77 0.0854 0.0758 0.0912
FVB 6477 05/24/14 07/23/14 27.22 0.0751 0.0494 0.099
Table A. 2 Male morphological data. Column headers are as follows: Male= Male genotype; Male No=
Individual male's ID; Date of Birth= Male's date of birth; Body Weight (g)= Body weight at dissection; Seminal
Vesicle Weight (g)= Absolute weight of the left seminal vesicle; Right Testis Weight (g)= Absolute weight of the
right testis; Left Testis Weight (g)= Absolute weight of the left testis
77
7Appendix B: Thrombin Assay Recipes and Protocol
Recipes:

S-2238 is a chromogenic substrate from Chromogenix. The vial is eluded with 19.98 mL
of water to a final concentration of 2mM. S-2238 should be refrigerated between uses.

Thrombin: Thrombin from human plasma supplied by sigma-aldrich. The vial is eluded
with 10 mL of water to a concentration of 4.31 ug/ ml. Samples of 1 ml are stored in low
retention tubes until use. When used they are diluted in 9 mL of water to .431 ug/ml. The
diluted samples should be stored in 4 C until use.

Assay Buffer: 50 mM Trizma Base
130 mM Sodium Chloride
pH 8.3- HCl

Protocol:
Copulatory Plug Preparation:
1. Grind plug with mortar and pestle using liquid nitrogen to freeze the plug.
2. Transfer plug into pre-weighed 1.5 ml tube using clean metal scrapper. Difference
in weight is weight of plug.
3. Add thrombin buffer to plug in a ratio of .0106 g of plug to 400 ul of buffer.
4. Vortex for 1 min.
5. Let sit for 30 mins, every 10 mins invert tube 10 times.
6. Centrifuge plug at max speed for 3 mins.
7. Take off supernatant. Use supernatant in thrombin plate assay.

Thrombin Plate Assay:
1. Incubate substrate (Chromogenix S-2388) at 37 degrees until use.
2. Set up plate adding thrombin buffer for Standard Curve and the plug supernatant
for the corresponding samples. Each well should have 95 ul total.
3. For standard curve:
a. For standard curve use varying amounts of thrombin but keep each well at
95 ul total.
b. The standard curve is creating using decreasing amounts of known
thrombin. We used: 50 ul, 35 ul, 30 ul, 25 ul, 15 ul, 5 ul, 0 ul. Buffer is
added to bring each well to 95 ul.
c. First add thrombin assay buffer followed by thrombin.
4. For samples:
a. We tested each plug (if enough supernatant) at thrombin concentrations of
30 ul, 15 ul, and 0 ul. 15 ul was the priority.
78
b. First add plug supernatant and then the appropriate thrombin amount to
the appropriate well keeping each well at 95 ul total.
An example of plate setup is shown in Table B. 1
Thrombin
(ul)
Buffer or Plug supernatant
(ul)
50 45
35 60
30 65
25 70
15 80
5 90
0 95
Table B.1 Example plate setup
5. Transfer plate to Microplate Reader.
6. Incubate plate at 37 degrees for 30 mins.
7. Add 5 ul of substrate (Chromogenix S-2388) to every well.
8. Take readings every 1 min for 2.5 hours using 405 nm filters.
9. Save file.

