University of Southern California Dissertations and Theses

Novel roles of the WDR23-DDB1-CUL4 ubiquitin ligase complex in cytoprotection

(USC Thesis Other)

Novel roles of the WDR23-DDB1-CUL4 ubiquitin ligase complex in cytoprotection

PDF

Download

Open document

Flip pages

Download a page range

Download transcript

Copy asset link

Request this asset

Transcript (if available)

Content

NOVEL ROLES OF THE WDR23-DDB1-CUL4
UBIQUITIN LIGASE COMPLEX IN CYTOPROTECTION
by
Jacqueline Yachiee Lo

A Dissertation Presented To The
FACULTY OF THE USC GRADUATE SCHOOL
UNIVERSITY OF SOUTHERN CALIFORNIA
In Partial Fulfillment Of The
Requirements For The Degree
DOCTOR OF PHILOSOPHY
MOLECULAR BIOLOGY

May 2016

Copyright 2016 Jacqueline Yachiee Lo

iii
Dedication
To my parents, Wenshen and Bihyun Lo, and my sister, Katherine, for their love,
encouragement, and support.

iv
Acknowledgements
First and foremost, I would like to thank my advisor, Dr. Sean Curran, for his
support and guidance during my time at USC. I’m incredibly grateful for the time I’ve
spent learning from you; thank you for your patience, your excitement, your advice, your
encouragement. You are an amazing scientist and mentor, and just a wonderful person
to be around overall. You are someone who inspires me, and I hope to achieve the
same qualities that I admire in you as I continue to grow as a scientist.
I would like to thank my current and former committee members: Drs. John
Tower, Matthew Michael, Michael Stallcup, Xuelin Wu, and Derek Sieburth. Your advice
and guidance during my oral exam, committee meetings, and throughout my time here
in general have been invaluable to my Ph.D. career.
The Curran Lab is made up of the most incredible and awesome group of people
that I’m happy to call my second family. Thank you to all current and former members:
Lori Thomas, Jennifer Paek, Akshat Khanna, Tammy Nguyen, Shanshan Pang, Emily
Griffin, Megan Bernstein, Elaine Roh, Dana Lynn, Hans Dalton, Meagan He, Jeremy
Dietrich, Andy Ixtlahuac, Maximilian Cabaj, Ajay Pradhan, Chia-An Yen, Brett Spatola,
and Hanna Kiani. I would also like to include frequent visitors of the Curran Lab: Hank
Cheng and Wilber Escorcia. You guys have been such great friends and are part of the
reason why I love coming to lab everyday. Thank you all for the science pow-wows and
troubleshooting, reading and editing my writing, listening to every practice talk, assisting
v
with lab experiments, and most of all, for the jokes, laughter, and stories. We are truly a
unique group of people.
Last, but certainly not least, I would like to thank my husband, Mu Jing, for being
by my side through this whole thing. Grad school probably would have been a lot harder
without your support. Thank you for hanging out with me in lab and bringing me food
when I had to be there on the weekends, and the early mornings, and the late nights.
Thank you for using your fancy computer tricks to help me organize and analyze some
of my data. Thanks for doing all my lab dishes! You made my life easier when you could
so that I could focus on the science thing, and I just can’t thank you enough.
The work in this dissertation could not have been possible without the support of
everyone mentioned, and for that, I am eternally grateful.

vi
List of Tables and Figures
Chapter 1
Figure 1: Phylogenetic tree for Nrf family ....................................................................... 12
Figure 2: Schematic of Neh domains in NRF2 ................................................................ 13
Figure 3: Model of regulation of SKN-1/NRF2 ................................................................ 14
Figure 4: Alignment of WDR23/DCAF11 ........................................................................ 15
Chapter 2
Figure 1: WDR23 is an ancient regulator of NRF2 ......................................................... 44
Figure 2: CUL4-WDR23 regulates NRF2 stability ........................................................... 45
Figure 3: WDR23 regulates NRF2 independently of KEAP1 .......................................... 46
Figure 4: WDR23 restores NRF2 regulation in cancer cells ........................................... 47
Supplementary Figure 1: WDR23 is a conserved protein ............................................... 48
Supplementary Figure 2: Specificity of impact of WDR23 in NRF2 cytoprotection ......... 49
Supplementary Figure 3: Control experiments for Co-IP experiments ........................... 50
Supplementary Figure 4: WDR23 expression reduces NRF2 ........................................ 51
Supplementary Figure 5: Persistence of WDR23-dependent regulation of NRF2 during
stress .............................................................................................................................. 52
vii
Supplementary Figure 6: ID of conserved domains in WDR23 by C. elegans genetic
screens ........................................................................................................................... 53
Supplementary Figure 7: Mutations in WDR23 alter subcellular localization .................. 54
Supplementary Figure 8: The interaction of WDR23 with NRF2 is dependent on the
Neh2 domain .................................................................................................................. 55
Supplementary Figure 9: WDR23 binding of NRF2 is independent of KEAP1 ............... 56
Supplementary Figure 10: Deregulation of WDR23 in human somatic tumors .............. 57
Supplementary Table 1: RNAi efficiencies ..................................................................... 58
Supplementary Table 2: C. elegans wdr-23 mutants ...................................................... 59
Supplementary Table 3: DWD-box motif homology ........................................................ 60
Supplementary Table 4: COSMIC Database analysis of WDR23 mutations and
expression ...................................................................................................................... 61
Supplementary Table 5: qPCR primer sequences .......................................................... 62
Chapter 3
Figure 1: Identification of novel interactors of CeWDR-23 .............................................. 79
Figure 2: CeGEN-1 is a direct interactor of CeWDR-23 ................................................. 80
Figure 3: The glycine at position 460 in CeWDR-23 is essential for interaction with
CeGEN-1 ........................................................................................................................ 81
viii
Figure 4: The GEN1 and WDR23 interaction is conserved in humans ........................... 82
Table 1: Best BLASTP matches ..................................................................................... 83
Supplementary Figure 1: Control experiment for WDR-23/GEN-1 Co-IP experiment .... 84

ix
Abbreviations
ABCC1: ATP-Binding Cassette, Sub-Family C (CFTR/MRP), Member 1
ACADL: Acyl-CoA Dehydrogenase, Long Chain
ACADM: Acyl-CoA Dehydrogenase, C-4 To C-12 Straight Chain
ACADS: Acyl-CoA Dehydrogenase, C-2 To C-3 Short Chain
ARE: Antioxidant Response Element
C. elegans: Caenorhabditis elegans
CNC: Cap ‘n’ Collar
Co-IP: Co-Immunoprecipitation
COSMIC: Catalogue of Somatic Mutations in Cancer
CUL4/CUL-4: Cullin 4
CUL3: Cullin 3
CPT1A1: Carnitine Palmitoyltransferase 1A
CYP1A1: Cytochrome P450, Family 1, Subfamily A, Polypeptide 1
CYP3A4: Cytochrome P450, Family 3, Subfamily A, Polypeptide 4
CYP4A11: Cytochrome P450, Family 4, Subfamily A, Polypeptide 11
DCAF11: DDB1 And CUL4 Associated Factor 11
x
DDB1/DDB-1: Damage-Specific DNA Binding Protein 1
E. coli: Escherichia coli
EMS: Ethyl methanesulfonate
ERCC5: Excision Repair Cross-Complementation Group 5
GCLC: Glutamate-Cysteine Ligase, Catalytic Subunit
GCLM: Glutamate-Cysteine Ligase, Modifier Subunit
GEN1/GEN-1: GEN1 Holliday Junction 5’ Flap Endonuclease
GFP: Green Fluorescent Protein
GSR: Glutathione Reductase
GSTA1: Glutathione S-Transferase Alpha 1
HhH2: Helix-hairpin-helix
HO-1: Heme Oxygenase
H. sapiens: Homo sapiens
KEAP1: Kelch-Like ECH-Associated Protein 1
Neh: Nrf2-ECH homology
NQO1: NAD(P)H Dehydrogenase, Quinone 1
NFE2L1/NRF1: Nuclear Factor, Erythroid 2-Like 1
xi
NFE2L2/NRF2: Nuclear Factor, Erythroid 2-Like 2
NFE2L3/NRF3: Nuclear Factor, Erythroid 2-Like 3
PRDX1: Peroxiredoxin 1
qPCR: Quantitative Polymerase Chain Reaction
ROS: Reactive Oxygen Species
RNAi: RNA Interference
siRNA: Small Interfering RNA
SKN-1: SKiNhead 1
tBHQ: tert-Butylhydroquinone
WDR23/WDR-23: WD Repeat-Containing Protein 23
Y2H: Yeast 2-Hybrid

xii
Abstract
Throughout its lifespan, an organism will encounter several sources of stress,
both endogenous and environmental, that will challenge its system to respond
appropriately in order to defend against damage and to restore homeostasis. As the
organism ages, its ability to properly activate such pathways will decline; this
deterioration in the response system contributes to the aging process. At the cellular
level, there exists a diverse set of pathways that all have intricate individual molecular
mechanisms, but also all work together to protect the cell and ultimately, the organism.
Elucidating how these pathways are regulated is critical to our understanding of human
health and disease.
Many cellular functions require proper proteostasis and protein turnover in order
to perform appropriately. The proteasome exists in cells to assist in this process by
degrading proteins that are damaged, mis-folded, or aggregated, as well as proteins
that are no longer necessary. WDR23 is a member of this proteasome system; it acts as
the substrate receptor in the cullin E3 ubiquitin ligase complex. While the identification
of this complex has been discovered in several species, its target substrates are largely
unknown, especially in humans.
In C. elegans, WDR-23 has been identified as the negative regulator for SKN-1,
the transcription factor that responds to oxidative stress. WDR-23 delivers SKN-1 to the
proteasome for degradation during homeostatic conditions. NRF2 is the homologous
transcription factor in humans, and the regulation of this pathway is mechanistically
xiii
similar. However, a structurally different protein, KEAP1, mediates this process.
Intriguingly, there exists a WDR23 in the human genome. Here we have identified a role
of WDR23 in the regulation of NRF2 that is independent of the canonical KEAP1
pathway. WDR23 is able to suppress NRF2 activity, and additionally, can turn-off NRF2
after it has been activated, such as in a stressed state or when KEAP1 is absent. The
latter is particularly interesting because many cancers result from deregulated and
activated NRF2 signaling. We demonstrate that increased expression of WDR23 is able
to restore NRF2 protein in lung carcinoma cell lines, where NRF2 is highly active.
We have also screened for roles outside of the oxidative stress response for
WDR23 and have identified a list of potential binding partners. Through this screen, we
have confirmed GEN1 to be a novel interactor of WDR23. GEN1 is a Holliday junction
resolvase that facilitates repair of double-strand breaks and plays a role in DNA damage
signaling. We have identified an additional cytoprotective pathway that we believe
WDR23 is involved in, as GEN1 is a member of one of the DNA damage response
pathways. Together with our results that identify WDR23 as a regulator of NRF2 activity,
we have uncovered novel roles for WDR23 in multiple cytoprotective pathways.

!
!
Table of Contents
Approval of Dissertation .................................................................................................... ii
Dedication ........................................................................................................................ iii
Acknowledgements .......................................................................................................... iv
List of Tables and Figures ............................................................................................... vi
Abbreviations ................................................................................................................... ix
Abstract ........................................................................................................................... xii

Chapter 1 ......................................................................................................................... 1
Introduction
1.1 Organismal stress response and survival ................................................................ 1
1.2 Nrf family of transcription factors ............................................................................. 2
1.3 Regulation of SKN-1/NRF2 via the proteasome system .......................................... 4
1.4 WDR23 is the substrate receptor protein in a E3 ubiquitin ligase complex .............. 6
1.5 Oxidative stress and cellular detoxification .............................................................. 7
1.6 Non-detoxification roles of SKN-1/NRF2 .................................................................. 8
1.7 NRF2 in cancer prevention ...................................................................................... 9
1.8 NRF2 in cancer promotion ..................................................................................... 10
1.9 Significance ............................................................................................................ 11
1.10 Figures ................................................................................................................... 12
1.11 References ............................................................................................................. 16

!

Chapter 2 ....................................................................................................................... 24
WDR23 is an ancient regulator of NRF2-dependent cytoprotection in humans
2.1 Abstract .................................................................................................................. 24
2.2 Introduction ............................................................................................................ 25
2.3 Results ................................................................................................................... 27
2.4 Discussion .............................................................................................................. 37
2.5 Methods ................................................................................................................. 38
2.6 Acknowledgements ................................................................................................ 43
2.7 Figures ................................................................................................................... 44
2.8 References ............................................................................................................. 63

