University of Southern California Dissertations and Theses

Glial support of neurite outgrowth: effects of aging and estrogen

(USC Thesis Other)

Glial support of neurite outgrowth: effects of aging and estrogen

PDF

Download a page range

Download transcript

Copy asset link

Request this asset

Transcript (if available)

Content

GLIAL SUPPORT OF NEURITE OUTGROWTH:
EFFECTS OF AGING AND ESTROGEN
by

Jason Arimoto

A Dissertation Presented to the
FACULTY OF THE USC GRADUATE SCHOOL
UNIVERSITY OF SOUTHERN CALIFORNIA
In Partial Fulfillment of the
Requirements for the Degree
DOCTOR OF PHILOSOPHY
(MOLECULAR BIOLOGY)

May 2012

Copyright 2012 Jason Arimoto

ii
!
TABLE OF CONTENTS

List of Figures iii

Abstract v

Chapter One: Introduction 1
Table 1.1 Age changes in estrogen receptors 8

Chapter Two: Age Changes in Estrogen Receptors Affect Glial
Support of E2-Mediated Neurite Outgrowth 11
Abstract 11
Introduction 12
Material and Methods 14
Results 19
Discussion 29

Chapter Three: Estrogen Mediated Neurite Outgrowth is
Determined byOvarian Cycling Status 35
Abstract 35
Introduction 36
Materials and Methods 41
Results 46
Discussion 55

Chapter Four: Summary and Discussion 62
Conclusions 69

Bibliography 71
iii
!
LIST OF FIGURES

Figure 2.1 Aging astrocytes support less E2-mediated neurite
outgrowth 20

Figure 2.2 Estrogen receptor expression in male rat cortical
astrocytes 21

Figure 2.3 Expression of estrogen receptors in cultured male
astrocytes 22

Figure 2.4 Verification of protein and mRNA levels after siRNA
or cDNA treatment 24

Figure 2.5 Manipulation of ER! in young and old astrocytes 26

Figure 2.6 Manipulation of ER" in young and old astrocytes 28

Figure 2.7 Upregulation of ER" in young ER" in young 29

Figure 2.8 Effect of ER! changes on GFAP and neurite
outgrowth 32

Figure 3.1 Adult male mixed glia support of neurite outgrowth,
GFAP, & IBA1 47

Figure 3.2 Cycling status of population 48

Figure 3.3 Effect of stage of female reproductive senescence
of glia on neurite outgrowth and GFAP expression
in 5-13mo rats 49

Figure 3.4 Effect of stage of female reproductive senescence
of glia on neurite outgrowth and GFAP expression in
9-10mo rats 51

Figure 3.5 ER levels in cultured glia: increase of ER! and ER!/"
ratio with stage of reproductive senescence 52

Figure 3.6 Co-localization of ERs with GFAP 53

iv
!
Figure 3.7 Expression of ERs vary with stage of female reproductive
senescence in 5-16mo rats 54

Figure 3.8 Expression of ERs vary with stage of female reproductive
senescence in 9-10mo rats 56

!
!
v
ABSTRACT

Glia are the most abundant cell type in the brain and perform a variety of
activities in support of neuronal function. These cells are dynamic and their
activation is an important aspect of the immune and inflammatory response,
as well as normal aging. Estrogen-mediated effects in the brain are altered
during aging, thus astrocytes and astrocytic estrogen receptors are an
important area of study in understanding these age-related changes.

In rat primary cortical cell culture, old (24mo) astrocytes support less E2-
mediated neurite outgrowth than young (3mo) astrocytes. Chapter 2 examines
estrogen receptor levels in-vivo and in-vitro in young and old rats and
astrocyte support of neurite outgrowth in-vitro. ER! levels and the ER!/" ratio
were found to be increased with age concurrently with decreased support of
E2-mediated neurite outgrowth. The loss of E2-mediated neurite outgrowth in
old astrocytes was reversed by decreasing ER! levels by siRNA and induced
in young astrocytes by increasing ER! levels by cDNA transfection.

Chapter 3 examines the role of reproductive senescence and perimenopausal
transition in glia support of neurite outgrowth. Young (5mo) normal cycling (4-5
day cycles) animals were compared with old (12-16mo) irregular cycling
!
!
vi
(>6day cycles) and constant estrus animals (>7days consecutive estrus). An
additional group of age-matched (9-10mo) normal cycling, irregular cycling
and constant estrus animals were also studied. Primary cortical mixed glia
cultures derived from normal cycling animals support E2-mediated increase in
neurite outgrowth, but mixed glia derived from irregular cycling and constant
estrus animals do not. This change in E2-mediated neurotrophic support
accompanies an increase in ER! and the ER!/" ratio in astrocytes both in-
vivo and in-vitro. These results suggest a component of stage of reproductive
senescence separate from chronological age in E2 mediated effects in the
brain that is mediated through altered expression of estrogen receptors.
!
!
1
CHAPTER ONE: INTRODUCTION

Glia cells: form and function
Glia cells have long been considered passive bystanders in the brain, a
structural support for neurons and their processes. They were once
considered to be connective tissue, which their name is testament to, glia
derived from a Greek word for “glue”. Glia cells are the predominant cell type
in the cerebral cortex with a roughly 3:1 ratio to neurons, and are vital to the
proper functioning of neurons. While the exact function of glia cells, in addition
to their structural role, continue to be elucidated and refined, glia cells have
been shown to be important for regulating extracellular matrix, providing
neurotrophic factors and nutrients to neurons (Pellerin and Magistretti 2004),
modifying synaptic transmission (Ullian et al. 2001), and maintaining the
blood-brain barrier (Abbott 2002, Abbott et al. 2006). Glia cells can be divided
into two types of cells: macroglia and microglia, with macroglia being further
divided into astrocytes and oligodendrocytes.

Microglia are the resident macrophages of the brain and are derived from a
monocytic lineage. They serve as the brain’s innate immune cells, monitoring
extracellular chemical composition, secreting immune cytokines, and
scavenging debris (Conde and Streit 2006). There is also evidence that
microglia are highly mobile and dynamic, aiding in “synaptic pruning” where
!
!
2
they monitor and “prune” synapses via phagocytosis, further supporting the
role of glia cells as active participants in maintaining proper neuronal function
(Paolicelli et al. 2011).

Macroglia can be further divided into two types of cells, oligodendrocytes and
astrocytes, the latter being the main glia cell type studied in this dissertation.
The main function of oligodendrocytes is to provide insulation along neuronal
processes via the myelin sheath, a specialized cell membrane of
oligodendrocytes that wrap around and insulate the neuronal process thereby
aiding in signal propagation.

Astrocytes, named for their star-like “Astros” appearance, are the main focus
of this dissertation. Closer inspection and higher magnification of astrocytes
reveal a highly branched architecture for some populations of astrocytes while
others are less so. Astrocytes, like their neuron counterparts, are a highly
diverse and specialized group of cells with many different sub-populations with
unique characteristics including radial astrocytes found in association with
ventricles, fibrous astrocytes found in white matter, and protoplasmic
astrocytes in grey matter (Privat et al. 1997, Chen and Swanson 2003).
Astrocytes are often found in close association with blood vessels, their
processes called “end feet” help to shuttle nutrients from blood vessels to
nearby neurons and interact with endothelial cells of the blood-brain barrier
!
!
3
(Abbott 2002, Abbott et al. 2006). There is new evidence, reviewed by Yi et al.
(2001) that astrocytes also have metabolic sensing capabilities, which is
interconnected with their role as energy suppliers for neurons. Moreover,
there is evidence that astrocytes metabolize glucose and provide neurons with
lactate as a substrate for glycolysis in neurons according to the astrocyte-
neuron lactate shuttle hypothesis reviewed in (Chih et al. 2001). Astrocytes
also synthesize many important molecules including glutamate, an important
neuro-transmitter, laminin, an important substrate for neurite outgrowth
(Rozovsky et al. 2002, 2005), neurogenesis and neuronal differentiation (Liesi
et al. 1984, Heaton and Swanson 1988), and steroid hormones including
progesterone and estrogen (Micevych and Sinchak 2008). However, in
addition to the many beneficial roles of glia cells, they also have detrimental
roles that accompany aging, disease and inflammation.

Glial activation occurs during the inflammatory response, which can have
negative consequences with regard to neuronal function and neurite
outgrowth. Both astrocytes and microglia are activated in response to physical
brain injury, disease, and pathogens. When microglia become activated they
secrete inflammatory cytokines such as IL6, TNFa, etc. (Hanisch 2002,
Kettenman et al. 2011) which can have detrimental effects associated with the
inflammatory response, including neuronal death. Both microglia and
astrocytes undergo morphological changes in their cellular structure. Reactive
!
!
4
astrocytes are marked by an increase in glial fribrilary acidic protein (GFAP),
an intermediate filament often used as a marker for cells of astrocytic lineage.
Reactive astrocytes with elevated GFAP form a “glial scar” in response to
brain injury, and though this helps to prevent further damage, it also prevents
neuronal growth past the glial scar (Menet et al. 2003, Rozovsky et al. 2005,
Wanner et al. 2008). The number and size of reactive glia increase as a
consequence of aging, which accompanies the increase in the overall
inflammatory load during the aging process and subsequent loss of synaptic
function and overall neuronal health. GFAP has been of particular interest to
the lab and is a key focus in this dissertation. GFAP first became an interest
to the lab over 20 years ago, when the search began for genes that changed
in both Alzheimer’s disease (AD) and normal aging. In addition, because of
evidence for the role of sex and adrenal steroids in glial aging, genes were
screened for steroidal regulation; GFAP was found to be elevated by age and
Alzheimer by all screens (reviewed in Finch et al. 2004).

Age changes in GFAP
GFAP is an astrocyte specific intermediate filament that is highly conserved in
vertebrates and has been shown to increase with age progressively in both
human and rodent models (Goss et al. 1990, Goss et al. 1991, Nichols et al.
1993, Morgan et al. 1999). The age increase of GFAP indicates the rising
reactivity and hyperactivity of astrocytes while neuronal function shows a
!
!
5
reciprocal decline. Glial activation occurs early in aging, even before
detectable neurodegeneration supporting the importance of glia in overall
brain aging. GFAP is the main component in glial-scars that form from
hyperactive astrocytes in response to injury, which impairs neurite outgrowth
(Menet et al. 2003). Studies from the Finch lab by Rozovsky et al. (2005) used
a heterochronic co-culture system where primary astrocytes from different
aged adults are co-cultured with embryonic neurons. Using this model system
the Finch lab showed that old astrocytes have increased GFAP expression
and support less neurite sprouting than young astrocytes. These broadly
observed changes in GFAP expression arise during middle age in rodents and
humans in the absence of recognized neuronal or vascular pathology, or
neuron loss.

Astrocytic laminin is an important substrate for neuronal survival, growth and
differentiation (Liesi et al. 1984, Heaton and Swanson 1988, Rozovsky et al.
2002). Studies from our lab, Rozovsky et al. (2002 and 2005), have shown
that GFAP levels vary inversely with extracellular laminin levels and neurite
outgrowth, and that manipulating GFAP level with cDNA or siRNA also alters
laminin secretion and neurite outgrowth. Manipulation of GFAP in Rozovsky
et al. (2005) was also able to reverse or induce the age phenotype of
decreased neurite outgrowth in heterochronic co-culture. GFAP manipulations
will be addressed further in chapter 2.
!
!
6
Estrogen and GFAP expression
As reviewed in Finch et al. (2004) GFAP not only appeared in screens for
genes upregulated with age and further upregulated in AD, but also in glial
genes that show hormone response. 17!–estradiol (E2) treatment was shown
to decrease GFAP protein in the rat hippocampus after stab wound in both
male and female rats (Garcia-Estrada et al. 1993). In vivo studies in aging rats
show a decrease in E2-sensitive sprouting after deafferenting lesions (Stone
et al. 2000). In vitro data using the wounding-in-a-dish model, where a scratch
wound is introduced to an astrocyte neuron co-culture to simulate brain injury,
supports the in vivo observations. Using this model system the Finch lab
showed that young co-cultures respond to E2 treatment with a decrease in
GFAP and an increase in neurite outgrowth into the wound zone, while old co-
cultures do not exhibit this response (Rozovsky et al. 2005). This shows that
glial age affects hormone response and subsequent expression of GFAP,
laminin secretion, and neurite outgrowth.