79
8References
Aafjes, J., Blijenberg, B., OORT, H. W. V. & Schenck, P. 1985. Enzyme activity of
human ejaculates, relation with abnormal liquefaction. Andrologia 17: 87-91.
Abele, L. & Gilchrist, S. 1977. Homosexual rape and sexual selection in acanthocephalan
worms. Science 197: 81-83.
Andersson, M. B. 1994. Sexual selection. Princeton University Press.
Arienti, G., Carlini, E., Nicolucci, A., Cosmi, E. V., Santi, F. & Palmerini, C. A. 1999.
The motility of human spermatozoa as influenced by prostasomes at various pH
levels. Biology of the Cell 91: 51-54.
Arnqvist, G. r. & Rowe, L. 2013. Sexual conflict. Princeton University Press.
Asdell, S. A. 1946. Patterns of mammalian reproduction. Comstock Publishing
Company, Ithaca, New York.
Asdell, S. A. & Hubbs, C. L. 1964. Patterns of mammalian reproduction. Cornell
University Press Ithaca, New York.
Austad, S. N. 1984. Evolution of sperm priority patterns in spiders. Sperm competition
and the evolution of animal mating systems: 223-249.
Austin, C. P., Battey, J. F., Bradley, A., Bucan, M., Capecchi, M., Collins, F. S., Dove,
W. F., Duyk, G., Dymecki, S. & Eppig, J. T. 2004. The knockout mouse project.
Nature genetics 36: 921-924.
Avila, F. W., Sirot, L. K., LaFlamme, B. A., Rubinstein, C. D. & Wolfner, M. F. 2011.
Insect seminal fluid proteins: identification and function. Annual review of
entomology 56: 21.
Ball, J. 1934. Demonstration of a quantitative relation between stimulus and response in
pseudopregnancy in the rat. Am. J. Physiol. 107: 698-703.
Barker, D. M. 1994. Copulatory plugs and paternity assurance in the nematode
Caenorhabditis elegans. Animal Behaviour 48: 147-156.
Bateman, A. J. 1948. Intra-sexual selection in Drosophila. Heredity 2: 349-368.
Baumgardner, D. J., Hartung, T. G., Sawrey, D. K., Webster, D. G. & Dewsbury, D. A.
1982. Muroid copulatory plugs and female reproductive tracts: a comparative
investigation. J Mammal 63: 110-117.
80
Beauchamp, G. K., Yamazaki, K., Bard, J. & Boyse, E. A. 1988. Preweaning experience
in the control of mating preferences by genes in the major histocompatibility
complex of the mouse. Behavior Genetics 18: 537-547.
Beck, J. A., Lloyd, S., Hafezparast, M., Lennon-Pierce, M., Eppig, J. T., Festing, M. F. &
Fisher, E. M. 2000. Genealogies of mouse inbred strains. Nature genetics 24: 23-
25.
Bedford, J. & Chang, M. 1962. Removal of decapacitation factor from seminal plasma by
high-speed centrifugation. American Journal of Physiology--Legacy Content 202:
179-181.
Bell, G. 2010. Fluctuating selection: the perpetual renewal of adaptation in variable
environments. Philos Trans R Soc Lond B Biol Sci 365: 87-97.
Belsey, M., Moghissi, K., Eliasson, R., Paulsen, C., Gallegos, A. & Prasad, M. 1980.
Laboratory manual for the examination of human semen and semen-cervical
mucus interaction.
Bilde, T., Foged, A., Schilling, N. & Arnqvist, G. 2009. Postmating sexual selection
favors males that sire offspring with low fitness. Science 324: 1705-1706.
Birdsall, D. A. & Nash, D. 1973. Occurrence of successful multiple insemination of
females in natural populations of deer mice (Peromyscus maniculatus). Evolution:
106-110.
Birkhead, T. 2000. Promiscuity: an evolutionary history of sperm competition. Harvard
University Press.
Birkhead, T., Martinez, J., Burke, T. & Froman, D. 1999. Sperm mobility determines the
outcome of sperm competition in the domestic fowl. Proceedings of the Royal
Society of London B: Biological Sciences 266: 1759-1764.
Birkhead, T. & Møller, A. 1993. Female control of paternity. Trends in Ecology &
Evolution 8: 100-104.
Birkhead, T. R. & Moller, A. P. 1998. Sperm competition and sexual selection. Academic
Press.
Birkhead, T. R. & Pizzari, T. 2002. Postcopulatory sexual selection. Nat Rev Genet 3:
262-273.
Blake, J. A., Bult, C. J., Kadin, J. A., Richardson, J. E., Eppig, J. T. & Group, M. G. D.
2011. The Mouse Genome Database (MGD): premier model organism resource
for mammalian genomics and genetics. Nucleic acids research 39: D842-D848.
Blandau, R. J. 1945a. Is the copulation plug necessary for the en masse transport of
spermatozoa into the uterine cornua of the albino rat? Anat Rec 91: 266-267.
81
Blandau, R. J. 1945b. On the factors involved in sperm transport through the cervix uteri
of the albino rat. Am J Anat 77: 253-272.
Breedveld, M. C. & Fitze, P. S. 2016. The timing and interval of mate encounter affects
investment during mating. Biological Journal of the Linnean Society: n/a-n/a.
Bromfield, J. J., Schjenken, J. E., Chin, P. Y., Care, A. S., Jasper, M. J. & Robertson, S.
A. 2014. Maternal tract factors contribute to paternal seminal fluid impact on
metabolic phenotype in offspring. Proceedings of the National Academy of
Sciences 111: 2200-2205.
Brown, J. L. 1997. A theory of mate choice based on heterozygosity. Behavioral Ecology
8: 60-65.
Brown, J. L. & Eklund, A. 1994. Kin recognition and the major histocompatibility
complex: an integrative review. American Naturalist: 435-461.
Bruce, H. M. 1960. A block to pregnancy in the mouse caused by proximity of strange
males. Journal of Reproduction and Fertility 1: 96-103.
Burley, N. 1977. Parental investment, mate choice, and mate quality. Proceedings of the
National Academy of Sciences 74: 3476-3479.
Byers, S. L., Payson, S. J. & Taft, R. A. 2006. Performance of ten inbred mouse strains
following assisted reproductive technologies (ARTs). Theriogenology 65: 1716-
26.
Byers, S. L., Wiles, M. V., Dunn, S. L. & Taft, R. A. 2012. Mouse estrous cycle
identification tool and images. PloS one 7: e35538.
Byrne, P., Roberts, J. & Simmons, L. 2002. Sperm competition selects for increased
testes mass in Australian frogs. Journal of Evolutionary Biology 15: 347-355.
Cameron, E., Day, T. & Rowe, L. 2007. Sperm competition and the evolution of ejaculate
composition. The American Naturalist 169: E158-E172.
Carballada, R. & Esponda, P. 1992. Role of fluid from seminal vesicles and coagulating
glands in sperm transport into the uterus and fertility in rats. J Reprod Fertil 95:
639-48.
Carballada, R. & Esponda, P. 1997. Fate and distribution of seminal plasma proteins in
the genital tract of the female rat after natural mating. Journal of reproduction
and fertility 109: 325-335.
Carnahan, S. J. & Jensen-Seaman, M. I. 2008. Hominoid seminal protein evolution and
ancestral mating behavior. Am J Primatol 70: 939-948.
82
Carpino, A. & Siciliano, L. 1998. Unaltered protein pattern/genital tract secretion marker
levels in seminal plasma of highly viscous human ejaculates. Archives of
andrology 41: 31-35.
Chang, M. 1957. A detrimental effect of seminal plasma on the fertilizing capacity of
sperm.
Chapman, T. 2001. Seminal fluid-mediated fitness traits in Drosophila. Heredity 87: 511-
521.
Chen, B., Yuen, Z. & Pan, G. 1985. Semen-induced ovulation in the bactrian camel
(Camelus bactrianus). Journal of reproduction and fertility 74: 335-339.
Chen, H., Cheung, M., Chow, P., Cheung, A. & Liu, W. 2002. Protection of sperm DNA
against oxidative stress in vivo by accessory sex gland secretions in male
hamsters. Reproduction 124: 491-499.
Chen, P., Stumm-Zollinger, E., Aigaki, T., Balmer, J., Bienz, M. & Böhlen, P. 1988. A
male accessory gland peptide that regulates reproductive behavior of female D.
melanogaster. Cell 54: 291-298.
Chinwalla, A. T., Cook, L. L., Delehaunty, K. D., Fewell, G. A., Fulton, L. A., Fulton, R.
S., Graves, T. A., Hillier, L. W., Mardis, E. R. & McPherson, J. D. 2002. Initial
sequencing and comparative analysis of the mouse genome. Nature 420: 520-562.
Clark, N. L., Aagaard, J. E. & Swanson, W. J. 2006. Evolution of reproductive proteins
from animals and plants. Reproduction Fertility and Development 131: 11-22.
Clark, N. L. & Swanson, W. J. 2005. Pervasive adaptive evolution in primate seminal
proteins. PLoS Genetics 1: e35.
Clutton-Brock, T. 1982. The functions of antlers. Behaviour 79: 108-124.
Coria-Avila, G. A., Pfaus, J. G., Hernandez, M. E., Manzo, J. & Pacheco, P. 2004.
Timing between ejaculations changes paternity success. Physiology & behavior