Chapter 3 ...................................................................................................................... 69
Identification of GEN-1 as a novel binding partner for WDR-23
3.1 Abstract .................................................................................................................. 69
3.2 Introduction ............................................................................................................ 69
3.3 Results ................................................................................................................... 71
3.4 Discussion .............................................................................................................. 74
3.5 Methods ................................................................................................................. 75
3.6 Acknowledgements ................................................................................................ 78
3.7 Figures ................................................................................................................... 79
3.8 References ............................................................................................................. 85
!
1
Chapter 1
All organisms are frequently exposed to stress, both from endogenous and
environmental sources. At the cellular level, pathways exist to combat stress in order to
restore homeostasis. Although these pathways are quick to activate when needed, they
are not perpetually active. While it is logical to reason that a cell with active defense
mechanisms is more suitable to survive stress exposure, this comes at a cost. For
instance, it costs energy to keep these pathways on; utilizing energy here may take
away resources needed for normal cellular function. Additionally, if a loss of regulation
leaves the pathway in a perpetually activated state, it is not surprising to observe both a
deregulation of cell death pathways and dampening of response with increasing stress,
both of which are detrimental to cell survival. Cancerous cells often proliferate in this
situation, exploiting these increased survival mechanisms to persist through unfavorable
conditions. Thus, these stress response pathways must be diverse, specific, and well-
regulated. Understanding the molecular mechanisms regulating these stress response
pathways greatly contributes to the understanding of human health and disease, and
identifying novel regulatory mechanisms for specific cytoprotective pathways provide
opportunities to reestablish homeostasis when such pathways are deregulated.
1.1 Organismal stress response and survival
Exposure to the noxious events from environmental and endogenous sources
elicits a defensive response from the targeted organism. The ability to respond and
react to these stimuli by the organism is a culmination of the capacity of its molecular
!
2
pathways at the cellular level. Our understanding of these molecular mechanisms has
allowed us to hone in on many specific responses in several different organisms, all of
which contribute to our understanding of human health and disease. Many of these
stress response pathways are organelle-specific; the mitochondrial unfolded protein
response (mito UPR)
1–3
and the endoplasmic reticulum UPR (ER UPR)
4–6
assist mis-
folded proteins in the respective organelles, and nuclear DNA damage can elicit a family
of repair pathways (base-excision repair, nucleotide-excision repair, non-homologous
end-joining, homologous recombination) depending on the specific type of impairment
7
.
Proteostasis is monitored by heat-shock factors (HSFs) and proteins (HSPs)
8–11
, which
chaperone unstable proteins in the cell, but can also utilize the ubiquitin-proteasome
system if damage becomes too great
12–14
. There are also surveillance pathways in
place to respond to metabolic changes; the insulin/IGF-1 and TOR signaling pathways
are well-studied mechanisms in this category
15,16
. Many of these pathways have been
examined in multiple organisms, ranging from single-celled eukaryotic yeast to
invertebrates to mammals
17
. Understanding exactly when and how these pathways
activate is critical to our understanding of the capacity of these pathways to function
properly as we age.
1.2 Nrf family of transcription factors
One critical stress pathway involves the transcription factor NRF2/NFE2L2
(Nuclear Factor E2-related Factor), which is central to the oxidative stress response
18
.
Oxidative stress refers to imbalances in reactive oxygen species (ROS) within a cell that
can damage proteins and disrupt the integrity of cellular components. In the presence of
!
3
oxidative stress, NRF2 is able to turn on genes necessary to detoxify and defend the
cell
19
. NRF2 is an exceptionally well-conserved transcription factor and belongs to a
bZIP (basic leucine zipper) family of transcription factors that share the CNC
(cap’n’collar) domain
18
(Fig. 1). In the nematode C. elegans, this transcriptional
regulator is named SKN-1, of which there are four isoforms
20
. While the functions of
SKN-1A and the newly identified SKN-1D have yet to be elucidated, SKN-1B is
expressed in ASI neurons and mediates lifespan extension in response to dietary
restriction
21
, and SKN-1C is required for oxidative stress resistance and contributes to
longevity with reduced insulin/insulin-like signaling
22
. Aside from mammalian NRF2,
there also exist NRF1, NRF3, and NF-E2 in the same family. NRF1 is ubiquitously
expressed, similar to NRF2, while NRF3 expression is restricted to the placenta and
liver tissues, and NF-E2 is only expressed in erythrocytes. All four NRFs contribute to
ARE (antioxidant response element) activation
23–26
(discussed in Section 1.6). NRF1, in
addition to its roles in oxidative stress, also has roles in embryonic development
27
.
Besides the CNC domain of the protein, SKN-1 and its CNC family members also share
a common fourteen amino acid motif in the N-terminal region named DIDLID
28
. While
not much is known about the requirement for this domain, its conservation hints at a
potential importance, as it has been shown in worms to be necessary for activation of
SKN-1.
Other domains of importance in NRF2 include the six defined NRF2-ECH
homology (Neh) domains that have characterized functions associated with them (Fig.
2). Neh2 is the most N-terminal domain and is the site of KEAP1 binding (discussed
!
4
below)
29
. Neh4 and Neh5 are transactivation domains; specifically, CBP, a CREB
binding protein, activates transcription through these domains
30
. Neh6 is characterized
as a degron, as it has been implicated to be required for non-KEAP1 degradation of
NRF2
31
. Neh1 is the DNA binding domain and where the basic leucine zipper is
located
32
. Neh3 is the most C-terminal domain and has also been characterized as a
transactivation domain via CHD6, a chromo-ATPase/helicase DNA binding protein
33
.
Most recently, the region between Neh5 and Neh6 has been implicated as a new
domain, Neh7, and has been found to be required for repression of NRF2 activity,
specifically by retinoic X receptor α
34
.
It is important to note that SKN-1 in C. elegans was first identified to be essential
in embryogenesis. The gene skn-1 was first found to be a maternally deposited
transcript into new embryos; thus, while skn-1 mutants are viable, they are also sterile,
as they are unable to properly deposit skn-1 transcripts to their progeny. Its role in
embryogenesis involves tissue specification during the earliest stages of embryonic
development, specifically, development of the digestive system
35
. Notably, this is not too
dissimilar from the roles of NRF1 in embryogenesis identified in mice
27
.
1.3 Regulation of SKN-1/NRF2 via the proteasome system
One major contributor to maintenance of a healthy cell is proteostasis and the
turnover of proteins. The proteasome exists in cells to assist in this by degrading
proteins. The proteins that are turned over are usually mis-folded, aggregated, or
damaged, but turnover can also occur with unnecessary proteins
12–14
. These actions
!
5
help to maintain homeostasis in the cell. In particular, the turnover of unnecessary
proteins is highlighted in the situation of NRF2 turnover, as NRF2 is delivered to the
proteasome for degradation when it is not needed during a non-stressed state. In the
first step of this process, the E1 (ubiquitin-activating) enzyme activates ubiquitin, a small
regulatory protein that signals for degradation. The second step involves the transfer of
the ubiquitin to the E2 (ubiquitin-conjugating) enzyme. The last step is the final transfer
of the ubiquitin to the target protein mediated by the E3 (ubiquitin ligase) enzyme. There
are not many types of E1 and E2 enzymes, but the diversity of E3 ligases exists for
substrate specificity
36
. For instance, NRF2 degradation is mediated by the RING-finger
family of E3 ligases, and specifically, a complex of a cullin, receptor, and substrate
forms for the final delivery to the proteasome
37,38
.
Along with the high functional conservation of SKN-1 in worms and NRF2 in
mammals, the mechanism behind the regulation of this transcription factor in each
species is also functionally conserved (Fig. 3). In C. elegans, its negative regulator,
WDR-23, dictates SKN-1 activity and abundance. In homeostatic conditions, SKN-1
activity is maintained at low levels because WDR-23 brings it to the proteasome for
degradation. In the presence of oxidative stress, this regulation is relieved, and SKN-1 is
able to translocate into the nucleus in order to turn on genes required for detoxification,
leading to increased stress resistance
39
.
In mammals, the main regulation of NRF2 is mechanistically similar to that in
worms. NRF2 and its downstream targets are kept off in the absence of stress by its
negative regulator KEAP1 (Kelch-like ECH-associated protein 1). KEAP1 is a bric-a-
!
6
brac, tramtrack, broad complex (BTB) domain-containing protein. Similar to worm WDR-
23, KEAP1 facilitates the degradation of NRF2 through the proteasome
19,29,40
.
Surprisingly, the structures of these two proteins are dissimilar despite their shared
function. C. elegans do not have a KEAP1 protein in their genome, but humans have
retained WDR23 over evolutionary time, while also evolving the KEAP1 mechanism of
NRF2 regulation. Despite the remarkable conservation of human WDR23 to its worm
counterpart, and even in several other species, WDR23 function in humans has yet to
be elucidated.
1.4 WDR23 is the substrate receptor protein in an E3 ubiquitin ligase complex
WDR23 is a WD40-repeat protein, containing seven repeats of the tryptophan
aspartic acid (WD) containing motif; these repeats facilitate protein-protein interactions.
WDR23 functions as a substrate receptor for CUL4/DDB1 E3 ubiquitin ligase complex,
where CUL4 is the cullin and DDB1 (damaged DNA binding protein 1) is an adaptor
protein; it is also referred to as DCAF11: DDB1 and CUL4 Associated Factor 11 protein.
Formation of this complex is done through the DWD-box of WDR23, a highly conserved
region of this protein (Fig. 4)
41
. While formation of this complex with WDR23 has been
identified in worms and humans
39,42,43
, its target substrates are largely unknown,
especially in humans.
In C. elegans, WDR-23 also forms a E3 ubiquitin ligase complex with the C.
elegans homologs of the respective proteins, CUL-4 (cullin) and DDB-1 (adaptor)
39
. A
more fleshed-out role for WDR-23 has been identified in C. elegans. Its role in the
!
7
oxidative stress pathway was identified when it was observed that loss of WDR-23
results in nuclear accumulation of SKN-1, as well as an overall increase in the
abundance of SKN-1. Consequently, RNAi-mediated knockdown of wdr-23 in C.
elegans improves survival on xenobiotic stressors
39
. A role for WDR-23 in development
and lifespan has also been identified. In a screen for antagonistic pleiotropic genes,
where there is a requirement for proper development while dispensability post-
development results in longevity, wdr-23 was found to be in this class of genes
44
.
1.5 Oxidative stress and cellular detoxification
Oxidative stress refers to the imbalance of reactive oxygen species (ROS) in the
biological system. In humans, oxidative stress has been implicated in many diseases
and health issues. As such, there are systems in place that cells utilize to restore
homeostasis should they find themselves in such an imbalance. In fact, the interaction
of KEAP1 and NRF2 is sensitive to the redox state of the cell. Electrophilic stress
interferes with the cysteine residues in KEAP1 that are essential to maintain interaction
between the two proteins. When these cysteine residues are disrupted, NRF2 regulation
is relieved
45,46
. Subsequently, when NRF2 translocates into the nucleus to turn on the
appropriate genes, it does so by utilizing the antioxidant response element (ARE) that is
shared in the promoters of xenobiotic response genes
47
. In C. elegans, there is also a
binding site in target gene promoters that SKN-1 utilizes, although it differs from
mammalian ARE
48
. In order to respond properly to cellular stress, NRF2 regulates the
transcription of several classes of xenobiotic response genes that contain these ARE
elements in their promoters, including: glutathione homeostasis
49
, iron metabolism
50
,
!
8
drug metabolism
51
, multidrug resistance transporters
52
, and cellular energy
metabolism
53
. Upregulation of the expression of these genes assists in restoring cellular
homeostasis in the presence of xenobiotics.
1.6 Non-detoxification roles of SKN-1/NRF2
Aside from its initial and canonical role in detoxification and oxidative stress,
SKN-1/NRF2 has recently also been linked to other cytoprotective actions. Notably,
these include pathogenesis and immunity, proteasome regulation, and lipid metabolism.
The role of SKN-1/NRF2 in pathogenesis and immune response has been largely
studied in C. elegans through the use of a bacterial pathogen, Pseudomonas
aeruginosa. It was demonstrated that SKN-1 is required for pathogen resistance for the
worm and depends on the conserved p38 mitogen-activated protein kinase (MAPK)
cascade; the p38 MAPK ortholog PMK-1 phosphorylates SKN-1 to activate it in order for
nuclear translocation and transcription of appropriate genes to occur
54–56
.
Just as the proteasome system is important for the regulation of SKN-1/NRF2,
there also is a role for SKN-1/NRF2 in regulating proteasomal activity and proteostasis
in general
57
. SKN-1 increases the expression of several proteasome subunit genes, and
it does so when the proteasome is inhibited. This regulation holds true at the
mammalian level as well; both NRF1 and NRF2 respond to proteasomal stress by
upregulating proteasome genes
58–62
.
The newest sector of SKN-1/NRF2 research identifies a role for the transcription
factor in lipid metabolism. Upon the isolation of the first gain-of-function allele of skn-1 in
!
9
C. elegans, it was discovered that SKN-1 elicits a specific transcriptional response when
there is a change in available nutrients. Worms with the active skn-1 allele perceive a
state of starvation even in the presence of plentiful food. Their transcriptional profiling
reflects that of an active metabolism and adaptation to starvation. This response was
shown to be conserved in mice
63
. Additionally, SKN-1(gof) worms also display
enhanced expression of genes involved in fatty acid oxidation, and this appears to
protect the animals from fat accumulation when fed a high carbohydrate diet. This is
conserved at the mammalian level, as NRF2 is shown to have to capacity to regulate
several fatty acid oxidation genes
53
.
1.7 NRF2 in cancer prevention
From all the evidence and support listed above, NRF2 is a protector, defender,
and detoxifier for cells. In fact, research from the past few decades has centered on
exploiting the NRF2 pathway for cancer prevention. There have been numerous studies
that examine chemical activators of NRF2 as chemopreventive compounds, including:
sulforaphane (cruciferous vegetables)
64
, curcumin (commonly used spice)
65–67
,
epigallocatechin-3-gallate (EGCG, green tea)
68,69
, resveratrol (grapes)
70,71
, caffeic acid
phenethyl ester (conifer trees)
65
, wasabi (Japanese horseradish)
72
, cafestol and
kahweol (coffee)
73,74
, cinnamonyl-based compounds (cinnamon)
75
, zerumbone
(ginger)
76
, garlic organosulfur compounds (garlic)
77,78
, lycopene (tomato)
79
, carnosol
(rosemary)
80,81
, and avicins (Bentham plant)
82
. This long list only includes plant-derived
compounds, but there is also a list of synthetically synthesized chemicals that have
been examined
83–86
, and the list in its entirety is continuously growing.
!
10
1.8 NRF2 in cancer promotion
Intriguingly, emerging data in the recent decade has demonstrated NRF2 to be
more of a “Jekyll and Hyde” transcription factor in the context of cancer. While there
exists a large body of work demonstrating NRF2’s positive roles in fighting cancer, there
is now evidence that NRF2 can also assists in cancer progression, particularly in
cancers with dysfunctional KEAP1/NRF2 signaling. Notably, NRF2 has been shown to
be constitutively elevated in several cancer types, including: breast
87
, renal
88
,
esophageal
89,90
, gall bladder
91
, and most prominently, lung
92–94
. This is often due to
somatic mutations in NRF2 or KEAP1. In fact, several lung carcinoma cell lines utilized
for studies in lab settings contain KEAP1 mutations, including A549 (G333C), H450
(D236H), H1435 (L413R), and H838 (frameshift)
93
.
When comparing survival of the active-NRF2 carcinoma lines and non-cancerous
cell lines after treatment of chemotherapeutic drugs, the carcinoma lines fared much
better; this resistance to chemo drugs was due to the active NRF2, as either knockdown
of NRF2 or restoration of a wild-type KEAP1 is able to attenuate the survival of these
cancerous cell lines. In fact, these carcinoma lines with activated NRF2 displayed
increased expression of downstream target genes that are involved in stress response,
which is likely assisting in the protection of these cells from chemo drug-induced death
95
.
This should not be too surprising though; NRF2 is cytoprotective, and chemo drugs are
cytotoxic, meaning even cancer cells can benefit from this. The critical point to note here
is that restoration of the broken regulation of NRF2 and KEAP1 is required to prevent
NRF2 signaling from being cancer-promoting.
!
11
1.9 Significance
SKN-1/NRF2 is a multi-faceted transcription factor involved in many areas of
cellular cytoprotection across numerous organisms. Intriguingly, though NRF2 has many
positive contributions to the survival of a normal cell, there are cases when it can be
detrimental to organismal survival; for instance, when it is perpetually active in a
different state, such as when the cells are cancerous. Thus, the regulation of NRF2 is
particularly important, especially in the context of human health and disease. The
canonical NRF2 regulatory pathway in humans via KEAP1 is very well studied; however,
KEAP1 is structurally different than WDR-23, the protein C. elegans use in their
homologous pathway governed by SKN-1. Surprisingly, human WDR23 has not yet
been looked at in the context of NRF2 regulation. In fact, there is very little known about
human WDR23 besides its role as the substrate receptor for an E3 ubiquitin ligase
complex; no specific substrates have been identified for this complex. Here we examine
the role of human WDR23 in the NRF2 cytoprotective pathway, as well as identify new
potential substrates that may interact with WDR23.

!
12
1.10 Figures

Figure 1. Phylogenetic tree for Nrf family. The tree is based on the largest gap-free
block of aligned sequences and contains the DNA binding domains. SKN-1 (C. elegans),
CncC (D. melanogaster), Nrf and Bach proteins (mammals). Figure adapted from
Sykiotis and Bohmann, 2010
18
.

!
13

Figure 2. Schematic of Neh domains in NRF2. NRF2 contains six Neh domains, each
with a defined function. The Neh2 domain also contains three different motifs: DIDLID
(in human, mouse, and worm), DLG (in human and mouse only), and ETGE (in human
and mouse only). Multiple roles have been identified for NRF2/SKN-1, including redox
balance, detoxification, immune response, proteasome regulation, and lipid metabolism.

!
14

Figure 3. Model of regulation of SKN-1/NRF2. SKN-1 (C. elegans) and NRF2
(humans) levels are maintained during homeostasis through proteasomal degradation.
The transcription factor is delivered to the proteasome for turnover during unstressed
conditions. In worms, this is through the WDR-23/DDB-1/CUL-4 complex. In humans, a
similar mechanism occurs through the KEAP1/CUL3 complex. In the presence of stress,
this regulation is relieved and SKN-1/NRF2 is allowed to translocate into the nucleus to
initiate transcription of appropriate stress response genes.