The age changes in glial support of E2 mediated neuronal activity indicate a
role for estrogen receptors (ER) in aging glia and will be explored
experimentally in chapters two and three. The classical nuclear estrogen
receptors are ER" and ER!. They are from separate genes and both function
as nuclear receptors, binding to estrogen, form hetero or homo-dimers and
translocate to the nucleus and drive transcription.
!
!
7

Interestingly, studies on the upstream GFAP promoter from our lab and others,
have revealed multiple putative ERE response elements including two full
EREs with only a two base pair deviation from the consensus ERE sequence:
-149 (ERE
1
) and -1817 (ERE
2
) (Laping et al. 1994, Stone et al. 1998,
Rozovsky et al. 2002). Both sites were shown by Rozovsky et al. (2002) to be
important for E2-mediated GFAP expression. This study used a truncated
GFAP promoter construct that lacked the ERE
2
site and had a mutated ERE
1

site. Stone et al. (1998) showed that ERE
1
is a functional binding site for ER".
This indicates that estrogen may have direct transcriptional effects on GFAP
expression via estrogen receptors in addition to other genes that are E2-
responsive.

Age changes in estrogen receptor
Aging decreases the ovarian-hypothalamic-pituitary axis response to positive
estrogen feedback (Hall and Gill 2001; Shaw et al. 2011). This change in E2
response is associated with the perimenopausal transition (Prior and Hancock
2011, Burger et al. 2008, Butler and Santoro 2011). Astrocytic GFAP is
upregulated by the E2 induced luteinizing hormone (LH) surge in the
hypothalamus while aging rats show decreased E2 response (Anderson et al.
2002). These changes were not reversed by restoration of the LH surge in
aging rats. This suggests that age-related changes occur that inhibit proper
!
8

Table 1.1 Age changes in estrogen receptors
reference species sex brain region/methods Cell type ER! ER" other
Ishunina et al
2007

Human Female (34-
92yo)
(IHC) Hippocampus Glia cells Staining intensity increase with
age in control group w/o AD (34-
43yo vs 58-83yo) AD group (62-
92yo) showed decreased
staining intensity (semi-
quantitative analysis, %change
not given)

Ishunina &
Swaab 2008

Human M (20-85yo) F
(21-94yo)
(IHC) Hypothalamus, TMN,
thalamus, colliculus
inferial, pontine nuclei,
dorsal motor nucleus of
vagus, spinal cord
Not determined (MB1 splice variant) 200%
Increase in TMN with age
(female 21-46yo vs 58-94yo)

Proposed
dominant
negative ERa
isoform in
human brain
Ishunina &
Swaab 2009

Human M (20-85yo) F
(21-94yo)
(IHC) Whole brain

Neurons TADDI splice variant increased
with age in women in female (21-
46yo vs 58-94yo) hippocampus,
nuceus basalis of Meynert
(100%), and the tuberomamillary
nucleus (200%). Decreased in
these areas with AD. In men
TADDI increased in NBM with
AD
Altered hinge
domain, may
have altered
nuclear
localization
Wu & Gore
2010

Rat Male 3mo vs.
12mo
(IHC) Anteroventral
periventricular nucleus,
Medial preoptic nucleus
Not determined Testosterone decreased (600%)
ER! cell density in AVPV and
MPN No difference between 3mo
and 12mo rats

!
!
9

Table 1.1 continued
reference species sex brain region/methods Cell type ER! ER" other
Wilson et al.
2002
Rat Female
(3-
24mo)
(in-situ) ER" - Cerebral
cortex, Supraoptic
nucleus
ER! – periventricular
preoptic, medial preoptic,
ventromedial and acuate
nucleus
Not determined Decreased (40%) in
periventricular preoptic
nucleus with age (3-4mo
vs. 19-24mo)

ER! not detected
outside the
hypothalamus
Decreased (60%) with age (3-4mo
vs. 19-24mo) in both intact and
ovx+E2 groups treatment in cortex
and supraoptic nucleus

Sakuma et al.
2009
Rat Male (8
weeks)
IHC hippocampus

Astrocytes, and
pyramidal cells
Control group: localized
in pyramidal cells of CA1
and CA3 cytoplasm and
nucleus
SE group: Pyramidal
cells CA1 and CA3. At
day 21 after SE, ER!
expressing reactive
astrocytes appeared in
CA1 (cytoplasm,
nucleus and processes)
Control group: localized in
pyramidal cells of CA1 and CA3
cytoplasm but NOT nucleus
SE group: Pyramidal cells CA1 and
CA3. At day 21 after SE, ER"
expressing reactive astrocytes
appeared in CA1(cytoplasm,
nucleus and processes)
Status-
epilepticus
induced
hippocamp
al damage
% change
in ER
expression
Not
determined
Yamaguchi-
Shima and
Yuri 2007
Rat Female
(10
week,
12mo,
24mo)
(in-situ)hippocampus,
caudate putamen,
claustrum, accumbens
nucleus, substantia nigra
and cerebellum
Not determined Number of ER" positive cells
decreased w/ age 10wk vs 24mo) in
cortex (50%), CA3 (20%),caudate
putamen (70%), claustrum (53%) ,
accumbens nucleus (90%),
substantia nigra (60%)

10
! !
E2 mediated GFAP changes in the hypothalamus. A contributing factor may
be glial age changes, which implicate changes in astrocytic ERs as a potential
cause of alterations in E2-mediated effects. Age changes in ERs are
documented in table 1.1. Few studies target glia specifically which highlights
the importance of the studies discussed in this dissertation.

Hormone therapy and cognition
Estrogen has long been used to treat symptoms of menopause, which along
with hot flashes and mood swings also include memory loss. (Schnatz et al.
2005). Observational data from hormone replacement therapy (HRT) studies
in women have shown cognitive benefits (Carlson et al. 2001, Yonker et al.
2006), whereas other studies have shown modest or no effects (Wolf et al.
2005). Beneficial effects of estrogen on memory and cognition can also be
seen in men with age-related cognitive impairment (Sherwin et al. 2009),
which indicates an underlying biology in both males and females. Animal
models also show beneficial effects of estrogen on cognition from rodents
(Frick et al. 2002) to non-human primates (Rapp et al. 2003). The glial
component of E2-mediated cognitive effects and neurite outgrowth will be
explored in this dissertation.

11
! !
CHAPTER TWO: AGE CHANGES IN ESTROGEN RECEPTORS
AFFECT GLIAL SUPPORT OF E2-MEDIATED NEURITE
OUTGROWTH

ABSTRACT
During normal aging in humans and rodent models, cellular changes in the
brain during mid-life include progressive loss of synapses concurrently with
increased astrocyte size and GFAP content. To analyze the glial role in
neuronal changes during aging, we developed a heterochronic co-culture
system of primary glia from various adult ages which are seeded with E18
neurons. Optimal neuronal outgrowth requires 100pM E2. Primary astrocytes
from old rat cortex (‘old astrocytes’) co-cultured with E18 neurons supported
50% neurite outgrowth than with young astrocytes (Rozovsky et al. 2002).
Furthermore, astrocytic GFAP levels are inversely correlated with neurite
sprouting, which model in vivo changes. The present studies show that the
age-related loss of E2-mediated sprouting is linked to altered ratios of the two
main nuclear estrogen receptors (ER! and ER"). ER! protein levels are 3-fold
higher in old astrocyte cultures than the young, while ER" levels remain
unchanged. This difference in ER!/ER" ratio may underlie the changes in E2
response with age because ER" can act as a suppressor of ER!
transcriptional activity (Hall and McDonnell 1999, Pettersson et al. 2000,
Gougelet et al. 2007). This hypothesis was tested by manipulating ER!/ER"
ratio in young and old astrocyte cultures using siRNA oligos or cDNA
12
! !
expression plasmids. Young astrocytes may express an optimal ER!/ER"
ratio for E2-mediated sprouting. Increasing this ratio by increasing ER!
resulted in a loss of E2-mediated sprouting, while decreasing the ER!/ER"
ratio beyond normal young astrocytes by increasing ER" also resulted in a
loss of E2-mediated sprouting. In further support of this hypothesis,
decreasing the ER!/ER" ratio in old astrocytes restored E2-mediated
sprouting. The competing interactions of ER! and ER" in regulating GFAP
expression may underlie decreased synapse formation during aging.

INTRODUCTION
During normal aging in humans and rodent models, cellular changes in the
brain during mid-life include progressive loss of synapses concurrently with
increased astrocyte size and GFAP content. (Nichols et al.1993, Morgan et
al.1999). These broadly observed changes arise during middle-age in the
absence of recognized neuronal or vascular pathology, or neuron loss. In
addition, GFAP is also increased by experimental lesions in vivo and in vitro
(Stone et al. 2000, Rozovsky et al. 2002), while the aging brain supports less
neuronal sprouting post lesion (Scheff et al. 1980). Estrogen, which is well
documented to affect neurons and glia cells with effects on cognition, also
regulates GFAP. 17!–estradiol (E2) treatment was shown to decrease GFAP
protein in the rat hippocampus after stab wound in both male and female rats
13
! !
(Garcia-Estrada et al. 1993). Ovariectomized (OVX) aging rats show a
decrease in sprouting after deafferenting lesions (Stone et al. 2000).

Primary glia model in vivo changes in GFAP, support of neurite outgrowth and
response to estrogen. Studies from our lab and others have shown a link
between GFAP and laminin deposition as well as other ECM adhesion
molecules (Menet et al. 2000, 2001), and show the link between GFAP, aging
and response to E2 (Rozovsky et al. 2002, 2005). Because of the relationship
between estrogen, aging, GFAP, and neurite outgrowth established by our lab
and others, we sought to analyze age changes in estrogen receptors in
astrocytes.

To analyze the glial role in neuronal changes during aging, separate from the
neuronal component, we developed a heterochronic co-culture system of
primary glia from various adult ages which are seeded with E18 neurons.
Optimal neuronal outgrowth requires 100pM E2. Primary astrocytes from old
rat cortex (‘old astrocytes’) co-cultured with E18 neurons supported 50% E2-
mediated neurite outgrowth than with young astrocytes (Rozovsky et al. 2005).
Furthermore, astrocytic GFAP levels vary inversely with neurite sprouting,
which model in vivo changes shown by Stone et al. (2000).

14
! !
The present studies explore the relationship between the age-related loss of
E2-mediated sprouting and altered ratios of the two main nuclear estrogen
receptors (ER! and ER"). A difference in ER!/ER" ratio may underlie the
changes in E2 response with age because ER" can act as a suppressor of
ER! transcriptional activity (Hall and McDonnell 1999, Pettersson et al. 2000,
Gougelet et al. 2007). ER" can also inhibit ER! transcription through binding
to an ERE in the ER! promoter (Trukhacheva et al. 2009). Both ER! and ER"
receptors are expressed in astrocytes, microglia, and oligodendrocytes
(Santagati et al. 1994, Azcotia et al.1999, McEwen et al. 2001, Sierra et al.
2008). The heterochronic co-culture system allow astrocytic ERs to be
manipulated independently of neuronal ERs by transfecting adult monotypic
astrocyte cultures with ER siRNA oligos or ER cDNA expression plasmids
before plating neurons in order to study the role of astrocytic ER!/ER" ratio in
aging, E2 regulation of GFAP, and neurite outgrowth.

MATERIAL AND METHODS
Cell culture
Primary cultures of astrocytes were originated from cerebral cortex of young (3
mo) and old (24 mo) male F344 rats and plated at 200,000 cells/cm2 in
DMEM/F12 medium with 20% of FBS, 100 u/ml penicillin, and 50 u/ml
streptomycin at 37oC/5% CO2 (Rozovsky et al. 1998, 2005). Medium was
refreshed every 3 d until confluence by day 30, when microglia and
15
! !
oligodendrocytes were removed by shaking. For astrocyte-neuron co-cultures,
neurons from fetal (E18) cerebral cortex were seeded onto confluent
monolayer of astrocytes at 1:3 ratio (neuron: astrocyte) (Rozovsky et al. 2005).