80: 733-737.
Cukierski, M., Sina, J., Prahalada, S. & Robertson, R. 1991. Effects of seminal vesicle
and coagulating gland ablation on fertility in rats. Reproductive Toxicology 5:
347-352.
Dalgaard, P. 2008. Introductory Statistics with R. Springer, New York, NY.
Darwin, C. 1871. Descent of Man: Part II Sexual Selection.
Dean, M. D. 2013. Genetic Disruption of the Copulatory Plug in Mice Leads to Severely
Reduced Fertility. PLoS Genet 9: e1003185.
83
Dean, M. D., Ardlie, K. G. & Nachman, M. W. 2006. The frequency of multiple paternity
suggests that sperm competition is common in house mice (Mus domesticus).
Molecular Ecology 15: 4141-4151.
Dean, M. D., Clark, N. L., Findlay, G. D., Karn, R. C., Yi, X., Swanson, W. J., MacCoss,
M. J. & Nachman, M. W. 2009. Proteomics and comparative genomic
investigations reveal heterogeneity in evolutionary rate of male reproductive
proteins in mice (Mus domesticus). Molecular biology and evolution 26: 1733-
1743.
Dean, M. D., Findlay, G. D., Hoopmann, M. R., Wu, C. C., MacCoss, M. J., Swanson,
W. J. & Nachman, M. W. 2011. Identification of ejaculated proteins in the house
mouse (Mus domesticus) via isotopic labeling. BMC Genomics 12: 306.
Delbarco-Trillo, J. & Ferkin, M. H. 2004. Male mammals respond to a risk of sperm
competition conveyed by odours of conspecific males. Nature 431: 446-449.
Delbarco ‐Trillo, J. 2011. Adjustment of sperm allocation under high risk of sperm
competition across taxa: a meta ‐analysis. Journal of evolutionary biology 24:
1706-1714.
Devine, M. C. 1975. Copulatory plugs in snakes: enforced chastity. Science 187: 844-
845.
Devine, M. C. 1977. Copulatory plugs, restricted mating opportunities and reproductive
competition among male garter snakes. Nature 267: 345-346.
Dewsbury, D. A. 1981. On the function of the multiple-intromission, multiple-ejaculation
copulatory patterns of rodents. Bulletin of the Psychonomic Society 18: 221-223.
Dewsbury, D. A. 1982. Ejaculate Cost and Male Choice. The American Naturalist 119:
601-610.
Dewsbury, D. A. (1984) Sperm competition in muroid rodents. In: Sperm competition
and the evolution of animal mating systems, (Smith, R. L., ed.). pp. 547-571.
Academic Press, New York.
Dewsbury, D. A. 1988. Copulatory Behavior as Courtship Communication. Ethology 79:
218-234.
Dickinson, J. L. & Rutowski, R. L. 1989. The function of the mating plug in the
chalcedon checkerspot butterfly. Animal Behaviour 38: 154-162.
Dietrich, W., Katz, H., Lincoln, S. E., Shin, H.-S., Friedman, J., Dracopoli, N. & Lander,
E. 1992. A genetic map of the mouse suitable for typing intraspecific crosses.
Genetics 131: 423-447.
Dixson, A. F. 1998a. Primate sexuality. Oxford University Press, New York.
84
Dixson, A. F. 1998b. Sexual selection and evolution of the seminal vesicles in primates.
Folia Primatol (Basel) 69: 300-6.
Dixson, A. F. & Anderson, M. J. 2002. Sexual selection, seminal coagulation and
copulatory plug formation in primates. Folia Primatol 73: 63-69.
Dorus, S., Evans, P. D., Wyckoff, G. J., Choi, S. S. & Lahn, B. T. 2004. Rate of
molecular evolution of the seminal protein gene SEMG2 correlates with levels of
female promiscuity. Nat Genet 36: 1326-1329.
Dorus, S., Wasbrough, E. R., Busby, J., Wilkins, E. C. & Karr, T. L. 2010. Sperm
proteomics reveals intensified selection on mouse sperm membrane and acrosome
genes. Molecular biology and evolution: msq007.
Drickamer, L. C. 1992. Oestrous female house mice discriminate dominant from
subordinate males and sons of dominant from sons of subordinate males by odour
cues. Animal Behaviour 43: 868-870.
Drickamer, L. C., Gowaty, P. A. & Holmes, C. M. 2000. Free female mate choice in
house mice affects reproductive success and offspring viability and performance.
Animal Behaviour 59: 371-378.
Drickamer, L. C., Gowaty, P. A. & Wagner, D. M. 2003. Free mutual mate preferences in
house mice affect reproductive success and offspring performance. Animal
Behaviour 65: 105-114.
Dubbink, H. J., de Waal, L., van Haperen, R., Verkaik, N. S., Trapman, J. & Romijn, J.
C. 1998. The human prostate-specific transglutaminase gene (TGM4): genomic
organization, tissue-specific expression, and promoter characterization. Genomics
51: 434-444.
Dziminski, M. A., Roberts, J. D., Beveridge, M. & Simmons, L. W. 2009. Sperm
competitiveness in frogs: slow and steady wins the race. Proceedings of the Royal
Society of London B: Biological Sciences 276: 3955-3961.
Eberhard, W. G. 1996. Female Control: Sexual Selection by Cryptic Female Choice.
Princeton Univeristy Press, Princeton, New Jersey.
Eberhard, W. G. 2010. Evolution of genitalia: theories, evidence, and new directions.
Genetica 138: 5-18.
Eberle, M. & Kappeler, P. 2004. Sex in the dark: determinants and consequences of
mixed male mating tactics in Microcebus murinus, a small solitary nocturnal
primate. Behavioral Ecology and Sociobiology 57: 77-90.
Edward, D. A. & Chapman, T. 2011. The evolution and significance of male mate choice.
Trends Ecol Evol 26: 647-54.
85
Emlen, D. J. 2008. The evolution of animal weapons. Annual Review of Ecology,
Evolution, and Systematics: 387-413.
Endler, J. A. 1992. Signals, signal conditions, and the direction of evolution. American
Naturalist: S125-S153.
Endler, J. A. & Houde, A. E. 1995. Geographic variation in female preferences for male
traits in Poecilia reticulata. Evolution: 456-468.
Fawell, S. E. & Higgins, S. J. 1987. Formation of rat copulatory plug: purified seminal
vesicle secretory proteins serve as transglutaminase substrates. Molecular and
cellular endocrinology 53: 149-152.
Fedorka, K. M. & Mousseau, T. A. 2002. Material and genetic benefits of female
multiple mating and polyandry. Animal Behaviour 64: 361-367.
Felsenstein, J. 1976. The theoretical population genetics of variable selection and
migration. Annu Rev Genet 10: 253-80.
Fenton, M. B. 1984. Sperm competition? The case of vespertilionid and rhinolophid bats.
Sperm competition and the evolution of animal mating systems (RL Smith, ed.).
Academic Press, New York: 573-587.
Finger, J. H., Smith, C. M., Hayamizu, T. F., McCright, I. J., Eppig, J. T., Kadin, J. A.,
Richardson, J. E. & Ringwald, M. 2011. The mouse gene expression database
(GXD): 2011 update. Nucleic acids research 39: D835-D841.
Firman, R. & Simmons, L. 2009. Sperm competition and the evolution of the sperm hook
in house mice. Journal of evolutionary biology 22: 2505-2511.
Firman, R. C., Garcia ‐Gonzalez, F., Thyer, E., Wheeler, S., Yamin, Z., Yuan, M. &
Simmons, L. W. 2015. Evolutionary change in testes tissue composition among
experimental populations of house mice. Evolution 69: 848-855.
Firman, R. C., Klemme, I. & Simmons, L. W. 2013. Strategic adjustments in sperm
production within and between two island populations of house mice. Evolution
67: 3061-3070.
Firman, R. C. & Simmons, L. W. 2008. The frequency of multiple paternity predicts
variation in testes size among island populations of house mice. J Evol Biol 21:
1524-1533.
Firman, R. C. & Simmons, L. W. 2010a. Experimental evolution of sperm quality via
postcopulatory sexual selection in house mice. Evolution 64: 1245-1256.
Firman, R. C. & Simmons, L. W. 2010b. Sperm midpiece length predicts sperm
swimming velocity in house mice. Biology letters 6: 513-516.
86
Firman, R. C. & Simmons, L. W. 2012. Male house mice evolving with post ‐copulatory
sexual selection sire embryos with increased viability. Ecology letters 15: 42-46.
Fisher, D. O., Double, M. C., Blomberg, S. P., Jennions, M. D. & Cockburn, A. 2006.
Post-mating sexual selection increases lifetime fitness of polyandrous females in
the wild. Nature 444: 89-92.
Fisher, R. A. 1915. The evolution of sexual preference. The Eugenics Review 7: 184.
Fitzpatrick, J. L., Montgomerie, R., Desjardins, J. K., Stiver, K. A., Kolm, N. & Balshine,
S. 2009. Female promiscuity promotes the evolution of faster sperm in cichlid
fishes. Proceedings of the National Academy of Sciences 106: 1128-1132.
Foltz, D. W. 1981. Genetic evidence for long-term monogamy in a small rodent,
Peromyscus polionotus. American Naturalist: 665-675.