!
15

Figure 4. Alignment of WDR23/DCAF11. Protein alignment of WDR23/DCAF11 in
several species was performed using ClustalW. % identity compared to Homo sapiens
is listed in the black box to the left of species name. WD repeats are highlighted in pink,
and the DWD box motif is marked.
!
16
1.11 References
1. Zhao, Q. et al. A mitochondrial specific stress response in mammalian cells.
EMBO J. 21, 4411–9 (2002).
2. Kuzmin, E. V, Karpova, O. V, Elthon, T. E. & Newton, K. J. Mitochondrial
respiratory deficiencies signal up-regulation of genes for heat shock proteins. J.
Biol. Chem. 279, 20672–7 (2004).
3. Yoneda, T. et al. Compartment-specific perturbation of protein handling activates
genes encoding mitochondrial chaperones. J. Cell Sci. 117, 4055–66 (2004).
4. Schröder, M. & Kaufman, R. J. The mammalian unfolded protein response. Annu.
Rev. Biochem. 74, 739–89 (2005).
5. Ron, D. & Walter, P. Signal integration in the endoplasmic reticulum unfolded
protein response. Nat. Rev. Mol. Cell Biol. 8, 519–29 (2007).
6. Hampton, R. Y. ER stress response: getting the UPR hand on misfolded proteins.
Curr. Biol. 10, R518–21 (2000).
7. Garinis, G. A., van der Horst, G. T. J., Vijg, J. & Hoeijmakers, J. H. J. DNA
damage and ageing: new-age ideas for an age-old problem. Nat. Cell Biol. 10,
1241–7 (2008).
8. Ben-zvi, A., Miller, E. a & Morimoto, R. I. Collapse of proteostasis represents an
early molecular event in Caenorhabditis elegans aging. Proc. Natl. Acad. Sci. U. S.
A. 106, 14914–14919 (2009).
9. Sóti, C. & Csermely, P. Molecular chaperones and the aging process.
Biogerontology 1, 225–33 (2000).
10. Macario, A. J. L. & Conway de Macario, E. Sick chaperones, cellular stress, and
disease. N. Engl. J. Med. 353, 1489–501 (2005).
11. Morrow, G. & Tanguay, R. M. Heat shock proteins and aging in Drosophila
melanogaster. Semin. Cell Dev. Biol. 14, 291–9 (2003).
12. Wong, E. & Cuervo, A. M. Integration of clearance mechanisms: the proteasome
and autophagy. Cold Spring Harb. Perspect. Biol. 2, a006734 (2010).
13. Tanaka, K. & Matsuda, N. Proteostasis and neurodegeneration: the roles of
proteasomal degradation and autophagy. Biochim. Biophys. Acta 1843, 197–204
(2014).
14. Finley, D. Recognition and Processing of Ubiquitin-Protein Conjugates by the
Proteasome. Annu. Rev. Biochem. 78, 477–513 (2009).
!
17
15. Rincon, M., Muzumdar, R., Atzmon, G. & Barzilai, N. The paradox of the
insulin/IGF-1 signaling pathway in longevity. Mech. Ageing Dev. 125, 397–403
(2004).
16. Wullschleger, S., Loewith, R. & Hall, M. N. TOR signaling in growth and
metabolism. Cell 124, 471–84 (2006).
17. Kenyon, C. J. The genetics of ageing. Nature 464, 504–12 (2010).
18. Sykiotis, G. P. & Bohmann, D. Stress-activated cap’n'collar transcription factors in
aging and human disease. Sci. Signal. 3, re3 (2010).
19. Ishii, T. et al. Transcription factor Nrf2 coordinately regulates a group of oxidative
stress-inducible genes in macrophages. J. Biol. Chem. 275, 16023–9 (2000).
20. An, J. H. & Blackwell, T. K. SKN-1 links C. elegans mesendodermal specification
to a conserved oxidative stress response. Genes Dev. 17, 1882–93 (2003).
21. Bishop, N. A. & Guarente, L. Two neurons mediate diet-restriction-induced
longevity in C. elegans. Nature 447, 545–9 (2007).
22. Tullet, J. M. A. et al. Direct inhibition of the longevity-promoting factor SKN-1 by
insulin-like signaling in C. elegans. Cell 132, 1025–38 (2008).
23. Chan, J. Y., Cheung, M. C., Moi, P., Chan, K. & Kan, Y. W. Chromosomal
localization of the human NF-E2 family of bZIP transcription factors by
fluorescence in situ hybridization. Hum. Genet. 95, 265–9 (1995).
24. Motohashi, H., O’Connor, T., Katsuoka, F., Engel, J. D. & Yamamoto, M.
Integration and diversity of the regulatory network composed of Maf and CNC
families of transcription factors. Gene 294, 1–12 (2002).
25. Blank, V. Small Maf proteins in mammalian gene control: mere dimerization
partners or dynamic transcriptional regulators? J. Mol. Biol. 376, 913–25 (2008).
26. Sankaranarayanan, K. & Jaiswal, A. K. Nrf3 negatively regulates antioxidant-
response element-mediated expression and antioxidant induction of
NAD(P)H:quinone oxidoreductase1 gene. J. Biol. Chem. 279, 50810–7 (2004).
27. Leung, L., Kwong, M., Hou, S., Lee, C. & Chan, J. Y. Deficiency of the Nrf1 and
Nrf2 transcription factors results in early embryonic lethality and severe oxidative
stress. J. Biol. Chem. 278, 48021–9 (2003).
28. Walker, A. K. et al. A conserved transcription motif suggesting functional parallels
between Caenorhabditis elegans SKN-1 and Cap’n'Collar-related basic leucine
zipper proteins. J. Biol. Chem. 275, 22166–71 (2000).
29. Itoh, K. et al. Keap1 represses nuclear activation of antioxidant responsive
elements by Nrf2 through binding to the amino-terminal Neh2 domain. Genes Dev.
!
18
13, 76–86 (1999).
30. Katoh, Y. et al. Two domains of Nrf2 cooperatively bind CBP, a CREB binding
protein, and synergistically activate transcription. Genes Cells 6, 857–68 (2001).
31. McMahon, M., Thomas, N., Itoh, K., Yamamoto, M. & Hayes, J. D. Redox-
regulated turnover of Nrf2 is determined by at least two separate protein domains,
the redox-sensitive Neh2 degron and the redox-insensitive Neh6 degron. J. Biol.
Chem. 279, 31556–67 (2004).
32. Moi, P., Chan, K., Asunis, I., Cao, A. & Kan, Y. W. Isolation of NF-E2-related
factor 2 (Nrf2), a NF-E2-like basic leucine zipper transcriptional activator that
binds to the tandem NF-E2/AP1 repeat of the beta-globin locus control region.
Proc. Natl. Acad. Sci. U. S. A. 91, 9926–30 (1994).
33. Nioi, P., Nguyen, T., Sherratt, P. J. & Pickett, C. B. The carboxy-terminal Neh3
domain of Nrf2 is required for transcriptional activation. Mol. Cell. Biol. 25, 10895–
906 (2005).
34. Wu, J., Wang, H. & Tang, X. Rexinoid inhibits Nrf2-mediated transcription through
retinoid X receptor alpha. Biochem. Biophys. Res. Commun. 452, 554–9 (2014).
35. Bowerman, B., Eaton, B. A. & Priess, J. R. skn-1, a maternally expressed gene
required to specify the fate of ventral blastomeres in the early C. elegans embryo.
Cell 68, 1061–75 (1992).
36. Haas, A. L. & Siepmann, T. J. Pathways of ubiquitin conjugation. FASEB J. 11,
1257–68 (1997).
37. Petroski, M. D. & Deshaies, R. J. Function and regulation of cullin-RING ubiquitin
ligases. Nat. Rev. Mol. Cell Biol. 6, 9–20 (2005).
38. Biedermann, S. & Hellmann, H. WD40 and CUL4-based E3 ligases: lubricating all
aspects of life. Trends Plant Sci. 16, 38–46 (2011).
39. Choe, K. P., Przybysz, A. J. & Strange, K. The WD40 repeat protein WDR-23
functions with the CUL4/DDB1 ubiquitin ligase to regulate nuclear abundance and
activity of SKN-1 in Caenorhabditis elegans. Mol. Cell. Biol. 29, 2704–15 (2009).
40. McMahon, M., Itoh, K., Yamamoto, M. & Hayes, J. D. Keap1-dependent
proteasomal degradation of transcription factor Nrf2 contributes to the negative
regulation of antioxidant response element-driven gene expression. J. Biol. Chem.
278, 21592–600 (2003).
41. Lee, J. & Zhou, P. DCAFs, the missing link of the CUL4-DDB1 ubiquitin ligase.
Mol. Cell 26, 775–80 (2007).
42. Jin, J., Arias, E. E., Chen, J., Harper, J. W. & Walter, J. C. A family of diverse
!
19
Cul4-Ddb1-interacting proteins includes Cdt2, which is required for S phase
destruction of the replication factor Cdt1. Mol. Cell 23, 709–21 (2006).
43. Angers, S. et al. Molecular architecture and assembly of the DDB1-CUL4A
ubiquitin ligase machinery. Nature 443, 590–3 (2006).
44. Curran, S. P. & Ruvkun, G. Lifespan Regulation by Evolutionarily Conserved
Genes Essential for Viability. PLoS Genet. 3, e56 (2007).
45. Zhang, D. D. & Hannink, M. Distinct cysteine residues in Keap1 are required for
Keap1-dependent ubiquitination of Nrf2 and for stabilization of Nrf2 by
chemopreventive agents and oxidative stress. Mol. Cell. Biol. 23, 8137–51 (2003).
46. Hu, C., Eggler, A. L., Mesecar, A. D. & van Breemen, R. B. Modification of keap1
cysteine residues by sulforaphane. Chem. Res. Toxicol. 24, 515–21 (2011).
47. Nguyen, T., Nioi, P. & Pickett, C. B. The Nrf2-antioxidant response element
signaling pathway and its activation by oxidative stress. J. Biol. Chem. 284,
13291–5 (2009).
48. Blackwell, T. K., Bowerman, B., Priess, J. R. & Weintraub, H. Formation of a
monomeric DNA binding domain by Skn-1 bZIP and homeodomain elements.
Science 266, 621–8 (1994).
49. Moinova, H. R. & Mulcahy, R. T. Up-regulation of the human gamma-
glutamylcysteine synthetase regulatory subunit gene involves binding of Nrf-2 to
an electrophile responsive element. Biochem. Biophys. Res. Commun. 261, 661–
8 (1999).
50. Reichard, J. F., Motz, G. T. & Puga, A. Heme oxygenase-1 induction by NRF2
requires inactivation of the transcriptional repressor BACH1. Nucleic Acids Res.
35, 7074–86 (2007).
51. Ishii, T. & Yanagawa, T. Stress-induced peroxiredoxins. Subcell. Biochem. 44,
375–84 (2007).
52. Maher, J. M., Cheng, X., Slitt, A. L., Dieter, M. Z. & Klaassen, C. D. Induction of
the multidrug resistance-associated protein family of transporters by chemical
activators of receptor-mediated pathways in mouse liver. Drug Metab. Dispos. 33,
956–62 (2005).
53. Pang, S., Lynn, D. A., Lo, J. Y., Paek, J. & Curran, S. P. SKN-1 and Nrf2 couples
proline catabolism with lipid metabolism during nutrient deprivation. Nat. Commun.
5, 5048 (2014).
54. Inoue, H. et al. The C. elegans p38 MAPK pathway regulates nuclear localization
of the transcription factor SKN-1 in oxidative stress response. Genes Dev. 19,
2278–83 (2005).
!
20
55. Papp, D., Csermely, P. & Sőti, C. A role for SKN-1/Nrf in pathogen resistance and
immunosenescence in Caenorhabditis elegans. PLoS Pathog. 8, e1002673
(2012).
56. Liu, F. et al. Nuclear hormone receptor regulation of microRNAs controls innate
immune responses in C. elegans. PLoS Pathog. 9, e1003545 (2013).
57. Li, X. et al. Specific SKN-1/Nrf stress responses to perturbations in translation
elongation and proteasome activity. PLoS Genet. 7, e1002119 (2011).
58. Pickering, A. M., Staab, T. A., Tower, J., Sieburth, D. & Davies, K. J. A. A
conserved role for the 20S proteasome and Nrf2 transcription factor in oxidative
stress adaptation in mammals, Caenorhabditis elegans and Drosophila
melanogaster. J. Exp. Biol. 216, 543–53 (2013).
59. Radhakrishnan, S. K. et al. Transcription factor Nrf1 mediates the proteasome
recovery pathway after proteasome inhibition in mammalian cells. Mol. Cell 38,
17–28 (2010).
60. Sha, Z. & Goldberg, A. L. Proteasome-mediated processing of Nrf1 is essential for
coordinate induction of all proteasome subunits and p97. Curr. Biol. 24, 1573–83
(2014).
61. Steffen, J., Seeger, M., Koch, A. & Krüger, E. Proteasomal degradation is
transcriptionally controlled by TCF11 via an ERAD-dependent feedback loop. Mol.
Cell 40, 147–58 (2010).
62. Pickering, A. M., Linder, R. A., Zhang, H., Forman, H. J. & Davies, K. J. A. Nrf2-
dependent induction of proteasome and Pa28αβ regulator are required for
adaptation to oxidative stress. J. Biol. Chem. 287, 10021–31 (2012).
63. Paek, J. et al. Mitochondrial SKN-1/Nrf mediates a conserved starvation response.
Cell Metab. 16, 526–37 (2012).
64. Kensler, T. W., Curphey, T. J., Maxiutenko, Y. & Roebuck, B. D. Chemoprotection
by organosulfur inducers of phase 2 enzymes: dithiolethiones and dithiins. Drug
Metabol. Drug Interact. 17, 3–22 (2000).
65. Balogun, E. et al. Curcumin activates the haem oxygenase-1 gene via regulation
of Nrf2 and the antioxidant-responsive element. Biochem. J. 371, 887–95 (2003).
66. Pae, H.-O. et al. Roles of heme oxygenase-1 in the antiproliferative and
antiapoptotic effects of nitric oxide on Jurkat T cells. Mol. Pharmacol. 66, 122–8
(2004).
67. Garg, R., Gupta, S. & Maru, G. B. Dietary curcumin modulates transcriptional
regulators of phase I and phase II enzymes in benzo[a]pyrene-treated mice:
mechanism of its anti-initiating action. Carcinogenesis 29, 1022–32 (2008).
!
21
68. Na, H.-K. & Surh, Y.-J. Modulation of Nrf2-mediated antioxidant and detoxifying
enzyme induction by the green tea polyphenol EGCG. Food Chem. Toxicol. 46,
1271–8 (2008).
69. Shen, G. et al. Comparison of (-)-epigallocatechin-3-gallate elicited liver and small
intestine gene expression profiles between C57BL/6J mice and C57BL/6J/Nrf2 (-/-
) mice. Pharm. Res. 22, 1805–20 (2005).
70. Kode, A. et al. Resveratrol induces glutathione synthesis by activation of Nrf2 and
protects against cigarette smoke-mediated oxidative stress in human lung
epithelial cells. Am. J. Physiol. Lung Cell. Mol. Physiol. 294, L478–88 (2008).
71. Chen, C.-Y., Jang, J.-H., Li, M.-H. & Surh, Y.-J. Resveratrol upregulates heme
oxygenase-1 expression via activation of NF-E2-related factor 2 in PC12 cells.
Biochem. Biophys. Res. Commun. 331, 993–1000 (2005).
72. Morimitsu, Y. et al. A sulforaphane analogue that potently activates the Nrf2-
dependent detoxification pathway. J. Biol. Chem. 277, 3456–63 (2002).
73. Higgins, L. G., Cavin, C., Itoh, K., Yamamoto, M. & Hayes, J. D. Induction of
cancer chemopreventive enzymes by coffee is mediated by transcription factor
Nrf2. Evidence that the coffee-specific diterpenes cafestol and kahweol confer
protection against acrolein. Toxicol. Appl. Pharmacol. 226, 328–37 (2008).
74. Cavin, C. et al. Cafestol and kahweol, two coffee specific diterpenes with
anticarcinogenic activity. Food Chem. Toxicol. 40, 1155–63 (2002).
75. Liao, B.-C. et al. Cinnamaldehyde inhibits the tumor necrosis factor-alpha-induced
expression of cell adhesion molecules in endothelial cells by suppressing NF-
kappaB activation: effects upon IkappaB and Nrf2. Toxicol. Appl. Pharmacol. 229,
161–71 (2008).
76. Nakamura, Y. et al. Zerumbone, a tropical ginger sesquiterpene, activates phase
II drug metabolizing enzymes. FEBS Lett. 572, 245–50 (2004).
77. Gong, P., Hu, B. & Cederbaum, A. I. Diallyl sulfide induces heme oxygenase-1
through MAPK pathway. Arch. Biochem. Biophys. 432, 252–60 (2004).
78. Chen, C. et al. Induction of detoxifying enzymes by garlic organosulfur
compounds through transcription factor Nrf2: effect of chemical structure and
stress signals. Free Radic. Biol. Med. 37, 1578–90 (2004).
79. Ben-Dor, A. et al. Carotenoids activate the antioxidant response element
transcription system. Mol. Cancer Ther. 4, 177–86 (2005).
80. Satoh, T. et al. Carnosic acid, a catechol-type electrophilic compound, protects
neurons both in vitro and in vivo through activation of the Keap1/Nrf2 pathway via
S-alkylation of targeted cysteines on Keap1. J. Neurochem. 104, 1116–31 (2008).
!
22
81. Martin, D. et al. Regulation of heme oxygenase-1 expression through the
phosphatidylinositol 3-kinase/Akt pathway and the Nrf2 transcription factor in
response to the antioxidant phytochemical carnosol. J. Biol. Chem. 279, 8919–29
(2004).
82. Haridas, V. et al. Avicinylation (thioesterification): a protein modification that can
regulate the response to oxidative and nitrosative stress. Proc. Natl. Acad. Sci. U.
S. A. 102, 10088–93 (2005).
83. Ramos-Gomez, M. et al. Sensitivity to carcinogenesis is increased and
chemoprotective efficacy of enzyme inducers is lost in nrf2 transcription factor-
deficient mice. Proc. Natl. Acad. Sci. U. S. A. 98, 3410–5 (2001).
84. Sekhar, K. R. et al. NADPH oxidase activity is essential for Keap1/Nrf2-mediated
induction of GCLC in response to 2-indol-3-yl-methylenequinuclidin-3-ols. Cancer
Res. 63, 5636–45 (2003).
85. Liby, K. et al. The synthetic triterpenoids, CDDO and CDDO-imidazolide, are
potent inducers of heme oxygenase-1 and Nrf2/ARE signaling. Cancer Res. 65,
4789–98 (2005).
86. Dinkova-Kostova, A. T. et al. Extremely potent triterpenoid inducers of the phase
2 response: correlations of protection against oxidant and inflammatory stress.
Proc. Natl. Acad. Sci. U. S. A. 102, 4584–9 (2005).
87. Nioi, P. & Nguyen, T. A mutation of Keap1 found in breast cancer impairs its
ability to repress Nrf2 activity. Biochem. Biophys. Res. Commun. 362, 816–21
(2007).
88. Ooi, A. et al. CUL3 and NRF2 mutations confer an NRF2 activation phenotype in
a sporadic form of papillary renal cell carcinoma. Cancer Res. 73, 2044–51 (2013).
89. Kim, Y. R. et al. Oncogenic NRF2 mutations in squamous cell carcinomas of
oesophagus and skin. J. Pathol. 220, 446–51 (2010).
90. Shibata, T. et al. NRF2 mutation confers malignant potential and resistance to
chemoradiation therapy in advanced esophageal squamous cancer. Neoplasia 13,
864–73 (2011).
91. Shibata, T. et al. Genetic alteration of Keap1 confers constitutive Nrf2 activation
and resistance to chemotherapy in gallbladder cancer. Gastroenterology 135,
1358–1368, 1368.e1–4 (2008).
92. Padmanabhan, B. et al. Structural basis for defects of Keap1 activity provoked by
its point mutations in lung cancer. Mol. Cell 21, 689–700 (2006).
93. Singh, A. et al. Dysfunctional KEAP1-NRF2 interaction in non-small-cell lung
cancer. PLoS Med. 3, e420 (2006).
!
23
94. Ohta, T. et al. Loss of Keap1 function activates Nrf2 and provides advantages for
lung cancer cell growth. Cancer Res. 68, 1303–9 (2008).
95. Wang, X.-J. et al. Nrf2 enhances resistance of cancer cells to chemotherapeutic
drugs, the dark side of Nrf2. Carcinogenesis 29, 1235–43 (2008).

!
24
Chapter 2:
WDR23 is an ancient regulator of NRF2-dependent cytoprotection in humans
Jacqueline Y. Lo and Sean P. Curran
This chapter is a version of a manuscript submitted for publication:
Lo JY and Curran SP. WDR23 is an ancient regulator of NRF2-depdent cytoprotection
in humans.
2.1 Abstract
Cellular adaptation to stress is essential to ensure organismal survival. NRF2/NFE2L2
is a key determinant of xenobiotic stress responses, and loss of negative regulation by
the CUL3-KEAP1 proteasome system is implicated in several chemo- and radiation-
resistant cancers. Here we establish a WDR23-DDB1-CUL4 regulatory axis for NRF2
activity that operates independently of the canonical KEAP1-CUL3 system. WDR23
binds the Neh2 domain of NRF2 to regulate its stability, but this regulation is not
dependent on the DLG or ETGE motifs in this domain that are utilized by KEAP1.
Regulation of NRF2 by WDR23-DDB1-CUL4 requires a central and highly conserved C-
terminal domain in WDR23. WDR23 suppresses NRF2 activity in the absence of
KEAP1 and depletes nuclear NRF2 in KEAP1-negative cancer cell lines, suggestive of a
tumor suppressor function. Together, our results identify WDR23 as a central regulator
of NRF2 activity and uncover a cellular pathway that regulates NRF2 levels and
capacity for cytoprotection.
!
25
2.2 Introduction
In response to environmental and cellular stress, organisms must activate
specific pathways to defend and protect against damage
1-3
. Such stressors include
electrophiles, pathogens, and xenobiotics, many of which are carcinogens and activate
the conserved cap-n-collar transcription factor NRF2 (nuclear factor E2-related factor)
stress response pathway
2,4
. In the presence of such stress, negative regulation of NRF2
is relieved, which leads to accumulation in the nucleus. Upon activation, NRF2 regulates
the expression of genes with antioxidant response elements (ARE) in their promoters
5-7
.
Activation of NRF2 cytoprotection pathways have been functionally linked to
longevity,
2,8,9
but when left unchecked, can be detrimental
10
and can even enhance
cancer severity and resistance to chemotherapy
11
.
The regulation of NRF2 is of particular importance to the progression of human
diseases where oxidative stress plays a mechanistic role, including: cancer
12
,
inflammation
13
, neurodegeneration
14
, cardiovascular diseases
15
, and even wound repair
and regeneration
16
. In humans, the CUL3 (Cullin 3) and KEAP1 (Kelch-like ECH-
associated protein 1) E3 ubiquitin ligase complex maintains NRF2 at low levels
17,18
.
KEAP1 is a bric-a-brac, tramtrack, broad complex (BTB) domain-containing protein that
when bound to NRF2, facilitates polyubiquitination and degradation by the 26S
proteasome
19
. However, recent studies allude to additional, but unidentified, layers of
regulation that are independent of KEAP1
20
.
!
26
In C. elegans, a mechanistically similar pathway negatively regulates the
abundance of SKN-1, the worm equivalent of NRF2, but via the action of WDR-23
21,22

and the CUL-4 E3 ubiquitin ligase, but not CUL-3
23
. WDR-23 is a WD40-repeat protein,
containing seven repeats of the tryptophan aspartic acid (WD) containing motif. This
structure facilitates protein-protein interactions, and in particular, WD40 proteins have
been shown to interact with the CUL4-DDB1 (damaged DNA binding protein 1) E3
ubiquitin ligase complex
24
. In worms, the CUL4-DDB1 ubiquitin ligase complex has been
shown to associate with WDR-23, and together, they suppress expression of oxidative
stress genes through regulation of SKN-1
21
. In the absence of wdr-23, SKN-1 is able to
translocate into the nucleus, where it is able to serve as the transcription factor
responsible for turning on oxidative stress genes leading to increased stress
resistance
25-32
and lifespan extension
21,33
.
Surprisingly, the similarities between KEAP1 and worm WDR-23 are only
mechanistic, as KEAP1 is structurally dissimilar to WDR-23. Despite the presence of
KEAP1, the human genome has retained WDR23 - also referred to as the DDB1 and
CUL4 Associated Factor 11 (DCAF11) protein. Here, we demonstrate functional
regulation of the NRF2 cytoprotection pathway by the CUL4-DDB1-WDR23 ubiquitin
proteasome system as an alternative to the canonical KEAP1 regulatory pathway. This
finding is of great importance, as loss of KEAP1 regulation of NRF2 is prevalent in
several cancers that are hallmarked by resistance to chemo- and radiation therapies, a
side effect of NRF2-dependent activation of cytoprotection pathways.

