University of Southern California Dissertations and Theses

MicroRNAs involved in the regulation of Endothelin-1 gene expression in endothelial cells

(USC Thesis Other)

MicroRNAs involved in the regulation of Endothelin-1 gene expression in endothelial cells

PDF

Download a page range

Download transcript

Copy asset link

Request this asset

Transcript (if available)

Content

MICRORNAs INVOLVED IN THE REGULATION OF ENDOTHELIN-1 GENE
EXPRESSION IN ENDOTHELIAL CELLS

by

Chen Li

A Thesis Presented to the
FACULTY OF THE USC GRADUATE SCHOOL
UNIVERSITY OF SOUTHERN CALIFORNIA
In Partial Fulfillment of the
Requirements for the Degree
MASTER OF SCIENCE
(BIOCHEMISTRY AND MOLECULAR BIOLOGY)

August 2012

Copyright 2012 Chen Li
ii

ACKNOWLEDGEMENTS
I would like to express my special thanks to Dr. Vijay Kalra, my mentor of this project
and the chair of committee, whose erudite knowledge and warm-hearted care in both
academic and daily life within the past year made my scientific endeavor in United States
and in the University of Southern California an extremely enjoyable journey and full of
excitement. I would also like to thank Dr. Stanley Tahara. His instructive and rigorous
requirements towards scientific research always drove me to be a serious researcher along
this journey, and with his guidance to become successful. I shared a lot of joy and hard
work with them, and gained much appreciated advice and encouragements from these
two professors. Thus, I owe my deepest gratitude to them.
I want to thank to my program advisor Dr. Zoltan Tokes for serving on my committee
and kindly providing me with a lot of valuable insights towards my career path and
course selections in the past two years.
I am thankful to my lab members, Vicky Yamamoto, Monisha Ravichandran and Jo Lee
who really helped me in this project, as well as all the professors at the Keck School of
Medicine for their contribution to my education and passing on of their knowledge to me;
this profoundly contributed to my intellectual growth.
Finally, I am eternally grateful to my parents, Minqiang Li and Jing Cai, my family
members and my friends. Their unconditional support in my education and research,
together with their eager expectations, tremendously motivated me to push forward and
confront all challenges confidently in this journey.
iii

TABLE OF CONTENTS
Acknowledgements ii
List of Figures v
Abstract vi
Chapter 1: Introduction 1
1.1. Sickle Cell Disease 1
1.2. Pulmonary Hypertension 2
1.3. Vasoactive factors involved in regulation of vascular tone and
pulmonary hypertension 3
1.4. Biology of endothelin-1 molecule 4
1.5. Placenta growth factor (PlGF) 6
1.6. MicroRNA (miRNA) 9
1.7. Biogenesis of miRNA 11
1.8. The mechanism of miRNA mediated gene silencing 13

Chapter 2: Hypothesis and Specific Aims 15
2.1. Hypothesis 16
2.2. Specific aims 16

Chapter 3: Material and Methods 17
3.1. Reagents 17
3.2. Endothelial cell culture 17
3.3. Transient Transfection 18
3.4. Isolation of RNA and qRT-PCR 19
3.5. Isolation and quantitation of miRNA 20
3.6. Construction of pGL-3-ET-1-3’UTR luciferase reporter construct 21
3.7. Statistical Analysis 22

Chapter 4: Results 23
4.1. Post-transcriptional regulation of PlGF-mediated ET-1 mRNA expression 23
4.2. Identification of miRNAs involved in destabilization of ET-1 mRNA in 24
HMEC-1
4.3. Quantitative expression of Pre-miR-648 in HMEC-1 27
4.4. Effect of miRs and anti-miRs on the expression of ET-1 mRNA 28
4.5. Effect of miR-648 on the target-binding sites in the 3’UTR of ET-1
mRNA utilizing ET-1 reporter luciferase assay 30

Chapter 5: Discussion 33
5.1. Discussion 33
iv

5.2. Conclusion 36
5.3. Future direction 36

Bibliography 38

v

LIST OF FIGURES
Figure 1: ROS activates transcription factors leading to expression of
inflammatory and cyto protective genes. 1

Figure 2: PlGF-induced ET-1 expression in human endothelial cells involves
activation of HIF-1α. 8

Figure 3: Working model of biogenesis of miRNA 12

Figure 4: Two mechanisms of miRNA –mediated posttranscriptional repression 13

Figure 5: Post transcriptional regulation of ET-1 mRNA 24

Figure 6: The location of miRNA binding sites on HIF-1α mRNA and ET-1 mRNA 24

Figure 7: miRNA levels in HMEC-1 upon PlGF treatment 25

Figure 8: Quantitative expression of Pre-miR-648 and Pre-miR-934 in HMEC-1 27

Figure 9: Effect of miRs and anti-miRs on the expression of ET-1 mRNA 29

Figure 10: Effect of miR-648 on the target-binding sites in the 3’UTR of ET-1
mRNA utilizing ET-1 reporter luciferase assay 31

vi

ABSTRACT

Pulmonary hypertension (PHT) is a highly prevalent complication of Sickle Cell Disease
(SCD) and it is a major cause of early morbidity and mortality in sickle cell patients.
SCD patients with PHT show reduced nitric oxide (NO) and increased expression of a
vaso-constrictor— endothelin-1 (ET-1) in plasma. The previous work of our laboratory
has shown that Placenta Growth Factor (PlGF), elaborated from erythroid cells, shows
high levels in the plasma of SCD patients, compared to the normal individuals, PlGF was
shown to induce the expression of inflammatory cytochemokines and endothelin-1
through a mechanism involving the activation of hypoxia induced factor-1 (HIF-1α).
Moreover, studies showed that binding of HIF-1α to the hypoxia response elements (HRE)
in the promoter region of the ET-1 gene leads to increased levels of ET-1 mRNA.
However, the mechanism that enhances ET-1 mRNA stability in response to PlGF
remains unclear.
In the present work, we showed that in human dermal microvascular endothelial cell line
(HMEC-1), the stability of ET-1 mRNA was increased in response to PlGF treatment.
We also observed that in PlGF treated HMEC-1, among several microRNAs (miRNA)
which have a potential binding site on ET-1 mRNA and HIF- 1α mRNA, the levels of
miR-648, miR-934 and miR-199a-5p were repressed significantly. Furthermore, we
showed that among these microRNA candidates, miR-648 attenuated ET-1 mRNA
vii

expression, while antimiR-648 increased the expression of ET-1 mRNA under basal and
PlGF treated conditions. To further validate this result, we constructed a pGL3-ET-1-
3’UTR luciferase reporter. The activity of reporter construct was reduced by miR-648
mimic while antimiR-648 increased the reporter activity, both under basal and PlGF
treated conditions. These studies showed miR-648 is involved in the regulation of ET-1
mRNA expression as a result of binding to the 3’UTR region of ET-1 mRNA. This study,
for the first time, identified a novel miRNA regulator which functions in the expression
of ET-1, and may play an important role in affecting pulmonary hypertension in SCD.

1

CHAPTER 1
INTRODUCTION
1.1. Sickle Cell Disease
Sickle cell disease (SCD) is a genetic disorder caused by the mutation in the β-globin
chain of the hemoglobin molecule, wherein the sixth amino acid residue, glutamine is
replaced by valine. The abnormal hemoglobin (HbS), due to polymerization at low
oxygen tension, forms 14 strands of fibers, which distort the shape of the red blood cells
to a sickle shape. The deformed sickle red blood cells when passing through small
capillaries undergo hemolysis, leading to hemolytic anemia. Furthermore, adhesion and
trapping of these
SS RBCs in the
small capillaries
and venules
leads to localized
ischemia or
hypoxia, which
further induces
sickling, and thus
a vicious cycle develops (Fig.1) (Francis & Johnson, 1991; Platt, et al., 1991; Wong, et
al., 1992). The vascular occlusion, which is mainly caused by the blockage of
Fig.1. ROS activates transcription factors leading to expression of
inflammatory and cyto- protective genes.
2

microvasculature by sickle erythrocytes, results in a series of severe complications such
as painful vaso-occlusive crises, acute chest syndrome and irreversible organ damage,
leading to stroke and renal failure. In the US, 8% of Afro-Americans are carriers for HbS,
while 100,000 individuals are homozygous for sickle cell disease (SCD). The median life
span of homozygous SCD individuals in the US is approximately 50 years. However, in
sub-Saharan Africa 180,000 infants are born per year with SCD, and 50% of them die
before 5 years of age (Modell, 2008). At present there are no therapies available for
treatment of SCD, though hydroxyurea has been approved for use in humans, which
causes an increase in hemoglobin F (HbF) levels in SS RBCs. The increased amount of
HbF in SS RBC delays polymerization of HbSS. This drug is effective in only 50% of the
SCD patients. Moreover, this drug has been found to be a teratogenic agent, in animal
studies. Thus hydroxyurea has the potential for side effects in SCD patients (Steinberg, et
al., 1997). For these reasons, new drugs should be developed for treatment of SCD.
However, to determine the targets of new drugs beneficial for treatment of SCD, we have
to understand the contribution of SS RBCs biology to vascular dysfunction and acute
chest syndrome (Modell, 2008).