Friesen, C. R., Powers, D. R., Copenhaver, P. E. & Mason, R. T. 2015. Size dependence
in non-sperm ejaculate production is reflected in daily energy expenditure and
resting metabolic rate. The Journal of experimental biology 218: 1410-1418.
Fromhage, L. 2012. Mating Unplugged: A model for the evolution of mating plug (Dis-)
placement Evolution 66: 31-39.
Fuller, R. C. 1998. Sperm competition affects male behaviour and sperm output in the
rainbow darter. Proceedings of the Royal Society of London B: Biological
Sciences 265: 2365-2371.
Gage, M. J. 1994. Associations between body size, mating pattern, testis size and sperm
lengths across butterflies. Proceedings of the Royal Society of London B:
Biological Sciences 258: 247-254.
Gage, M. J. & Freckleton, R. P. 2003. Relative testis size and sperm morphometry across
mammals: no evidence for an association between sperm competition and sperm
length. Proceedings of the Royal Society of London B: Biological Sciences 270:
625-632.
Gage, M. J., Macfarlane, C. P., Yeates, S., Ward, R. G., Searle, J. B. & Parker, G. A.
2004. Spermatozoal traits and sperm competition in Atlantic salmon: relative
sperm velocity is the primary determinant of fertilization success. Current biology
14: 44-47.
Gomendio, M., Martin-Coello, J., Crespo, C., Magaña, C. & Roldan, E. R. 2006. Sperm
competition enhances functional capacity of mammalian spermatozoa.
Proceedings of the National Academy of Sciences 103: 15113-15117.
Gomendio, M. & Roldan, E. R. 1991. Sperm competition influences sperm size in
mammals. Proceedings of the Royal Society of London B: Biological Sciences
243: 181-185.
87
Gonzales, G., Kortebani, G. & Mazzolli, A. 1993. Hyperviscosity and hypofunction of
the seminal vesicles. Systems Biology in Reproductive Medicine 30: 63-68.
Gosling, L. 1986. Selective abortion of entire litters in the coypu: adaptive control of
offspring production in relation to quality and sex. American Naturalist: 772-795.
Gowaty, P. A., Drickamer, L. C. & Schmid-Holmes, S. 2003. Male house mice produce
fewer offspring with lower viability and poorer performance when mated with
females they do not prefer. Animal Behaviour 65: 95-103.
Gross, M. R. 1996. Alternative reproductive strategies and tactics: diversity within sexes.
Trends in Ecology & Evolution 11: 92-98.
Gubernick, D. J. 1988. Reproduction in the California mouse, Peromyscus californicus.
Journal of Mammalogy 69: 857-860.
Harcourt, A. H., Harvey, P. H., Larson, S. G. & Short, R. 1981. Testis weight, body
weight and breeding system in primates. Nature 293: 55-57.
Hartung, T. G. & Dewsbury, D. A. 1978. A comparative analysis of copulatory plugs in
muroid rodents and their relationship to copulatory behavior. Journal of
Mammalogy 59: 717-723.
Hedrick, P. W. & Poulin, R. 2002. Pathogen resistance and genetic variation at MHC
loci. Evolution 56: 1902-1908.
Heifetz, Y., Lung, O., Frongillo, E. A. & Wolfner, M. F. 2000. The Drosophila seminal
fluid protein Acp26Aa stimulates release of oocytes by the ovary. Current
Biology 10: 99-102.
Helfenstein, F., Losdat, S., Møller, A. P., Blount, J. D. & Richner, H. 2010. Sperm of
colourful males are better protected against oxidative stress. Ecology letters 13:
213-222.
Hengst, U., Albrecht, H., Hess, D. & Monard, D. 2001. The phosphatidylethanolamine-
binding protein is the prototype of a novel family of serine protease inhibitors. J
Biol Chem 276: 535-40.
Herman, A. 1994. First record of mating plugs in lizards. Amphibia-Reptilia 15: 89-93.
Hernández-López, L., Cerda-Molina, A. L., Páez-Ponce, D. L. & Mondragón-Ceballos,
R. 2008. The seminal coagulum favours passage of fast-moving sperm into the
uterus in the black-handed spider monkey. Reproduction 136: 411-421.
Hoelzer, G. A. 1989. The good parent process of sexual selection. Animal Behaviour 38:
1067-1078.
88
Horne, T. J. & Ylönen, H. 1996. Female bank voles (Clethrionomys glareolus) prefer
dominant males; but what if there is no choice? Behavioral Ecology and
Sociobiology 38: 401-405.
Hosken, D. & Ward, P. 2001. Experimental evidence for testis size evolution via sperm
competition. Ecology Letters 4: 10-13.
Hosmer, D. W. & Lemeshow, S. 2000. Applied Logistic Regression. John Wiley and
Sons, New York.
Houde, A. E. 1987. Mate choice based upon naturally occurring color-pattern variation in
a guppy population. Evolution: 1-10.
Huggins, C. & Neal, W. 1942. Coagulation and liquefaction of semen proteolytic
enzymes and citrate in prostatic fluid The Journal of experimental medicine 76:
527-541.
Ideraabdullah, F. Y., de la Casa-Esperón, E., Bell, T. A., Detwiler, D. A., Magnuson, T.,
Sapienza, C. & de Villena, F. P.-M. 2004. Genetic and haplotype diversity among
wild-derived mouse inbred strains. Genome Research 14: 1880-1887.
Jennions, M. D. & Petrie, M. 2000. Why do females mate multiply? A review of the
genetic benefits. Biol Rev Camb Philos Soc 75: 21-64.
Jensen-Seaman, M. & Li, W.-H. 2003. Evolution of the Hominoid Semenogelin Genes,
the Major Proteins of Ejaculated Semen. Journal of Molecular Evolution 57: 261-
270.
Jordan, W. & Bruford, M. W. 1998. New perspectives on mate choice and the MHC.
Heredity 81: 127-133.
Karn, R. C., Clark, N. L., Nguyen, E. D. & Swanson, W. J. 2008. Adaptive evolution in
rodent seminal vesicle secretion proteins. Molecular biology and evolution 25:
2301-2310.
Kawano, N., Araki, N., Yoshida, K., Hibino, T., Ohnami, N., Makino, M., Kanai, S.,
Hasuwa, H., Yoshida, M., Miyado, K. & Umezawa, A. 2014. Seminal vesicle
protein SVS2 is required for sperm survival in the uterus. Proceedings of the
National Academy of Sciences 111: 4145-4150.
Kawano, N., Kang, W., Yamashita, M., Koga, Y., Yamazaki, T., Hata, T., Miyado, K. &
Baba, T. 2010. Mice lacking two sperm serine proteases, ACR and PRSS21, are
subfertile, but the mutant sperm are infertile in vitro. Biology of Reproduction 83:
359-369.
Keane, T. M., Goodstadt, L., Danecek, P., White, M. A., Wong, K., Yalcin, B., Heger,
A., Agam, A., Slater, G., Goodson, M., Furlotte, N. A., Eskin, E., Nellaker, C.,
Whitley, H., Cleak, J., Janowitz, D., Hernandez-Pliego, P., Edwards, A., Belgard,
89
T. G., Oliver, P. L., McIntyre, R. E., Bhomra, A., Nicod, J., Gan, X., Yuan, W.,
van der Weyden, L., Steward, C. A., Bala, S., Stalker, J., Mott, R., Durbin, R.,
Jackson, I. J., Czechanski, A., Guerra-Assuncao, J. A., Donahue, L. R., Reinholdt,
L. G., Payseur, B. A., Ponting, C. P., Birney, E., Flint, J. & Adams, D. J. 2011.
Mouse genomic variation and its effect on phenotypes and gene regulation.
Nature 477: 289-294.
Kelleher, E. S. & Pennington, J. E. 2009. Protease gene duplication and proteolytic
activity in Drosophila female reproductive tracts. Molecular Biology and
Evolution 26: 2125-2134.
Kelleher, E. S., Swanson, W. J. & Markow, T. A. 2007. Gene duplication and adaptive
evolution of digestive proteases in Drosophila arizonae female reproductive
tracts. PLoS Genet 3: e148.
Kelly, C. D. & Jennions, M. D. 2011. Sexual selection and sperm quantity: meta-analyses
of strategic ejaculation. Biological Reviews 86: 863-884.
Kingan, S. B., Tatar, M. & Rand, D. M. 2003. Reduced polymorphism in the chimpanzee
semen coagulating protein, semenogelin I. Journal of Molecular Evolution 57:
159-169.
Kirkpatrick, M. 1996. Good genes and direct selection in the evolution of mating
preferences. Evolution: 2125-2140.
Koboldt, D. C., Chen, K., Wylie, T., Larson, D. E., McLellan, M. D., Mardis, E. R.,
Weinstock, G. M., Wilson, R. K. & Ding, L. 2009. VarScan: variant detection in
massively parallel sequencing of individual and pooled samples. Bioinformatics
25: 2283-5.
Kodric-Brown, A. & Brown, J. H. 1984. Truth in advertising: the kinds of traits favored
by sexual selection. American Naturalist: 309-323.
Kokko, H., Brooks, R., Jennions, M. D. & Morley, J. 2003. The evolution of mate choice
and mating biases. Proceedings of the Royal Society of London B: Biological
Sciences 270: 653-664.
Koprowski, J. L. 1992. Removal of copulatory plugs by female tree squirrels. Journal of
Mammalogy: 572-576.