!
27
2.3 Results
Human WDR23 regulates activation of NRF2 cytoprotection pathways
WDR-23 is the major regulator of SKN-1 activity, which is the C. elegans
equivalent to mammalian NRF2/NFE2L2. Nematodes lack a KEAP1 homolog, but WDR-
23 regulation of SKN-1 is mechanistically similar to KEAP1 regulation of NRF2,
regulating turnover of the transcription factor by the ubiquitin proteasome system.
Despite the evolution of the KEAP1 regulatory pathway, the WDR23 locus is
exceptionally well conserved from worms to humans (Fig. 1A, Supplementary Fig. 1A).
Remarkably, a role for WDR23 in the regulation of the NRF2 cytoprotection pathway has
yet to be described, and a general understanding of the role WDR23 plays in cell
biology is lacking; only one published report describes altered expression of
WDR23/DCAF11 in the mouse bladder epithelium in response to increased levels of
urea and nitric oxide
34
. However, WDR23 has been identified in association with the
CUL4-DDB1 E3 ligase complex, but like most E3 ligase adapters, specific target
substrates remain elusive
35
.
Two major isoforms (iso) of WDR23 are expressed in mammals (Fig. 1A).
WDR23 isoform 1 (UniProtKB/Swiss-Pro Accession: Q8TEB1-2) encodes a 546 amino
acid polypeptide with a predicted molecular mass of 61.7 kDa, while the second isoform,
WDR23 isoform 2 (UniProtKB/Swiss-Prot Accession: Q8TEB1-1), encodes a 520 amino
acid polypeptide with a predicted molecular mass of 58.8 kDa. GFP tagged WDR23
isoform 1 is localized primarily to the cytoplasm (Fig. 1B), while GFP-WDR23 isoform 2
!
28
is enriched in the nucleus, but can be found in the cytoplasm when expressed in HEK-
293T (Fig. 1C) or HepG2 (Supplementary Fig. 1B-C) cells, which is consistent with the
localization of the two predominant CeWDR-23 isoforms (Supplementary Fig. 1D-E)
36
.
Although NRF2 activation by xenobiotic electrophiles leads to its accumulation in the
nucleus
37
, the subcellular localization of WDR23 does not change with stress
(Supplementary Fig. 1F-I). The localization of WDR23 isoform 2 in the nucleus is
intriguing, as KEAP1 regulation of NRF2 is thought to be restricted to the cytoplasm
38-40
,
thus KEAP1 and WDR23 may coordinately regulate NRF2 in either compartment.
To mount an appropriate response to cellular stress, NRF2 regulates the
expression of several classes of xenobiotic response genes, including: glutathione
homeostasis, drug metabolism, iron metabolism, multidrug resistance transporters,
cellular energy metabolism, biogenesis of circulatory signaling molecules and receptors,
and calcium homeostasis
41
. These genes all contain an antioxidant response element
(ARE) and are positively regulated by NRF2. To assess whether WDR23 is a functional
regulator of NRF2 cytoprotection pathways, we measured NRF2-dependent activation of
an ARE-luciferase reporter in HEK-293T cells that were transfected with WDR23-GFP
expression constructs (Fig. 1D). ARE-luciferase activity was inversely related to
WDR23 expression levels, supporting a model where WDR23 functions as a negative
regulator of NRF2. Surprisingly, expression of CeWDR-23 did not impact ARE-luciferase
expression in unstressed cells or in KEAP1 siRNA treated cells. Thus, although
WDR23 is an ancient regulator of cytoprotection, its functionality in the SKN-1 and
NRF2 pathways is species-specific (Supplementary Fig. 2A-B).
!
29
We were intrigued by the ability of WDR23 to influence the expression of cellular
antioxidant responses via the ARE. We next determined if WDR23 could repress the
expression of specific NRF2 targets. Increased expression of WDR23 resulted in
reduced steady-state expression of several NRF2 targets, including: GSTA1 (Fig. 1E),
CYP3A4 (Fig. 1F), ACADL (Fig. 1G), and ACADM (Fig. 1H); however, not all NRF2
targets were altered (Supplementary Fig. 2C-E). Turning off the NRF2 response is
equally important, particularly in the context of cancer cells where NRF2 is deregulated.
Treatment of cells with tert-butylhydroquinone (tBHQ) activates NRF2-dependent
transcription of cytoprotection genes
37
, but when combined with WDR23 expression, the
induction of electrophile induced NRF2 targets, including: GSR (Fig. 1I), CYP1A1 (Fig.
1J), CPT1A1 (Fig. 1K), ACADS (Fig. 1L) and ACADL (Fig. 1M) was attenuated, while
other NRF2-dependent transcripts were unaffected (Supplementary Fig. 2F-H). The fact
that not all NRF2 targets were influenced by WDR23 may be indicative of the WDR23-
regulatory pathway to direct a specific subset of NRF2 targets, the differential impact the
WDR23-NRF2 pathway plays in NRF2-cytoprotection in a cell-type dependent manner,
or perhaps one function of the WDR23 control is to turn off NRF2 following
transcriptional activation, which is more important for some targets.
CUL4-DDB-1-WDR23 directly regulates NRF2 stability
The CUL4-DDB1 E3 ligase complex licenses WDR proteins as adapters for
substrate recognition; however, very few receptor-substrate pairs are defined. CeWDR-
23 is thought to physically bind SKN-1
21
to regulate its abundance in the cell. To reveal
the ability of WDR23 to directly regulate NRF2, we immunoprecipitated (IP) WDR23
!
30
isoform 1 (Fig. 2A) or WDR23 isoform 2 (Fig. 2B) and found that NRF2 was efficiently
co-immunoprecipitated with WDR23, but not GFP, which indicates the ability of these
two proteins to complex (Supplementary Fig. 3A-D). IP of WDR23 also pulled down
DDB1 and CUL4A, but not KEAP1, which define the CUL4A E3 ligase complex as a
novel regulator of NRF2 that operates independently of the established CUL3-KEAP1
E3 ligase machinery. In addition to NRF2, mammals express NRF1, NRF3, and NF-E2,
which contribute to ARE activation
42-44
. NRF1 is ubiquitously expressed, similar to
NRF2, while NRF3 expression is restricted to the placenta and liver tissues, and NF-E2
is only expressed in erythrocytes. NRF1 and NRF2 have distinct cellular roles
45,46
, and
importantly, the cytoprotective role of WDR23 was specific, as it did not interact with
NRF1 (Fig. 2C). As such, the WDR23-DDB1-CUL4 E3 ligase complex is specific to
NRF2-dependent cytoprotection (Fig. 2D).
Our discovery that WDR23 is a component of the CUL4A-DDB1 E3 ligase
complex (Fig. 2A-B) predicts that the underlying mechanism of NRF2 regulation would
be at the level of protein turnover and stability. As such, we examined whether
modulating WDR23 levels could alter the abundance of NRF2 protein. The increased
expression of WDR23 in HEK-293T cells decreased the abundance of co-transfected
NRF2 in a dose dependent manner (Fig. 2E). The reduction of NRF2 was dependent
on the increase in WDR23 expression, since co-transfection of a WDR23 siRNA
restored NRF2 levels (Supplementary Fig. 4A). As predicted, the WDR23-mediated
degradation of NRF2 was dependent on the ubiquitin proteasome system, as the
WDR23-mediated reduction of NRF2 was attenuated when cells were treated with the
!
31
proteasome inhibitor peptide MG-132 (Fig. 2F). As observed by others, we found
endogenous NRF2 levels to be relatively low under basal conditions. However,
expression of isoform 2 of WDR23 significantly reduced endogenous NRF2 protein
levels (Fig. 2G and Supplementary Fig. 4B). This reduction of endogenous NRF2 is not
observed following MG-132 treatment, which confirms the requirement of functional
proteasome machinery (Supplementary Fig. 4C). These data indicate that the regulation
of NRF2 by WDR23 is in part at the level of NRF2 localization and/or stability.
KEAP1 function is primarily restricted to the cytoplasm, but KEAP1-independent
regulation, perhaps in the nucleus, has long been hypothesized
47
. A nuclear function for
the WDR23 regulatory pathway for NRF2 is supported by three findings: first, the
enhanced capacity of WDR23 isoform 2, which is more nuclear than WDR23 isoform 1,
to impact the transcription of Nrf2 targets like GSTA1 and ACADM without stress (Fig.
1E, G) and CYP1A1, CPT1A1 during oxidative stress (Fig. 1J, K); second, the strong
binding of NRF2 to nuclear localized WDR23 isoform 2 (Fig. 2B); and third, the ability of
WDR23 isoform 2, but not WDR23 isoform 1, to reduce endogenous NRF2 levels at
steady state. The stable localization of WDR23 in the presence or absence of xenobiotic
stress predicts that this regulation can occur regardless of the redox state of the cell. In
fact, the interaction of WDR23 with NRF2 similarly occurs in cells treated with tBHQ
(Supplementary Fig. 5A-B). During electrophilic stress, the physical association of
NRF2 with KEAP1 is disrupted, which stabilizes NRF2, allowing its accumulation in the
nucleus
48
. This active form of NRF2 is then free to turn on appropriate cytoprotective
genes. We challenged the WDR23 regulatory system to turn over activated NRF2
!
32
following oxidative stress. In line with our studies in non-stressed cells, expression of
WDR23 was sufficient to abrogate the increased accumulation of NRF2 following
exposure to hydrogen peroxide (Fig. 2H). Intriguingly, it appears as though WDR23
itself is differentially regulated depending on its subcellular localization; the abundance
of cytoplasmic WDR23 isoform 1 is consistently lower than nuclear WDR23 isoform 2,
which is consistent with the idea that WDR23 is regulated at the level of protein stability
(Supplementary Fig. 5C).
The conserved capacity of C. elegans WDR-23 to regulate similar cellular
cytoprotection responses, albeit mediated by SKN-1, suggested we could exploit our C.
elegans genetic system to identify the domains of WDR-23 that would be of functional
significance for regulation of the mammalian NRF2 pathway. To that end, we performed
an ethyl methanesulfonate (EMS) mutagenesis screen to identify wdr-23 mutants, which
we predicted would be enriched, as WDR-23 is the canonical negative regulator of SKN-
1 activity in worms. We sequenced the wdr-23 locus in all isolated mutants that mapped
to linkage group I
49
and identified eight novel alleles of wdr-23 (Fig. 2I, Supplementary
Table 2). Each of these mutations is fully recessive and although variable in strength,
can enhance animal survival during xenobiotic stress (Supplementary Fig. 6A) and
activate the transcription of cytoprotection genes (Supplementary Fig. 6B-E) in a skn-1-
dependent manner (Supplementary Fig. 6F-U). The mutations in wdr-23 cluster around
WD40 repeats 4 and 5, which are near the conserved DWD-box found in WDR23
across species (Supplementary Table 3). Notably, many of these mutations are in
residues that are conserved from worm to man.
!
33
Our studies identify the first substrate for the CUL4 adapter protein WDR23.
Although WDR23 has previously been shown to bind to the CUL4-DDB1 complex
35,50
,
the biochemical mechanism underlying this interaction is unknown. Informed by our
worm mutants, we used site-directed mutagenesis to generate orthologous mutations in
highly conserved residues in WDR23: H306Y and W335Stop (Fig. 2I). These mutant
versions of WDR23 did not alter the subcellular localization of WDR23 isoform 1, but we
often observed non-nuclear localized WDR23 isoform 2 harboring these mutations,
which might impact their functionality (Supplementary Fig. 7A-D). Both mutations were
stably expressed and could be enriched by our IP strategy, but each had a significant
impact on the WDR23 axis of NRF2 regulation. The W335Stop mutation impaired the
association of both WDR23 isoforms with NRF2, DDB1 and CUL4A (Fig. 2J,
Supplementary Fig. 7E), whereas the H306Y mutation strongly reduced binding to
DDB1 and CUL4A and modestly reduced NRF2 binding (Fig. 2K, Supplementary Fig.
7F). Informed by our invertebrate studies, these results demonstrate the important
functionality of the C-terminus of WDR23, and more specifically the H306 in the central
WD4 domain for substrate binding and recruitment of the CUL4 E3 ligase complex.
WDR23 regulates NRF2 independently of KEAP1
The regulation of NRF2 by KEAP1 is thought to occur in the cytoplasm
38-40
. Our
immunoprecipitation studies of WDR23 did not pull down KEAP1, supporting the
formation of a CUL3-KEAP1-independent regulatory complex. Six NRF2-ECH
homology (Neh) domains have been defined within NRF2 that are key determinants of
NRF2 regulation and activity
48,51-54
(Fig. 3A). We systematically examined a panel of
!
34
NRF2 mutants, each with a different Neh domain deleted
12
, and measured the capacity
of WDR23 to bind the truncated protein. NRF2(ΔNeh2) failed to co-IP with either
WDR23 isoform (Fig. 3B and Supplementary Fig. 8A), while binding still occurred with
all other truncated versions of NRF2 (Supplementary Fig. 8B-I). This result indicates the
absolute requirement of the Neh2 domain to facilitate the interaction of WDR23 with
NRF2.
KEAP1 also regulates NRF2 via the Neh2 domain
17
, which might suggest a
common mechanism of WDR23 and KEAP1 regulation of NRF2, despite lack of a
detectable interaction between WDR23 and KEAP1. To confirm a KEAP1-independent
axis of NRF2 regulation by WDR23, we assessed the capacity of WDR23 to suppress
the activation of NRF2 when KEAP1 is inhibited. Expression of WDR23 reduced ARE-
luciferase activation in cells transfected with KEAP1 siRNA (Fig. 3C, Supplementary
Table 1). Specifically, expression of WDR23 suppressed the induction of the canonical
KEAP1-NRF2 pathway targets GCLC (Fig. 3D), but not NQO1 (Supplementary Fig. 9A).
The shared use of the Neh2 domain for binding of NRF2 by WDR23 and KEAP1
may reflect a competition between the CUL4 and CUL3 E3 ligases for NRF2 regulation.
To determine whether this model was correct, we tested if WDR23 could associate with
NRF2 when the motifs utilized by KEAP1 for binding were mutated
55
. Mutation of the
DLG (Fig. 3E, Supplementary Fig. 9B) or ETGE (Fig. 3F, Supplementary Fig. 9C) motifs
did not abolish binding. In fact, the interaction of the mutated NRF2 protein with WDR23
was enhanced as compared to wild type NRF2 (Figs. 2A-B, 3E-F), perhaps due to an
increase in the available NRF2 protein, which due to these mutations is unable to
!
35
associate with KEAP1. These findings further support the model where WDR23 can
restore regulatory control of NRF2 independent of KEAP1 function (Fig. 4A).
WDR23 can restore NRF2 homeostasis in cancer cells
KEAP1 function is perturbed in several aggressive cancers that are resistant to
chemo- and radiation-based therapies due to enhanced NRF2 activity, making them
particularly hard to treat
56-58
. We queried the Catalogue Of Somatic Mutations In Cancer
(COSMIC) online database of somatically acquired mutations found in human tumor
samples for evidence of deregulated WDR23
59,60
. 103 unique somatic mutations in
WDR23 have been documented that include 9 nonsense and 74 missense mutations
discovered across multiple tissues, including: skin (2.44% of samples tested), stomach
(1.7% of samples tested), large intestine (1.33% of samples tested), endometrium (1.1%
of samples tested), and less frequently (less than 1% of each tissue type) in bone,
breast, CNS, cervix, kidney, liver, lung, esophagus, ovary, pancreas, prostate, thyroid,
and urinary tract (Supplementary Table 4). Several of these mutations fall within the
region of WDR23, which we have defined as important for substrate binding and
association with DDB1 (Supplementary Fig. 10A). In addition, WDR23 expression is
increased in 427 tumor samples, including 40 with increased copy number, and
decreased in 279 samples, including 9 with reduced copy number (Supplementary
Table 4).
Our findings support a model where WDR23 and KEAP1 coordinately regulate
NRF2 levels by independent mechanisms. Feedback regulation of redundant or parallel
!
36
pathways can occur at the level of transcription when one arm of the system is
disabled
61-63
or when demand on the pathway is increased, as observed in our
transcriptional analysis of KEAP1 during oxidative stress when WDR23 is
overexpressed in mammalian cells (Supplementary Fig. 2I)
6,64
and the increased
expression of wdr-23 in C. elegans wdr-23 mutants (Supplementary Fig. 6E). As such,
we next investigated whether WDR23 expression is altered in tumor samples harboring
KEAP1 mutations and vice versa. In support of our hypothesis, several lung cancers
harboring KEAP1 mutations have increased expression of WDR23, ranging from 2.06 to
4.8-fold (Supplementary Fig. 10B). Similarly, multiple stomach cancer samples that
have sequence identified somatic mutations in WDR23 have increased KEAP1
expression, ranging from 2.07 to 3.41 fold (Supplementary Fig. 10C). Future exploration
of the significance and influence these mutations and transcriptional responses play in
the etiology of these cancers will be of great significance.
Our data, when combined with the information archived at the COSMIC from
human somatic tumors, strongly supports the prediction that enhancing the WDR23
pathway could reestablish regulation of activated NRF2 in KEAP1(-/-) cancer cells. To
directly test this hypothesis, we expressed either WDR23 isoform 1 or WDR23 isoform 2
in A549 lung carcinoma cells, where loss of KEAP1 results in NRF2 nuclear
accumulation. In support of our hypothesis, cells transfected with either isoform of
WDR23 had reduced nuclear NRF2, while NRF2 in non-transfected cells remained
nuclear (Fig. 4B-D). Moreover, the reduction of nuclear NRF2 was more pronounced
when WDR23 isoform 2 was expressed, consistent with the idea that the WDR23 is the
!
37
nuclear complement to the cytoplasmic KEAP1 system. Quantification of total NRF2
protein levels in cells expressing WDR23 isoform 1 or WDR23 isoform 2 reveal a
reduction of approximately 20%, although based on the difficulty in transfecting these
cells, and the resulting mosaic nature of the population, this is likely an underestimate of
the effect WDR23 has on NRF2 stability (Supplementary Fig. 10D-E). Collectively, our
studies provide new mechanistic insight underlying the complex regulation of NRF2-
dependent cytoprotection. Additionally these findings are of particular medical relevance,
as the ability to shutdown NRF2 activity, independently from KEAP1, is of particular
clinical interest for cancers where activated NRF2 contributes to both the severity and
resistance to treatment by radiation- or chemo-based therapies.
2.4 Discussion
We propose a novel regulatory mechanism to maintain NRF2-dependent cellular
homeostasis. Cellular adaptation to stress (oxidative, xenobiotic, dietary) is essential to
ensure organismal survival, and NRF2 is an exceptionally well-studied and key
determinant of cellular stress responses
2,11
. Our findings expand upon 15 years of
research that have focused primarily on the role of the KEAP1-CUL3 E3-ubiquitin ligase
proteasome system as the preeminent mechanism for negative regulation of
NRF2
10,65,66
. Through the combined use of C. elegans and human cell culture models,
we establish a functional and evolutionarily conserved role for human WDR23 as the
substrate receptor for the Cullin 4(CUL4)-DDB1 E3 ligase that can regulate NRF2 levels
and which operates independently of the canonical KEAP1-CUL3 pathway.
!
38
Exposures from multiple sources – both environmental and internal - impact a
person’s overall health and susceptibility to disease, with the total exposure throughout
an individual’s lifespan (conception to death) is defined as the exposome. The
mechanisms underlying responses to the exposome are central to our understanding of
human health and disease. Collectively, cellular cytoprotective systems, including NRF2,
are required for appropriate responses to the exposome. However, these response
systems require precise regulation, both for activation and inactivation; inappropriate
activation of these pathways can also promote resistance to the inherently toxic
treatment of diseases by chemo- and radiation therapies. As such, our findings have
enhanced our understanding of the complex nature of NRF2-dependent stress
adaptation and will lay the foundation for the development of new therapeutics to
appropriately tailor a person’s exposome responses.
2.5 Methods
Cell cultures, transfections, and chemicals
HEK-293T and HepG2 cells were maintained in Dulbecco’s modified Eagle’s medium
supplemented with 10% fetal bovine serum and 1% antibiotic/antimycotic (Thermo
Fisher) at 37°C, 5% CO2. A549 (ATCC) cells were maintained in Ham’s F-12K
(Kaighn’s) medium supplemented with 10% fetal bovine serum and 1%
antibiotic/antimycotic at 37°C, 5% CO2. Transfections were performed with
Lipofectamine 3000 (Thermo Fisher) according to the manufacturer’s protocol. siRNAs
(Thermo Fisher) used include: KEAP1 (HSS114799, HSS114800, HSS190639),
!
39
WDR23 (HSS129631, HSS129632, HSS129633), NRF2 (s9492). Chemical treatments
include: 50μM tert-Butylhydroquinone (Sigma), 250μM H2O2 (Sigma), and 10μM MG-
132 (Sigma).
Recombinant DNA
Full-length cDNA sequence of Hs WDR23 Isoforms 1 and 2 and Ce wdr-23 Isoforms A
and B were cloned into pcDNA 6.2/N-EmGFP/TOPO (Thermo Fisher). 3xFLAG:NRF2
and 3xFLAG:NRF1 were purchased from GeneCopeia. mCherry-LaminA-C-18 was a
gift from Michael Davidson (Addgene plasmid # 55068). Nrf2(ΔNeh) plasmids were a
generous gift from Donna Zhang (University of Arizona). Additional mutants were
generated from existing plasmids using Q5 Site-Directed Mutagenesis (NEB).
C. elegans strains utilized and culture methods
C. elegans were cultured using standard techniques. The following strains were used:
wild-type N2 Bristol, CL2166[gst-4p::gfp], SPC296[wdr-23(lax101;Q80Stop)],
SPC318[wdr-23(lax123;D387N)], SPC302[wdr-23(lax124;T400I)], SPC306[wdr-
23(lax126;W339Stop)], SPC299[wdr-23(lax129;frameshift)], SPC315[wdr-
23(lax134;H310Y)], SPC303[wdr-23(lax211;D313N)], and SPC317[wdr-
23(lax213;G460R)]. Double mutants were generated by standard genetic techniques.
For RNAi experiments, NGM plates containing 5 mM IPTG and 100 μg/ml carbencillin
were seeded with overnight cultures of double-stranded RNAi-expressing HT115
bacteria. Plates were allowed to induce overnight followed by transfer of age-
synchronous populations of C. elegans. For arsenite survival, L4 worms of indicated
!
40
genotype were transferred to plates containing 5 mM arsenite (J.T.Baker) and counted
for survival after 24 hours.
Isolation of wdr-23 mutants
Ethyl methanesulfonate (EMS) mutagenesis was performed. Briefly, a C. elegans strain
harboring the SKN-1 transcriptional reporter gst-4p::gfp was mutagenized with EMS and
F1 worms with high GFP expression, indicating SKN-1 activation, were selected. A
complementation group of eight recessive alleles were isolated and mapped to
chromosome I. The wdr-23 gene was sequenced in each mutant isolated to determine
the specific mutation in each strain.
Fluorescent imaging
Cells were grown on coverslips coated with poly-D-lysine (Corning) and transiently
transfected with indicated plasmids. Twenty-four hours post-transfection, cells were
mounted on cover slides and imaged with Zeiss Axio Imager.M2m microscope, Axio
Cam MRm camera, and Zen Blue software.
Luciferase reporter gene assay
HEK-293T cells were transiently transfected with the indicated plasmids and/or siRNA
and Cignal antioxidant response luciferase reporter (Qiagen). Forty-eight hours post-
transfection, cells were assayed using the Dual-Glo Luciferase Assay System
(Promega) according to the manufacturer’s protocol. Firefly luciferase activity was
normalized to renilla luciferase activity.
!
41
RNA extraction and quantitative PCR
Either human cells or worms of the indicated genotypes and treatments were collected
and lysed in Tri reagent (Zymo Research). RNA was extracted according to the
manufacturer’s protocol. DNA contamination was digested with DNase I and
subsequently, RNA was reverse-transcribed to complementary DNA using qScript cDNA
SuperMix (Quanta Biosciences). Quantitative PCR was performed by using SYBR
Green (BioRad). The expression levels of snb-1 and B2M were used to normalize
samples in worms and human cells, respectively. Primer sequences listed in
Supplementary Table 5.
Co-immunoprecipitation
HEK-293T cells were transiently transfected with indicated plasmids. Twenty-four hours
post-transfection, cells were lysed in 0.5% CHAPS buffer (10mM Tris/Cl pH 7.5, 150mM
NaCl, 0.5mM EDTA, 0.5% CHAPS) containing Halt Protease Inhibitor (Thermo Fisher).
Immunoprecipitation of GFP:WDR23 was performed according to the manufacturer’s
protocol (ChromoTek). Briefly, cell lysates were precleared with blocked magnetic
agarose GFP Trap beads for 1 hour at 4°C, followed by incubation with magnetic
agarose GFP Trap beads for 1 hour at 4°C. After three washes (10mM Tris/Cl pH 7.5,
150mM NaCl, 0.5mM EDTA) post-immunoprecipitation, immunoprecipitated protein
complexes were eluted in 2X sample buffer (0.1M Tris/Cl pH 6.8, 4% SDS, 20% glycerol,
0.2M DTT, 0.1% bromophenol blue) by boiling for 10 minutes at 95°C. Samples were
analyzed by Western blot.
!
42
Western blot analysis and antibodies
For detection of protein expression in total cell lysates, cells were lysed in RIPA buffer
(50mM Tris/Cl pH 8, 150mM NaCl, 0.5% sodium deoxycholate, 0.1% SDS). Protein
concentrations were measured with Bradford (Amaresco), prepared with 5X sample
buffer (0.25M Tris/Cl pH 6.8, 10% SDS, 50% glycerol, 0.5M DTT, 0.25% bromophenol
blue), electrophoresed through Bolt 4-12% bis-tris polyacrylamide gels in MOPS running
buffer (Thermo Fisher), transferred to nitrocellulose membranes, and subjected to
immunoblot analysis. Antibodies used include: GFP GF28R (Thermo Fisher), FLAG M2
(Sigma), Nrf2 H-300 (Santa Cruz), Nrf2 C-20 (Santa Cruz), DDB1 A300-462 (Bethyl),
Cul4A 113876 (GeneTex), Keap1 ab66620 (Abcam), Actin A5441 (Sigma), Tubulin
21485 (CST).
Immunocytochemistry
A549 cells were grown on coverslips coated with poly-D-lysine (Corning) and transiently
transfected with indicated plasmids. Forty-eight hours post-transfection, cells were fixed
in 100% methanol in -20°C for 5 minutes, blocked in 10% normal goat serum/PBS for 20
minutes, incubated in primary antibody for 1 hour each, incubated in secondary Alexa
Fluor antibody (Abcam) for 1 hour each, and mounted with Vectashield with DAPI
(Vector Labs). Images were taken with Zeiss Axio Imager.M2m microscope, Axio Cam
MRm camera, and Zen Blue software.