Transfection of siRNA and cDNA
Astrocytes purified from microglia were plated onto poly-D-Lysine coated 4
chamber slides (Nalge Nunc international, IL) at 200,000 cells/chamber. The
next day, cells were transfected with siRNA (30 nM) or ER!/" cDNA (2.0 kb)
(0.1#g). ER! cDNA construct is human ER! cDNA (2.0 kb) (0.1#g) in the
PCMV5 expression vector (kindly provided by Dr. Christian Pike). ER" cDNA
construct is human ER" (1.6 kb) in the pSG5 vector (kindly provided by Dr.
Claudine Gaudon, Institut Génétique de Biologie Moléculaire et Cellulaire
(IGBMC), Illkirch-Cedex, France)

siRNA to rat ER! and ER" were synthesized by
ER! siRNA: wt : AA/GTCTCTGGAAGAGAAGGAC/CA
mut: AA/GTCTCGTGAAGAGAAGGAC/CA

ER" siRNA: wt: AA/AGCTGCCAGGCCTGCCGAC/TT
mut: AA/AGCTGCACGGCCTGCCGAC/TT

16
! !
Transfection was done in serum-reduced OPTI-MEMI (Gibco) for 3-6 hours,
then 3 times volume of normal serum containing medium was added
overnight. Medium was changed 24 hours after transfection. E2 treatment
started 48h after transfection.

Effectiveness of siRNA or cDNA transfection was analyzed using both qRT-
PCR and Western blot analyses. siRNAs were highly selective, e.g. siRNA
against ER! caused 43% reduction in ER! protein and no change in ERß;
siRNA against ERß caused 39% reduction in ERß with no change in ER!.
Non-targeting siRNA were used as controls. Transfection of human ER!
cDNA resulted in about 600% increase of ER! levels, while transfection of
ERß cDNA caused 400% increase in ERß. Over expression of one ER did not
cause any change in the other (fig 2.4).

Two days after transfection with siER!, siER", ER! cDNA or ERß cDNA, E18
neurons were plated at 1:3 ratio. One h later, E2 (100 pM) was introduced with
fresh media. 48 h after E2 treatment, co-cultures were fixed in methanol at -
200 for 5 min for immunocytochemistry.

Immunocytochemistry and image analysis
Fixed co-cultures were double immunostained with polyclonal rabbit anti-
GFAP (1:500, Dako, Carpinteria, CA) or with polyclonal rabbit anti-laminin-1
17
! !
(1:25, Sigma, St. Louis, MO) and monoclonal anti-MAP-5 (1:100, Sigma);
fluorescent secondary antibodies, Alexa Fluor 488 goat anti-mouse (green),
for MAP 5 and Alexa Fluor 594 goat anti-rabbit (red) for GFAP
immunostaining.

Neurite outgrowth was measured as the area covered by MAP-5
immunopositive neurites, defined with a modified Sobel edge detection
algorithm (IPLab, Scanalytics, Inc., Fairfax, VA) (see details in Rozovsky et al.
2005). Briefly, a semi-automated program used IPLab imaging software to
define the edge profile of the neurites, exclusive of cell bodies. This filtered
image was further processed (skeletonized) to generate a single pixel line.
From the one pixel width line, the total neurite length was calculated. GFAP
immunoreactivity was measured as area using IPLab imaging software.

Confocal image analysis
IHC was performed on slides of 18#m sagittal cryostat sections with 2 young
(3mo) and 2 old (24mo) brains per slide. Sections were analyzed for ER"
(Santa Cruz H-150) or ERa (Santa Cruz MC-20) and GFAP (Millipore).
Images of molecular layer cells were captured with a Nikon TE2000 scanning
confocal microscope and EZ-C1 software. Z stack images were taken with a 1
#m step size and analyzed using ImageJ “measure stack” plugin. For each
slide an optimal threshold was determined to reduce background and
18
! !
maximize signal. Only cells that co-localized with GFAP and were visible in
their entirety through the stack were analyzed. Signal from each image in the
stack was isolated using the magic wand tool and total integrated density per
cell was measured.

Western blot
Cells were lysed in 10mM Tris, 2% SDS, 10% ß-mercaptoethanol, and 0.5 mM
EDTA, followed by boiling for 5 min. To analyze astrocytic ER! and ERß,
equal amounts of proteins were electrophoresed on 10% acrylamide gels,
followed by immunoblotting with primary anti- ER! and anti-ERß antibodies
(Santa Cruz Biotechnology), then processed with peroxidase conjugated
secondary antibodies and SuperSignal West Pico Chemiluminescent
Substrate (Pierce, Rockford, IL). Relative optical density was measured by IP
Lab gel (Signal analytics Corp., Vienna, VA). Signals were normalized to beta-
tubulin.

Quantitative real-time PCR
Total cellular RNA was extracted from purified young and old astrocytes
cultures and cultures transfected with siER!, siER", ER! cDNA or ER" cDNA.
mRNA were reverse transcribed to cDNA (Super Script III Invitrogen).
Estrogen receptor genes were amplified using specific primers by qRT-PCR.
19
! !
Signals were analyzed in IPLab Gel and normalized to housekeeping gene
beta-actin. Primers were synthesized as follows:

rERalpha_F AATTCTGACAATCGACGCCAG
rERalpha_B GTGCTTCAACATTCTCCCTCCTC (28)

rERbeta-F ATCTGTCCAGCCACGAATCA (GI:6978816)
rERbeta-R ATTAGCACCTCCATCCAGCA

Statistical analysis
Each experiment was repeated 3-5 times. Data were analyzed by using
ANOVA or paired t-test (GraphPad software)

RESULTS
Validation of astrocyte effects on E2-mediated neurite outgrowth
Old (24mo) astrocyte co-cultures support less basal neurite outgrowth and do
not support E2-mediated neurite sprouting in ‘wounding-in-a-dish’ cultures. We
first validated the non-wounded co-culture system in showing an age-related
decrease in astrocyte support of E2-mediated neurite outgrowth. Data shows
40% less support of neurite outgrowth by old (24mo) astrocytes that young
(3mo) astrocytes (Fig 2.1) as well as 40% increased neurite outgrowth with E2
20
! !
treatment in young (3mo) astrocyte co-cultures. Old co-cultures showed no
E2 response.
MAP5 (ICC)
Young (3mo)
Young (3mo) + E2
Old (24mo)
Old (24mo) + E2
0
50
100
150
200
**
*
%Young Control
MAP5 MAP5
Young + E2 Old + E2
A B

Differential expression of ER! and ERß with age in astrocytes from
cortical tissue and cultured cortical astrocytes

In order to test the hypothesis that age-related changes in astorcytic ERs
underlie a loss of E2-mediated response in-vitro, confocal microscopy was
used to analyze ER expression in brain regions of young and old rats. Total
intensity of ER signal was measured per astrocyte in the cortex (Fig2 .2A and
C). We show a 90% age-increase of ER! and a 13% age-increase of ER" per
cortical astrocyte. There was also a significant age-increase (77%) in the
ER!/" ratio in the cortex (Fig. 2.2E). Frequency distribution of receptors was
Fig. 2.1 Aging astrocytes support less E2-mediated neurite outgrowth
A. 100pm E2 increased neurite outgrowth 40% in young (3mo) astrocyte co-
cultures but not old (24mo). Basal support of neurite outgrowth was decreased
40% with age. B. Fluorescent -microscope images (20x) of MAP5 (green) ICC
depicting decrease in astrocytic support of E2-mediated neurite outgrowth with
age. (mean+SEM) p *<0.05, **<0.01
21
! !
ER! protein (IHC)
per astrocyte in male rat cortex
Young (3mo)
Old (24mo)
0.0
200000.0
400000.0
600000.0
800000.0
***
Total IntDen per cell
Frequency Distribution of
ER! in Cortical Astrocytes
0
1000000
2000000
3000000
4000000
0
50
100
Young (3mo)
Old (24mo)
Bin Center (IntDens)
% total cells
ER" protein (IHC)
per astrocyte in male rat cortex
Young (3mo)
Old (24mo)
0
100000
200000
300000
400000
500000
*
Total IntDen per cell
Frequency Distribution of ER" in
Cortical Astrocytes
0.0 400000.0 800000.0
0
50
100
Young (3mo)
Old (24mo)
Bin Center (IntDens)
% total cells
ER!/" ratio in
male rat cortex
young (3mo)
" / ! ER
old (24mo)
" / ! ER
0.0
0.5
1.0
1.5
2.0
2.5
*
ER
!
/
"
expression ratio
A B
C D
E F
Cortical Astrocyte Volume
Young (3mo)
Old (24mo)
0
50
100
150
**
%Young
G
Perecent of ER positive
astrocytes per field
!
young ER
! old ER
" young ER
" old ER
0
20
40
60
80

Fig2.2. ER protein levels in cortical astrocytes in vivo
Astrocytes were analyzed with confocal microscopy to determine total intensity of
ER protein signal per astrocyte in the cortex. A-B. Age-increase in astrocytic ER!
(90%); C-D. Minimal age change in astrocytic ER"; E. Age-increase in ER!/" ratio
(77%); F. Increase in volume of astrocytes with age; G. Percent ER positive
astrocytes per field (mean+SEM); *** P< 0.001, ** P<0.01,* p<0.05
22
! !
analyzed showing an age-increase in the percentage of astrocytes with high
expression levels of ER! (Fig 2.2B). ER" shows a slight increase in
percentage of astrocytes with higher expression levels (Fig. 2.2D). Old
astrocytes showed a 20% increase in total cell volume measured by GFAP
(Fig 2.2F). There was no age difference in the percent ER co-localization
studies (Fig 2.2G). We also saw a 30% age-increase in ER! in astrocytes of
the Corpus Callosum (data not shown).

RT PCR of cultured astrocytes showed 3-fold higher levels of ER! mRNA in
old astrocytes compared to young astrocytes, whereas ERß showed no age
ER mRNA Levels
!
Young ER
!
Old ER
"
Young ER
" Old ER
ratio
" /
!
Young ER
ratio
" /
!
Old ER
0
100
200
300
400
500
***
***
relative copy number
(%young)
ER protein levels (western blot)
! Young (3mo) ER
!
Old (24mo) ER
" Young (3mo) ER
" Old (24mo) ER
ratio
" /
!
Young (3mo) ER
ratio
" / !
Old (24mo) ER
0
100
200
300
400
***
***
(% young)
A
B
C
change. Protein levels measured by western blot showed similar age changes
for ER! and a modest decrease in ERß (Fig. 2.3 A- C). Western blot analysis
Fig. 2.3 ER levels in cultured astrocytes
A. mRNA (RT-PCR) for ERs: old astrocytes have a 3-fold increased ER! while ERß
shows similar levels in both young and old astrocytes. B. Protein expression
(western blot) for ERs show similar age-related differences; C. Immunoblot showing
the expected size products for ER! and ERß. Data (mean+SEM) expressed as a
percent of young; ***, P< 0.001
!
23
! !
on cortical tissue lysates from young and old rats showed a similar age-
increase in ER! as cultured astrocytes. Due to the differential expression of
ERs with age seen both in cultured cortical astrocytes and in cortical
astrocytes in sectioned tissue, we then investigated the effect of ER
manipulation on E2-mediated neurite outgrowth.

A series of experiments using the heterochronic co-culture system (Rozovsky
et al. 1998) manipulated astrocytic ER! or ER" by siRNA (decrease) or cDNA
(increase) in primary cortical astrocytes cultured from young (3mo) and old
(24mo) F344 rats. Specific and selective siRNA oligos were designed to target
single-stranded secondary structures in the predicted folded structure (mFold)
of the mature mRNA sequences of ER! and ER". Specificity of ER-siRNA
was confirmed by both western blot and qRT-PCR (Fig4a-d). Astrocytes were
treated with ER-siRNA or ER cDNA prior to overlaying with E18 neurons
thereby selectively manipulating ERs in astrocytes, but not in neurons. E2 (0.1
nM) was added to co-cultures 1 h after neuron plating and co-cultures were
analyzed with IP lab for GFAP expression and neurite outgrowth via
quantitative fluorescent ICC 2 d later (see methods).