Koren, E. & Lukač, J. 1979. Mechanism of liquefaction of the human ejaculate I.
Changes of the ejaculate proteins. Journal of reproduction and fertility 56: 493-
499.
Lawniczak, M. K. N. & Begun, D. J. 2007. Molecular population genetics of female-
expressed mating-induced serine proteases in Drosophila melanogaster. Mol Biol
Evol 24: 1944-1951.
90
Leinders-Zufall, T., Brennan, P., Widmayer, P., S, P. C., Maul-Pavicic, A., J √§ger, M.,
Li, X.-H., Breer, H., Zufall, F. & Boehm, T. 2004. MHC Class I Peptides as
Chemosensory Signals in the Vomeronasal Organ. Science 306: 1033-1037.
Lemaître, J.-F., Ramm, S. A., Hurst, J. L. & Stockley, P. 2011. Social cues of sperm
competition influence accessory reproductive gland size in a promiscuous
mammal. Proceedings of the Royal Society of London B: Biological Sciences 278:
1171-1176.
Levine, L. 1967. Sexual selection in mice. IV. Experimental demonstration of selective
fertilization. American Naturalist: 289-294.
Li, H. & Durbin, R. 2009. Fast and accurate short read alignment with Burrows-Wheeler
transform. Bioinformatics 25: 1754-60.
Li, H., Handsaker, B., Wysoker, A., Fennell, T., Ruan, J., Homer, N., Marth, G.,
Abecasis, G. & Durbin, R. 2009. The sequence alignment/map format and
SAMtools. Bioinformatics 25: 2078-2079.
Lin, H.-J., Luo, C.-W. & Chen, Y.-H. 2002. Localization of the transglutaminase cross-
linking site in SVS III, a novel glycoprotein secreted from mouse seminal vesicle.
Journal of Biological Chemistry 277: 3632-3639.
Lincoln, G. 1994. Teeth, horns and antlers: the weapons of sex. Differences between the
sexes (RV Short and E. Balaban, eds.). Cambridge University Press, Cambridge,
United Kingdom: 131-158.
Lundwall, Å., Peter, A., Lovgren, J., Lilja, H. & Malm, J. 1997. Chemical
characterization of the predominant proteins secreted by mouse seminal vesicles.
Eur J Biochem 249: 39-44.
Lüpold, S., Manier, M. K., Ala-Honkola, O., Belote, J. M. & Pitnick, S. 2010. Male
Drosophila melanogaster adjust ejaculate size based on female mating status,
fecundity, and age. Behavioral Ecology: arq193.
Ma, W., Miao, Z. & Novotny, M. V. 1999. Induction of estrus in grouped female mice
(Mus domesticus) by synthetic analogues of preputial gland constituents.
Chemical senses 24: 289-293.
Malo, A. F., Gomendio, M., Garde, J., Lang-Lenton, B., Soler, A. J. & Roldan, E. R.
2006. Sperm design and sperm function. Biology Letters 2: 246-249.
Mangels, R., Young, B., Keeble, S., Ardekani, R., Meslin, C., Ferreira, Z., Clark, N.,
Good, J. & Dean, M. 2015. Genetic and phenotypic influences on copulatory plug
survival in mice. Heredity.
Manning, C. J., Wakeland, E. K. & Potts, W. K. 1992. Communal nesting patterns in
mice implicate MHC genes in kin recognition. Nature 360: 581-583.
91
Martan, J. & Shepherd, B. A. 1976. The role of the copulatory plug in reproduction of the
guinea pig. Journal of Experimental Zoology 196: 79-83.
Martin, P., Reimers, T., Lodge, J. & Dziuk, P. 1974. The effect of ratios and numbers of
spermatozoa mixed from two males on proportions of offspring. Journal of
Reproduction and Fertility 39: 251-258.
Masumoto, T. 1993. The effect of the copulatory plug in the funnel-web spider, Agelena
limbata (Araneae: Agelenidae). Journal of Arachnology: 55-59.
Matthews Jr, M. K. & Adler, N. T. 1978. Systematic interrelationship of mating, vaginal
plug position, and sperm transport in the rat. Physiology & Behavior 20: 303-309.
Mays, H. L. & Hill, G. E. 2004. Choosing mates: good genes versus genes that are a good
fit. Trends in Ecology & Evolution 19: 554-559.
McClive, P. J., Huang, D. & Morahan, G. 1994. C57BL/6 and C57BL/10 inbred mouse
strains differ at multiple loci on chromosome 4. Immunogenetics 39: 286-288.
McGill, T. E. 1962. Sexual behavior in three inbred strains of mice. Behaviour 19: 341-
350.
McGill, T. E., Dewsbury, D. A., Sachs, B. D. & Beach, F. A. 1978. Sex and behavior.
Plenum Press, New York.
McGraw, L. A., Suarez, S. S. & Wolfner, M. F. 2015. On a matter of seminal importance.
BioEssays 37: 142-147.
Michener, G. R. 1984. Copulatory plugs in Richardson's ground squirrels. Canadian
Journal of Zoology 62: 267-270.
Mikhailichenko, V. V. & Esipov, A. S. 2005. Peculiarities of semen coagulation and
liquefaction in males from infertile couples. Fertility and sterility 84: 256-259.
Milardi, D., Grande, G., Vincenzoni, F., Messana, I., Pontecorvi, A., De Marinis, L.,
Castagnola, M. & Marana, R. 2012. Proteomic approach in the identification of
fertility pattern in seminal plasma of fertile men. Fertility and sterility 97: 67-73.
e1.
Moller, A. 1989. Ejaculate quality, testes size and sperm production in mammals.
Functional Ecology: 91-96.
Møller, A. & Birkhead, T. 1989. Copulation behaviour in mammals: evidence that sperm
competition is widespread. Biological Journal of the Linnean Society 38: 119-
131.
Møller, A. & Jennions, M. 2001. How important are direct fitness benefits of sexual
selection? Naturwissenschaften 88: 401-415.
92
Møller, A. P. 1988. Ejaculate quality, testes size and sperm competition in primates.
Journal of Human Evolution 17: 479-488.
Montoto, L. G., Arregui, L., Sánchez, N. M., Gomendio, M. & Roldan, E. R. 2012.
Postnatal testicular development in mouse species with different levels of sperm
competition. Reproduction 143: 333-346.
Montoto, L. G., Sánchez, M. V., Tourmente, M., Martín-Coello, J., Luque-Larena, J. J.,
Gomendio, M. & Roldan, E. R. 2011. Sperm competition differentially affects
swimming velocity and size of spermatozoa from closely related muroid rodents:
head first. Reproduction 142: 819-830.
Moreira, P. L. & Birkhead, T. R. 2004. Copulatory plug displacement and prolonged
copulation in the Iberian rock lizard (Lacerta monticola). Behavioral Ecology and
Sociobiology 56: 290-297.
Mosig, D. W. & Dewsbury, D. A. 1970. Plug fate in the copulatory behavior of rats.
Psychon. Sci. 20: 315-316.
Mossman, C. A. & Drickamer, L. C. 1996. Odor preferences of female house mice (Mus
domesticus) in seminatural enclosures. Journal of Comparative Psychology 110:
131.
Murer, V., Spetz, J. F., Hengst, U., Altrogge, L. M., de Agostini, A. & Monard, D. 2001.
Male fertility defects in mice lacking the serine protease inhibitor protease nexin-
1. Proc Natl Acad Sci U S A 98: 3029-33.
Nagy, A. G., Marina; Vintersten, Kristina; Behringer, Richard 2003. Manipulating the
Mouse Embryo: A Laboratory Manual, Third ed. Cold Spring Harbor Laboratory
Press, Cold Spring Harbor, New York
Nilson, G. & Andrén, C. 1982. Function of renal sex secretion and male hierarchy in the
adder, Vipera berus, during reproduction. Hormones and Behavior 16: 404-413.
Notides, A. C. & Williams-Ashman, H. 1967. The basic protein responsible for the
clotting of guinea pig semen. Proceedings of the National Academy of Sciences of
the United States of America 58: 1991.
O'Hanlon, J. K. & Sachs, B. D. 1986. Fertility of mating in rats (Rattus norvegicus):
contributions of androgen-dependent morphology and actions of the penis. J
Comp Psychol 100: 178-187.
Orr, A. & Rutowski, R. L. 1991. The function of the sphragis in Cressida cressida
(Fab.)(Lepidoptera, Papilionidae): a visual deterrent to copulation attempts.
Journal of Natural History 25: 703-710.
93
Palopoli, M. F., Rockman, M. V., TinMaung, A., Ramsay, C., Curwen, S., Aduna, A.,
Laurita, J. & Kruglyak, L. 2008. Molecular basis of the copulatory plug
polymorphism in Caenorhabditis elegans. Nature 454: 1019-1022.
Paradis, E., Claude, J. & Strimmer, K. 2004. APE: Analyses of Phylogenetics and
Evolution in R language. Bioinformatics 20: 289-290.
Parga, J. A. 2003. Copulatory plug displacement evidences sperm competition in Lemur
catta. International Journal of Primatology 24: 889-899.
Parga, J. A., Maga, M. & Overdorff, D. J. 2006. High-resolution X-ray computed
tomography scanning of primate copulatory plugs. American Journal of Physical
Anthropology 129: 567-576.
Parker, G. 1979. Sexual selection and sexual conflict. Sexual selection and reproductive
competition in insects: 123-166.
Parker, G. 1998. Sperm competition and the evolution of ejaculates: towards a theory