!
43
2.6 Acknowledgements
We thank L. Thomas, M. Jing, and H. Kiani for technical support; D. Zhang for
the ΔNeh domain plasmids; A. Pradhan, D. Lynn, H. Dalton, C. Yen, and B. Spatola for
critical reading and comments on the manuscript; the CGC, funded by NIH Office of
Research Infrastructure Programs (P40 OD010440) for some strains. Support from NIH
grants R00AG032308 (S.P.C.), R01GM109028 (S.P.C.), and T32GM067587 (J.Y.L); the
American Heart Association (S.P.C.), an Ellison New Scholar Award (S.P.C.), the
American Federation for Aging Research (S.P.C.), and the Hanson-Thorell Family for
pilot funding.

!
44
2.7 Figures

Figure 1. WDR23 is an ancient regulator of NRF2. a, Schematic of the domains found
in human WDR23 isoform 1 (pink) and WDR23 isoform 2 (orange). b,c, Representative
images of HEK-293T cells co-expressing LAMIN and either GFP-WDR23 isoform 1 (b)
or GFP-WDR23 isoform 2 (c). Scale bar, 20μm. d, Expression of WDR23 isoform 1 or
WDR23 isoform 2 reduces the expression of an ARE-inducible luciferase reporter. e-h,
Cells expressing WDR23 have reduced levels of the NRF2 target genes GSTA1 (e),
CYP3A4 (f), ACADL (g), and ACADM (h). i-m, Expression of WDR23 abrogates the
effects of tBHQ-treatment on NRF2 targets GSR (i), CYP1A1 (j), CPT1A1 (k), ACADS
(l), and ACADL (m). Data are mean ± s.e.m.; d, two-tailed t-test relative to control
samples; e-m, one-tailed t-test relative to control samples. *P<0.05, **P<0.01,
***P<0.001
!
45

Figure 2. CUL4-WDR23 regulates NRF2 stability. a-d, NRF2 immunoprecipitates (IP)
with WDR23 isoform 1 (a) or WDR23 isoform 2 (b) along with DDB1 and CUL4a, but not
KEAP1. NRF1 does not IP with the WDR-23-DDB1 complex (c); as diagramed in (d). e-
g, Increased expression of WDR23 reduces the abundance of co-expressed FLAG-
NRF2 (e) in a proteasome dependent manner (f) and can also reduce endogenous
NRF2 (g). h, The increased stability of NRF2 following oxidative stress is abrogated
when WDR23 is expressed. Oxidative stress also destabilizes WDR23. i, Schematic of
C. elegans WDR-23 and the identify of eight recessive loss of function alleles.
Conserved residues between worm and human WDR23 that are mutated for structure
function analysis are in pink. j,k, The WDR23(W335Stop) mutation (j) abolishes binding
of NRF2 and impairs association with the DDB1-CUL4A complex, while the H306Y
mutation modestly impairs binding of both (k). Data are mean ± s.e.m.; one-tailed t-test
relative to control samples. *P<0.05. Co-IP data contain (+) for GFP IP and (-) for
control (blocked GFP) IP.
!
46

Figure 3. WDR23 regulates NRF2 independently of KEAP1. a, Schematic of the
NRF2 protein, the location of each Neh domain, and the amino acid sequence of the
DIDLID, DLG, and ETGE motifs. b, WDR23 requires the Neh2 domain of NRF2 for
binding. c,d, Reduction of KEAP1 by RNAi induces the activation of a NRF2-dependent
ARE-luciferase reporter (c) and the increased expression of the NRF2 target GCLC.
This induction is attenuated when WDR23 is overexpressed. e,f, Despite shared use of
the Neh2 domain by KEAP1 and WDR23 for binding, WDR23 does not require the DLG
(e) or ETGE (f) motifs utilized by KEAP1. Data are mean ± s.e.m.; one-tailed t-test
relative to control samples. *P<0.05, ***P<0.001. Co-IP data contain (+) for GFP IP and
(-) for control (blocked GFP) IP.
!
47

Figure 4. WDR23 restores NRF2 regulation in cancer cells. a, Model for the shared
regulation of NRF2 by the cytoplasmic Cullin3 E3-ubiquitin ligase complex (CUL3-
KEAP1) and the nuclear and the cytoplasmic Cullin4 E3 ubiquitin ligase complexes
(CUL4-DDB1-WDR23). b,c, Expression of GFP-WDR23 isoform 1 (b) or GFP-WDR23
isoform 2 (c) can deplete activated NRF2 (red) from the nucleus (DAPI, blue) in A549
lung cancer cells. Scale bar, 20μm. Arrows denote transfected cells. d, Quantification of
nuclear or diffuse localization of endogenous NRF2 in cells expressing GFP-WDR23
isoform 1 (n=74), GFP-WDR23 isoform 2 (n=84) or non-transfected cells from the same
experiment (n=490). Fisher’s exact test; **P<0.01, ***P<0.001.
!
48

Supplementary Figure 1. WDR23 is a conserved protein. a, Homology table of
selected WDR23 proteins with BLAST e-values among invertebrates and vertebrates. %
Length compared to C. elegans represents the extent of coverage of all matches on the
target sequence. b-e, Subcellular localization of human WDR23 isoform 1 in the
cytoplasm and nucleus (b) and WDR23 isoform 2 primarily in the nucleus (c) in HepG2
cells is similar to the expression of these same constructs observed in HEK-293T cells
(Figure 1) and of worm WDR-23A (d) and WDR-23B (e), respectively. f-g, The
subcellular localization of WDR23 isoform 1 (f) and WDR23 isoform 2 (h) in normal cells
is not measurably altered in cells treated with tBHQ and expressing WDR23 isoform 1
(g) or WDR23 isoform 2 (i).
!
49

Supplementary Figure 2. Specificity of impact of WDR23 in NRF2 cytoprotection.
a,b, Expression of C. elegans WDR-23A or WDR-23B is unable to alter NRF2
transcriptional responses in normal cells (a) or in cells with reduced KEAP1 expression
following KEAP siRNA treatment (b). c-e, Expression of WDR23 isoform 1 or isoform 2
does not significant reduce the expression of the NRF2 targets GCLM (c), ABCC1 (d) or
CYP4A11 (e) in the absence of stress. f-h, The increased expressioin of NRF2 targets
following exposure to tBHQ does not occur for PRDX1 (f) when WDR23 is ectopically
expressed while expression of NQO1 (g) and HO-1 (h) is still increased. i, The
compensatory increased expression of KEAP1 following stress is attenuated when
WDR23 isoform 1 or isoform 2 are overexpressed.
!
50

Supplementary Figure 3. Control experiments for Co-IP experiments. a,
Expression of GFP and subsequent IP of the GFP protein does not pull down NRF2,
DDB1, CUL4A, or KEAP1. b, Schematic NRF2 protein and localization of the binding
site of a NRF2 siRNA and domains used as antigens H-300 and C-20 for the production
of NRF2 specific antibodies. c,d, Specificity of the NRF2 protein detected in co-IPs when
detected by H-300 (c) and C-20 (d). Co-IP data contain (+) for GFP IP and (-) for control
(blocked GFP) IP.
!
51

Supplementary Figure 4. WDR23 expression reduces NRF2. a, The decreased level
of NRF2 protein when WDR23 is expressed is dependent on WDR23 and reversed by
WDR23 siRNA treatment. b,c, Expression of WDR23 reduces endogenous NRF2 levels
and is dependent on the proteasome.
!
52

Supplementary Figure 5. Persistence of WDR23-dependent regulation of NRF2
during stress. a,b, The interaction of WDR23 isoform 1 (a) or WDR23 isoform 2 (b)
with NRF2 occurs even in the presence of oxidative stress. c, The levels of WDR23
isoform 1, which is primarily cytoplasmic is less abundant than WDR23 isoform 2, which
is primarily nuclear. Co-IP data contain (+) for GFP IP and (-) for control (blocked GFP)
IP.