Manipulation of ER! in young and old astrocytes
Due to the increase of ER" in old astrocyte cultures, we first used
24
! !
ER"#siRNA to knockdown expression to test the hypothesis that age-related
changes in astrocytic ERs underlie the loss of E2-mediated neurite outgrowth.

ER siRNA Protein Knock-down in young
male rat (3mo) cultured astrocytes
Control
siRNA
!
ER
si-control
Control
siRNA
"
ER
si-control
0
50
100
150
%Control
ER mRNA levels in young male rat (3mo)
cultured astrocytes post manipulation
Control
Control
si-control
si-control
!
siRNA ER
!
siRNA ER
"
siRNA ER
"
siRNA ER
cDNA
!
ER
cDNA
!
ER
cDNA
"
ER
cDNA
"
ER
0
50
100
150
200
400
600
800
ER!
ER"
%Control
ER mRNA levels in old male rat (24mo)
cultured astrocytes post manipulation
Control
Control
si-control
si-control
siRNA ERa
siRNA ERa
siRNA ERb
siRNA ERb
ERa cDNA
ERa cDNA
ERb cDNA
ERb cDNA
0
50
100
150
200
400
600
800
ER"
ER!
%Control
ER! ER"
64kD 57kD
Tubulin
siRNA
- ! ctl - " ctl
A B
C D
!
Fig. 2.4. Verification of protein & mRNA levels after siRNA or cDNA treatment.
A-B. Analysis of ER protein after manipulation show 50% decrease in ER! with ER!
siRNA and 45% decrease in ER" with ER" siRNA. No difference between non-
transfected and siRNA control transfected protein levels. C-D. Analysis of ER mRNA
after manipulation show 50% decrease of ER! with ER! siRNA and 70% decrease
in ER" with ER" siRNA. 600% increase in ER! and a 400% increase in ER" with
cDNA transfection was observed. No cross-talk between ERs was observed in
either young or old astrocytes. Data (mean+SEM)

25
! !
In old astrocyte co-culture, knockdown of ER" with siRNA (Fig.4A)
significantly decreased GFAP expression and increased E2-mediated neurite
outgrowth to levels seen in young astrocyte co-cultures. However, in young
astrocytes, ER" knockdown did not change either GFAP or neurite outgrowth
(Fig 2.5). This lack of response!to ER"-siRNA is consistent with the inverse
relationship of GFAP expression to neurite outgrowth (Rozovsky 2005) and
suggests a role of ER" in GFAP expression and subsequent neurite
outgrowth.
!
To further characterize the role of astrocytic ER" in the loss of E2-mediated
neurite outgrowth with age, young astrocyte cultures were transfected with
ER" cDNA to up-regulate ER". Because old astrocytes express higher levels
of ER", young astrocytes were transfected with ER" cDNA significantly
increased GFAP expression and decreased E2-mediated neurite outgrowth
(Fig. 2.5B). Old astrocytes were not used in ER" cDNA experiments because
their ER" levels were already indicative of a loss in E2 sensitivity. The
induction of an aged phenotype in young astrocyte co-cultures via
ER" upregulation provides further evidence for the role of ER" in the loss of
E2-mediated neurite outgrowth with age. These bi-directional manipulations of
neurite outgrowth by ER" also suggest that a higher ER"/ERß ratio in old
26
! !
Fig.2.5. Manipulation of astrocytic ER! with siRNA and cDNA: GFAP and
neurite outgrowth.
Young and old astrocytes cultures were transfected with ER siRNA or cDNA (30
nM). GFAP immunoreactivity was measured as area; neurite outgrowth was
measured as the area covered by MAP-5 immunopositive neurites. A-B. siRNA
ER! in young astrocytes had no effect while significantly decreasing GFAP and
increasing neurite outgrowth in old astrocyte co-culture. C. ER! cDNA in young
astrocytes significantly increased GFAP and decrease neurite outgrowth; Data
(mean+SEM) expressed as a percent of young; *, P< 0.05 ***, P<0.0001.
!
GFAP (ICC)
Young Control
Young siERa
Old Control
Old siERa
0
50
100
150
***
Immunopositive area
(% young control)
MAP5 (ICC)
Young Control
!
Young siER
Old Control
!
Old siER
0
50
100
150
*
Immunopositive area
(%young control)
A
Down-regulation of ER! in young and old astrocytes
B
Young Control GFAP
cDNA GFAP
!
Young ER
Young Control MAP5
cDNA MAP5
!
Young ER
0
50
100
150
200
***
***
GFAP (ICC) MAP5 (ICC)
Immunopositive area
(% Control)
Up-regulation of ER! in young astrocytes
!

27
! !
astrocytes is a key factor in the loss of E2-mediated neurite outgrowth with
age. Changes in the ER!/ER" ratio may underlie the changes in E2 response
with age because ER" can act as a suppressor of ER" transcriptional activity
(Hall and McDonnell 1999, Pettersson et al. 2000, Gougelet et al. 2007).

Manipulation of ERß in young and old astrocytes
To examine the role of ER!/ERß ratio in young astrocytes, we transfected
young astrocytes with ER" siRNA, thereby increasing the ER"/ERß ratio to
levels closer to those found in old astrocyte cultures. This induced an age
phenotype of increased GFAP and decreased neurite outgrowth, supporting
the hypothesis that ER"/ERß ratio is critical for E2-mediated neurite outgrowth
(Fig 2.6A). Additional support for this hypothesis came from an experiment
where we transfected old astrocytes with ER"-cDNA, thereby decreasing the
ER"/ERß ratio to levels closer to those found in young astrocyte cultures.
Decreasing ER"/ERß ratio in old astrocytes via ER" cDNA transfection
caused a significant decrease in GFAP and a small (non- significant) increase
in neurite outgrowth (Fig 2.6B), restoring some E2 mediated effects. Both ER"
knockdown and ERß up-regulation caused a reversal of the age phenotype in
old astrocyte co-cultures supporting the role of the ER"/ER" ratio in regulating
GFAP expression and response to E2.
28
! !
Young Control GFAP
GFAP
!
Young siER
Young Control MAP5
MAP5
!
Young siER
0
50
100
150
***
***
GFAP (ICC) MAP5 (ICC)
Immunopositive area
(%Control)
Old Control GFAP
cDNA GFAP
!
Old ER
Old Control MAP5
cDNA MAP5
!
Old ER
0
50
100
150
**
GFAP (ICC) MAP5 (ICC)
Immunopositive area
(% Control)
A B
upregulation of ER!
in old astrocytes
downregulation of ER!
in young astrocytes

To further explore the role of the ER"/ERß ratio in adult glia cultures, we
decreased the ER"/ERß ratio in young astrocytes by increasing ERß with
ERß cDNA. Lowering the ER"/ERß ratio beyond that of normal young
astrocyte co-cultures elevated GFAP and inhibited neurite outgrowth (Fig.2.7).

Fig.2.6. Manipulation of astrocytic ER" in young and old astrocytes.
Young and old astrocytes cultures were transfected with ER" siRNA or cDNA (30
nM). GFAP immunoreactivity was measured as area; neurite outgrowth was
measured as the area covered by MAP-5 immunopositive neurites.
A. ER" downregulation by siRNA in young significantly increased GFAP and
decreased neurite outgrowth. B. ER" upregulation by cDNA in old astrocytes
decreased GFAP and showed a trend for increased neurite outgrowth Data
(Mean+SEM); *, P< 0.05 ***, P<0.0001.
!
29
! !
DISCUSSION
These studies demonstrated the age-related increase in ER" level in cultured
cortical astrocytes
originated from 24 mo old
rats vs. 3 mo old rats. In-
vivo analysis of ERs has
provided supporting
evidence for ER age
changes occurring in
concert with GFAP
changes as the corpus
callosum, a region where
we have reported a higher
age-increase in GFAP
expression (Morgan et al.
1998) also shows an age
increase in ER" and an
age decrease in ER!. We
have shown that old astrocytes support much less E2-mediated neurite
outgrowth than young or neonatal astrocytes in co-culture with embryonic
cortical neurons (Rozovsky et al. 2005). The present studies manipulated
Fig 2.7. Upregulation of ER" in young astrocytes
Young astrocytes cultures were transfected with
ER" cDNA (30 nM). GFAP immunoreactivity was
measured as area; neurite outgrowth was measured
as the area covered by MAP-5 immunopositive
neurites. ER" cDNA in young astrocytes
significantly increased GFAP and decreased neurite
outgrowth Data (mean+SEM); **, P<0.001.
!
Young Control GFAP
cDNA GFAP
!
Young ER
Young Control MAP5
cDNA MAP5
!
Young ER
0
50
100
150
**
**
GFAP (ICC) MAP5 (ICC)
Immunopositive area
(% Control)
upregulation of ER! in young astrocytes
30
! !
ER"/ERß ratio bi-directionally by decreasing ER" in old astrocytes (ER"
siRNA) or by increasing ER" (cDNA transfection.) By decreasing the
ER"/ERß ratio in old astrocytes, we observed the restoration of E2-mediated
neurite outgrowth. Whereas increasing the ER"/ERß ratio in young astrocytes
inhibited neurite outgrowth.

Altering the ER"/ERß ratio via ERß manipulation also modified GFAP
expression and neurite outgrowth. When ERß was overexpressed in old
astrocytes to decrease the ER"/ERß ratio, there was a trend of increased
neurite outgrowth (non-significant), while GFAP was decreased as expected.
Interestingly, decreasing the ER"/ERß ratio in young astrocytes also
increased GFAP expression and inhibited neurite outgrowth. This indicates
that the ER"/ERß ratio in young astrocytes may be at an optimal level for
neurite outgrowth. In all manipulation of astrocytic ERs, neurite outgrowth was
inversely correlated with GFAP, confirming prior studies (Rozovsky et al.
2005) Fig. 6 shows these reciprocal relationships between ER" levels, and
neurite outgrowth and GFAP, citing prior data as well. In all manipulation of
astrocytic ERs, neurite outgrowth was inversely correlated with GFAP,
confirming prior studies (Rozovsky et al. 2005)

31
! !
Our studies have shown ERs to be capable of affecting GFAP expression and
downstream neuronal function. We propose a model for astrocytic age
changes in ERs where elevated ER"/ERß ratio results in increased GFAP
thereby inhibiting secretion of extra cellular matrix proteins and neurotrophic
factors. We have previously established the inverse relationship of
extracellular laminin and neurite outgrowth. Changes in ERs may underlie
changes in laminin as we previously showed astrocytic laminin secretion to
increase with E2 treatment in the “wounding-in-a-dish” co-culture system
(Rozovsky et al. 2002). It has also been shown that E2 induces laminin
synthesis in human skin fibroblasts while tamoxifen, a pan ER antagonist can
block this effect indicating a role for ERs in this pathway (Soldano et al. 2010).
To add another level of complexity, laminin decreases ER! expression in the
human breast cancer cell line MDA-MB-231 (Neubauer et al. 2009), indicating
that E2 induced astrocytic secreted laminin may in turn affect ER expression
and E2 response in other cell types such as neurons. In addition, E2 has
been shown to regulate astrocytic secretion of growth factors such as TGF-!
(Buchanan et al. 2000, Dhandapani et al. 2005), which may be affected by
altered ER expression with age.

To our knowledge no other studies have directly looked at the role of the
ER"/ERß ratio in regulating GFAP. Studies by Spence et al. (2011) have
32
! !
used cell type knock-out (astrocytes and neurons) of ER! to study E2-
mediated neuroprotection in experimental autoimmune encephalomyelitis
(EAE) mice, a mouse model for multiple sclerosis (MS). Their study showed
that astrocytic ER!, not neuronal ER!, was necessary for E2-mediated
neuroprotection in EAE. This study implicates astrocytes in mediating E2
effects on neurons, supporting our hypothesis. This study also supports the
importance of the ER!/" ratio because by knocking-out ERa completely in
astrocytes the ER!/" ratio is lowered beyond that of normal E2-sensitive
astrocytes. This may explain the effects of increasing ER" in young astrocyte
co-cultures as this experiment lowered the ER!/" ratio beyond that of normal
E2 sensitive young astrocytes.