base. Sperm competition and sexual selection 3: 54.
Parker, G. A. 1970. Sperm competition and its evolutionary consequences in the insects.
Biological Reviews 45: 525-567.
Parker, G. A. & Pizzari, T. 2010. Sperm competition and ejaculate economics. Biological
Reviews 85: 897-934.
Parkes, A. 1926. Observations on the oestrous cycle of the albino mouse. Proceedings of
the Royal Society of London. Series B, Containing Papers of a Biological
Character: 151-170.
Penn, D. J. & Potts, W. K. 1999. The evolution of mating preferences and major
histocompatibility complex genes. The American Naturalist 153: 145-164.
Peter, A., Lövgren, J., Lilja, H. & Malm, J. 1997. Chemical characterization of the
predominant proteins secreted by mouse seminal vesicles. European Journal of
Biochemistry 249: 39-44.
Peters, L. L., Robledo, R. F., Bult, C. J., Churchill, G. A., Paigen, B. J. & Svenson, K. L.
2007. The mouse as a model for human biology: a resource guide for complex
trait analysis. Nature Reviews Genetics 8: 58-69.
Petkov, P. M., Ding, Y., Cassell, M. A., Zhang, W., Wagner, G., Sargent, E. E., Asquith,
S., Crew, V., Johnson, K. A. & Robinson, P. 2004. An efficient SNP system for
mouse genome scanning and elucidating strain relationships. Genome research
14: 1806-1811.
Pilch, B. & Mann, M. 2006. Large-scale and high-confidence proteomic analysis of
human seminal plasma. Genome biology 7: R40.
94
Pitcher, T., Dunn, P. & Whittingham, L. 2005. Sperm competition and the evolution of
testes size in birds. Journal of evolutionary biology 18: 557-567.
Pizzari, T., Cornwallis, C. K., Lovlie, H., Jakobsson, S. & Birkhead, T. R. 2003.
Sophisticated sperm allocation in male fowl. Nature 426: 70-4.
Poiani, A. 2006. Complexity of seminal fluid: a review. Behavioral Ecology and
Sociobiology 60: 289-310.
Potts, W. K., Manning, C. J. & Wakeland, E. K. 1991. Mating patterns in seminatural
populations of mice influenced by MHC genotype. Nature 352: 619-621.
Potts, W. K. & Wakeland, E. K. 1993. Evolution of MHC genetic diversity: a tale of
incest, pestilence and sexual preference. Trends in Genetics 9: 408-412.
Preston, B., Stevenson, I., Pemberton, J., Coltman, D. & Wilson, K. 2003. Overt and
covert competition in a promiscuous mammal: the importance of weaponry and
testes size to male reproductive success. Proceedings of the Royal Society of
London B: Biological Sciences 270: 633-640.
Preston, B. T. & Stockley, P. 2006. The prospect of sexual competition stimulates
premature and repeated ejaculation in a mammal. Current Biology 16: R239-
R241.
Price, C. S., Dyer, K. A. & Coyne, J. A. 1999. Sperm competition between Drosophila
males involves both displacement and incapacitation. Nature 400: 449-452.
Ramm, S. A., Edward, D. A., Claydon, A. J., Hammond, D. E., Brownridge, P., Hurst, J.
L., Beynon, R. J. & Stockley, P. 2015. Sperm competition risk drives plasticity in
seminal fluid composition. BMC biology 13: 87.
Ramm, S. A., McDonald, L., Hurst, J. L., Beynon, R. J. & Stockley, P. 2009.
Comparative proteomics reveals evidence for evolutionary diversification of
rodent seminal fluid and its functional significance in sperm competition.
Molecular Biology and Evolution 26: 189-198.
Ramm, S. A., Oliver, P. L., Ponting, C. P., Stockley, P. & Emes, R. D. 2008. Sexual
Selection and the Adaptive Evolution of Mammalian Ejaculate Proteins.
Molecular Biology and Evolution 25: 207-219.
Ramm, S. A., Parker, G. A. & Stockley, P. 2005. Sperm competition and the evolution of
male reproductive anatomy in rodents. Proceedings of the Royal Society B:
Biological Sciences 272: 949-955.
Ramm, S. A. & Stockley, P. 2007. Ejaculate allocation under varying sperm competition
risk in the house mouse, Mus musculus domesticus. Behavioral Ecology 18: 491-
495.
95
Ramm, S. A. & Stockley, P. 2009. Adaptive plasticity of mammalian sperm production in
response to social experience. Proceedings of the Royal Society B: Biological
Sciences 276: 745-751.
Ramm, S. A. & Stockley, P. 2014. Sequential male mate choice under sperm competition
risk. Behavioral Ecology: aru037.
Reynolds, J. D. 1996. Animal breeding systems. Trends in Ecology & Evolution 11: 68-
72.
Reynolds, J. D. & Gross, M. R. 1992. Female mate preference enhances offspring growth
and reproduction in a fish, Poecilia reticulata. Proceedings of the Royal Society of
London B: Biological Sciences 250: 57-62.
Ribble, D. O. 1991. The monogamous mating system of Peromyscus californicus as
revealed by DNA fingerprinting. Behavioral Ecology and Sociobiology 29: 161-
166.
Rich, T. J. & Hurst, J. L. 1998. Scent marks as reliable signals of the competitive ability
of mates. Animal Behaviour 56: 727-735.
Robert, T. 1972. Parental investment and sexual selection. Sexual Selection & the
Descent of Man, Aldine de Gruyter, New York: 136-179.
Roberts, S. C. & Gosling, L. M. 2003. Genetic similarity and quality interact in mate
choice decisions by female mice. Nature genetics 35: 103-106.
Robertson, S. 2007. Seminal fluid signaling in the female reproductive tract: lessons from
rodents and pigs. Journal of Animal Science 85: E36-E44.
Rogers, D. W., Baldini, F., Battaglia, F., Panico, M., Dell, A., Morris, H. R. &
Catteruccia, F. 2009. Transglutaminase-mediated semen coagulation controls
sperm storage in the malaria mosquito. PLoS Biol 7: e1000272.
Rohland, N. & Reich, D. 2012. Cost-effective, high-throughput DNA sequencing
libraries for multiplexed target capture. Genome Res 22: 939-46.
Ross, P. & Crews, D. 1977. Influence of the seminal plug on mating behaviour in the
garter snake.
Rubenstein, D. I. 1984. Resource acquisition and alternative mating strategies in water
striders. American Zoologist 24: 345-353.
Rubinstein, C. D. & Wolfner, M. F. 2013. Drosophila seminal protein ovulin mediates
ovulation through female octopamine neuronal signaling. Proceedings of the
National Academy of Sciences 110: 17420-17425.
96
Rülicke, T., Chapuisat, M., Homberger, F. R., Macas, E. & Wedekind, C. 1998. MHC-
genotype of progeny influenced by parental infection. Proceedings of the Royal
Society of London B: Biological Sciences 265: 711-716.
Schalkwyk, L. C., Jung, M., Daser, A., Weiher, M., Walter, J., Himmelbauer, H. &
Lehrach, H. 1999. Panel of microsatellite markers for whole-genome scans and
radiation hybrid mapping and a mouse family tree. Genome research 9: 878-887.
Schantz, T., Wittzell, H., Göransson, G. & Grahn, M. 1997. Mate choice, male
condition ‐dependent ornamentation and MHC in the pheasant. Hereditas 127:
133-140.
Schill, W. 1975. [Significance of proteolytic sperm enzymes for the fertility]. Der
Hautarzt; Zeitschrift fur Dermatologie, Venerologie, und verwandte Gebiete 26:
514-523.
Schneider, C. A., Rasband, W. S. & Eliceiri, K. W. 2012. NIH Image to ImageJ: 25 years
of image analysis. Nat Methods 9: 671-5.
Schultz, N., Hamra, F. K. & Garbers, D. L. 2003. A multitude of genes expressed solely
in meiotic or postmeiotic spermatogenic cells offers a myriad of contraceptive
targets. Proceedings of the National Academy of Sciences 100: 12201-12206.
Schwartz, J. M., McCracken, G. F. & Burghardt, G. M. 1989. Multiple paternity in wild
populations of the garter snake, Thamnophis sirtalis. Behavioral Ecology and
Sociobiology 25: 269-273.
Searle, J. B. 1990. Evidence for multiple paternity in the common shrew (Sorex araneus).
Journal of Mammalogy 71: 139-144.
Shapiro, L. E. & Dewsbury, D. A. 1986. Male dominance, female choice and male
copulatory behavior in two species of voles (Microtus ochrogaster and Microtus
montanus). Behavioral Ecology and Sociobiology 18: 267-274.
Sharma, R. K., Pasqualotto, F. F., Nelson, D. R., Thomas, A. J. & Agarwal, A. 1999. The
reactive oxygen species—total antioxidant capacity score is a new measure of
oxidative stress to predict male infertility. Human Reproduction 14: 2801-2807.
Shine, R., Olsson, M. M. & Mason, R. T. 2000. Chastity belts in gartersnakes: the
functional significance of mating plugs. Biological Journal of the Linnean Society
70: 377-390.