!
53

Supplementary Figure 6. ID of conserved domains in WDR23 by C. elegans
genetic screens. a, Most mutations in WDR-23 result in an increase in cytoprotection
from heavy metals. b-d, Strains harboring mutant versions of WDR-23 display increased
expression of the SKN-1/NRF2 cytoprotection targets gcs-1 (b), gst-4 (c), ugt-11 (d) and
compensatory increased expression of wdr-23 itself (e). f-u, The increased expression
of the SKN-1/NRF2 transcriptional reporter gst-4::gfp in wdr-23 mutants (f,h,j,l,n,p,r,t) is
dependent on skn-1 (g,i,k,m,o,q,s,u).
!
54

Supplementary Figure 7. Mutations in WDR23 alter subcellular localization. a-d,
The H306Y (a,b) and W335Stop (c,d) mutations do not measurably change the
subcellular localization of WDR23 isoform 1 while the same mutations in WDR23
isoform 2 leads to more cytoplasmic protein. e, The W335Stop mutation in WDR23
isoform 1 reduces the interaction with NRF2 and DDB1-CUL4 complexes. f, The H306Y
mutation in WDR23 isoform 2 reduces the interaction with NRF2 and DDB1-CUL4. Co-
IP data contain (+) for GFP IP and (-) for control (blocked GFP) IP.
!
55

Supplementary Figure 8. The interaction of WDR23 with NRF2 is dependent on
the Neh2 domain. a, WDR23 isoform 2 does not interact with NRF2ΔNeh2. b-i,
WDR23 isoform 1 (b,d,f,h) or WDR23 isoform 2 (c,e,g,i) still interact with NRF2ΔNeh4,5
(b,c), NRF2ΔNeh6 (d,e), NRF2ΔNeh1 (f,g), and NRF2ΔNeh3 (h,i). Co-IP data contain
(+) for GFP IP and (-) for control (blocked GFP) IP.
!
56

Supplementary Figure 9. WDR23 binding of NRF2 is independent of KEAP1. a,
Although expression of WDR23 can suppress some NRF2 transcriptional targets when
KEAP1 is reduced, NQO1 expression remains high. b,c, Mutation of the DLG (b) or
ETGE (c) motifs in the Neh2 domain of NRF2 does not abolish binding by WDR23. Co-
IP data contain (+) for GFP IP and (-) for control (blocked GFP) IP.
!
57

Supplementary Figure 10. Deregulation of WDR23 in human somatic tumors. a,
Location of WDR23 mutations sequence confirmed from somatic tumors in human
patients. Pink lines are in regions identified in C. elegans and human in this study that
result in SKN- 1/NRF2 activation. b, Somatic tumors isolated from lung cancer patients
with confirmed KEAP1 mutations have increased expression of WDR23. c, Samples
from stomach cancers with confirmed WDR23 mutations have increased expression of
KEAP1. d,e,
!
58
Supplementary Table 1: RNAi efficiencies
Genotype siRNA Average Fold Change
1
S.E.M. P-value
2

Wild-type Wdr23 0.147 0.018 ***
Wild-type Nrf2 0.548 0.047 ***
Wild-type Keap1 0.649 0.054 ***
Wdr23 Iso 1 o/e Keap1 0.531 0.025 ***
Wdr23 Iso 2 o/e Keap1 0.590 0.046 ***

1
As compared to wild-type with control siRNA
2
*P<0.05, **P<0.01, ***P<0.001

!
59
Supplementary Table 2: C. elegans wdr-23 mutants
Strain Allele Amino Acid Mutation
SPC296 lax101 Q80Stop
SPC318 lax123 D387N
SPC302 lax124 T400I
SPC206 lax126 W339Stop
SPC299 lax129 frameshift
SPC315 lax134 H310Y
SPC303 lax211 D313N
SPC317 lax213 G460R

!
60
Supplementary Table 3: DWD-box motif homology
Organism DWD-Box Motif Sequence
Consensus sssxDxxhxhWDhR
H. sapiens SNSKDQTIKLWDIR
M. Musculus SNSKDQTIKLWDIR
A. melanoleuca SNSKDQTIKLWDIR
T. guttata SGSLDKTIRLWDLR
D. melanogaster SNSKDQSIKIWDIR
S. pombe SASSDGEVKLWDIR
S. cerevisiae SSSKDGTIKIWDTV

!
61
Supplementary Table 4: COSMIC Database analysis of WDR23 mutations and
expression

Tissue
Point mutations
ID/Tested
Copy number variation
ID/Tested
Expression ID/Tested
Adrenal gland n.d.
1/72 increased 5/79 increased
n.d. n.d.
Bone 2/496
n.d. n.d.
n.d. n.d.
Breast 6/1350
8/987 increased 59/1092 increased
1/987 decreased 46/1092 decreased
CNS 1/2128
1/805 increased 25/662 increased
n.d. 59/662 decreased
Cervix 1/320
1/174 increased 20/305 increased
n.d. n.d.
Endometrium 7/631
2/421 increased 40/593 increased
n.d. 11/593 decreased
Lymphoid 1/2139
n.d. 12/216 increased
n.d. 2/216 decreased
Kidney 7/1474
n.d
n.d..
17/595 increased
13/595 decreased
Large Intestine 18/1356
3/699 decreased 20/602 increased
n.d. 22/602 decreased
Liver 6/1611
n.d. 24/359 increased
n.d. n.d.
Lung 8/1823
10/1102 increased 57/1008 increased
3/1102 decreased 30/1008 decreased
Oesophagus 4/791
3/108 increased 4/125 increased
n.d. 1/125 decreased
Ovary 2/831
2/721 increased 19/266 increased
1/721 decreased 38/266 decreased
Pancreas 2/1521
n.d.
n.d.
7/168 increased
2/168 decreased
Prostate 1/1019
n.d.
n.d.
16/491 increased
20/491 decreased
Skin 24/983
1/482 decreased 20/467 increased
n.d. 10/467 decreased
Soft tissue n.d.
3/139 increased 15/215 increased
n.d. 7/215 decreased
Stomach 10/587
1/348 increased 11/285 increased
n.d. 4/285 decreased
Thyroid 1/567
n.d.
n.d.
15/512 increased
6/512 decreased
Upper aerodigestive
tract
n.d.
4/467 inceased 19/517 increased
n.d. n.d.
Urinary tract 2/652
2/225 increased 22/393 increased
n.d. 8/393 decreased

!
62
Supplementary Table 5: qPCR primer sequences
Target Gene Forward Sequence Reverse Sequence
Human Targets
B2M AATGTCGGATGGATGAAACC TCTCTCTTTCTGGCCTGGAG
ABCC1 GTTTCTCAGATCGCTCACCC TCCACCAGAAGGTGATCCTC
ACADL TAGTATTCATTCAGGTATTGTC GCTCTGTCATTGCTATTG
ACADM CTGGTGCTGTTGGATTAG ATATTGCTTGGTGCTCTAC
ACADS GATTGTGCTGTGAACTAC CAACTTGAACTGGATGAC
CPT1A1 AATAAGCAGTCTCTTGATG CACTTCTGTATCCTTCTTC
CYP1A1 CCCAGCTCAGCTCAGTACCT GAGGCCAGAAGAAACTCCGT
CYP3A4 TTTTGTCCTACCATAAGGGCTTT CACAGGCTGTTGACCATCAT
CYP4A11 CTCAAAGCCCTCCAGCAGT ACCCATTTCTGAATCCGTTG
GCLC CTGGGGAGTGATTTCTGCAT AGGAGGGGGCTTAAATCTCA
GCLM AATCTTGCCTCCTGCTGTGTGA TGCGCTTGAATGTCAGGAATGC
GSR CAAGCTGGGTGGCACTTG TTGGAAAGCCATAATCAGCA
GSTA1 AATTCAGTTGTCGAGCCAGG CCGTGCATTGAAGTAGTGGA
HO-1 AGGTCATCCCCTACACACCA TGTTGGGGAAGGTGAAGAAG
KEAP1 CCAACTTCGCTGAGCAGATT GCTGATGAGGGTCACCAGTT
NQO1 GTTGCCTGAAAAATGGGAGA AAAAACCACCAGTGCCAGTC
NRF2 CGGTATGCAACAGGACATTG GTTTGGCTTCTGGACTTGGA
WDR23 TTCTCCCCCATTCATAGCAC CAGCTTCTTCACAATGTGGC

C. elegans Targets
snb-1 CCGGATAAGACCATCTTGACG GACGACTTCATCAACCTGAGC
gcs-1 CCAATCGATTCCTTTGGAGA TCGACAATGTTGAAGCAAGC
gst-4 GCTGAGCCAATCCGTATCAT CCGAATTGTTCTCCATCGAC
ugt-11 CCGATTTCTGGGACTCTCAA GGACTCCCAGGAAGTGTGAC

!
63
2.8 References
1 Shore, D. E. & Ruvkun, G. A cytoprotective perspective on longevity regulation.
Trends Cell Biol, doi:10.1016/j.tcb.2013.04.007 (2013).
2 Sykiotis, G. P. & Bohmann, D. Stress-activated cap'n'collar transcription factors in
aging and human disease. Science signaling 3, re3,
doi:10.1126/scisignal.3112re3 (2010).
3 Kensler, T. W., Wakabayashi, N. & Biswal, S. Cell survival responses to
environmental stresses via the Keap1-Nrf2-ARE pathway. Annu Rev Pharmacol
Toxicol 47, 89-116, doi:10.1146/annurev.pharmtox.46.120604.141046 (2007).
4 Slocum, S. L. & Kensler, T. W. Nrf2: control of sensitivity to carcinogens. Arch
Toxicol 85, 273-284, doi:10.1007/s00204-011-0675-4 (2011).
5 Liebler, D. C. & Guengerich, F. P. Elucidating mechanisms of drug-induced
toxicity. Nat Rev Drug Discov 4, 410-420, doi:10.1038/nrd1720 (2005).
6 Hussong, M. et al. The bromodomain protein BRD4 regulates the KEAP1/NRF2-
dependent oxidative stress response. Cell Death Dis 5, e1195,
doi:10.1038/cddis.2014.157 (2014).
7 Wasserman, W. W. & Fahl, W. E. Functional antioxidant responsive elements.
Proc Natl Acad Sci U S A 94, 5361-5366 (1997).
8 Lewis, K. N. et al. Regulation of Nrf2 signaling and longevity in naturally long-lived
rodents. Proc Natl Acad Sci U S A 112, 3722-3727,
doi:10.1073/pnas.1417566112 (2015).
9 Oliveira, R. P. et al. Condition-adapted stress and longevity gene regulation by
Caenorhabditis elegans SKN-1/Nrf. Aging Cell 8, 524-541, doi:10.1111/j.1474-
9726.2009.00501.x (2009).
10 Wakabayashi, N. et al. Keap1-null mutation leads to postnatal lethality due to
constitutive Nrf2 activation. Nat Genet 35, 238-245, doi:10.1038/ng1248 (2003).
11 Sporn, M. B. & Liby, K. T. NRF2 and cancer: the good, the bad and the
importance of context. Nat Rev Cancer 12, 564-571, doi:10.1038/nrc3278 (2012).
12 Jaramillo, M. C. & Zhang, D. D. The emerging role of the Nrf2-Keap1 signaling
pathway in cancer. Genes Dev 27, 2179-2191, doi:10.1101/gad.225680.113
(2013).
13 Keleku-Lukwete, N. et al. Amelioration of inflammation and tissue damage in
sickle cell model mice by Nrf2 activation. Proc Natl Acad Sci U S A 112, 12169-
12174, doi:10.1073/pnas.1509158112 (2015).
!
64
14 Johnson, J. A. et al. The Nrf2-ARE pathway: an indicator and modulator of
oxidative stress in neurodegeneration. Ann N Y Acad Sci 1147, 61-69,
doi:10.1196/annals.1427.036 (2008).
15 Koenitzer, J. R. & Freeman, B. A. Redox signaling in inflammation: interactions of
endogenous electrophiles and mitochondria in cardiovascular disease. Ann N Y
Acad Sci 1203, 45-52, doi:10.1111/j.1749-6632.2010.05559.x (2010).
16 Beyer, T. A., Auf dem Keller, U., Braun, S., Schafer, M. & Werner, S. Roles and
mechanisms of action of the Nrf2 transcription factor in skin morphogenesis,
wound repair and skin cancer. Cell Death Differ 14, 1250-1254,
doi:10.1038/sj.cdd.4402133 (2007).
17 Itoh, K. et al. Keap1 represses nuclear activation of antioxidant responsive
elements by Nrf2 through binding to the amino-terminal Neh2 domain. Genes Dev
13, 76-86 (1999).
18 Dinkova-Kostova, A. T. et al. Direct evidence that sulfhydryl groups of Keap1 are
the sensors regulating induction of phase 2 enzymes that protect against
carcinogens and oxidants. Proc Natl Acad Sci U S A 99, 11908-11913,
doi:10.1073/pnas.172398899 (2002).
19 Kobayashi, A. et al. Oxidative stress sensor Keap1 functions as an adaptor for
Cul3-based E3 ligase to regulate proteasomal degradation of Nrf2. Mol Cell Biol
24, 7130-7139, doi:10.1128/MCB.24.16.7130-7139.2004 (2004).
20 Itoh, K., Tong, K. I. & Yamamoto, M. Molecular mechanism activating Nrf2-Keap1
pathway in regulation of adaptive response to electrophiles. Free Radic Biol Med
36, 1208-1213, doi:10.1016/j.freeradbiomed.2004.02.075 (2004).
21 Choe, K. P., Przybysz, A. J. & Strange, K. The WD40 repeat protein WDR-23
functions with the CUL4/DDB1 ubiquitin ligase to regulate nuclear abundance and
activity of SKN-1 in Caenorhabditis elegans. Mol Cell Biol 29, 2704-2715,
doi:10.1128/MCB.01811-08 (2009).
22 Tang, L. & Choe, K. P. Characterization of skn-1/wdr-23 phenotypes in
Caenorhabditis elegans; pleiotrophy, aging, glutathione, and interactions with
other longevity pathways. Mech Ageing Dev 149, 88-98,
doi:10.1016/j.mad.2015.06.001 (2015).
23 Lydeard, J. R., Schulman, B. A. & Harper, J. W. Building and remodelling Cullin-
RING E3 ubiquitin ligases. EMBO Rep 14, 1050-1061,
doi:10.1038/embor.2013.173 (2013).
24 Lee, J. & Zhou, P. DCAFs, the missing link of the CUL4-DDB1 ubiquitin ligase.
Mol Cell 26, 775-780, doi:10.1016/j.molcel.2007.06.001 (2007).
25 Paek, J. et al. Mitochondrial SKN-1/Nrf mediates a conserved starvation response.
!
65
Cell Metab 16, 526-537, doi:10.1016/j.cmet.2012.09.007 (2012).
26 Pang, S. & Curran, S. P. Adaptive Capacity to Bacterial Diet Modulates Aging in C.
elegans. Cell Metab 19, 221-231, doi:10.1016/j.cmet.2013.12.005 (2014).
27 Pang, S., Lynn, D. A., Lo, J. Y., Paek, J. & Curran, S. P. SKN-1 and Nrf2 couples
proline catabolism with lipid metabolism during nutrient deprivation. Nature
communications 5, 5048, doi:10.1038/ncomms6048 (2014).
28 Lynn, D. A. et al. Omega-3 and -6 fatty acids allocate somatic and germline lipids
to ensure fitness during nutrient and oxidative stress in Caenorhabditis elegans.
Proc Natl Acad Sci U S A 112, 15378-15383, doi:10.1073/pnas.1514012112
(2015).
29 An, J. & Blackwell, T. SKN-1 links C. elegans mesendodermal specification to a
conserved oxidative stress response. Genes Dev 17, 1882-1893,
doi:10.1101/gad.1107803 (2003).
30 Inoue, H. et al. The C. elegans p38 MAPK pathway regulates nuclear localization
of the transcription factor SKN-1 in oxidative stress response. Genes &
development 19, 2278-2283, doi:10.1101/gad.1324805 (2005).
31 Tullet, J. M. et al. Direct inhibition of the longevity-promoting factor SKN-1 by
insulin-like signaling in C. elegans. Cell 132, 1025-1038,
doi:10.1016/j.cell.2008.01.030 (2008).
32 Glover-Cutter, K. M., Lin, S. & Blackwell, T. K. Integration of the unfolded protein
and oxidative stress responses through SKN-1/Nrf. PLoS Genet 9, e1003701,
doi:10.1371/journal.pgen.1003701 (2013).
33 Curran, S. & Ruvkun, G. Lifespan regulation by evolutionarily conserved genes
essential for viability. PLoS Genet 3, e56, doi:10.1371/journal.pgen.0030056
(2007).
34 Dong, Z. et al. Urea transporter UT-B deletion induces DNA damage and
apoptosis in mouse bladder urothelium. PLoS One 8, e76952,
doi:10.1371/journal.pone.0076952 (2013).
35 Higa, L. A. et al. CUL4-DDB1 ubiquitin ligase interacts with multiple WD40-repeat
proteins and regulates histone methylation. Nat Cell Biol 8, 1277-1283,
doi:10.1038/ncb1490 (2006).
36 Staab, T. A. et al. The conserved SKN-1/Nrf2 stress response pathway regulates
synaptic function in Caenorhabditis elegans. PLoS Genet 9, e1003354,
doi:10.1371/journal.pgen.1003354 (2013).
37 Hong, F., Sekhar, K. R., Freeman, M. L. & Liebler, D. C. Specific patterns of
electrophile adduction trigger Keap1 ubiquitination and Nrf2 activation. J Biol
!
66
Chem 280, 31768-31775, doi:10.1074/jbc.M503346200 (2005).
38 Kaspar, J. W., Niture, S. K. & Jaiswal, A. K. Nrf2:INrf2 (Keap1) signaling in
oxidative stress. Free Radic Biol Med 47, 1304-1309,
doi:10.1016/j.freeradbiomed.2009.07.035 (2009).
39 Aarnio, V. et al. Fatty acid composition and gene expression profiles are altered in
aryl hydrocarbon receptor-1 mutant Caenorhabditis elegans. Comp Biochem
Physiol C Toxicol Pharmacol 151, 318-324, doi:10.1016/j.cbpc.2009.12.006
(2010).
40 Li, Y., Paonessa, J. D. & Zhang, Y. Mechanism of chemical activation of Nrf2.
PLoS One 7, e35122, doi:10.1371/journal.pone.0035122 (2012).
41 Singh, S., Vrishni, S., Singh, B. K., Rahman, I. & Kakkar, P. Nrf2-ARE stress
response mechanism: a control point in oxidative stress-mediated dysfunctions
and chronic inflammatory diseases. Free Radic Res 44, 1267-1288,
doi:10.3109/10715762.2010.507670 (2010).
42 Chan, J. Y., Cheung, M. C., Moi, P., Chan, K. & Kan, Y. W. Chromosomal
localization of the human NF-E2 family of bZIP transcription factors by
fluorescence in situ hybridization. Hum Genet 95, 265-269 (1995).
43 Motohashi, H., O'Connor, T., Katsuoka, F., Engel, J. D. & Yamamoto, M.
Integration and diversity of the regulatory network composed of Maf and CNC
families of transcription factors. Gene 294, 1-12 (2002).
44 Blank, V. Small Maf proteins in mammalian gene control: mere dimerization
partners or dynamic transcriptional regulators? J Mol Biol 376, 913-925,
doi:10.1016/j.jmb.2007.11.074 (2008).
45 Sankaranarayanan, K. & Jaiswal, A. K. Nrf3 negatively regulates antioxidant-
response element-mediated expression and antioxidant induction of
NAD(P)H:quinone oxidoreductase1 gene. J Biol Chem 279, 50810-50817,
doi:10.1074/jbc.M404984200 (2004).
46 Leung, L., Kwong, M., Hou, S., Lee, C. & Chan, J. Y. Deficiency of the Nrf1 and
Nrf2 transcription factors results in early embryonic lethality and severe oxidative
stress. J Biol Chem 278, 48021-48029, doi:10.1074/jbc.M308439200 (2003).
47 Kang, M. I., Kobayashi, A., Wakabayashi, N., Kim, S. G. & Yamamoto, M.
Scaffolding of Keap1 to the actin cytoskeleton controls the function of Nrf2 as key
regulator of cytoprotective phase 2 genes. Proceedings of the National Academy
of Sciences of the United States of America 101, 2046-2051,
doi:10.1073/pnas.0308347100 (2004).
48 Zhang, D. D. & Hannink, M. Distinct cysteine residues in Keap1 are required for
Keap1-dependent ubiquitination of Nrf2 and for stabilization of Nrf2 by
!
67
chemopreventive agents and oxidative stress. Mol Cell Biol 23, 8137-8151 (2003).
49 Davis, M. W. et al. Rapid single nucleotide polymorphism mapping in C. elegans.
BMC Genomics 6, 118, doi:10.1186/1471-2164-6-118 (2005).
50 He, Y. J., McCall, C. M., Hu, J., Zeng, Y. & Xiong, Y. DDB1 functions as a linker to
recruit receptor WD40 proteins to CUL4-ROC1 ubiquitin ligases. Genes Dev 20,
2949-2954, doi:10.1101/gad.1483206 (2006).
51 Villeneuve, N. F., Lau, A. & Zhang, D. D. Regulation of the Nrf2-Keap1 antioxidant
response by the ubiquitin proteasome system: an insight into cullin-ring ubiquitin
ligases. Antioxid Redox Signal 13, 1699-1712, doi:10.1089/ars.2010.3211 (2010).
52 Hayes, J. D., McMahon, M., Chowdhry, S. & Dinkova-Kostova, A. T. Cancer
chemoprevention mechanisms mediated through the Keap1-Nrf2 pathway.
Antioxid Redox Signal 13, 1713-1748, doi:10.1089/ars.2010.3221 (2010).
53 Katoh, Y. et al. Two domains of Nrf2 cooperatively bind CBP, a CREB binding
protein, and synergistically activate transcription. Genes Cells 6, 857-868 (2001).
54 McMahon, M., Thomas, N., Itoh, K., Yamamoto, M. & Hayes, J. D. Redox-
regulated turnover of Nrf2 is determined by at least two separate protein domains,
the redox-sensitive Neh2 degron and the redox-insensitive Neh6 degron. J Biol
Chem 279, 31556-31567, doi:10.1074/jbc.M403061200 (2004).
55 Tong, K. I. et al. Keap1 recruits Neh2 through binding to ETGE and DLG motifs:
characterization of the two-site molecular recognition model. Mol Cell Biol 26,
2887-2900, doi:10.1128/MCB.26.8.2887-2900.2006 (2006).
56 Shibata, T. et al. Cancer related mutations in NRF2 impair its recognition by
Keap1-Cul3 E3 ligase and promote malignancy. Proc Natl Acad Sci U S A 105,
13568-13573, doi:10.1073/pnas.0806268105 (2008).
57 Shibata, T. et al. Genetic alteration of Keap1 confers constitutive Nrf2 activation
and resistance to chemotherapy in gallbladder cancer. Gastroenterology 135,
1358-1368, 1368 e1351-1354, doi:10.1053/j.gastro.2008.06.082 (2008).
58 Ohta, T. et al. Loss of Keap1 function activates Nrf2 and provides advantages for
lung cancer cell growth. Cancer Res 68, 1303-1309, doi:10.1158/0008-5472.CAN-
07-5003 (2008).
59 Forbes, S. A. et al. COSMIC: mining complete cancer genomes in the Catalogue
of Somatic Mutations in Cancer. Nucleic Acids Res 39, D945-950,
doi:10.1093/nar/gkq929 (2011).
60 Bamford, S. et al. The COSMIC (Catalogue of Somatic Mutations in Cancer)
database and website. Br J Cancer 91, 355-358, doi:10.1038/sj.bjc.6601894
(2004).
!
68
61 Wang, L. et al. Redundant pathways for negative feedback regulation of bile acid
production. Dev Cell 2, 721-731 (2002).
62 Kafri, R., Levy, M. & Pilpel, Y. The regulatory utilization of genetic redundancy
through responsive backup circuits. Proc Natl Acad Sci U S A 103, 11653-11658,
doi:10.1073/pnas.0604883103 (2006).
63 Shen, X. et al. Complementary signaling pathways regulate the unfolded protein
response and are required for C. elegans development. Cell 107, 893-903 (2001).
64 Sykiotis, G. P. & Bohmann, D. Keap1/Nrf2 signaling regulates oxidative stress
tolerance and lifespan in Drosophila. Dev Cell 14, 76-85,
doi:10.1016/j.devcel.2007.12.002 (2008).
65 Motohashi, H. & Yamamoto, M. Nrf2-Keap1 defines a physiologically important
stress response mechanism. Trends Mol Med 10, 549-557,
doi:10.1016/j.molmed.2004.09.003 (2004).
66 Suzuki, T. & Yamamoto, M. Molecular basis of the Keap1-Nrf2 system. Free
Radic Biol Med, doi:10.1016/j.freeradbiomed.2015.06.006 (2015).