Fig 2.8. Changes in ER! and its effect on GFAP and neurite outgrowth
A. Increase or decrease of E2-mediated neurite outgrowth inversely
correlated with GFAP levels as was observed in our prior studies (Rozovsky
et al., 2005). B. Reciprocal relationships between astrocytic ER! levels,
GFAP and neurite outgrowth.

!
GFAP%
MAP5%
MAP5
GFAP
A
B
ICC intensity
low
low
high
ER! level
high
-100
0
100
-100 0 100
O GFAP siRNA
Y GFAP cDNA
Age effect
Y GFAPsiRNA
Y ERacDNA
O ERa siRNA
33
! !
While studies have shown that total ER" levels increase in the hippocampus
with E2 and accompany increased cognitive function in ovariectomized rats, it
is unclear do to the multiple cell types present which cell types are contributing
to the change (Rodgers et al. 2010). ER" is shown to be upregulated in
astrocytes with age in the hippocampus of human females (Ishunina et al.
2007), which is consistent with our in vitro findings in rodents. This suggests a
change in the ER"/ERß ratio in humans which may accompany a loss of E2-
mediated cognitive benefits which may be pertinent to hormone replacement
therapy (HRT). Alterations in ER"/ERß ratio during normal aging in mammals
may preclude a loss of E2-sensitivity in astrocytes which then alters GFAP
expression and support of optimal neuronal function and may represent the
closing of the window of opportunity for successful HRT mediated cognitive
benefits. This is further explored using a rat perimenopausal model in chapter
3 of this dissertation. Interestingly, the age-increase in GFAP transcription has
been shown to be attenuated by caloric restriction (Nichols et al. 1996, Morgan
et al. 1999), which implies oxidative stress as a potential mechanism behind
increased GFAP transcription with age. ER" has also been implicated in
decreased peroxide metabolism and increased sensitivity to peroxide DNA
damage (Mobley and Brueggemeier 2004). GFAP transcription has been
shown to be regulated by E2 possibly through transcriptional control by ERs
suggested by the presence of EREs in the upstream promoter (Stone et al.
34
! !
1998). The age-increase in both GFAP and ER" may be related to increasing
oxidative stress during aging.

35
! !
CHAPTER THREE: ESTROGEN MEDIATED NEURITE OUTGROWTH
IS DETERMINED BY OVARIAN CYCLING STATUS

ABSTRACT
Rodent models of perimenopause undergo lengthening of estrous cycles in
association with altered sensitivity of hypothalamic control of pituitary
gonadotropins by estradiol (E2) concurrently with activation of hypothalamic
glia. This study analyzed glial age changes in neurotrophic support during the
perimenopausal transitions, using mixed glia (astrocytes: microglia, 3:1) in co-
culture with E18 cortical neurons. For comparison with prior studies on
astrocytes, mixed glia were analyzed from aging male rats, and showed strong
age-impairment of E2-dependent neurite outgrowth (24 mo vs. 3 mo).
This study analyzes E2-response in mixed glia derived from 5-13 moth old
rats. These rats were divided into three groups based on stage of
reproductive senescence: normal cyclers (4-5 day cycles), irregular cyclers
(>6 day cycles), and constant estrus (>7 days estrus). We have found that in
co-culture, mixed glia derived from normal cycling animals support E2-
mediated increase in neurite outgrowth, but mixed glia derived from irregular
cycling and constant estrus animals do not. This change in E2-mediated
neurotrophic support accompanies an increase in ER! and the ER!/" ratio in
astrocytes both in vivo and in vitro. These results suggest a component stage
of reproductive senescence separate from chronological age in E2 mediated
36
! !
effects in the brain that is mediated through altered expression of estrogen
receptors.

INTRODUCTION
Mammals have a finite reproductive span, and the subsequent ovarian follicle
depletion that occurs with age causes a large drop in circulating estradiol (E2)
and progesterone and a cessation of ovarian cycles, or menopause. (vom
Saal et al. 1992, Gosden et al. 1983, Finch et al. 1984). There is an increase
in irregular cycling along with decreasing fertility and an increase in the
frequency of anovulatory cycles with low levels of estrogen (E2) and
progesterone (P4) during the perimenopausal transition (Treloar et al. 1967).
And while there is an increase in anovulatory cycles with low E2 and P4 during
perimenopause, there are higher levels of E2 in the ovulatory cycles of
perimenopausal women. Intricate changes occur to the sensitivity of the
ovarian-hypothalamic-pituitary axis which are associated with the
perimenopausal transition (Prior and Hancock, 2011, Burger et al. 2008, Butler
and Santoro 2011). Thus, preceding menopause and reproductive
senescence ovarian and hypothalamic changes both occur.

Characteristics of menopause are modeled by changes in rodents during
reproductive senescence. Laboratory mice and rats exhibit depletion of
ovarian follicles (Gosden et al. 1983, Finch and Holmes 2010) and even
37
! !
though highly inbred, rodent models show high variability in cycle length
during perimenopause and age of cycling cessation (Nelson et al. 1982, Finch
et al. 1998). Rodents show increased cycle irregularity at 8 months of age, and
by 15 months of age most animals are in the constant estrus (CE) acyclic
stage, though some individuals in this age range still exhibit fecundity and
ovulatory cycling.

In perimenopausal women, anovulatory cycles are characterized by low E2
and P4. In aging rodents, CE models these hormone levels since E2 below
proestrus levels but is 3-fold higher than ovariectomized levels, whit P4 levels
at low OVX levels (Nelson et al. 1983). Young ovarian transplants to older CE
mice fail to induce the pro-ovulatory surge of luteinizing hormone (LH) and
follicle-stimulating hormone (FSH) indicating a desensitization of the
hypothalamus to E2 showing changes that model those seen in
perimenopausal women (Finch et al. 1984). Young ovarian transplants to older
but still cycling mice showed both ovarian and hypothalamic changes (Nelson
et al. 1992). This indicates that changes that occur during reproductive
senescence and perimenopause may result in brain changes that alter E2
response and are not altered by further ovarian hormone manipulation.

In aging rodents, reproductive senescence is associated with cognitive
decline. A study by Paris et al. (2011) showed learning impairments in 12 mo
38
! !
old, irregular cycling, and constant estrus rats compared with age-matched
normal cycling animals. A chronic estrogen treatment of 8 weeks at
physiological levels impaired cognition in 12 mo old rats, indicating that
prolonged exposure to estrogen may be a mechanism for the cognitive
declines seen with ovarian cycling decline (Neese et al. 2011; Wang et al.
2009).

Chronic E2 treatment also impaired cognition in ovariectomized 3 mo old rats
and increased microglia activation, this impairment was synergistic with LPS
treatment whereas intact rats showed no synergistic impairment with LPS
(Marriott et al. 2002). In a separate study, chronic E2 treatment was shown to
increase superoxide production in the brains of intact 3 mo old rats
(Sabrumanian et al. 2011). A study from the same group comparing 4-5 mo
old normal cycling animals to 16-18 mo old constant estrus animals showed
that following ovariectomy and chronic E2 treatment, hypothalamic GFAP and
IL1" levels were increased in young, normal cycling animals to levels
approximating old, constant estrus animals (Mohan-Kumar et al. 2011). While
short-term estrogen treatment can be anti-inflammatory and neuro-protective,
(Stone et al. 1998a, Stone et al. 1998b, Wong et al. 2009, Khaksari et al.
2011), the above mentioned studies indicate that constant low levels of
estrogen may be pro-inflammatory and contribute to age-related cognitive
declines and increased inflammation. Moreover, findings by Bake and
39
! !
Sorahbji (2004) show that estrogen has opposite effects on blood-brain barrier
permeability in young (decrease) and older acyclic rats (increase).

The targets and mechanisms of estrogen activity in the brain is complex
puzzle as neurons (Shughrue et al. 1997, Temel et al. 2002), astrocytes
(Azcoitia et al. 1999), microglia (Liu et al. 2005, Sierra et al. 2008, Elzer et al.
2010) and oligodendrocytes (Takao et al. 2004) all express estrogen
receptors. This combined with findings that estrogen receptors are
differentially expressed in different brain regions (Simerly et al. 1990,
Shughrue et al. 1997) indicates that E2-mediated cognitive effects require
complex communication between various neural cell types with differential
expression of estrogen receptors complicating the pleiotropic nature of
estrogen mediated effects.

Glia cells have been implicated in both short-term E2 effects and chronic E2
effects. The above mentioned studies by Marriott et al. (2002) and
Sabrumanian et al. (2011) both show increased glial activation with chronic
estrogen treatment. Short-term estrogen treatment decreases astrocyte
(Stone et al. 1998, Wong et al. 2005) and microglia activation (Bruce-Keller et
al. 2000, Dimayuga et al. 2005, Wong et al. 2005).

40
! !
We are particularly interested in glial mediated effects on neurite outgrowth
and have shown that glia age affects their support of neurite outgrowth and
response to estrogen (Rozovsky et al. 2002, 2005, chapter two). We
developed a hetero-glia E18 neuron co-culture model system in order to study
glial-mediated effects on neurite outgrowth. In this in-vitro model system glia
differ by age, or as in this study, stage of reproductive senescence. Cultured
glia cells have been shown to retain age-related changes that approximate
age-changes in vivo, such as decreased support of neurite outgrowth
(Rozovsky et al. 2005), loss of E2 sensitivity (Rozovsky et al. 2002, 2005),
decreased support of neuronal differentiation (Lewis et al. 2009), as well as
increased expression of inflammatory and reactive markers such as GFAP
(Rozovsky et al. 2005,) CD68 (Wong et al. 2005). The hetero-glia co-culture
model system allows the study of glial donor mediated effects on E18 neurons.

Using this model system we have also shown that astrocytic estrogen receptor
levels are altered with age in male rats both in vivo and in vitro. With an
increase in estrogen receptor ! (ER!) and no change in estrogen receptor "
(ER"), thereby increasing the ER!/" ratio (chapter two). The ER!/" ratio may
play a crucial role in glial response to estrogen and support of neuronal
function as ER" can act as a dominant negative regulator of ER! mediated
transcriptional events (Hall and McDonnell 1999, Pettersson et al. 2000,
Gougelet et al. 2007). These changes in estrogen receptors occur
41
! !
concurrently in elevations in GFAP, cognitive declines, and loss of response to
estrogen. We hypothesize that changes in glia may underlie changes in
cognition and support of neuronal function with progressive stage of
reproductive senescence and exposure to chronic low levels of estrogen.

In this study we used animals that were normal cycling (4-5 day cycles),
irregular cycling (>6 day cycles) and constant estrus (>7 days continuous
estrus) to study changes in glial support of neurite outgrowth with stage of
reproductive senescence. We document glial expression of estrogen
receptors, GFAP, and support of estrogen-mediated neurite outgrowth.

MATERIALS AND METHODS
Animal Care and Cycling Status
Retired breeder Sprague Dawley female rats were purchased from Harlan
Laboratories and were housed at a 12-h light/dark cycle. After a one-week
acclimation period, vaginal cytology was performed. Daily vaginal smears
were performed in the AM to monitor cycling status. A fire-polished, shortened
Pasteur pipet with few drops of saline was inserted to the opening of vagina
carefully (with a insertion less than 1 mm, to avoid inducing pseudo-
pregnancy). Saline was expelled into the vagina and aspired back into the
pipet tip two times, then the vaginal wash was transferred to and smeared on
a microscope slide. The used pipet was rinsed with 70% ethyl alcohol and
42
! !
saline several times before the application for second sampling. The smear
on the slide was fixed with 100% Methanol and stained in 2% Giemsa Blood
Stain (Medical Chemical Corp., Los Angeles).

Smear slides were prepared at the morning of each day at 11am and
examined using a 100x microscope in phase contrast mode. The amount of
cell types among leukocytes, round epithelial cells, and cornified cells would
indicate the stage of the smear. An estrus cycle was defined as the period
between successive proestrus smears (DP, P, or PE) of two valid estrus
cycles. Among older females, there were frequent a series of contiguous
proestrus smears at the beginning of the potential cycle. At these cases, the
Day 1 is defined as the highest rank of the proestrus smear in the series (P >
DP > PE). A valid cycle met the criteria defined from the early studies of rats
(Long and Evans 1922) and mice (Allen 1922). The cycle begins with
proestrus stage followed by a cornified cell stage (E or M) with at least one
day long and then leukocytes stage (D or PD) (Nelson et al. 1982).