1.2. Pulmonary Hypertension
Acute chest syndrome (ACS) is the most widely observed acute pulmonary disease in
adult patients with SCD, affecting 15% to 40% of the total number of SCD patients
(Castro, et al., 1994). It is the second most common cause of hospitalization and a leading
3

cause of both morbidity and mortality (Vichinsky, et al., 1997). Pulmonary hypertension
(PHT) occurs in ~30% of patients with ACS, and affects both adults and children
(Gladwin, et al., 2004). PHT is a significant risk factor for early mortality in SCD patients
and in adults it is associated with a 40-50% risk of death within 2-3 years (Gladwin, et al.,
2004; Minniti, et al., 2009). Factors implicated in PHT in SCA include: endothelial
dysfunction, pulmonary vasoconstriction, and vascular remodeling. All of these factors
are associated with chronic hemolysis, hypoxia, hemostatic activation i.e. coagulation,
and inflammation (Ataga, et al., 2004; Castro, et al., 1994; Hsu, et al., 2007; Minniti, et
al., 2009).

1.3. Vasoactive factors involved in regulation of vascular tone and pulmonary
hypertension
There are two opposing pulmonary vasoactive factors that regulate pulmonary vascular
tone, Nitric Oxide (NO), a vasodilator, and Endothelin-1, a vasoconstrictor (Ergul, et al.,
2004; Hsu, et al., 2007). Studies of Gladwin and his coworkers have shown that plasma
of SCD patients have reduced bioavailability of nitric oxide, due to scavenging of nitric
oxide by excess hemoglobin released following increased hemolysis of SS RBC (Hsu, et
al., 2007). In SCD patients, the reduced bioavailability of NO correlated with mean
pulmonary artery pressure (PAP), an indicator of pulmonary hypertension. In other words,
lower NO levels correlated with increased PAP or PHT in SCD patients. There are two
sources of nitric oxide, one involves activation of nitric oxide synthase (iNOS and eNOS)
4

and the other involves metabolism of arginine. Studies showed reduced amount of
arginine in the plasma of SCD indicating increased degradation of arginine (Morris, et al.,
2005). Thus, it was hypothesized that administration of arginine to SCD patients should
increase NO and improve PHT. However, the clinical trial of arginine in SCD patients
was found to be ineffective in PHT of SCD patients (Bunn, et al., 2010). Thus, other
mechanisms must exist that contribute to PHT. Studies from our laboratory hypothesized
that endothelin-1 may play an important role in PHT of SCD patients. Studies from ours
and other laboratories have shown higher levels of ET-1 in the plasma of SCD patients
compared to matched control subjects (Patel, Gonsalves, Malik, & Kalra, 2008;
Sundaram, et al., 2010).

1.4. Biology of endothelin-1 molecule
There are three isoforms of human endothelin, ET-1, ET-2 and ET-3. It has been shown
that ET-1 and ET-2 are 90% homologous in amino acid sequence, and ET-3 is 70%
identical to ET-1 and ET-2. ET-1, which was identified as a 24kD endothelium-derived
factor, is the predominant one among the three human isoforms involved in the regulation
of blood pressure in arteries. Studies show that there is a significant increase in plasma
levels of ET-1 in patients who develop hypertension, atherosclerosis, heart disease, and
SCD (Barton & Yanagisawa, 2008). Studies also show that endothelin-1 plays a role in
cell growth and invasion in many tumors including ovarian, prostate and breast cancer
(Bagnato & Rosano, 2008). Moreover, studies show that ET-1 is involved in neurological
5

function (Dashwood & Loesch, 2010; Hans, Schmidt, & Strichartz, 2009; Khimji &
Rockey, 2010) and autoimmune disorders (Ramos-Casals, Fonollosa-Pla, Brito-Zeron, &
Siso-Almirall, 2010).
Previous studies have shown that a number of factors are involved in the regulation of
ET-1, such as transforming growth factor- β (TGF-β) (Kurihara, et al., 1989), tumor
necrosis factor-α (TNF-α) (Marsden & Brenner, 1992), interleukin-1 (IL-1) (Yoshizumi,
et al., 1990), insulin (Oliver, et al., 1991), nitric oxide (Blanchard, Acquaviva, Galson, &
Bunn, 1992), and hypoxia (Aversa, et al., 1997; Blanchard, et al., 1992). Moreover, it has
been shown that cis-regulatory elements contribute to the regulation of ET-1 by direct
binding to the specific promoter regions located upstream of the transcription start site
(TSS), such as activator protein-1 (AP-1), nuclear factor-1 (NF-1) and GATA-2 (M. E.
Lee, Bloch, Clifford, & Quertermous, 1990).
Hypoxia is one of the most potent inducers of ET-1, and the expression of ET-1 has been
shown to be up-regulated by hypoxia inducible factor-1 α (HIF-1α) (Hu, Discher,
Bishopric, & Webster, 1998; Yamashita, Discher, Hu, Bishopric, & Webster, 2001).
These studies showed that binding of HIF-1α occurs at a hypoxia response element (HRE)
positioned at -118 to -125 bp upstream from the 5’ transcription start site of ET-1 gene, in
response to hypoxia.
Previous studies from our laboratory showed a significant, high level of ET-1 in the
plasma of patients with SCD, which correlates with pulmonary artery pressure (PAP), an
indicator of pulmonary hypertension (Patel, et al., 2008). The role of ET-1 in PHT is
6

supported by studies showing endothelin-1 receptor antagonists are beneficial in the
treatment of primary pulmonary hypertension (Benza, 2008; Rybicki & Benjamin, 1998)
and endothelin-1 receptor antagonists have also been found to be effective in sickle-
Antilles-hemoglobin-D mice exhibiting PHT (Sabaa, et al., 2008). These studies show
that ET-1 is an important factor in pulmonary hypertension in sickle cell anemia.
However, the molecular mechanism of ET-1 up-regulation in sickle pulmonary
hypertension is relatively less known.

1.5. Placenta growth factor (PlGF)
Placenta growth factor (PlGF) is an angiogenic growth factor, which belongs to the
platelet derived growth factor/vascular endothelial growth factor (PDGF/VEGF) family.
PlGF has a high sequence similarity to VEGF, and it binds to vascular endothelial growth
factor receptor-1 (VEGFR-1), while VEGF binds to both VEGFR-1 and VEGFR-2,
although VEGF has a higher affinity to VEGFR-2 than VEGFR-1. Furthermore, PlGF
has been shown to cause increased secretion of VEGF from monocytes.
Previous studies from our laboratory show that the level of placenta growth factor (PlGF)
in plasma of human patients with SCD are higher than the healthy controls, and the
increase in PlGF levels is strongly associated with the increased incidence of vaso-
occlusion (Perelman, et al., 2003). PlGF was previously shown to be secreted by
placental trophoblasts and human umbilical vein endothelial cell (HUVEC) (Perelman, et
al., 2003), and recent studies show that PlGF can also be produced by erythroid cells
7

(Tordjman, et al., 2001). Thus, the high level of PlGF observed in SCD patient plasma is
likely to result from increased erythropoiesis in SCD individuals (Perelman, et al., 2003).
Also, it has been observed that PlGF levels are significantly increased in patients with
chronic hemolytic anemia, such as β-thalassemia (Perelman, et al., 2003; Selvaraj, et al.,
2003).
Based on these observations, our laboratory hypothesized that PlGF likely activates the
endothelial cells which line blood vessels and circulating monocytes for induction of
inflammation and vasoconstriction. This hypothesis was later validated by the study on
humanized sickle (Berkeley-SS) mice, in which significantly elevated levels of PlGF and
ET-1 in plasma were observed (Sundaram, et al.). The specific contribution of elevated
PlGF to pulmonary hypertension has been further validated by simulating erythroid
expression of PlGF using a lentiviral vector in normal mice to the levels of PlGF in
Berkeley-SS mice (Sundaram, et al.). Normal mice over-expressing PlGF showed
increased production of ET-1, and developed increased right ventricular (RV) pressures,
RV hypertrophy and pulmonary fibrosis, which is consistent with pulmonary
hypertension (Sundaram, et al.). Indeed, studies conducted by another research group also
found a positive association between high PlGF levels to pulmonary hypertension in the
patients with SCA (Brittain, et al., 2010), thus validating results obtained from our group.
These studies strongly support the role of PlGF induced ET-1 in pulmonary hypertension
in sickle animal models and human patients. However, additional studies are needed to
understand the molecular mechanisms of ET-1 expression regulated by PlGF. These
8