!
69
Chapter 3: Identification of GEN-1 as a novel binding partner for WDR-23
Jacqueline Y. Lo, Brett N. Spatola, and Sean P. Curran
3.1 Abstract
Maintenance of proteostasis is critical for overall proper cellular function. WDR23 is a
substrate receptor of a cullin E3 ubiquitin ligase complex that is involved in proteasomal
degradation, but its substrates are largely unknown. Protein turnover removes damaged,
mis-folded, and aggregated proteins, but it also balances the amount of many of the
proteins required by the cell. Here we identify a diverse and novel list of potential
interactors of WDR-23 in C. elegans, and demonstrate one interaction, with GEN1, to be
confirmed biochemically in both the worm and human counterparts. Our results provide
the foundation to answer the questions: what are the substrates of WDR23, and what
other roles does WDR23 have?
3.2 Introduction
In humans, WDR23 is the substrate receptor in a cullin E3 ubiquitin ligase
complex. In addition to WDR23, this complex is composed of DDB1 (damaged DNA
binding protein 1), the adaptor protein, and CUL4, (the cullin). As such, WDR23 is also
referred to as DCAF11: DDB1 and CUL4 Associated Factor 11 protein. The structure of
WDR23 is primarily composed of seven WD40 repeats (repeats of the tryptophan
aspartic acid, WD, containing motif); these repeats facilitate protein-protein interactions.
Additionally, WDR23 also contains a highly conserved region named the DWD box; this
is the site of binding for DDB1 and ultimately, it assists in the formation of the E3
!
70
ubiquitin ligase complex
1
. While formation of this complex with WDR23 has been
identified in several species, its target substrates are largely unknown, especially in
humans.
In C. elegans, there also exists WDR23-DDB1-CUL4 complex with the homologs
of the respective proteins being: WDR-23 (substrate receptor), DDB-1 (adaptor), and
CUL-4 (cullin)
2
. A more fleshed-out role for WDR-23 has been identified in C. elegans,
as it has been implicated in detoxification, longevity, and development, all of which are
likely through its role as a negative regulator of SKN-1, the transcription factor for
oxidative stress in worms
3,4
. This role has been demonstrated to also exist in humans,
as we have found that human WDR23 is capable of regulating NRF2 (the homolog of
SKN-1) activity, as discussed in Chapter 2.
Knowledge of potential roles of WDR23 outside of oxidative stress response is
very limited. Here we have utilized our C. elegans model to screen for potential
interactors of WDR-23. We have generated a diverse and novel list of proteins that we
are in the process of confirming biochemically. From this screen, we have isolated GEN-
1 to be a direct binding partner of WDR-23. GEN-1, which is a Holliday junction
resolvase, is conserved in yeast (as Yen1), worms, and humans, all of which have been
shown to have endonuclease activity
5–7
. In worms, GEN-1 was shown to facilitate the
repair of double-stranded breaks (DSBs), but is not essential for the double-strand
break repair during meiotic recombination. Its role appears to be in DNA-damage
signaling, as gen-1 mutants are defective in ionizing radiation (IR) induced cell cycle
arrest and apoptosis
6
. As such, we are interested in WDR-23’s role in a different
!
71
cytoprotective response: does WDR-23 influence the worm’s response to stress-
induced double-strand breaks?
3.3 Results
Identification of novel interactors of CeWDR-23
In C. elegans, WDR-23 is identified to be the negative regulator of SKN-1, a
transcription factor that responds to xenobiotic and cellular stress. Due to its formation
in an E3 ubiquitin ligase complex, as well as its structure that allows for protein-protein
interaction, we hypothesize that WDR-23 is capable of assisting in other pathways
outside of oxidative stress and interacting with proteins other than SKN-1. To test this,
we performed a Yeast 2-Hybrid screen, with the entire C. elegans cDNA library as the
prey and full-length, wild-type WDR-23 as bait, to identify candidate proteins that may
potentially directly interact with WDR-23 (Fig. 1A). We screened 200,000 yeast colonies
and identified 70 prey constructs (Fig. 1B-C). Positive colonies from the screen were
first re-tested individually to confirm our two screening outputs: growth in Aureobasidin
A and X-α-galactosidase activity. The interaction was semi-quantified with the α-gal
quantitative assay (Fig. 1B). While there was no enrichment of any particular biological
category in our hits (Fig. 1C), we were interested in proteins that are well-conserved and
somewhat less defined biologically, but with potentially interesting roles. Our Yeast 2-
Hybrid screen yielded a diverse list of proteins, and we selected our strongest hits
based on our screening methods to verify biochemically.

!
72
CeGEN-1 is a direct interactor of CeWDR-23
GEN-1 was identified to be a strong candidate from our Yeast 2-Hybrid screen,
as it resulted in a strong growth in Aureobasidin A and high X-α-galactosidase, as
measured both qualitatively with blue/white screening and quantitatively with the α-gal
quantitative assay (Fig. 1B). GEN-1 is a Holliday junction resolving enzyme that is
involved in DNA damage repair; specifically, its activity is required for DNA double-
strand break repair by homologous recombination. Expression of GEN-1:GFP is seen in
the germline in hermaphrodite C. elegans (Fig. 2A-B). In particular, we observed high
expression of GEN-1::GFP in the developing oocytes (Fig. 2A) as well as the
spermatheca (Fig. 2B).
In order to confirm the interaction identified by the Yeast 2-Hybrid screen, we
performed co-immunoprecipitation in order to examine it biochemically. We saw that
when we immunoprecipitated either isoform of GFP:WDR-23, Isoform A or Isoform B,
we were also able to co-immunoprecipitate GEN-1 in the same complex (Fig. 2C-D,
Supplementary Fig. 1A-B). This indicates that WDR-23 Isoform A and B are both able to
directly interact with GEN-1.
The glycine at position 460 in WDR-23 is essential for interaction with GEN-1
Previously, we have identified eight novel alleles of wdr-23 that resulted in a loss-
of-function mutation (Chapter 2; Fig. 3A). While all wdr-23 mutants were unable to
regulate SKN-1 properly, there was a range in the strength of phenotypes in the assays
we performed. We were curious if any of these mutations interfered with the ability of
!
73
WDR-23 to interact with GEN-1. Hence, we performed site-directed mutagenesis to
mimic the mutants in our mammalian GFP-expression construct (GFP:WDR-23) and
performed co-immunoprecipitation. When we immunoprecipitated GFP:WDR-
23(D387N) (Fig. 3B), GFP:WDR-23(H310Y) (Fig. 3C), and GFP:WDR-23(D313N) (Fig.
3D), we were still able to detect interaction with GEN-1. However, the mutation G460R
in WDR-23 was able to completely abolish interaction with GEN-1 (Fig. 3E). These
results suggest that the glycine at position 460 in WDR-23 is required for its interaction
with GEN-1.
The interaction between CeWDR-23 and CeGEN-1 is conserved in humans
In humans, there also exists a GEN1 protein that is a resolvase for Holliday
junctions – the same role as in worms. Intriguingly, the most similar human protein for C.
elegans GEN-1 is actually ERCC5 (Table 1), which is another human DNA repair
protein, but is involved in DNA nucleotide excision repair following UV-damage
8–10
. Both
GEN1 and ERCC5 belong to the Rad2/XPG nuclease family, which is characterized by
conserved XPG domains (N-terminal and internal), as well as a HhH2 (helix hairpin
helix) motif (Fig. 4A)
11
. We were curious whether human WDR23 is also capable of
interacting with either human GEN1 and/or ERCC5. When we immunoprecipitated
human GFP:WDR23, we observed co-immunoprecipitation of GEN1 (Fig. 4B-C).
However, WDR23 appeared to specifically interact with GEN1 in humans because it did
not co-immunoprecipitate ERCC5 (Fig. 4D). This is particularly interesting because it
may shed insight on a specific role for WDR23 in the type of repair process it might be
involved in; GEN1 resolves Holliday junctions and DNA double-stranded break repair in
!
74
both humans and worms, but ERCC5 is specific for DNA excision repair in humans,
despite being more orthologous to worm GEN-1.
3.4 Discussion
We have identified GEN1 as a novel interactor for WDR23 in both worms and
humans. This expands the role of WDR23 outside of the oxidative stress pathway.
Additionally, through our C. elegans Yeast 2-Hybrid screen, we have generated a
candidate list of potential interactors of WDR-23 that we can use to explore and
investigate other pathways that WDR-23 might be involved in.
The discovery of the interaction of WDR23 with GEN1 opens up the possibility of
a cytoprotective role of WDR23 in DNA damage response. WDR23 has been shown to
have other cytoprotective roles because of its regulation of SKN-1/NRF2, but even
though SKN-1/NRF2 has been implicated in many stress response pathways, such as
redox balance
12–14
, detoxification
12,13,15
, immunity
16–18
, proteasome regulation
19–21
, and
lipid metabolism
22–25
, there is little known about a role of SKN-1/NRF2 in DNA damage
response. We are curious to identify whether there is a possible larger role for WDR23
in these stress response pathways in general.
The interaction in humans with GEN1 and not ERCC5, the more orthologous
human protein to C. elegans GEN-1, points to a possibility of specificity in WDR23’s
involvement in DNA repair pathways. While identification of this interaction in both
worms and humans is intriguing, there are several questions yet to be answered. We
speculate that the interaction of WDR23 and GEN1 results in protein regulation of GEN1,
!
75
but this still has to be tested. Additionally, what are the physiological consequences of
this interaction? We will be able to answer these questions through the combined use of
C. elegans and human cell culture models, with the former assisting us in physiological
and organismal phenotypes, and the latter in clarifying biochemistry phenotypes. Lastly,
identification of a residue that abolishes the interaction will greatly assist in this process;
specifically, it allows us to compare a system in worms where this interaction no longer
occurs and observe organismal phenotypes in this model. Our discovery of this novel
interaction provides the start to the elucidation of a new role for WDR23 in both C.
elegans and humans.
3.5 Methods
C. elegans strains utilized and culture methods
C. elegans were cultured using standard techniques
26
. The following strains were used:
wild-type N2 Bristol, CL2166[gst-4p::gfp], TG21511[gen-1(tm2940) III; gtSi02[Pgen-
1::GEN-1::GFP::gen-1; cb-unc-119(+)] II; unc-119(ed3) III], SPC296[wdr-
23(lax101;Q80Stop)], SPC318[wdr-23(lax123;D387N)], SPC302[wdr-23(lax124;T400I)],
SPC306[wdr-23(lax126;W339Stop)], SPC299[wdr-23(lax129;frameshift)], SPC315[wdr-
23(lax134;H310Y)], SPC303[wdr-23(lax211;D313N)], and SPC317[wdr-
23(lax213;G460R)]. Double mutants were generated by standard genetic techniques.
Ethyl methanesulfonate (EMS) mutagenesis was performed as described in Chapter 2.
Briefly, a C. elegans strain harboring the SKN-1 transcriptional reporter gst-4p::gfp was
mutagenized with EMS and F1 worms with high GFP expression (indicating SKN-1
!
76
activation), were selected. A complementation group of eight recessive alleles were
isolated and mapped to chromosome I. The wdr-23 gene was sequenced in each
mutant isolated to determine the specific mutation in each strain.
Yeast 2-Hybrid
Yeast 2-Hybrid was performed according to the manufacturer’s protocol (Clontech).
Briefly, a 50ml culture of Y2H Gold was prepared for competency and used for library-
scale transformation. The cells were combined with 7.5μg of bait plasmid DNA (Ce wdr-
23 in pLexA) and 7.5μg of prey plasmid DNA (Ce cDNA library in pACT2.2). After
transformation, 200,000 colonies were screened on SD –leu, – trp, X-α-gal plates.
Presence of both pLexA and pACT2.2 plasmids would allow for growth. Interaction
would drive transcription of X-α-galactosidase, resulting in blue colonies, compared to
the white colonies where X-α-galactosidase activity is absent. Prey plasmids of positive
hits were extracted and sequenced, and re-transformed individually with bait plasmid to
verify blue/white X-α-galactosidase screening. Additionally, each transformation was
also screened for growth in media with Aureobasidin A. Interaction would drive
transcription of the Aureobasidin A resistance gene. Lastly, the α-gal quantitative assay
was performed. Briefly, cultures of yeast were grown that expressed the pair of proteins
being analyzed in SD –leu –trp, X- α -gal. OD
600
was measured, and then the culture
was spun down to pellet the yeast. The supernatant was used for analysis. 16μl of
supernatant was combined with 48μl of Assay Buffer (2 volumes of 1X NaOAc Buffer
{0.5M sodium acetate pH 4.5} + 1 volume PNP-α-Gal Solution {100mM p-nitrophenyl α-
D-Galactopyranoside [Sigma] in diH
2
O}) and allowed to incubate at 30°C for 60 minutes.
!
77
The reaction was terminated by adding 136ul of 10X Stop Solution (1M Na
2
CO
3
in
diH
2
O), and the OD
410
was recorded. The α-galactosidase units were calculated: OD
410