Tissue Collection
3-17 mo female Sprague Dawley rats were anesthetized and sacrificed
according to IUCUC protocol. Whole brains were taken and cut in half with the
right hemisphere saved for primary glia culture and the left hemisphere placed
in 4% paraformaldehyde for 2 days. Tissue was then transferred to 30%
43
! !
sucrose/PBS solution for cryo-protection. Once tissue had sunk, brains were
blocked in OCT and sagittal sections were taken (18um sections).

Immunohistochemistry and image analysis
IHC was performed on slides of 18#m sagittal cryostat sections with 3 brains
per slide. Each slide had one brain from each stage of reproductive
senescence analyzed, normal cycling (9-10mo), irregular cycling (9-10mo),
and constant estrus (9-10mo). Sections were analyzed for ER" (Santa Cruz
H-150) or ER! (Millipore C1355) and GFAP (Millipore). Images of cortical
cells were captured with a Nikon TE2000 scanning confocal microscope and
EZ-C1 software. Z stack images were taken with a 1#m step size and
analyzed using ImageJ “measure stack” plugin. For each slide an optimal
threshold was determined to reduce background and maximize signal. Only
cells that co-localized with GFAP and were visible in their entirety through the
stack were analyzed. Signal from each image in the stack was isolated using
the magic wand tool and total integrated density per cell was measured.

Cell culture
Primary glia was cultured from adult female Sprague-Dawley rats ranging in
age from 3-14mo. Rats were sacrificed according to IUCUC protocol and
cortical tissue was dissected and used for primary cell culture. Cortical glia
cells were cultured using sterile technique and standard lab protocol as
44
! !
established by McCarthy and de Vellis (1980). Cells were maintained in
DMEM/F12 media, supplemented with 10% FBS (20%FBS for adults),
100U/ml penicillin, 50U/ml streptomycin, and 2.5mM L-glutamine and grown
for 3-4 weeks confluence in T-75 flasks. Flasks containing confluent cells
were trypsinized and re-plated on 4-well chamber slides (200,000 cells per
well). After 24 hours in secondary culture E18 neurons were plated directly on
the glial monolayer at a 3:1 ratio to approximate the glia to neuron ratio in
cortical tissue. Media was switched to DMEM with 4.5mg/ml glucose, 100U/ml
penicillin, 50U/ml streptomycin neuronal supplement based on Brewer (ref) but
without progesterone added. One hour after plating neurons, un-attached
cells were aspirated and media was refreshed. For non-wounded
experiments, 100pM E2 or vehicle (70% ethanol) was added at this time. After
2 days of growth non-wounded cultures were fixed in 0" methanol and
analyzed by ICC.

Immunocytochemistry and image analysis
Fixed slides were washed in PBS and incubated with two primary antibodies, a
glial marker (GFAP or IBA1) and a neurite marker (MAP5). Glia markers used
were anti-rabbit GFAP (Dako, Carpinteria CA) to stain astrocytes or anti-rabbit
IBA1 (Invitrogen) to stain microglia. To stain neurites, anti-mouse MAP5
(Invitrogen) was used. Slides were then incubated with fluorescent secondary
45
! !
antibodies; Alexa Flour 488 goat anti-mouse and Alexa Flour 594 goat anti-
rabbit.

Neurite outgrowth was measured as the length covered by MAP-5
immunopositive neurites, defined with a modified Sobel edge detection
algorithm (IPLab, Scanalytics, Inc., Fairfax, VA) (see details in Rozovsky et al.
2005). Briefly, a semi-automated program used IPLab imaging software to
define the edge profile of the neurites, exclusive of cell bodies. This filtered
image was further processed (skeletonized) to generate a single pixel line.
From the one pixel width line, the total neurite length was calculated. GFAP
and IBA1 immunoreactivity was measured as area using IPLab imaging
software.

Western blot
Cells were lysed in 10mM Tris, 2% SDS, 10% "-mercaptoethanol, and 0.5 mM
EDTA, followed by boiling for 5 min. To analyze astrocytic ER! and ER",
equal amounts of proteins were electrophoresed on 10% acrylamide gels,
followed by immunoblotting with primary anti- ER! (C1355 Millipore) and anti-
ER" (H-150 Santa Cruz Biotechnology) antibodies then processed with
peroxidase conjugated secondary antibodies and SuperSignal West Pico
Chemiluminescent Substrate (Pierce, Rockford, IL). Integrated density was
46
! !
measured by ImageJ software and ER signals were normalized to GAPDH
signal.

Statistical analysis
Each experiment was repeated 3-5 times. Data were analyzed by using
ANOVA or paired t-test (GraphPad software)

RESULTS
Validation of the mixed glia model for studies of neurotrophic support
Prior studies of aging glia for E2-dependent neurotrophic activity used
enriched astrocytes (Rozovsky et al. 2005). Subsequently, we found that
mixed glia from neonatal rats also supported equivalent E2-induced neurite
outgrowth (Wong et al. 2009). Because both astrocytes and microglia show
activation during aging (Introduction), it was of interest to examine the mixed
glial model across the lifespan. We therefore compared mixed glia from young
adult males (3 mo) and old males (24 mo). Old mixed glia supported 40% less
basal neurite outgrowth than young mixed glia (Fig 3.1C) E2 induced a 50%
increase in neurite outgrowth in young mixed glia E18 co-cultures (Fig. 3.C). In
contrast, mixed glia from old males entirely lacked E2-induced neurite
outgrowth, confirming prior findings with enriched astrocytes (Rozovsky et al.
2005). Also confirming prior studies, GFAP was found to be elevated in old
mixed glia co-cultures (45%) and levels in young mixed glia co-cultures were
47
! !
decreased by E2 treatment (35%), while old mixed glia showed no E2-
response (Fig 3.1A). IBA1 levels were analyzed to examine any microglia
effect. Old mixed glia had 30% more expression IBA1 compared to young
mixed glia, while both showed an attenuation of IBA1 expression with E2
treatment (Fig 3.1B). An age increase in IBA1 expression was also found by
Xu et al. (2008). The mixed glial model was used for further studies of
neurotrophic support because it minimizes the manipulation by shaking to
obtain monotypic astrocytes.

Fig 3.1. Adult male mixed glia support of neurite outgrowth, GFAP and IBA1
A. 35% less basal support of neurite outgrowth by old (24mo) glia than young (2mo),
40% increase in MAP5 immunopositive area with E2 treatment in young (3mo) but not
old (24mo) glia. B. 45% more basal GFAP expression in old glia (24mo) than young
(3mo), 35% decrease in GFAP immunopositive area with E2 treatment in young (3mo)
but not old (24mo) glia. C. 30% increase in IBA1 in old (24mo) glia than young (3mo).
Both ages show attenuation by E2. Data (mean+SEM) expressed as a percent of
normal cycling; * p< 0.05, ** p<.001, *** p<0.0001. "
!
MAP5 Expression (ICC)
Young (3mo)
Young (3mo) + E2
Old (24mo)
Old (24mo) + E2
0
50
100
150
200
*
* *
%Young Control
GFAP Expression (ICC)
Young (3mo)
Young (3mo) + E2
Old (24mo)
Old (24mo) + E2
0
50
100
150
200
*
*** ***
% young control
IBA1 Expression (ICC)
Young (3mo)
Young (3mo) + E2
Old (24mo)
Old (24mo) + E2
0
50
100
150 ***
***
IBA1 % young control
A B C
48
! !

E2-mediated increase in neurite outgrowth and decrease in GFAP
dependent on glial stage of reproductive senescence

Population cycling status
The cycling status of female rats aged 5mo (young) and 10mo
(perimenopausal) was determined by vaginal cytology during 29 days of
consecutive observation, and defined
three groups (Fig. 3.2). 4-6mo
group were all normal cyclers. As
expected, only 24% of the 9-10mo
group had regular cycles; most had
irregular cycles (63%) with a minority
in constant estrus (14%). A second
group of slightly older rats (13mo)
had no regular cyclers (45%
irregular, 55% constant estrus).

Neurite Outgrowth
Mixed glial cultures from these
groups were evaluated for
neurotrophic support with E18
cortical neurons, as above. Basal neurite outgrowth in the absence of E2 did
Percent of Population per
Stage of Reproductive Senescence
4-6 mo Normal Cycling
9-10 mo Normal Cycling
4-6 mo Irregular Cycling
9-10 mo Irregular Cycling
4-6 mo Constant Estrus
9-10 mo Constant Estrus
0
25
50
75
100
125
150
%of population
Fig 3.2. Percent of population per stage
of female reproductive senescence
The cycling status of female rats was
determined during 29 days of consecutive
observation. 4-6mo group were all normal
cyclers. As expected, only 24% (9-10mo)
had regular cycles; most had irregular
cycles (63%) and few constant estrus
(14%). A second group of slightly older
rats (13mo) had no regular cyclers (45%
irregular, 55% constant estrus).
!
49
! !
showed a modest age effect, with 50% more basal neurite outgrowth in glia
from 5mo regularly cycling rats, than from 13-14mo irregular cycling and
constant estrus animals (Fig 3.3D). Moreover, only the 5mo normal cycling
group had E2-induced neurite outgrowth. A second group of slightly younger
perimenopausal rats (10mo) further resolved effects of age and cycling status.
The normal cyclers (10mo) had E2-induced neurite outgrowth with the same
effect size (50%) as in 5mo regular cyclers, which was absent in irregularly
cycling and constant estrus rats of the same age (10mo) (Fig 3.5C).

Neurite Outgrowth (MAP5 ICC)
Normal Cycling 5mo
Normal Cycling 5mo + E2
Irregular Cycling 13mo
Irregular Cycling 13mo +E2
Constant Estrus 13mo
Constant Estrus 13mo +E2
0
50
100
150
200
***
*** ***
% Normal Cycling control
GFAP (ICC)
Normal Cycling 5mo
Normal Cycling 5mo + E2
Irregular Cycling 13mo
Irregular Cycling 13mo +E2
Constant Estrus 13mo
Constant Estrus 13mo +E2
0
50
100
150
200
**
*
% Normal Cycling control
IBA1 (ICC)
Normal Cycling 5mo
Normal Cycling 5mo + E2
Irregular Cycling 13mo
Irregular Cycling 13mo +E2
Constant Estrus 13mo
Constant Estrus 13mo +E2
0
50
100
150
%Normal Cycling Control
A
B C
Fig 3.3 Effect of stage of female reproductive senescence of glia on neurite
outgrowth and GFAP expression in 5-13mo rats
A. 50% decrease in GFAP immunopositive area with E2 treatment in normal cycling,
but not irregular cycling or constant estrus glia. Old constant estrus animals showed
50% more GFAP immunoreactivity. GFAP immunoreactivity was measured as area.
B. No change in IBA1 expression. IBA1 immunoreactivity was measured as area. C.
50% increase in MAP5 immunopositive area with E2 treatment in normal cycling, but
not irregular cycling or constant estrus glia. 50% less basal neurite outgrowth in
irregular cycling and constant estrus animals vs. normal cycling. Neurite outgrowth
was measured as the area covered by MAP-5 immunopositive neurites; Data
(mean+SEM) expressed as a percent of normal cycling; * p< 0.05, ** p<.001, ***
p<0.0001."
50
! !
GFAP analysis
GFAP did not differ with E18 neurons grown on glia from age-matched normal
cycling, irregular cycling and constant estrus animals (Fig 3.5A). However,
response to E2 did differ significantly between groups. Only normal cyclers
show a decrease (25%) in GFAP in response to E2, while glia from irregular
cycling and constant estrus animals show no E2 mediated decrease in GFAP
expression. The direction of the E2 response is consistent with previous
findings in the lab. The E2-mediated decrease in GFAP expression is
consistent with our previous findings in both neonates and young adults
(Stone et al, 1998, Rozovsky et al. 2002). Co-cultures from glia of 4-5mo
normal cycling animals also show an E2-mediated decrease (50%) in GFAP
expression (Fig 3.4A). These cultures also show less basal GFAP expression
than glia from 13-14mo old constant estrus animals. The E2-mediated
decrease in GFAP expression is consistent with our previous findings
described above. GFAP expression of glia from 13mo old irregular cycling and
constant estrus animals did not respond to E2. Basal GFAP expression from
glia from irregular cycling animals showed no significant difference from either
normal cycling control or constant estrus groups.