Fig.2. PlGF-induced ET-1 expression in human endothelial cells involves activation of HIF-
1 α.
PlGF-induced cytochemokines expression in monocytes involves up-regulation of ET-1 in
endothelial cells followed by interaction of ET-1 with ET-BR in monocytes. PlGF activates the
NAPDH-oxidase pathway to produce ROS and activates PI-3 kinase. Both of these pathways
activate HIF-1 α which translocate into the nucleus and forms heterodimers with HIF-1β. The
complex binds to HRE in ET-1 promoter.
Adapted from Patel et. al. Blood. (112) 856-865. 2008. Gonsalves and Kalra. J Immunology. (185)
6253-6264.2010
studies will provide insight into how to reduce the expression of ET-1 and thus
antagonize pulmonary hypertension.
Previous studies from our laboratory show that PlGF mediated ET-1 expression in human
pulmonary microvascular endothelial cells (HPMVEC) involves HIF-1α, via an
activation of NADPH oxidase and PI-3Kinase (Fig. 2) (Patel, et al., 2008). Furthermore,
9

these studies showed that ET-1 released from endothelial cells activated human
monocytes through ET-BR and up-regulated the expression of cytochemokines MCP-1,
IL-8 and MIP-1β (Gonsalves & Kalra, 2010), as shown in Fig.2. Another study from our
laboratory show that treatment of rat liver sinusoidal endothelial cells (LSEC) or human
endothelial cells with ethanol up-regulates the expression of ET-1 via activation of HIF-
1α, independently of hypoxia (S. M. Yeligar, Machida, & Kalra, 2010). These studies
support the role of HIF-1α in the expression of ET-1. Since the expression of ET-1
increased in response to both PlGF and ethanol, we were interested in determining the
molecular mechanism which could lead to increased stability of ET-1 mRNA. The
stability of mRNA is affected by binding of RNA binding protein(s) (RNP) or microRNA
or both. I focused my studies on identification and functional role of miRNAs in the
expression of ET-1 in human endothelial cells.

1.6. MicroRNA (miRNA)
MicroRNAs (miRNAs) are a family of small RNAs of ~22 nucleotides in length that play
an important role in gene regulation by complimentary binding to the target mRNA. The
first miRNA, lin-4 was discovered in 1993 by Ambros and his coworkers (37). In this
study, lin-4 is shown to play a role in developmental timing in C. elegans by regulating a
key gene lin-14 (R. C. Lee, Feinbaum, & Ambros, 1993). In the last decade, it has been
shown that the miRNAs in eukaryotes are involved in the regulation of apoptosis,
10

metabolism, embryo development, brain development and cancer progression
(Kloosterman & Plasterk, 2006). miR-14 was found to be a cell death repressor and it is
required for fat metabolism in Drosophila (Xu, Vernooy, Guo, & Hay, 2003); miR-29b,
miR-34, miR-15a and miR-16 are all able to inhibit the expression of anti-apoptotic genes
such as Mcl-1 and Bcl-2, and the overexpression of miR-15a and miR-16 was shown to
induce cell apoptosis (Y. S. Lee & Dutta, 2009). In addition, miR-15 and miR-16 are
also found to be involved in early embryo development as they are the inhibitors of the
Wnt/β-catenin signaling pathway resulting from miRNA dependent down-regulation of
catenin expression. . Inhibition of these two miRNAs also increases the mesoderm
patterning in X. laevis. MiR-29 has been shown to directly target the mRNAs for DNA
methyltransferase (DNMT) 1 and 2, and the over expression of miR-29 is effective in
reversing the global methylation in lung cancer (Fabbri, et al., 2007; Meng, et al., 2007).
MiR-21 expression has been shown to increase several fold in tumors. MiR-21 has been
shown to target tumor repressor phosphatase and tensin homolog (PTEN). By repressing
the level of PTEN in cancer, miR-21 promotes the motility and invasiveness of tumor
cells (Meng, et al., 2007). There are numerous studies, which focus on the identification
of microRNA and its function in human disease. These studies show the importance of
miRNAs in post-transcriptional regulation of mRNA and protein expression in normal
cells, and their aberrant expression in the diseased state.

11

1.7. Biogenesis of miRNA
RNA polymerase II is the major polymerase involved in transcription of miRNA coding
genes. After the transcription of miRNA coding genes, a stem-loop forms containing
primary miRNA (pri-miRNA), which can range from several hundreds of base pairs to
kilo-base pairs (Cai, Hagedorn, & Cullen, 2004). Pol II transcribed pri-miRNAs can be
characterized by a 5’ cap structure and 3’ polyadenylated tails (Y. Lee, et al., 2004) as
shown in Fig. 3. The pri-miRNA is then processed within the nucleus by a multiprotein
complex called the Microprocessor, whose central enzymatic component is Drosha,
which has RNase III-like activity. Other components of Microprocessor include double-
stranded RNA-binding domain (dsRBD) protein GCR8/Pasha (Denli, Tops, Plasterk,
Ketting, & Hannon, 2004; Gregory, et al., 2004). Drosha cleaves the stem-loop structure
of pri-miRNA and generates a ∼70-nt hairpin precursor miRNA (pre-miRNA). The
cleavage by Drosha of pre-miRNA leads to a 2 nt 3’-overhang of the stem-loop structure.
The 3’overhang serves as a recognition signal for exportin-5 to translocate pre-miRNA
from the nucleus to cytoplasm in a Ran-GTP-dependent manner (Fig. 3). After export
into the cytoplasm, pre-miRNAs are further processed by another RNase III enzyme,
Dicer, which cuts ~70 nt pre-miRNAs into ~22 nt mature miRNAs (Saito, Ishizuka,
Siomi, & Siomi, 2005).

12

Fig. 3. The working model of biogenesis of miRNA. Adapted from Bushati, N. and Cohen, S.M.,
Annu. Rev. Cell. Dev. Biol. 2007, 23: 175-205
13

1.8. The mechanism of miRNA mediated gene silencing

MiRNAs can target the 3’ un-translated regions (3’ UTRs) of mRNAs by either perfect
pairing or imperfect nucleotide pairing in miRNAs to target gene. The miRNA mediated
gene silencing occur by two different mechanisms, either by targeting of mRNA and
degradation, or translational repression of target mRNA (Fig. 4). In the first case, when a
miRNA is in a perfect or nearly perfect Watson-Click pair with the target mRNA, the ~22
nt mature miRNA is loaded into RNA-induced silencing complex (RISC) containing
Fig.4. There are two mechanisms of miRNA mediated gene silencing: cleavage and
translational repression. Adapted from Daniel. K.M. et. al. Nat. Rev.Genetics. 2007, 8: 173-184
14

Argonaute 2 (AGO2), with the assistance of the two Dicer dsDNA binding protein
partners, TAR RNA-binding protein (TRBP) and protein activator of protein kinase PKR
(PACT). Then, the AGO-2 endonuclease activity in RISC cleaves the passenger strand of
the mature RNA, and miRNA single strand along with RISC complex targets the mRNA
for degradation (Martinez, Patkaniowska, Urlaub, Luhrmann, & Tuschl, 2002; S. Yeligar,
Tsukamoto, & Kalra, 2009). Alternatively, when the sequences of miRNA and target
mRNA are imperfect complementary pairing, the translational repression occur (Fig. 4).
It involves a bypass mechanism, which requires a helicase activity to unwind and discard
the passenger miRNA strand, rather than directly cleave the passenger mRNA strand by
AGO-2. Once the passenger strand has been unwound or discarded, the mature miRNA
binds to its target mRNA 3’UTR, and RISC leads to translational repression (Fig. 4).
Our previous studies showed PlGF-mediated up-regulation of endothelin-1 (ET-1)
requires activation of HIF-1α (Patel, et al., 2008). Moreover, we showed PlGF-mediated
up-regulation of plasminogen activator inhibitor-1 (PAI-1) involved activation of HIF-1α
and AP-1 (Patel, et al., 2011). Both ET-1 and PAI-1 have been shown to contribute to
pulmonary hypertension in sickle cell disease. We showed that PAI-1 mRNA stability
was increased in response to PlGF in HMEC-1 and HPMVEC cells (Patel, et al., 2011).
Furthermore, studies showed that miR-30c and miR-301, which bind to the 3’UTR of
PAI-1 mRNA, are involved in post-transcriptional regulation of PAI-1 mRNA and
protein expression (51). In the present study, we determined the stability of ET-1 mRNA,
in response to PlGF, in endothelial cells. We identified three microRNAs, miR-648, miR-
934 and miR-199a-5p as putative effectors of ET-1 and HIF-1α mRNA. Among these
15

miRNAs, miR-648 and miR-934 were found to target the 3’UTR of ET-1 mRNA.
Transfection of HMEC-1 with miR-648 decreased ET-1 mRNA levels, while anti-miR-
648 augmented ET-1 mRNA expression. Furthermore, miR-648 reduced and anti-miR-
648 increased 3’UTR ET-1 reporter luciferase activity, indicating that miR-648 has a
bona fide target site in the 3’UTR of ET-1 for regulating ET-1 expression.

16

CHAPTER 2
Hypothesis and Specific Aims
2.1. Hypothesis
We hypothesize PlGF-induced ET-1 expression is up-regulated in endothelial cells via
the stabilization of ET-1 mRNA. The stabilization of ET-1 mRNA involves two possible
mechanisms, either through the binding of RNA binding protein or by reduced miRNA
binding to the 3’UTR of ET-1 mRNA, and may involve both mechanisms.