x (final volume of assay: 200μl) x 1000 / [(p-nitrophenol molar absorbtivity at 410 nm x
light path: 10.5 ml/μmol) x (elapsed time: 60mins) x (supernatant volume: 16μl) x OD
600
].
Fluorescent imaging
Worms were placed in an M9/sodium azide solution on a 2% agarose/M9 pad on a
microscope slide for intact imaging. If gonad dissection was required, prior to placing
coverslip, the worm was cut open below the pharynx using a 27-gauge needle. This
allowed for reflexing of the gonad arm to outside of the worm.
Co-immunoprecipitation
Co-immunoprecipitation was performed as described in Chapter 2. Briefly, HEK-293T
cells were transiently transfected with indicated plasmids. Twenty-four hours post-
transfection, cells were lysed in 0.5% CHAPS buffer (10mM Tris/Cl pH 7.5, 150mM
NaCl, 0.5mM EDTA, 0.5% CHAPS) containing Halt Protease Inhibitor (Thermo Fisher).
Immunoprecipitation of GFP:WDR23 was performed according to the manufacturer’s
protocol (ChromoTek). Briefly, cell lysates were precleared with blocked magnetic
agarose GFP Trap beads for 1 hour at 4°C, followed by incubation with magnetic
agarose GFP Trap beads for 1 hour at 4°C. After three washes (10mM Tris/Cl pH 7.5,
150mM NaCl, 0.5mM EDTA) post-immunoprecipitation, immunoprecipitated protein
complexes were eluted in 2X sample buffer (0.1M Tris/Cl pH 6.8, 4% SDS, 20% glycerol,
!
78
0.2M DTT, 0.1% bromophenol blue) by boiling for 10 minutes at 95°C. Samples were
analyzed by Western blot.
Western blot analysis and antibodies
Western blot analysis was performed as described in Chapter 2. For detection of protein
complexes after co-immunoprecipitation, samples were electrophoresed through Bolt 4-
12% bis-tris polyacrylamide gels in MOPS running buffer (Thermo Fisher), transferred to
nitrocellulose membranes, and subjected to immunoblot analysis. Antibodies used
include: GFP GF28R (Thermo Fisher) and FLAG M2 (Sigma).
3.6 Acknowledgements
We thank L. Thomas and H. Kiani for technical support; A. Gartner for the gen-
1::gfp strain; the CGC, funded by NIH Office of Research Infrastructure Programs (P40
OD010440) for some strains; C. Tucker, Duke University for the C. elegans Y2H library
(developed by Maureen Barr’s laboratory).

!
79
3.7 Figures

Figure 1. Identification of novel interactors of CeWDR-23. (a) A Yeast 2-Hybrid
screen was designed to screen against an entire C. elegans cDNA library to identify
potential binding partners of WDR-23. Two screening methods were used, Aureobasidin
A resistance (screened with ability to grow) and α-galactosidase activity (screened with
blue or white cultures). (b) Quantification of α-galactosidase activity with α-gal
quantitative activity assay of selected set of hits. (c) The screen identified 70 novel
interactors of WDR-23, represented by their category in this pie chart.
a b
c
!
80

Figure 2. CeGEN-1 is a direct interactor of CeWDR-23. GEN-1 was identified with the
Yeast 2-Hybrid screen. (a) Expression of gen-1p::gen-1::gfp in C. elegans can be seen
in late developing oocytes in the hermaphrodite germline (arrows), (b) as well as in the
hermaphrodite spermatheca (arrow). (c) GEN-1 co-immunoprecipitates (IP) with WDR-
23 Isoform A, (d) as well as with WDR-23 Isoform B. HEK-293T cells were transfected
with GFP tagged C. elegans WDR-23 and 3xFLAG C. elegans tagged GEN-1. Lysates
were IP’d with GFP beads; GFP and FLAG antibodies were used for detection. Arrow
indicates specific band for GFP:WDR-23 that was IP’d.
a b
c d
IP:GFP IP:GFP
!
81

Figure 3. The glycine at position 460 in CeWDR-23 is essential for interaction with
CeGEN-1. (a) Schematic of C. elegans WDR-23 and the identity of eight recessive loss-
of-function alleles. (b) The WDR-23(D387N) mutation, (c) WDR-23(H310Y) mutation,
and (d) WDR-23(D313N) mutation are all still capable of interacting with GEN-1. (e) The
WDR-23(G460R) mutation abolishes binding with GEN-1. HEK-293T cells were
transfected with GFP tagged C. elegans WDR-23 mutants and 3xFLAG tagged C.
elegans GEN-1. Lysates were IP’d with GFP beads; GFP and FLAG antibodies were
used for detection.
a
b c d e
IP:GFP IP:GFP IP:GFP IP:GFP
!
82

Figure 4. The GEN1 and WDR23 interaction is conserved in humans. (a) C.
elegans GEN-1 is most orthologous with human ERCC5, but there is also a human
GEN1 protein that, like in C. elegans, is a Holliday junction resolvase. (b) Human GEN1
immunoprecipitates (IP) with human WDR23, Isoform 1 and (c) WDR23, Isoform 2. (d)
Human ERCC5 does not immunoprecipitate with human WDR23. HEK-293T cells were
transfected with GFP tagged human WDR23 and 3xFLAG tagged human GEN1 or
ERCC5. Lysates were IP’d with GFP beads; GFP and FLAG antibodies were used for
detection. Control (Ctrl) indicates IP with blocked GFP beads.
Figure 4b-c is work done by BNS.

a
b c
d
IP:GFP IP:GFP
IP:GFP
IP:Blocked
GFP
IP:Blocked
GFP
IP:Blocked
GFP
!
83
Table 1: Best BLASTP matches (adapted from www.WormBase.org)
BLASTP
e-value Species Hit Description % Length*

5.3e-25 S. cerevisiae SGD:YGR258C
(RAD2)
Single-stranded DNA
endonuclease;
cleaves single-
stranded DNA during
nucleotide excision
repair to excise
damaged DNA;
subunit of Nucleotide
Excision Repair Factor
3 (NEF3); homolog of
human XPG protein
82.7

6.5e-23 S. pombe SW:P28706
(RAD13)
DNA repair protein
rad13
82.9

6.6e-22 D. melanogaster FLYBASE:
CG10890
(MUS201)
Flybase gene name is
mus201-PD
73.5

8.8e-24 H. sapiens ENSEMBL:
ENSP00000347978
(ERCC5)
Isoform 1 of DNA
repair protein
complementing XP-G
cells
77.4

1.1e-13 H. sapiens GEN1 Flap endonuclease
GEN homolog 1
N/A

* % Length compared to C. elegans represents the extent of coverage of all matches on
the target sequence.
!
84

Supplementary Figure 1. Control experiment for WDR-23/GEN-1 Co-IP experiment.
(a) GEN-1 co-immunoprecipitates (IP) with WDR-23 Isoform A, (b) as well as with WDR-
23 Isoform B. HEK-293T cells were transfected with GFP tagged C. elegans WDR-23
and 3xFLAG tagged C. elegans GEN-1. Lysates were IP’d with GFP beads; GFP and
FLAG antibodies were used for detection. Control (Ctrl) indicates IP with blocked GFP
beads.
Supplementary Figure 1 is work done by BNS.

a
b
IP:GFP
IP:GFP
IP:Blocked
GFP
IP:Blocked
GFP
!
85
3.8 References
1. Lee, J. & Zhou, P. DCAFs, the missing link of the CUL4-DDB1 ubiquitin ligase.
Mol. Cell 26, 775–80 (2007).
2. Choe, K. P., Przybysz, A. J. & Strange, K. The WD40 repeat protein WDR-23
functions with the CUL4/DDB1 ubiquitin ligase to regulate nuclear abundance and
activity of SKN-1 in Caenorhabditis elegans. Mol. Cell. Biol. 29, 2704–15 (2009).
3. Leung, C. K. et al. Direct Interaction between the WD40 Repeat Protein WDR-23
and SKN-1/Nrf Inhibits Binding to Target DNA. Mol. Cell. Biol. 34, 3156–3167
(2014).
4. Curran, S. P. & Ruvkun, G. Lifespan Regulation by Evolutionarily Conserved
Genes Essential for Viability. PLoS Genet. 3, e56 (2007).
5. Ip, S. C. Y. et al. Identification of Holliday junction resolvases from humans and
yeast. Nature 456, 357–61 (2008).
6. Bailly, A. P. et al. The Caenorhabditis elegans Homolog of Gen1/Yen1
Resolvases Links DNA Damage Signaling to DNA Double-Strand Break Repair.
PLoS Genet. 6, e1001025 (2010).
7. Rass, U. et al. Mechanism of Holliday junction resolution by the human GEN1
protein. Genes Dev. 24, 1559–69 (2010).
8. Shiomi, T. et al. An ERCC5 gene with homology to yeast RAD2 is involved in
group G xeroderma pigmentosum. Mutat. Res. 314, 167–75 (1994).
9. MacInnes, M. A. et al. Human ERCC5 cDNA-cosmid complementation for
excision repair and bipartite amino acid domains conserved with RAD proteins of
Saccharomyces cerevisiae and Schizosaccharomyces pombe. Mol. Cell. Biol. 13,
6393–402 (1993).
10. Mudgett, J. S. & MacInnes, M. A. Isolation of the functional human excision repair
gene ERCC5 by intercosmid recombination. Genomics 8, 623–33 (1990).
11. Bauknecht, M. & Kobbe, D. AtGEN1 and AtSEND1, two paralogs in Arabidopsis,
possess holliday junction resolvase activity. Plant Physiol. 166, 202–16 (2014).
12. An, J. H. & Blackwell, T. K. SKN-1 links C. elegans mesendodermal specification
to a conserved oxidative stress response. Genes Dev. 17, 1882–93 (2003).
13. Sykiotis, G. P. & Bohmann, D. Stress-activated cap’n'collar transcription factors in
aging and human disease. Sci. Signal. 3, re3 (2010).
14. Tullet, J. M. A. et al. Direct inhibition of the longevity-promoting factor SKN-1 by
insulin-like signaling in C. elegans. Cell 132, 1025–38 (2008).
!
86
15. Kobayashi, M. & Yamamoto, M. Nrf2-Keap1 regulation of cellular defense
mechanisms against electrophiles and reactive oxygen species. Adv. Enzyme
Regul. 46, 113–40 (2006).
16. Inoue, H. et al. The C. elegans p38 MAPK pathway regulates nuclear localization
of the transcription factor SKN-1 in oxidative stress response. Genes Dev. 19,
2278–83 (2005).
17. Papp, D., Csermely, P. & Sőti, C. A role for SKN-1/Nrf in pathogen resistance and
immunosenescence in Caenorhabditis elegans. PLoS Pathog. 8, e1002673
(2012).
18. Liu, F. et al. Nuclear hormone receptor regulation of microRNAs controls innate
immune responses in C. elegans. PLoS Pathog. 9, e1003545 (2013).
19. Li, X. et al. Specific SKN-1/Nrf stress responses to perturbations in translation
elongation and proteasome activity. PLoS Genet. 7, e1002119 (2011).
20. Pickering, A. M., Linder, R. A., Zhang, H., Forman, H. J. & Davies, K. J. A. Nrf2-
dependent induction of proteasome and Pa28αβ regulator are required for
adaptation to oxidative stress. J. Biol. Chem. 287, 10021–31 (2012).
21. Pickering, A. M., Staab, T. A., Tower, J., Sieburth, D. & Davies, K. J. A. A
conserved role for the 20S proteasome and Nrf2 transcription factor in oxidative
stress adaptation in mammals, Caenorhabditis elegans and Drosophila
melanogaster. J. Exp. Biol. 216, 543–53 (2013).
22. Bishop, N. A. & Guarente, L. Two neurons mediate diet-restriction-induced
longevity in C. elegans. Nature 447, 545–9 (2007).
23. Paek, J. et al. Mitochondrial SKN-1/Nrf mediates a conserved starvation response.
Cell Metab. 16, 526–37 (2012).
24. Pang, S. & Curran, S. P. Adaptive capacity to bacterial diet modulates aging in C.
elegans. Cell Metab. 19, 221–31 (2014).
25. Pang, S., Lynn, D. A., Lo, J. Y., Paek, J. & Curran, S. P. SKN-1 and Nrf2 couples
proline catabolism with lipid metabolism during nutrient deprivation. Nat. Commun.
5, 5048 (2014).
26. Brenner, S. The genetics of Caenorhabditis elegans. Genetics 77, 71–94 (1974).

Abstract (if available)

Abstract Throughout its lifespan, an organism will encounter several sources of stress, both endogenous and environmental, that will challenge its system to respond appropriately in order to defend against damage and to restore homeostasis. As the organism ages, its ability to properly activate such pathways will decline

Linked assets

University of Southern California Dissertations and Theses

Conceptually similar

PDF

WDR23-mediated regulation of the DNA damage response, oxidative stress resistance, and glucose metabolism

PDF

SKN-1 coordination of stress adaptation, metabolism, and resource allocation in Caenorhabditis elegans

PDF

Elucidating the mechanism behind the negative outcomes associated with hyperactive SKN-1

PDF

Dissecting novel roles for MAFR-1 in reproduction and metabolic homeostasis

PDF

Regulation of Caenorhabditis elegans small RNA pathways: an examination of Argonaute protein RNA binding and post-translational modifications in C. elegans germline

PDF

Destabilization of the replication fork protection complex is associated with meiotic defects in fission yeast

PDF

Biochemical mechanism of TopBP1 recruitment to sites of DNA damage

PDF

Characterizing the physiological roles and regulatory mechanisms of Maf1

PDF

Subnuclear localization of replication origins is controlled by Fkh1-dependent recruitment of DDK to origins in S. cerevisiae

PDF

The organization of small RNA pathways within C. elegans germ granules: mutator foci formation, regulation, and interaction

PDF

Molecular mechanism of the recruitment of SWI/SNF chromatin remodeling complex and histone acetyltransferase to estrogen-responsive promoters

PDF

Positive regulation of RNA polymerase III-mediated transcription of tRNA genes by the Mediator kinase submodule

PDF

Packaging and delivery of plasmids by bacterial extracellular vesicles

PDF

The role of PAX8 in epithelial ovarian carcinoma

PDF

An essential role of argininosuccinate synthase 1 in Kaposi’s sarcoma-associated herpesvirus-induced cellular transformation

PDF

Unraveling the role of iron-sulfur clusters in DNA repair enzymes

PDF

Functional analysis of a prostate cancer risk enhancer at 7p15.2

PDF

The effects of prolonged fasting/ fasting mimicking diet (FMD) on CNS protection, regeneration, and treatment

PDF

The role of DNA methylation in early detection and progression of pancreatic cancer

PDF

Mechanism of secretion and function of heat shock protein-90 (Hsp90) family genes

Asset Metadata

Creator Lo, Jacqueline Yachiee (author)

Core Title Novel roles of the WDR23-DDB1-CUL4 ubiquitin ligase complex in cytoprotection

Contributor Electronically uploaded by the author (provenance)

School College of Letters, Arts and Sciences

Degree Doctor of Philosophy

Degree Program Molecular Biology

Publication Date 04/25/2016

Defense Date 03/10/2016

Publisher University of Southern California (original), University of Southern California. Libraries (digital)

Tag C. elegans,cancer,chemotherapy,cytoprotection,DCAF11,human,KEAP1,NFE2L2,Nrf2,OAI-PMH Harvest,WDR23

Format application/pdf (imt)

Language English

Advisor Curran, Sean P. (committee chair), Michael, Matthew (committee member), Stallcup, Michael (committee member), Tower, John (committee member)

Creator Email jacqueline.lo@usc.edu,jacqueyl@usc.edu

Permanent Link (DOI) https://doi.org/10.25549/usctheses-c40-242224

Unique identifier UC11278103

Identifier etd-LoJacqueli-4369.pdf (filename),usctheses-c40-242224 (legacy record id)

Legacy Identifier etd-LoJacqueli-4369.pdf

Dmrecord 242224

Document Type Dissertation

Format application/pdf (imt)

Rights Lo, Jacqueline Yachiee

Type texts

Source University of Southern California (contributing entity), University of Southern California Dissertations and Theses (collection)

Access Conditions The author retains rights to his/her dissertation, thesis or other graduate work according to U.S. copyright law. Electronic access is being provided by the USC Libraries in agreement with the a...

Repository Name University of Southern California Digital Library

Repository Location USC Digital Library, University of Southern California, University Park Campus MC 2810, 3434 South Grand Avenue, 2nd Floor, Los Angeles, California 90089-2810, USA