Siepielski, A. M., DiBattista, J. D. & Carlson, S. M. 2009. It's about time: the temporal
dynamics of phenotypic selection in the wild. Ecol Lett 12: 1261-76.
Silver, L. 1995. Mouse genetics: concepts and applications. Oxford University Press.
97
Simmons, L. W. 2001. Sperm competition and its evolutionary consequences in the
insects. Princeton University Press.
Slatyer, R. A., Mautz, B. S., Backwell, P. R. Y. & Jennions, M. D. 2012. Estimating
genetic benefits of polyandry from experimental studies: a meta-analysis.
Biological Reviews 87: 1-33.
Snow, L. S., Abdel ‐Mesih, A. & Andrade, M. C. 2006. Broken Copulatory Organs are
Low ‐Cost Adaptations to Sperm Competition in Redback Spiders. Ethology
112: 379-389.
Snyder, R. L. (1967) Fertility and reproductive performance of grouped male mice. In:
Comparative aspects of reproductive failure, (Benirschke, K., ed.). pp. 458-472.
Springer-Verlag, New York.
Stockard, C. R. & Papanicolaou, G. N. 1919. The vaginal closure membrane, copulation,
and the vaginal plug in the guinea-pig, with further considerations of the œstrous
rhythm. The Biological Bulletin 37: 222-245.
Stockley, P. 1997. Sexual conflict resulting from adaptations to sperm competition.
Trends in Ecology & Evolution 12: 154-159.
Stockley, P., Gage, M., Parker, G. & Møller, A. 1997. Sperm competition in fishes: the
evolution of testis size and ejaculate characteristics. The American Naturalist 149:
933-954.
Stockley, P., Ramm, S. A., Sherborne, A. L., Thom, M. D., Paterson, S. & Hurst, J. L.
2013. Baculum morphology predicts reproductive success of male house mice
under sexual selection. BMC biology 11: 66.
Stone, G. N. 1995. Female foraging responses to sexual harassment in the solitary
beeAnthophora plumipes. Animal Behaviour 50: 405-412.
Su, A. I., Cooke, M. P., Ching, K. A., Hakak, Y., Walker, J. R., Wiltshire, T., Orth, A. P.,
Vega, R. G., Sapinoso, L. M. & Moqrich, A. 2002. Large-scale analysis of the
human and mouse transcriptomes. Proceedings of the National Academy of
Sciences 99: 4465-4470.
Su, A. I., Wiltshire, T., Batalov, S., Lapp, H., Ching, K. A., Block, D., Zhang, J., Soden,
R., Hayakawa, M. & Kreiman, G. 2004. A gene atlas of the mouse and human
protein-encoding transcriptomes. Proceedings of the National Academy of
Sciences of the United States of America 101: 6062-6067.
Suhm, M., Thaler, K. & Alberti, G. 1996. Glands in the male palpal organ and the origin
of the mating plug in Amaurobius species (Araneae: Amaurobiidae). Zoologischer
Anzeiger 234: 191-199.
98
Sutter, A., Simmons, L. W., Lindholm, A. K. & Firman, R. C. 2015. Function of
copulatory plugs in house mice: mating behavior and paternity outcomes of rival
males. Behavioral Ecology: arv138.
Swanson, W. J. & Vacquier, V. D. 2002. The rapid evolution of reproductive proteins.
Nat Rev Genet 3: 137-144.
Taborsky, M. 1998. Sperm competition in fish:bourgeois' males and parasitic spawning.
Trends in Ecology & Evolution 13: 222-227.
Testa, G., Schaft, J., van der Hoeven, F., Glaser, S., Anastassiadis, K., Zhang, Y.,
Hermann, T., Stremmel, W. & Stewart, A. F. 2004. A reliable lacZ expression
reporter cassette for multipurpose, knockout ‐first alleles. genesis 38: 151-158.
Thaler, C. 1989. Immunological role for seminal plasma in insemination and pregnancy.
American Journal of Reproductive Immunology 21: 147-150.
Toner, J. P., Attas, A. I. & Adler, N. T. 1987. Transcervical sperm transport in the rat: the
roles of pre-ejaculatory behavior and copulatory plug fit. Physiology & behavior
39: 371-375.
Tregenza, T. & Wedell, N. 1998. Benefits of multiple mates in the cricket Gryllus
bimaculatus. Evolution: 1726-1730.
Tregenza, T. & Wedell, N. 2000. Genetic compatibility, mate choice and patterns of
parentage: invited review. Molecular Ecology 9: 1013-1027.
Tseng, H.-C., Tang, J.-B., Sudhakar Gandhi, P., Luo, C.-W., Ou, C.-M., Tseng, C.-J.,
Lin, H.-J. & Chen, Y.-H. 2011. Mutual adaptation between mouse
transglutaminase 4 and its native substrates in the formation of copulatory plug.
Amino Acids 42: 951-960.
Uhl, G., Nessler, S. H. & Schneider, J. M. 2010. Securing paternity in spiders? A review
on occurrence and effects of mating plugs and male genital mutilation. Genetica
138: 75-104.
Voss, R. 1979. Male accessory glands and the evolution of copulatory plugs in rodents.
Wade, C. M., Kulbokas, E. J., Kirby, A. W., Zody, M. C., Mullikin, J. C., Lander, E. S.,
Lindblad-Toh, K. & Daly, M. J. 2002. The mosaic structure of variation in the
laboratory mouse genome. Nature 420: 574-578.
Wai-Sum, O., Chen, H. & Chow, P. 2006. Male genital tract antioxidant enzymes—their
ability to preserve sperm DNA integrity. Molecular and cellular endocrinology
250: 80-83.
Wallach, S. J. R. & Hart, B. L. 1983. The role of the striated penile muscles of the male
rat in seminal plug dislodgement and deposition. Physiol Behav 31: 815-821.
99
Wedell, N., Gage, M. J. G. & Parker, G. A. 2002. Sperm competition, male prudence and
sperm-limited females. Trends in Ecology & Evolution 17: 313-320.
Wigby, S., Sirot, L. K., Linklater, J. R., Buehner, N., Calboli, F. C., Bretman, A.,
Wolfner, M. F. & Chapman, T. 2009. Seminal fluid protein allocation and male
reproductive success. Current Biology 19: 751-757.
Williams-Ashman, H. G. 1984. Transglutaminases and the clotting of mammalian
seminal fluids. Mol Cell Biochem 58: 51-61.
Wolfner, M. F. 1997. Tokens of love: functions and regulation of Drosophila male
accessory gland products. Insect biochemistry and molecular biology 27: 179-
192.
Wolfner, M. F. 2002. The gifts that keep on giving: physiological functions and
evolutionary dynamics of male seminal proteins in Drosophila. Heredity 88: 85-
93.
Wong, A., Turchin, M. C., Wolfner, M. F. & Aquadro, C. F. 2008. Evidence for positive
selection on Drosophila melanogaster seminal fluid protease homologs. Mol Biol
Evol 25: 497-506.
Wong, K., Bumpstead, S., Van Der Weyden, L., Reinholdt, L. G., Wilming, L. G.,
Adams, D. J. & Keane, T. M. 2012. Sequencing and characterization of the
FVB/NJ mouse genome. Genome Biol 13: R72.
Yamaguchi, M., Yamazaki, K., Beauchamp, G., Bard, J., Thomas, L. & Boyse, E. 1981.
Distinctive urinary odors governed by the major histocompatibility locus of the
mouse. Proceedings of the National Academy of Sciences 78: 5817-5820.
Yamazaki, K., Beauchamp, G., Curran, M., Bard, J. & Boyse, E. 2000. Parent–progeny
recognition as a function of MHC odortype identity. Proceedings of the National
Academy of Sciences 97: 10500-10502.
Yamazaki, K., Beauchamp, G. K., Kupniewski, D., Bard, J., Thomas, L. & Boyse, E.
1988. Familial imprinting determines H-2 selective mating preferences. Science
240: 1331-1332.
Yamazaki, K., Boyse, E., Mike, V., Thaler, H., Mathieson, B., Abbott, J., Boyse, J.,
Zayas, Z. & Thomas, L. 1976. Control of mating preferences in mice by genes in
the major histocompatibility complex. The Journal of experimental medicine 144:
1324-1335.
Yamazaki, K., Yamaguchi, M., Andrews, P., Peake, B. & Boyse, E. 1978. Mating
preferences of F2 segregants of crosses between MHC-congenic mouse strains.
Immunogenetics 6: 253-259.
100
Young, B., Conti, D. V. & Dean, M. D. 2013. Sneaker “jack” males outcompete
dominant “hooknose” males under sperm competition in Chinook salmon
(Oncorhynchus tshawytscha). Ecology and evolution 3: 4987-4997.
Zeh, J. A. 1997. Polyandry and enhanced reproductive success in the harlequin-beetle-
riding pseudoscorpion. Behavioral Ecology and Sociobiology 40: 111-118.
Zeh, J. A. & Zeh, D. W. 2001. Reproductive mode and the genetic benefits of polyandry.
Anim Behav 61: 1051-1063.
Zhu, J., Massey, J. B., Mitchell-Leef, D., Elsner, C. W., Kort, H. I. & Roudebush, W. E.
2006. Platelet-activating factor acetylhydrolase activity affects sperm motility and
serves as a decapacitation factor. Fertility and sterility 85: 391-394.
Zuk, M., Thornhill, R., Ligon, J. D., Johnson, K., Austad, S., Ligon, S. H., Thornhill, N.
W. & Costin, C. 1990. The role of male ornaments and courtship behavior in
female mate choice of red jungle fowl. American Naturalist: 459-473.