2.2. Specific Aims
To determine the post-transcriptional mechanism(s) leading to increased expression and
stability of ET-1 mRNA, in response to PlGF in human microvascular endothelial cells,
studies will be performed to characterize miRNAs that bind ET-1 mRNA 3’UTR, and
their role in affecting expression of ET-1 mRNA and protein in the presence and absence
of PlGF.

17

CHAPTER 3
Materials and Methods
3.1. Reagents
Human recombinant PlGF (R&D Systems, Minneapolis, MN); Actinomycin D (Enzo
Life Sciences, Plymouth Meeting, PA), and hsa-miR mimics and hsa-miR-inhibitors were
purchased from Shanghai Gene Pharma Co. Ltd (Shanghai, China). BAC clones for ET-1
were obtained from Children’s Hospital and Research Center at Oakland, BACPAC
Resources (Oakland, CA). The primers used for qRT-PCR were designed and purchased
from Integrated DNA Technologies, Inc. (Skokie, IL) as described in Table 1. Unless
otherwise specified, all other reagents were purchased from Sigma Chemical Company
(St. Louis, MO).

3.2. Endothelial cell culture
The immortalized human dermal microvascular endothelial cell line (HMEC-1),
originally developed by Dr. Edwin Ades and Francisco J. Candall of the CDC, and Dr.
Thomas Lawley of Emory University was obtained from Centers for Disease Control
and Prevention (CDC, Atlanta). HMEC-1 were cultured in RPMI-1640 media (Mediatech
Inc., Manassas, VA) containing 10% FBS (Omega Scientific, Tarzana, CA) , 1 mM
sodium pyruvate, 1 mM glutamine, 5 mM Hepes, MEM vitamins and non-essential
18

amino acids (1x) (Mediatech Inc., Manassas, VA), 50 µ g/mL endothelial cell mitogen
(Biomedical Technologies, Stoughton, MA) and Heparin (20 units/mL) as previously
described (S. Yeligar, et al., 2009). HMEC-1 were incubated overnight in RPMI-1640
complete medium containing 2% serum, followed by serum deprivation for 3 hr, and
treatment with either PlGF (R&D Systems, Minneapolis, MN) (250 ng/mL) or other
indicated experimental conditions.

3.3 Transient transfection
HMEC-1 (approximately 5x10
5
cells) were suspended in 100 µ L of RPMI complete
medium containing either the miRNA mimic or anti-miRNA (GenePharma, Shanghai) at
indicated concentration (60 pM or 90 pM), and transfected by nucleofection with the S-
005 program in the AMAXA nucleofector apparatus (Lonza, Basel, Swizerland) as
previously described (Patel, et al., 2008). The luciferase reporter plasmids (0.5 µ g) and
SV-40-Renilla plasmids (0.5 µ g) were co-transfected in HMEC-1 utilizing nucleofection.
After the transfection, cells were incubated in RPMI complete medium for either 24 hrs
or 48 hrs, followed by serum deprivation for 3 hr, and treatment with either PlGF (250
ng/mL) or other indicated experimental conditions.

19

3.4. Isolation of RNA and qRT-PCR
HMEC-1 was treated with PlGF (250 ng/mL) for indicated time periods followed by total
RNA extraction with TriZOL reagent (Invitrogen, Carlsbad, CA). mRNA level and purity
of RNA in the samples was determined by Nanodrop 8000 spectrometer (Thermo
Scientific). The mRNA expression was determined and quantified using specific mRNA
primers (Table 1). Real-time quantitative PCR of mRNA templates was done using the
iScript One-Step RT-PCR Kit with SYBR Green (Bio-Rad). PCR amplification of 100 ng
of RNA was performed for 40 cycles under the following conditions: cDNA synthesis at
50° C for 10 min, iScript reverse transcriptase inactivation at 95° C for 5 min, and PCR
cycling and detection at 95° C for 10 s, followed by elongation at 60° C for 45 s, utilizing
ABI 7900 HT sequencing detection system. Values are expressed as relative expression
of mRNA normalized to housekeeping GAPDH mRNA. Relative quantitative (RQ)
levels for miRNA expression were calculated as 2
–ΔΔCt
by the comparative Ct method,
where ΔΔCt= (Ct target miRNA of treated sample- Ct reference gene of treated sample) -
(Ct target miRNA of control sample-Ct reference gene of control sample) as previously
described (Patel, et al., 2011).

20

Table 1. Sequence of Primers utilized in qRT-PCR and PCR amplification.

Organism/Gene
Meth
od Forward sequence (5'→3') Reverse sequence (5'→3')
H.ET-1 PCR
CCTCTAGACCTTCGGGGC
CTGTC
CCTCTAGATACACAGTAAGGAAAAAAATATTTA
TTTTCTAAAGTC
H.ET-1
qPC
R

TGATTTTCTCTCTGCTGTT
TGTG CAATGTGCTCGGTTGTGGGTCA
H.PremiR-648
qPC
R CACAGACACCTCCAAGTG CCCTCACTTCCGACTAAG
H.pre-miR-934
qPC
R
GAAATAAGGCTTCTGTCT
AC GAAATAAGGCTCCCGTCC
H.GAPDH
qPC
R
AACCTGCCAAGTACGATG
ACATC GTAGCCCAGGATGCCCTTGA

3.5. Isolation and quantification of microRNAs (miRNAs)
Total RNA was isolated from HMEC-1 by using the miRVana miRNA isolation kit
(Ambion-Applied Biosystems, Foster City, CA). The miRNA expression was determined
using the TaqMan microRNA assay kits for indicated miRNA (Applied Biosystems,
Foster City, CA) according to the manufacturer’s protocol. Briefly, 1x10
6
HMEC-1 cells
were lysed in 600µ L Lysis/Binding Buffer followed by the addition of 60 µ L miRNA
homogenate additive. To the mixture was added 660 µ L of Acid-Phenol: Chloroform,
and then centrifuged at 13,000 rpm at room temperature to separate the aqueous and
organic phases. Aqueous phase (approximately 700 µ L) was mixed with a 1/3 volume of
100% ethanol (Gold shield, CA) and passed through the filter cartridge. Next, the filtrate
was collected in the collection tube and mixed with a 2/3 volume of 100% ethanol, and
then filtered through the filter cartridge to allow miRNA to reversibly bind to the filter
21

cartridge. The miRNA-enriched RNA was rinsed twice in rinse buffer, and then eluted
with 50 µ L pre-heated elution buffer (Applied Biosystems).
Isolated miRNA was reverse transcribed at 16°C for 30 min, 42° C for 30 min and 85° C
for 5 min. qRT-PCR was performed in a 384-well plate at 95° C for 10 min, followed by
40 cycles of 95° C for 15s and 60° C for 60s. All reactions were run in triplicate. miRNA
expression was normalized to reference gene U6 small nuclear RNA (snU6). miRNA
expression was determined and quantified, utilizing specific miRNA primers.

3.6. Construction of pGL-3-ET-1-3’UTR luciferase reporter construct
The 1125 bp fragment spanning the region between +2 and +1127 bp relative to the
translation stop codon of ET-1 mRNA was PCR-amplified using the forward and
reverse primers, both contain XbaI restriction enzyme sites (New England Biolabs,
Ipswitch, MA), and Taq DNA polymerase (New England Biolabs, Ipswitch, MA),
according to standard procedures. The human genomic clone for ET-1 (BACPAC clone
number RP-11-353G10) was used as a template (BACPAC, Oakland, CA). The PCR
product was cloned downstream of the firefly luciferase reporter gene in pGL3-Control
plasmid (Promega, Madison, WI). The orientation of the insert relative to the luciferase
gene was confirmed by DNA sequencing, and the plasmid was purified using CsCl
density gradient. The resulting plasmid is designated as pGL3-ET-1–3’UTR. The
sequence of insert was verified by sequence analysis (Retrogen, San Diego, CA).
22

3.7. Statistical Analysis
Data are presented as mean ± SEM. The significance of difference between two groups of
experiments are evaluated by students’s t-test in which *** P< 0.001; ** P<0.01; *
P<0.05.

23

CHAPTER 4
Results
4. 1. Post-transcriptional regulation of PlGF-mediated ET-1 mRNA expression
Studies by our laboratory show PlGF-mediated ET-1 mRNA expression is under
transcriptional activation by binding of HIF-1  to the HRE of the ET-1 promoter region
as shown in Fig.5 (Patel, et al., 2008). This induction occurs in a time-dependent manner
(from 1 to 24 hrs) in endothelial cells (Patel, et al., 2008). Furthermore, the maximum
expression of ET-1 mRNA and protein was observed 6 hr after PlGF addition. Next, we
determined whether PlGF affected the stability of ET-1 mRNA. As shown in Fig. 5
treatment of HMEC-1 (Human dermal microvascular endothelial cell line) with PlGF for
6 hr resulted in a significant stabilization in ET-1 mRNA from t 1/2 of 22 ± 1 min to 36 ±
2 min compared with non-treated control, as determined by actinomycin D treatment, a
transcription inhibitor. The kinetics show a biphasic decline in ET-1 mRNA in untreated
cells, indicating a second order degradation process, likely involving miRNA-dependent
mechanism.
24

Fig. 6 The location of miRNA binding sites on HIF-1α
mRNA and ET-1 mRNA.
Fig. 5. Determination of t-half time of ET-1 mRNA degradation.
HMVECs were stimulated with PlGF for 6 h, followed by the addition of actinomycin D at time 0 h;
ET-1 and GAPDH mRNA levels were sampled at the indicated time points (0-90 min). Each data point
is the average of three amplifications using total RNA samples from three independent experiments.
The ET-1 mRNA levels observed following PlGF treatment for 6 h was considered 100 %.