IBA1 analysis
This study differed from our previous studies by the use of mixed glia cultures
containing astrocytes and microglia rather than an enriched astrocyte
51
! !
population. To investigate microglial changes, ICC was performed using and
antibody for IBA1 a microglia cell marker. There was no significant difference
between groups from both age-matched and non-age-matched groups.
Although irregular cycling animals in the age-matched experiment did show a
trend for increased IBA1 expression, there was no difference seen as a result
of E2 treatment in all groups (Fig 3.4B and Fig 3.5B).
Neurite Outgrowth (MAP5 ICC)
Normal Cycling 9-10mo
Normal Cycling 9-10mo + E2
Irregular Cycling 9-10mo
Irregular Cycling 9-10mo+ E2
Constant Estrus 9-10mo
Constant Estrus 9-10mo + E2
0
50
100
150
200
**
% Normal Cycling control
GFAP (ICC)
Normal Cycling 9-10mo
Normal Cycling 9-10mo + E2
Irregular Cycling 9-10mo
Irregular Cycling 9-10mo+ E2
Constant Estrus 9-10mo
Constant Estrus 9-10mo + E2
0
50
100
150
*
%Normal Cycling Control
IBA1 (ICC)
Normal Cycling 9-10mo
Normal Cycling 9-10mo + E2
Irregular Cycling 9-10mo
Irregular Cycling 9-10mo+ E2
Constant Estrus 9-10mo
Constant Estrus 9-10mo + E2
0
50
100
150
%Normal Cycling Control
A B
C

Fig 3.4 Effect of stage of female reproductive senescence of glia on neurite
outgrowth and GFAP expression in age-matched 9-10mo rats
A. 25% decrease in GFAP immunopositive area with E2 treatment in normal cycling,
but not irregular cycling or constant estrus glia. GFAP immunoreactivity was measured
as area. B. No change in IBA1 expression. IBA1 immunoreactivity was measured as
area. C. 50% increase in MAP5 immunopositive area with E2 treatment in normal
cycling, but not irregular cycling or constant estrus glia. Neurite outgrowth was
measured as the area covered by MAP-5 immunopositive neurites. Data (mean+SEM)
expressed as a percent of normal cycling; * p< 0.05, ** p<.001, *** p<0.0001."
52
! !
Expression of estrogen receptors varies with stage of reproductive
senescence

Expression of Estrogen Receptors in Primary Gila
Because of age increases in the ratio of estrogen receptors ER!:ER" in male
rats was a determinant of E2-induced neurite outgrowth, we also characterize
ER!:ER" in mixed glia from perimenopausal rats (Fig. 3.6). ER! was higher in
constant estrus-derived glia than both the normal cyclers (non-age-matched)
and irregular cyclers. ER" did not differ between groups. Thus, the increase of
ER!/" ratio in constant estrus glia compared to the normal cyclers is driven by
ER! elevations.
ER protein levels in
cultured female rat mixed glia
(5mo)
!
NC ER
(13mo)
!
IC ER
(13mo)
!
CE ER
(5mo)
"
NC ER
(13mo)
"
IC ER
(13mo)
"
CE ER
(5mo)
"
/
!
NC ER
(13mo)
"
/
!
IC ER
(13mo)
"
/
!
CE ER
0.0
0.5
1.0
1.5
2.0
2.5
* *
Normalized
protein Expression
B A
Fig 3.5. ER levels in cultured glia: increase of ER! and ER!/" ratio with
stage of reproductive senescence
A. Immunoblot showing the expected size products for ER! and ERß.
B. ER Protein (western blot) show 2-fold increase in ER! and ER!/" ratio with
progressive stage of reproductive senescence (5mo NC vs 13mo CE); data
(mean+SEM); *, P< 0.05.”
53
! !
In-vivo analysis of astrocytic ER! and ER" in 5-16mo female rats
Astrocytic levels of ERs were
assayed by immune-
histochemistry in young normal
cycling (5mo), irregular cycling
(15-16mo), and constant
estrus (15-16mo) animals. Fig
3.7 shows co-localization of
ERs with GFAP positive
astrocytes in the cortex. ER!
immunostaining intensity per
cell increased in irregular
cycling and constant estrus animals vs. normal cycling animals (Fig 3.8A).
ER" decreases in irregular cycling and constant estrus animals vs. normal
cycling animals (Fig 3.8C), which again increased the ER!/" ratio (Fig 3.8E).

ER! and ER" in 9-10mo female rats
The other hemisphere from glial cultures was assayed by
immunohistochemistry to determine immunoreactive ER! and ER" per cortical
astrocyte. ER! immunostaining intensity per cell increased in irregular cycling
and constant estrus animals vs. normal cycling animals (Fig 3.9A). ER"
Fig 3.6 Confocal images of Co-localization
of ERs in cortical astrocytes in 9mo female
rat brain section
A. Co-localization of GFAP (Millipore) and
ERa (c1355) in cortical astrocyte. B. Co-
localization of GFAP (Millipore) and ERb (H-
150) in cortical astrocytes.
54
! !
ER! protein (IHC) per astrocyte
in female rat cortex
Normal Cycling (5mo)
Irregular Cycling (15-16mo)
Constant Estrus (15-16mo)
0
100000
200000
300000
400000
** **
IntDens Per cell
Frequency Distribution of ER! in
Cortical Astrocytes
0.0 500000.0 1000000.0 1500000.0
0
50
100
Normal Cycling (5mo)
Irregular Cycling (15-16mo)
Constant Estrus (15-16mo)
IntDensity
% total cells
ER" protein (IHC) per astrocyte
in female rat cortex
Normal Cycling (5mo)
Irregular Cycling (15-16mo)
Constant Estrus (15-16mo)
0
200000
400000
600000
*** ***
IntDens Per cell
Frequency Distribution of ER" in
Cortical Astrocytes
0.0 500000.0 1000000.0 1500000.0
0
50
100
Normal Cycling (5mo)
Irregular Cycling (15-16mo)
Constant Estrus (15-16mo)
IntDensity
% total cells
A
B
C
D
ER!/" ratio in female rat cortex
Normal Cycling (5mo)
Irregular Cycling (15-16mo)
Constant Estrus (15-16mo)
0.0
0.5
1.0
1.5
** **
ER
!
/
"
ratio
E

Fig 3.7. Expression of ERs in cortex and cultured cortical glia of normal cycling,
irregular cycling and constant estrus female rats 5-16mo
A&B. ER! expression and distribution showing increased ERa with stage of RS C&D.
ERb expression and distribution showing decreased ERb with stage of reproductive
senescence. E. Shows increase in ER!/" ratio with stage of RS Data (mean+SEM); **,
p<0.01, ***, p< 0.001.“
55
! !
decreases in constant estrus animals vs. normal cycling animals (Fig 3.9C),
which again increased the ER!/" ratio (Fig 3.9E).

Analysis of the frequency distribution of receptors shows an increase in the
percentage of astrocytes with high expression levels of ER! and a decrease in
the percentage of astrocytes with low expression levels in irregular cycling and
constant estrus animals compared to normal cycling animals (Fig 3.9B).
Frequency distribution of ER" shows an increase in the frequency of
astrocytes with low expression levels and a decrease in the percentage of
astrocytes with high expression levels in constant estrus animals compared to
irregular cycling and normal cycling animals (Fig 3.9D).

DISCUSSION
We show that in an adult glia/E18 neuron co-culture system, cortical mixed
glia derived from young (5mo) female normal cycling rats exhibit E2-mediated
neurite outgrowth, whereas glia from older (13mo) irregular cycling or constant
estrus female rats do not. To analyze the effect of cycling status separate from
chronological age we used 9-10mo female rats at varying stage of
reproductive senescence. In-vitro co-culture experiments using glia from these
animals showed that only glia from normal cycling animals supported E2-
mediated neurite outgrowth, while glia from irregular cycling and constant
estrus animals did not, indicating that E2-mediated neurite outgrowth is
56
! !
ER! (IHC) per astrocyte in female rat cortex
Normal Cycling 9-10mo
Irregular Cycling 9-10mo
Constant Estrus 9-10mo
0
50000
100000
150000
200000
*
**
total IntDens per cell
Frequency Distribution of ER! in
Cortical Astrocytes
0.0 200000.0 400000.0 600000.0 800000.0
0
50
100
Normal Cycling 9-10mo
Irregular Cycling 9-10mo
Constant Estrus 9-10mo
(IntDens)
% total cells
ER" (IHC) per astrocyte in female rat cortex
Normal Cycling 9mo
Irregular Cycling 9mo
Constant Estrus 9mo
0
50000
100000
150000
200000
***
Total IntDen per cell
Frequency Distribution of ER" in
Cortical Astrocytes
0.0 200000.0 400000.0 600000.0 800000.0
0
50
100
Normal Cycling 9-10mo
Irregular Cycling 9-10mo
Constant Estrus 9-10mo
(IntDens)
% total cells
ER!/" ratio in female rat cortex
Normal Cycling 9mo
Irregular Cycling 9mo
Constant Estrus 9mo
0.0
0.5
1.0
1.5
2.0
2.5 *
ER
!
/
"
expression ratio
Cortical astrocyte volume
Normal Cycling 9-10mo
Irregular Cycling 9-10mo
Constant Estrus 9-10mo
0
50
100
150
%Young
A B
C D
E F

Fig 3.8 Expression of ERs in cortex and cultured cortical glia of normal
cycling, irregular cycling and constant estrus female rats 9-10mo
A&B. ER! expression and distribution in age-matched brains showing increased
ER! in both irregular cycling and constant estrus animals. C&D. ER" expression
and distribution in age-matched brains showing decreased ER" (40%) only in
constant estrus animals. E. ER!/" ratio is increased 2-fold with stage RS. F. GFAP
volume shows slight (14%) but non-significant increase; data (mean+SEM); *,
p<0.05, **, p<0.01, ***, p< 0.001. "
57
! !
dependent on ovarian cycling status. Analysis of estrogen receptors in vitro
showed that there was a two-fold increase in ER" in the older constant estrus
group vs. the young (5mo) with a similar change in the ER"/! ratio. These
results are similar to findings from aging male rats discussed in chapter 2.
The increase in ER" and the ER"/! ratio with progressive stage of
reproductive senescence was also observed in vivo. This is similar to what
was shown in chapter 2 in aging male rats, although the increase shown here
was dependent on stage of reproductive senescence. These findings indicate
that changes in glial ERs may alter response to estrogen in the brain, which
has implications in hormone replacement therapy and estrogen replacement
therapy.

Hormone therapy may reduce the risk of dementia when administered at a
younger age (48yo) rather than an older age (76yo) (Whitmer et al. 2011),
although no clear link between estrogen replacements and deficits and
cognitive changes have been established (Henderson and Popat 2011,
Mitchell and Woods 2011). However, there is evidence that oral estrogens
administered to older post-menopausal women may increase inflammation as
measured by elevations in C-reactive protein (CRP), and as a consequence,
increase risk of heart disease, stroke, and other vascular problems (Cushman
et al. 1999, Walsh et al. 2000) (reviewed by Davison and Davis 2003). It
58
! !
remains unclear if the observed elevation in CRP and vascular disease
extends to vascular dementia such as Alzheimer’s disease. And while these
studies did not show a clear link to cognition elevated CRP, IL6 and other
inflammatory marker levels are associated with cognitive deficits and an
increased risk in developing dementia (Schmidt et al. 2002, Weaver et al.
2002, Yaffe et al. 2003). To complicate the issue, other findings indicate that
other forms of estrogen replacement therapy, such as transdermal
administration of estrogens, show no change in the same markers found to be
elevated with oral estrogen treatment (Vehkavaara et al. 2000, Decensi et al.
2002), and other studies even show anti-inflammatory effects (Sattar et al.
1999, Saucedo et al. 2002).