Asset Metadata

Creator Mangels, Rachel (author)

Core Title Male-female conflict after mating: function and dynamics of the copulatory plug in mice (Mus domesticus)

Contributor Electronically uploaded by the author (provenance)

School College of Letters, Arts and Sciences

Degree Doctor of Philosophy

Degree Program Molecular Biology

Publication Date 04/19/2016

Defense Date 03/23/2016

Publisher University of Southern California (original), University of Southern California. Libraries (digital)

Tag copulatory plug,OAI-PMH Harvest,sexual conflict,sexual selection

Format application/pdf (imt)

Language English

Advisor Dean, Matthew (committee chair), Conti, David (committee member), Nuzhdin, Sergey (committee member)

Creator Email mangels@usc.edu,rachel.mangels@gmail.com

Permanent Link (DOI) https://doi.org/10.25549/usctheses-c40-233608

Unique identifier UC11277999

Identifier etd-MangelsRac-4296.pdf (filename),usctheses-c40-233608 (legacy record id)

Legacy Identifier etd-MangelsRac-4296.pdf

Dmrecord 233608

Document Type Dissertation

Format application/pdf (imt)

Rights Mangels, Rachel

Type texts

Source University of Southern California (contributing entity), University of Southern California Dissertations and Theses (collection)

Access Conditions The author retains rights to his/her dissertation, thesis or other graduate work according to U.S. copyright law. Electronic access is being provided by the USC Libraries in agreement with the a...

Repository Name University of Southern California Digital Library

Repository Location USC Digital Library, University of Southern California, University Park Campus MC 2810, 3434 South Grand Avenue, 2nd Floor, Los Angeles, California 90089-2810, USA

Abstract (if available)

Abstract Sexual selection is a strong evolutionary force affecting numerous aspects of reproduction. In many internally fertilizing species, females mate with multiple males during a reproductive cycle, leading to sperm competition. Although multiple mating likely benefits females, it decreases any one male’s potential for reproductive success, resulting in sexual conflict over remating. Consistent with this hypothesis of sexual conflict, males of many species have evolved countermeasures to prevent multiple mating. Chapter 1 introduces these countermeasures, and the resulting conflict over female remating, focusing on the male derived copulatory plug. In mice (Mus domesticus), a male’s seminal fluid coagulates inside of the female’s vaginal-cervical space to form a copulatory plug. The copulatory plug has multiple proposed functions, but a large body of research suggests that this structure evolved as a male’s defensive adaptation to sperm competition to impede future mating opportunities for females. ❧ The research-based chapters of this thesis quantify the copulatory plug’s role in preventing female remating and investigate the influence of sexual conflict on copulatory plug dynamics. In Chapter 2, I use a one-female-two-male serial mating design to quantify the role of the copulatory plug in mate guarding. By using a knockout model that is unable to form a copulatory plug, I am able to directly and noninvasively determine the effectiveness of copulatory plug for the first time, showing that the second male sired significantly fewer pregnancies when the first male could form a copulatory plug. This chapter is currently in review at the journal Evolution. ❧ Although chapter 2 shows the plug has a strong effect on female remating, it remained unknown whether the efficacy of the plug varied across male and female genotypes. Chapter 3 contains the first systematic examination of copulatory plug dynamics in mice, which is key to understanding the phenotypic and genetic bases of copulatory plug breakdown. Using 8 genetically distinct strains of males and 2 genetically distinct female genotypes of house mice (Mus domesticus), I uncovered significant influence of male genotype on the length of time that the copulatory plug remained intact in the female’s reproductive tract. Counter intuitively, males that produced small plugs tended to produce long-lasting plugs, potentially providing insight into the mechanisms by which females clear them. This chapter has been published as a research article in Heredity. ❧ In Chapter 4, I investigated whether females adjusted plug clearance according to whether they mated with preferred or unpreferred males. A model of sexual conflict predicts that females will clear plugs more rapidly when mated to unpreferred males, especially when pre-exposed to the scents of both preferred and unpreferred males. I did not find support for these predictions, and discuss potential reasons why. In Chapter 5, I place my results in the context of future experiments that will aid our understanding of the fitness implications of the variation observed and highlight the importance of studying the effect of seminal fluid after mating.