4.2 Identification of miRNAs involved in destabilization of ET-1 mRNA in HMEC-1
We used Bioinformatics approach (Microcosm.org) to predict the potential miRNA
candidates and their binding sites on ET-1 mRNA 3’UTR. This approach considers
complementarity to specific miRNAs,
target site accessibility, and the extent
of evolutionary miRNA sequence
conservation. This program
revealed the presence of several miRNAs, those with strongest correlation with seed
sequence stability (- , negative Gibbs Free Energy) and highest species conservation
25

Fig.7. HMVECs were treated with PlGF for 6 h, followed by isolation of total RNA.
Levels of indicated miRNA candidates were analysed using a specific TaqMan MicroRNA assay for
each miRNA. Each miRNA level was determined after normalizing to snU6 RNA level. Values are the
means +/− S.E.M. of triplicate independent experiments. *P < 0.05, **P < 0.01 and ***P < 0.001.
are shown. This program predicted ~18 putative miRNA target sites in the 3’UTR of ET-
1 mRNA. The figure indicates potential miRNA binding sites to the 3’UTRs of ET-1
mRNA (Fig. 6).

26

We selected four candidates (miR-648, miR-934, miR-517b and miR-454) based on
sequence complementarity ( G° ~ -15-21 kCal/mol) and high degree of site conservation
among different mammalian species (e.g. 4-6 species). In addition, we also compared the
expression of miR-125a-3p, miR-125a-5p, and miR-125b, which have recently been
shown to be involved in the oxidized LDL-mediated regulation of ET-1 mRNA in
vascular endothelial cells (Li, et al., 2010) . Since PlGF- mediated ET-1 expression has
been shown to be regulated by HIF-1α (Patel, et al., 2008), and HIF-1α stability has been
shown to be affected by miR-199a in response to ethanol (S. Yeligar, et al., 2009), we
examined the expression of these miRNAs concurrently. As shown in Fig.7A, the
expression of miR-934 and miR-648 decreased by approximately 3-fold and 11-fold,
respectively, in response to treatment of HMEC cells with PlGF as compared to the
untreated control cells. The expression of miR-199a-5p decreased by ~ 9-fold upon
treatment of HMEC with PlGF (Fig.7A). In contrast, the expression of miR-199a-3p did
not change significantly in PlGF treated HMEC (Fig.7C). However, the expression of
miR-125a-3p, miR-125b, and miR-454 increased in the range of 3- to 4-fold (Fig.7C).
Interestingly, the expression of miR-517b increased significantly i.e. 25- to 30-fold in
PlGF-treated HMEC (Fig. 7B).

27

Fig.8. The level of pre-miR-648 and pre-miR-934 is reduced upon PlGF-treatment.
HMECs were treated with PlGF(250 ng/mL) for 6 h followed by isolation of total RNA. Levels of pre-
miRNA-648 and premiR-934 were determined by qRT-PCR utilizing primers specifically amplifying
target precursor miRNA. Values are means ± S.E.M. of triplicate independent experiments. *P < 0.05,
**P < 0.01 and ***P < 0.001.
4. 3. Quantitative expression of Pre-miR-648 and Pre-miR-934 in HMEC-1
The precursor miRNA (pre-miR) are the ~70 nt small RNAs generated in the nucleus
during miRNA biogenesis, and translocated into cytoplasm to produce mature miRNA.
We determined the expression of pre-miR for each of these miRNAs (miR-648 and miR-
934) to see whether pre-miR-648 and pre-miR-934 processing and/or their transcription
levels were affected by PlGF. As shown, expression of pre-miR-648 was reduced by~ 80 %
(Fig. 8A), while pre-miR-934 expression was ~ reduced by 90% (Fig.8B), upon treatment
with PlGF.

28

4. 4. Effect of miRs and anti-miRs on the expression of ET-1 mRNA
Since miR-648, miR-934 and miR-199a-5p expression decreased in PlGF treated HMEC
cells, our next question is whether these miRNAs are responsible for regulating the level
of ET-1 mRNA in HMEC-1 cells. To address this question, we examined miR-648 as a
focus of investigation and determined whether mimics or anti-miRs of miR-648 affected
the expression of ET-1 mRNA. This was approached utilizing transient transfection of
these mimics and anti-miRs into HMEC-1 cells. As shown in Fig.9A, the transfection of
HMEC with miR-648 at 60 pM and 90 pM attenuated the basal level of ET-1 mRNA by
~40 % and ~80 %, respectively. Conversely, transfection of HMEC with anti-miR-648 at
60 pM and 90 pM in a dose dependent manner augmented the expression of ET-1 mRNA
by ~2 fold and ~2.8 fold, respectively (Fig.9A). These results show that miR-648
regulates ET-1 mRNA expression under basal conditions.
29

Fig. 9. miR-648 affects the level of ET-1 mRNA in the presence or absence of PlGF.
HMVECs were transfected with indicated the miRNA mimic and anti-miRNA oligonucleotides,
followed by total RNA isolation. ET-1 mRNA expression was estimated by qRT-PCR. (A) qRT-PCR
analysis of ET-1 mRNA expression in HMVECs transfected with the indicated miRNA mimic and anti-
miRNA oligonucleotides in the absent of PlGF. (B) qRT-PCR analysis of ET-1 mRNA expression in
HMVECs transfected with the indicated miRNA mimic and anti-miRNA oligonucleotides in the
present of PlGF (250 ng/mL). (C) qRT-PCR analysis of ET-1 mRNA expression in HMVECs transfected
with the nagetive control oligonucleotides of miRNA mimic and miRNA inhibitor. ET-1 mRNA levels
were normalized to GAPDH (glyceraldehyde-3-phosphate dehydrogenase) mRNA expression. Values
are the means +/−S.E.M. of triplicate independent experiments. *P < 0.05, **P < 0.01 and ***P < 0.001.

30

Next, we examined the effect of PlGF in combination with miR-648 on ET-1 mRNA
expression. Transfection of HMEC-1 with miR-648 mimic followed by treatment with
PlGF reduced the level of ET-1 mRNA to approximately 80% at 60 pM miRNA and 105%
at 90 pM miRNA, compared to the PlGF-induced mRNA level (Fig.9B). When antimiR-
648 was transfected into HMEC cells in the presence of PlGF, the level of ET-1 mRNA
was further augmented by ~1.38 fold with 60 pM anti-miR-648, and ~1.48 fold with 90
pM anti-miR-648 (Fig.9B). It is important to mention that the level of ET-1 mRNA did
not change significantly when HMEC-1 cells were transfected with either the negative
controls of miRNA mimic or anti-miRNA at 60 pM and 90 pM concentration (Fig. 9C).
Taken together, these data show that miR-648 is involved in the regulation of ET-1
mRNA expression under basal and PlGF stimulated condition in endothelial cells, likely
through the complementary binding to the 3’UTR region of ET-1 mRNA.

4.5. Effect of miR-648 on the target-binding sites in the 3’UTR of ET-1 mRNA
utilizing ET-1 reporter luciferase assay
Our next question is whether miR-648 directly regulates ET-1 mRNA expression by
binding of miR-648 to the 3’UTR of ET-1 mRNA. To address this, we constructed a
3’UTR ET-1 mRNA reporter luciferase construct by inserting a region of the ET-1
3’UTR bases +2 to +1127 relative to the translation stop codon downstream of the
luciferase open reading frame in pGL3 (Fig. 10A).
31

Fig. 10. PlGF-induced pGL3-ET-1-3’UTR luciferase activity is reduced by miR-648, but
augmented by antimiR-648.
HMVECs were co-transfected with pGL3-ET-1-3’UTR with either the miRNA-648 mimic or
anti-miRNA-648 oligonucleotides, followed by measurement of luciferase activity. (A) The
structure of pGL-3-ET-1-3’UTR construct: a region of the ET-1 3’UTR bases +2 to +1127
relative to the translation stop codon was inserted downstream of the luciferase open reading
frame (ORF) in the pGL3 luciferase vector. (B) Luciferase reporter assays were performed by
co-transfection of pGL3-ET-1-3’UTR construct with either the miRNA-648 mimic or anti-
miRNA-648 oligonucleotides in the presence of PlGF (250 ng/mL). Firefly luciferase
activities were normalized to internal Renilla activities for transfection efficiency. Values are
the means± S.E.M. of triplicate independent experiments. *P < 0.05, **P < 0.01 and ***P <
0.001.
The resulting reporter construct (pGL3-ET-1 3’UTR) was co-transfected with the internal
control SV-40-Renilla plasmid to monitor transfection efficiency. As shown in Figure
32

10B, treatment with PlGF augmented the luciferase reporter activity to approximately
2.5-fold compared to the pGL3 control vector treated with PlGF for the same time period
(6 hrs) (Fig. 10B), indicating PlGF treatment stabilizes the 3’UTR of ET-1 mRNA.
However, co-transfection of miR-648 with the reporter construct showed a reduction in
luciferase activity to ~70%, after normalization to the internal control, compared to the
PlGF-induced luciferase activity (Fig. 10B). Conversely, co-transfection of antimiR-648
with the reporter construct showed increase of ~1.7 fold luciferase activity, and 3.5-fold
increase relative to basal luciferase activity of the reporter construct (Fig.10B).
Taken together, the data show that miR-648 binds to 3’UTR of ET-1 mRNA to affect the
PlGF-induced ET-1 mRNA expression. For determination of the specificity of binding of
miR-648 to 3’UTR of ET-1 mRNA, site directed mutagenesis of miR-648 binding sites in
3’UTR of ET-1 mRNA luciferase construct is required to validate the specificity of
binding of miR-648 to 3’UTR of ET-1 mRNA.

33

CHAPTER 5
Discussion
5. 1. Discussion
Placenta growth factor (PlGF) belonging to the VEGF family of angiogenic factors, was
originally identified to be released from human placental trophoblast cells and umbilical
vein endothelial cells (Hauser & Weich, 1993). Recent studies show that PlGF is
produced by erythroid cells (Tordjman, et al., 2001), and its secretion from bone marrow
cells is induced in response to erythropoietin (14). Since sickle cell patients undergo
hemolytic anemic, there is increased erythropoiesis to compensate for reduction in RBC
numbers. As a result there is an increased plasma level of PlGF in patients with hemolytic
anemia. Studies from our laboratory showed three to eight fold increases in the plasma
levels of PlGF in SCD patients compared to matched normal individuals (Perelman, et al.,
2003; Sundaram, et al., 2010). It was hypothesized that PlGF may be a contributing
factor to inflammation, pulmonary hypertension and reactive airway disease seen in SCD
individuals. Studies from our laboratory showed PlGF induced the mRNA and protein
expression of proinflammatory cytokines (TNF-α, IL-1β, MCP-1, IL-8 and MIP-1β) in
monocytes from normal individual and in THP-1 monocytic cell line (Selvaraj, et al.,
2003). Moreover, monocytes isolated from blood of SCD patients showed increased
expression of the same cytochemokines without PlGF treatment (Selvaraj, et al., 2003).
These results indicated that monocytes of SCD patients are in contact with high
34

circulating levels of PlGF resulting in activation of monocytes in vivo to express high
levels of cytochemokine mRNAs.
Further studies from our laboratory showed PlGF activated HIF-1α, independent of
hypoxia, which caused downstream activation of target genes for ET-1 (Patel, et al.,
2008), PAI-1 (Patel, et al., 2011), and 5-lipoxygenase activating protein involved in
leukotriene formation (Patel, Gonsalves, Yang, Malik, & Kalra, 2009). Both ET-1 and
PAI-1 genes are involved in pulmonary hypertension seen in sickle cell patients, while
leukotrienes are involved in asthma and reactive airway disease seen in SCD patients.
Studies also showed that PlGF induced ET-1 binds to its cognate receptor, endothelin-B
receptor (ET-BR) on monocytes to up-regulate the expression of cytochemokines thus
further exaggerating inflammation seen in SCD (Fig. 2). Our previous study showed that
PlGF increased the stability of PAI-1 mRNA in human endothelial cells (Patel, et al.,
2011), and the stability of mRNA was affected by microRNAs (miR-30c and miR-301).
Both of these miRNAs bind to the 3’UTR of PAI-1 mRNA and thus affect its stability
under basal and PlGF treated conditions. Thus, we examined the mRNA stability of ET-
1 in endothelial cells in response to PlGF. Our studies showed PlGF increased the ET-1
mRNA stability (t
1/2
of 22 ± 1 min to 36 ± 2 min). The stability of mRNA is affected by
many factors such as binding of RNA binding protein(s) and miRNAs to the 3’UTR of
mRNA.
I examined the role of miRNA in ET-1 mRNA stability. Among the eleven candidate
miRNAs, which have putative binding sites in the 3’UTR of ET-1 mRNA, as determined
35

from bioinformatics analysis and quantitation by qRT-PCR, the expression of three
miRNAs was significantly reduced in HMEC-1 upon treatment with PlGF. These three
miRNAs were: miR-648, miR-934 and miR-199a-5p. A previous study from our
laboratory showed that miR-199a-5p has a binding site in the 3’UTR of HIF-1α (S.
Yeligar, et al., 2009). In the present study, we show miR-648 regulates ET-1 mRNA
levels as determined by transfection of HMEC-1 with miR-648 and anti-miR-648.
Transfection with miR-648 decreased ET-1 mRNA expression, while anti-miR-648
augmented ET-1 mRNA expression in HMEC-1 cells under basal conditions. Consistent
with the latter result, miR-648 reduced PlGF induced ET-1 expression, and anti-miR-648
increased the levels of ET-1 mRNA expression over and above that that observed with
PlGF alone. These studies strongly suggest that miR-648 binds to the 3’UTR of ET-1
mRNA to affect overall ET-1 expression. To confirm this, we prepared a reporter
construct from pGL3-Control with the 3’UTR of ET-1 mRNA fused to a luciferase
reporter gene. For this a PCR-cloned fragment from a BAC clone of the entire ET-1 gene
was produced and inserted 3’ of the luciferase ORF. The sequence of the insert in this
fusion construct was confirmed by sequence analysis. This vector was further used for
functional assays of miR-648 binding to ET-1 3’UTR in the context of luciferase mRNA.
Co-transfection of the luc-ET-1 3’UTR reporter with miR-648 reduced luciferase activity
while substitution with anti-miR-648 increased luciferase activity. These results indicated
that miR-648 has a functional binding site in the 3’UTR of ET-1 mRNA and is
independent of any 5’UTR or ORF sequences found in the native ET-1 mRNA. Further
studies are aimed to perform site directed mutagenesis of the miR-648 binding site in the
36

3’UTR of ET-1 mRNA. Additionally, studies are in progress to determine the effect of
miR-648 on ET-1 protein expression in HMEC-1, with and without PlGF.
5. 2. Conclusions
Pulmonary hypertension contributes to morbidity and mortality in SCD, and studies have
shown that the levels of vasoconstrictor endothelin-1 are high in the plasma of patients
with SCD. We previously showed PlGF mediated ET-1 expression involves activation of
HIF-1α. In the present study, we showed a regulatory role of microRNAs which bind the
3’UTR of ET-1 mRNA on ET-1 mRNA levels with subsequent effect on ET-1 protein
levels. We identified miR-648, miR-934 and miR-199a-5p which bind to the 3’UTR of
ET-1 mRNA among several candidate miRNAs. The role of miR-648 in PlGF mediated
induction of ET-1 mRNA expression was demonstrated by transfection with miR-648
mimic and antimiR-648, and reporter analysis of 3’UTR of ET-1 mRNA. Since we have
shown that miR-648 affects the level of ET-1 mRNA in endothelial cells, we expect that
the endogenous level of miR-648 will affect endothelin levels, and thus miR-648 plasma
level can be indicative of pulmonary hypertension in sickle cell patients.
5. 3. Future Directions
Our studies showed that the levels of miR-648, miR-934 and miR-199a-5p were reduced
in HMEC-1 cell line in response to PlGF treatment and mIR-648 binds the 3’UTR of ET-
1 mRNA, it will be important to validate the data in primary human microvascular
endothelial cells. Next, we will determine the roles of miR-934 and miR-199a-5p in the
expression of ET-1 and HIF-1α and overall mRNA stability. Moreover, microRNAs are
37

under transcriptional control, it will be important to understand how these miRNAs are
transcriptionally regulated. Our preliminary studies show that miR-648 is located in the
intron of MICAL3 gene and both are co-transcribed in the same direction. Bioinformatics
analysis revealed that sites for transcription factors PAX5 and Kid3 are present in the
promoter of MICAL3. In preliminary studies we used shRNAs for PAX5 and showed
that reduction of PAX5 levels attenuated MICAL3 mRNA expression as well as miR-648
expression. Further studies are underway to examine the role of PAX-5 in transcriptional
regulation of miR-648 and MICAL-3.

38

BIBLIOGRAPHY
Ataga, K. I., Sood, N., De Gent, G., Kelly, E., Henderson, A. G., Jones, S., et al. (2004).
Pulmonary hypertension in sickle cell disease. Am J Med, 117(9), 665-669.

Aversa, C. R., Oparil, S., Caro, J., Li, H., Sun, S. D., Chen, Y. F., et al. (1997). Hypoxia
stimulates human preproendothelin-1 promoter activity in transgenic mice. Am J
Physiol, 273(4 Pt 1), L848-855.

Bagnato, A., & Rosano, L. (2008). The endothelin axis in cancer. Int J Biochem Cell Biol,
40(8), 1443-1451.

Barton, M., & Yanagisawa, M. (2008). Endothelin: 20 years from discovery to therapy.
Can J Physiol Pharmacol, 86(8), 485-498.

Benza, R. L. (2008). Pulmonary hypertension associated with sickle cell disease:
pathophysiology and rationale for treatment. Lung, 186(4), 247-254.

Blanchard, K. L., Acquaviva, A. M., Galson, D. L., & Bunn, H. F. (1992). Hypoxic
induction of the human erythropoietin gene: cooperation between the promoter
and enhancer, each of which contains steroid receptor response elements. Mol
Cell Biol, 12(12), 5373-5385.

Brittain, J. E., Hulkower, B., Jones, S. K., Strayhorn, D., De Castro, L., Telen, M. J., et al.
(2010). Placenta growth factor in sickle cell disease: association with hemolysis
and inflammation. Blood, 115(10), 2014-2020.

Bunn, H. F., Nathan, D. G., Dover, G. J., Hebbel, R. P., Platt, O. S., Rosse, W. F., et al.
(2010). Pulmonary hypertension and nitric oxide depletion in sickle cell disease.
Blood, 116(5), 687-692.

Cai, X., Hagedorn, C. H., & Cullen, B. R. (2004). Human microRNAs are processed
from capped, polyadenylated transcripts that can also function as mRNAs. RNA,
10(12), 1957-1966.

Castro, O., Brambilla, D. J., Thorington, B., Reindorf, C. A., Scott, R. B., Gillette, P., et
al. (1994). The acute chest syndrome in sickle cell disease: incidence and risk
factors. The Cooperative Study of Sickle Cell Disease. Blood, 84(2), 643-649.

Dashwood, M. R., & Loesch, A. (2010). Endothelin-1 as a neuropeptide: neurotransmitter
or neurovascular effects? J Cell Commun Signal, 4(1), 51-62.

39

Denli, A. M., Tops, B. B., Plasterk, R. H., Ketting, R. F., & Hannon, G. J. (2004).
Processing of primary microRNAs by the Microprocessor complex. Nature,
432(7014), 231-235.
Ergul, S., Brunson, C. Y., Hutchinson, J., Tawfik, A., Kutlar, A., Webb, R. C., et al.
(2004). Vasoactive factors in sickle cell disease: in vitro evidence for endothelin-
1-mediated vasoconstriction. Am J Hematol, 76(3), 245-251.

Fabbri, M., Garzon, R., Cimmino, A., Liu, Z., Zanesi, N., Callegari, E., et al. (2007).
MicroRNA-29 family reverts aberrant methylation in lung cancer by targeting
DNA methyltransferases 3A and 3B. Proc Natl Acad Sci U S A, 104(40), 15805-
15810.

Francis, R. B., Jr., & Johnson, C. S. (1991). Vascular occlusion in sickle cell disease:
current concepts and unanswered questions. Blood, 77(7), 1405-1414.

Gladwin, M. T., Sachdev, V., Jison, M. L., Shizukuda, Y., Plehn, J. F., Minter, K., et al.
(2004). Pulmonary hypertension as a risk factor for death in patients with sickle
cell disease. N Engl J Med, 350(9), 886-895.

Gonsalves, C., & Kalra, V. K. (2010). Endothelin-1-induced macrophage inflammatory
protein-1beta expression in monocytic cells involves hypoxia-inducible factor-
1alpha and AP-1 and is negatively regulated by microRNA-195. J Immunol,
185(10), 6253-6264.

Gregory, R. I., Yan, K. P., Amuthan, G., Chendrimada, T., Doratotaj, B., Cooch, N., et al.
(2004). The Microprocessor complex mediates the genesis of microRNAs. Nature,
432(7014), 235-240.

Hans, G., Schmidt, B. L., & Strichartz, G. (2009). Nociceptive sensitization by
endothelin-1. Brain Res Rev, 60(1), 36-42.

Hauser, S., & Weich, H. A. (1993). A heparin-binding form of placenta growth factor
(PlGF-2) is expressed in human umbilical vein endothelial cells and in placenta.
Growth Factors, 9(4), 259-268.

Hsu, L. L., Champion, H. C., Campbell-Lee, S. A., Bivalacqua, T. J., Manci, E. A.,
Diwan, B. A., et al. (2007). Hemolysis in sickle cell mice causes pulmonary
hypertension due to global impairment in nitric oxide bioavailability. Blood,
109(7), 3088-3098.

Hu, J., Discher, D. J., Bishopric, N. H., & Webster, K. A. (1998). Hypoxia regulates
expression of the endothelin-1 gene through a proximal hypoxia-inducible factor-
1 binding site on the antisense strand. Biochem Biophys Res Commun, 245(3),
894-899.
40

Khimji, A. K., & Rockey, D. C. (2010). Endothelin--biology and disease. Cell Signal,
22(11), 1615-1625.

Kloosterman, W. P., & Plasterk, R. H. (2006). The diverse functions of microRNAs in
animal development and disease. Dev Cell, 11(4), 441-450.
Kurihara, H., Yoshizumi, M., Sugiyama, T., Takaku, F., Yanagisawa, M., Masaki, T., et
al. (1989). Transforming growth factor-beta stimulates the expression of
endothelin mRNA by vascular endothelial cells. Biochem Biophys Res Commun,
159(3), 1435-1440.

Lee, M. E., Bloch, K. D., Clifford, J. A., & Quertermous, T. (1990). Functional analysis
of the endothelin-1 gene promoter. Evidence for an endothelial cell-specific cis-
acting sequence. J Biol Chem, 265(18), 10446-10450.

Lee, R. C., Feinbaum, R. L., & Ambros, V. (1993). The C. elegans heterochronic gene
lin-4 encodes small RNAs with antisense complementarity to lin-14. Cell, 75(5),
843-854.

Lee, Y., Kim, M., Han, J., Yeom, K. H., Lee, S., Baek, S. H., et al. (2004). MicroRNA
genes are transcribed by RNA polymerase II. EMBO J, 23(20), 4051-4060.

Lee, Y. S., & Dutta, A. (2009). MicroRNAs in cancer. Annu Rev Pathol, 4, 199-227.

Li, D., Yang, P., Xiong, Q., Song, X., Yang, X., Liu, L., et al. (2010). MicroRNA-
125a/b-5p inhibits endothelin-1 expression in vascular endothelial cells. J
Hypertens, 28(8), 1646-1654.

Marsden, P. A., & Brenner, B. M. (1992). Transcriptional regulation of the endothelin-1
gene by TNF-alpha. Am J Physiol, 262(4 Pt 1), C854-861.

Martinez, J., Patkaniowska, A., Urlaub, H., Luhrmann, R., & Tuschl, T. (2002). Single-
stranded antisense siRNAs guide target RNA cleavage in RNAi. Cell, 110(5),
563-574.

Meng, F., Henson, R., Wehbe-Janek, H., Ghoshal, K., Jacob, S. T., & Patel, T. (2007).
MicroRNA-21 regulates expression of the PTEN tumor suppressor gene in human
hepatocellular cancer. Gastroenterology, 133(2), 647-658.

Minniti, C. P., Sable, C., Campbell, A., Rana, S., Ensing, G., Dham, N., et al. (2009).
Elevated tricuspid regurgitant jet velocity in children and adolescents with sickle
cell disease: association with hemolysis and hemoglobin oxygen desaturation.
Haematologica, 94(3), 340-347.

41

Modell, B. D., M. (2008). Global epidemiology of haemoglobin disorders and derived
service indicators. Bull World Health Organ, 86(6), 480-487.

Morris, C. R., Kato, G. J., Poljakovic, M., Wang, X., Blackwelder, W. C., Sachdev, V., et
al. (2005). Dysregulated arginine metabolism, hemolysis-associated pulmonary
hypertension, and mortality in sickle cell disease. JAMA, 294(1), 81-90.

Oliver, F. J., de la Rubia, G., Feener, E. P., Lee, M. E., Loeken, M. R., Shiba, T., et al.
(1991). Stimulation of endothelin-1 gene expression by insulin in endothelial cells.
J Biol Chem, 266(34), 23251-23256.
Patel, N., Gonsalves, C. S., Malik, P., & Kalra, V. K. (2008). Placenta growth factor
augments endothelin-1 and endothelin-B receptor expression via hypoxia-
inducible factor-1 alpha. Blood, 112(3), 856-865.

Patel, N., Gonsalves, C. S., Yang, M., Malik, P., & Kalra, V. K. (2009). Placenta growth
factor induces 5-lipoxygenase-activating protein to increase leukotriene formation
in sickle cell disease. Blood, 113(5), 1129-1138.

Patel, N., Sundaram, N., Yang, M., Madigan, C., Kalra, V. K., & Malik, P. (2011).
Placenta growth factor (PlGF), a novel inducer of plasminogen activator inhibitor-
1 (PAI-1) in sickle cell disease (SCD). J Biol Chem, 285(22), 16713-16722.

Perelman, N., Selvaraj, S. K., Batra, S., Luck, L. R., Erdreich-Epstein, A., Coates, T. D.,
et al. (2003). Placenta growth factor activates monocytes and correlates with
sickle cell disease severity. Blood, 102(4), 1506-1514.

Platt, O. S., Thorington, B. D., Brambilla, D. J., Milner, P. F., Rosse, W. F., Vichinsky,
E., et al. (1991). Pain in sickle cell disease. Rates and risk factors. N Engl J Med,
325(1), 11-16.

Ramos-Casals, M., Fonollosa-Pla, V., Brito-Zeron, P., & Siso-Almirall, A. (2010).
Targeted therapy for systemic sclerosis: how close are we? Nat Rev Rheumatol,
6(5), 269-278.

Rybicki, A. C., & Benjamin, L. J. (1998). Increased levels of endothelin-1 in plasma of
sickle cell anemia patients. Blood, 92(7), 2594-2596.

Sabaa, N., de Franceschi, L., Bonnin, P., Castier, Y., Malpeli, G., Debbabi, H., et al.
(2008). Endothelin receptor antagonism prevents hypoxia-induced mortality and
morbidity in a mouse model of sickle-cell disease. J Clin Invest, 118(5), 1924-
1933.

Saito, K., Ishizuka, A., Siomi, H., & Siomi, M. C. (2005). Processing of pre-microRNAs
by the Dicer-1-Loquacious complex in Drosophila cells. PLoS Biol, 3(7), e235.
42

Selvaraj, S. K., Giri, R. K., Perelman, N., Johnson, C., Malik, P., & Kalra, V. K. (2003).
Mechanism of monocyte activation and expression of proinflammatory
cytochemokines by placenta growth factor. Blood, 102(4), 1515-1524.

Steinberg, M. H., Lu, Z. H., Barton, F. B., Terrin, M. L., Charache, S., & Dover, G. J.
(1997). Fetal hemoglobin in sickle cell anemia: determinants of response to
hydroxyurea. Multicenter Study of Hydroxyurea. Blood, 89(3), 1078-1088.

Sundaram, N., Tailor, A., Mendelsohn, L., Wansapura, J., Wang, X., Higashimoto, T., et
al. High levels of placenta growth factor in sickle cell disease promote pulmonary
hypertension. Blood, 116(1), 109-112.
Sundaram, N., Tailor, A., Mendelsohn, L., Wansapura, J., Wang, X., Higashimoto, T., et
al. (2010). High levels of placenta growth factor in sickle cell disease promote
pulmonary hypertension. Blood, 116(1), 109-112.

Tordjman, R., Delaire, S., Plouet, J., Ting, S., Gaulard, P., Fichelson, S., et al. (2001).
Erythroblasts are a source of angiogenic factors. Blood, 97(7), 1968-1974.

Vichinsky, E. P., Styles, L. A., Colangelo, L. H., Wright, E. C., Castro, O., & Nickerson,
B. (1997). Acute chest syndrome in sickle cell disease: clinical presentation and
course. Cooperative Study of Sickle Cell Disease. Blood, 89(5), 1787-1792.

Wong, W. Y., Powars, D. R., Chan, L., Hiti, A., Johnson, C., & Overturf, G. (1992).
Polysaccharide encapsulated bacterial infection in sickle cell anemia: a thirty year
epidemiologic experience. Am J Hematol, 39(3), 176-182.

Xu, P., Vernooy, S. Y., Guo, M., & Hay, B. A. (2003). The Drosophila microRNA Mir-
14 suppresses cell death and is required for normal fat metabolism. Curr Biol,
13(9), 790-795.

Yamashita, K., Discher, D. J., Hu, J., Bishopric, N. H., & Webster, K. A. (2001).
Molecular regulation of the endothelin-1 gene by hypoxia. Contributions of
hypoxia-inducible factor-1, activator protein-1, GATA-2, AND p300/CBP. J Biol
Chem, 276(16), 12645-12653.

Yeligar, S., Tsukamoto, H., & Kalra, V. K. (2009). Ethanol-induced expression of ET-1
and ET-BR in liver sinusoidal endothelial cells and human endothelial cells
involves hypoxia-inducible factor-1alpha and microrNA-199. J Immunol, 183(8),
5232-5243.

Yeligar, S. M., Machida, K., & Kalra, V. K. (2010). Ethanol-induced HO-1 and NQO1
are differentially regulated by HIF-1alpha and Nrf2 to attenuate inflammatory
cytokine expression. J Biol Chem, 285(46), 35359-35373.
43

Yoshizumi, M., Kurihara, H., Morita, T., Yamashita, T., Oh-hashi, Y., Sugiyama, T., et al.
(1990). Interleukin 1 increases the production of endothelin-1 by cultured
endothelial cells. Biochem Biophys Res Commun, 166(1), 324-329.

Abstract (if available)

Abstract We showed that in human dermal microvascular endothelial cell line (HMEC-1), the stability of ET-1 mRNA was increased in response to PlGF treatment. We also observed that in PlGF treated HMEC-1, among several microRNAs (miRNA) which have a potential binding site on ET-1 mRNA and HIF- 1α

Linked assets

University of Southern California Dissertations and Theses

Conceptually similar

PDF

The role of miRNA and its regulation in pulmonary hypertension in sickle cell disease

PDF

Placenta growth factor-miRNAs-lncRNAs axis in the regulation of ET-1 gene involved in pulmonary hypertension in sickle cell disease

PDF

Differential effect of ethanol and r-sulforaphane on regulation of heme oxygenase-1 in endothelial cells

PDF

Placental growth factor mediated transcriptional and post-transcriptional regulation of hemeoxygenase-1

PDF

Alcohol mediated expression of cyto-protective enzyme - NQO-1 and its post translational regulation

PDF

Transcriptional regulation of IFN-γ and PlGF in response to Epo and VEGF in erythroid cells

PDF

The role of microRNAs in cancer

PDF

Creating a multiple micrornia expression vector to target GRP78, an ER chaperone and signaling regulator in cancer

PDF

A novel role for hypoxia-inducible factor-1alpha (HIF-1alpha) in the regulation of inflammatory chemokines and leukotriene expression in sickle cell disease

PDF

Discovery of mature microRNA sequences within the protein- coding regions of global HIV-1 genomes: Predictions of novel mechanisms for viral infection and pathogenicity

PDF

Review of long noncoding RNAs and chromosome structure

PDF

DNA methylation inhibitors and epigenetic regulation of microRNA expression

PDF

Pten deletion in adult pancreatic beta-cells induces cell proliferation and G1/S cell cycle progression

PDF

Identification of novel epigenetic biomarkers and microRNAs for cancer therapeutics

PDF

The relationship between per- and polyfluoroalkyl substances, microRNA, and non-alcoholic fatty liver disease

PDF

RNA polymerase III-dependent transcription is repressed under prolonged hypoxic conditions

PDF

The role of Ryk and Smek in neurogenesis; Mechanisms of CBP/β-catenin signaling inhibitor and IL-6 mediators in head and neck cancer

PDF

Characterization of the retromer complex of proteins in gastric parietal cells

PDF

Ethanol induced modulation of microglial P2X7 receptor expression and its role in neuroinflammation

PDF

Lnc-RNA and WNT signal synergistically promotes self-renewal of tumor initiating stem-like cells via epigenetic regulation

Asset Metadata

Creator Li, Chen (author)

Core Title MicroRNAs involved in the regulation of Endothelin-1 gene expression in endothelial cells

School Keck School of Medicine

Degree Master of Science

Degree Program Biochemistry and Molecular Biology

Publication Date 08/03/2014

Defense Date 08/03/2012

Publisher University of Southern California (original), University of Southern California. Libraries (digital)

Tag endothelial cells,Endothelin-1,microRNA,OAI-PMH Harvest

Language English

Contributor Electronically uploaded by the author (provenance)

Advisor Kalra, Vijay K. (committee chair), Tahara, Stanley M. (committee member), Tokes, Zoltan A. (committee member)

Creator Email 2009lichen@gmail.com,cli7@usc.edu

Permanent Link (DOI) https://doi.org/10.25549/usctheses-c3-86172

Unique identifier UC11290226

Identifier usctheses-c3-86172 (legacy record id)

Legacy Identifier etd-LiChen-1134.pdf

Dmrecord 86172

Document Type Thesis

Rights Li, Chen

Type texts

Source University of Southern California (contributing entity), University of Southern California Dissertations and Theses (collection)

Access Conditions The author retains rights to his/her dissertation, thesis or other graduate work according to U.S. copyright law. Electronic access is being provided by the USC Libraries in agreement with the a...

Repository Name University of Southern California Digital Library

Repository Location USC Digital Library, University of Southern California, University Park Campus MC 2810, 3434 South Grand Avenue, 2nd Floor, Los Angeles, California 90089-2810, USA