One explanation for the seemingly contradictory nature of the data from HRT
and ERT trials is the timing of gonadal hormone administration. ERT is
commonly used to treat early symptoms of menopause in the perimenopausal
stage. ERT with healthy women in perimenopausal stages have shown
positive effects, whereas in the same study, ERT administered to older
postmenopausal women had adverse effects (Yaffe et al. 1998). The
Women’s Health Initiative Memory Study (WHIMS) concluded that HRT and
ERT administered to an older cohort of women increased cognitive impairment
(Espeland et al. 2004, Shumaker et al. 2004). The study by Shumaker et al.
(2004) showed that estrogen treatment alone showed no cognitive benefits
59
! !
and cohorts with estrogen in combination with progesterone (similar to HRT)
had elevated inflammatory markers and risk of dementia. An important note is
that the cohort of women in the Shumaker et al. study were all post-
menopausal aged 65-79 with at least 10 years of low estrogen, which
suggests that changes that occur during menopause affect estrogen activity in
the brain. And that a longer time spent post-menopause may influence the
lack of E2-mediated cognitive benefits. This indicates that ovarian cycling
status may be a contributing factor in E2-mediated cognitive benefits. Our
studies using rat models show a similar lack of response to estrogen with older
animals, Moreover, our studies suggest that ovarian cycling status rather than
chronological age is the determining factor in glial support of E2-mediated
neuronal effects, with no E2 response in later stages of reproductive
senescence. Our in-vitro data also implicate changes in glial estrogen
receptors during declining ovarian activity with age as a possible mechanism
for the loss of E2 response.

From the studies summarized in chapter two of this dissertation we conclude
that there is an age-related increase in the ER"/! ratio in male rats. It is
unclear as to the transition period of this age change in males, but the studies
explored in chapter three seem to indicate that for female rats it is during the
progression of reproductive senescence. The data presented shows that there
is an increase in astrocytic ER" both in vivo and in vitro in normal cycling
60
! !
(5mo) animals vs. irregular cycling and constant estrus (13-16mo) animals. In
an age-matched group (9-10mo), a similar change in ER! was found although
the irregular cycling group showed less of an increase in ER!. In all constant
estrus groups a significant increase in the astrocytic ER"/! ratio occur both in
vivo and in vitro. In contrast, only the older (15-16mo) irregular cycling group
shows a significant increase in the ER"/! ratio. This indicates that astrocytic
changes in ERs occur progressively during reproductive senescence. These
changes in astrocytic estrogen receptors are concomitant with decrease
support of E2-mediated outgrowth in vitro in our hetero-glia E18 neuron co-
culture system.

Similar results were described by Lewis et al. (2008) who showed that
astrocytes from acyclic rats supported less outgrowth and differentiation by
neural progenitor cells. The documented in-vivo changes in estrogen
receptors in female rats during transition to acyclic stages of reproductive
senescence occur in concert with learning deficits in irregular cycling and
constant estrus rats documented by Paris et al. (2011). This data along with
data collected from HRT and ERT clinical trials, discussed earlier, raise an
argument that the timing of estrogen treatment may affect the estrogen-
mediated effects on cognition and inflammation in part due to changing
expression of astrocytic estrogen receptors. A genetic study in humans by
Yaffe et al. (2009) found SNPs in ER! and ER" correlated with cognitive
61
! !
impairment in both older men and women, further implicating the role of
estrogen receptors in cognitive impairment. These changes in astrocytic
estrogen receptors may represent an altered-E2-responsive phenotype of
astrocytes appear as a consequence of changing levels of circulating ovarian
hormones with implications of an increased inflammatory load.

62
! !
CHAPTER FOUR: SUMMARY AND DISCUSSION

Age-related changes in E2-mediated activities and estrogen receptors
The data presented in chapter two indicates that there is an age-related
increase in ER" and the ER"/! ratio both in vivo and in vitro in adult male rats.
These changes occur in concert in vitro with decreased support of basal and
E2 mediated neurite outgrowth, elevated GFAP levels and changes in laminin
secretion (Chapter 2, Rozovsky et al. 2002, 2005). In vivo there is a similar
increase in ER" and the ER"/! ratio which is concomitant with an increase in
astrocytic volume. Increases in GFAP content and astrocyte volume occur with
age concurrently with cognitive declines (Nichols et al. 1993), with astrocytic
volume changes potentially altering neuron/astrocyte contact and downstream
neuronal function and synaptic plasticity (Finch 2003).

Reproductive senescence related changes in E2- mediated activities and
estrogen receptors

As presented in chapter 3, there is an increase in ER" and the ER"/! ratio
both in vivo and in vitro with progressive stage of female reproductive
senescence which is separate from age-related changes shown in chapter 2.
Similar to the age-effect on estrogen receptors in male rats, the stage of
reproductive senescence related changes in estrogen receptors also occur in
concert with decreased E2-mediated neurite outgrowth and increased GFAP
63
! !
in vitro. In-vivo irregular cycling and constant estrus rats show an increase in
ER" and the ER"/! ratio, these changes occur in concert with the observed
cognitive declines of irregular cycling and constant estrus rats compared to
age-matched normal cycling rats (Paris et al. 2011). Stage of reproductive
senescence also predicted cognitive decline in female rhesus monkeys
(Roberts et al. 1997).

Astrocytes, inflammation, and estrogen receptors
Reactive astrocytes have been shown to have elevated estrogen receptors
(García-Ovejero et al. 2002, Tokuhara et al. 2005), and astrocytic ER" has
been shown to be upregulated in neurodegenerative disease such as
Alzheimer’s disease (Ishunina et al. 2007) and models of neurodegeneration
such as kanaic acid (Tokuhara et al. 2005). A study by Heron et al. 2009
found that increased ER! mRNA in reactive astrocytes correlated to severity
of HIV induced dementia. This provides evidence for increased astrocytic ER!
in a dementia with a proposed to be driven in part by glial activation, especially
microglial infection by HIV due to its expression of CD4 (Dick et al. 1997, Gray
et al. 2001). While reactive astrocytes and gliosis increase during normal
aging and are associated with a pro-inflammatory environment and
neurodegeneration, their appearance is part of a response to limit tissue
damage and maintain the blood-brain barrier. Estrogen, as discussed
throughout this dissertation, can have anti-inflammatory and neurotrophic
64
! !
effects, and reactive astrocytes have increased aromatase expression in vivo
and in vitro (Garcia-Segura et al. 1999, Azcotia et al. 2003, Lepore et al.
2011), and cultured astrocytes have also been shown to synthesize estrogen
de novo (Hu et al. 2007).

The synthesis of estrogen by reactive astrocytes may contribute to their role in
response to brain injury. However, the data presented in this dissertation
indicates that response to estrogen changes with age (chapter 2) and ovarian
cycling decline (chapter 3) with some evidence that estrogen can be pro-
inflammatory in chronic estrogen models or in acyclic stages of reproductive
senescence (Bake and Sohrabji 2004, Johnson et al. 2004, Lewis et al. 2008).
Therefore, aging astrocytes with altered ER expression may not respond to
the estrogen synthesized by reactive astrocytes with downstream anti-
inflammatory effects. Astrocytes with increased ER" and ER"/! ratio as a
result of aging (chapter two) or stage of reproductive senescence (chapter 3)
do not respond to estrogen, showing no neurotrophic effects with estrogen
treatment in vitro. These changes may be occurring due to an increasing
inflammatory load which then leads to altered glial reactivity to both steroid
hormones and brain injury.

The increase in ER" as a consequence of aging and reproductive senescence
may also be contributing to the pro-inflammatory environment through
65
! !
oxidative stress. Interestingly ER" has been found to be associated with
protein complexes involved in DNA repair (Perillo et al. 2008,) and oxidative
stress response (Rao et al. 2008, 2009) (reviewed by Schultz-Norton et al.
2011). Findings by Mobley and Brueggemeier (2004) have shown that
ER! positive MCF-7 cells, when treated with E2, show decreased peroxide
metabolism and increased peroxide-induced DNA damage with E2 treatment,
while the ER! negative MDA-MB-231 cell did not show these E2 effects. This
indicates an ER! regulated pathway of oxidative stress. One of the most
intriguing studies on ER" activity and oxidative stress comes from Perillo et al.
(2008), who provide evidence that ER" transcription actually involves
oxidative stress-mediated DNA transcription. They found that hydrogen
peroxide, formed as a by-product of histone demethylation, modified
surrounding DNA through oxidative damage to recruit base-excision repair
enzymes to repair 8-oxoguanine sites which resulted in chromatin and DNA
conformational changes necessary for ER" mediated transcription. This
indicates that ER" mediated transcription in certain cases is associated with
oxidative DNA damage. This may contribute to increasing oxidative stress
especially in astrocytes that exhibit increasing levels of ER" with age and
ovarian cycling decline, although it is unclear if transcription mechanisms
involving oxidative DNA damage are involved for all genes that utilize ER"
mediated transcription. ER! has been shown to be a negative regulator of
66
! !
ER" transcription (Hall and McDonnell 1999, Pettersson et al. 2000, Gougelet
et al. 2007), and some of the anti-inflammatory effects attributed to
ER! (Edvardsson et al. 2011, Saijo et al. 2011) may be partially due to its role
in regulating ER" transcription and thereby limiting downstream oxidative
stress and 8-oxoguanine formation.

Rozovsky et al. 2005 show that astrocytes from old (24mo) rats do not show
E2-mediated neurite outgrowth in ‘wounding-in-a-dish’ in-vitro cultures in
contrast to cultures using young (3mo) or neonatal (3day) astrocytes. This
indicates that astrocytes and mixed glia do not support basal E2-mediated
neurotrophic effects and that this loss of response to estrogen extends to
reactive glia activated by a scratch wound. The data documented in this
dissertation has shown the astrocytic increase in ER" and the ER"/! ratio as
a common aspect of both normal aging in males and progressive stage of
reproductive senescence. Another common aspect shared between normal
aging and progressive stage of reproductive senescence is increased blood-
brain barrier permeability which may make the brain more sensitive to
systemic inflammation.

Blood-brain barrier, aging, and reproductive senescence
Aging is associated with increased inflammatory cytokines and oxidative
67
! !
stress, both of which increase blood-brain barrier dysfunction (Banks et al.
1995, Greenwood 1991). Overall, there is an age-related increase in blood-
brain barrier permeability that is worsened with vascular dementia in humans
(Farral and Wardlaw 2009, Popescu et al. 2009). An age increase in blood-
brain barrier permeability was also found in rodents (Saija et al. 1990) and was
correlated with and age-related deficits in LTP (Blau et al. 2011). Secreted
astrocytic factors have been implicated in regulation of the blood-brain barrier
such as FGF-2 and VEGF (Proia et al. 2008), and both factors also implicated
in gliosis in addition to their role in blood-brain barrier regulation (Krum and
Khaibullina 2003). FGF-2 has also been shown to be a positive regulator of
GFAP (Reuss et al. 2003), which has an inverse correlation to neurite
outgrowth in vitro (Rozovsky et al. 2005). While there is no clear direct
evidence for astrocytic regulation of the blood-brain barrier, astrocyte secreted
factors do influence blood-brain barrier permeability (Proia et al. 2008), and as
the blood-brain barrier becomes more permeable with age, the brain then
becomes more susceptible to systemic inflammation.

Stage of reproductive senescence has also been shown to alter blood-brain
barrier permeability, with reproductive senescent rats showing greater blood-
brain barrier permeability than young normal cycling animals (Bake and
Sohrabji 2004). Moreover, this study showed that estrogen treatment showed
decreased permeability of the blood-brain barrier in young normal cycling rats
68
! !
while in older acyclic rats there was an increase in blood-brain barrier
permeability. These findings indicate another phenotype of altered response
to estrogen with cessation of ovarian cycling found in concert with decreased
support of neural stem-cell differentiation and outgrowth by acyclic astrocytes
(Lewis et al. 2008), and decreased E2-mediated neurotrophic support by
primary glia from irregular cycling and constant estrus rats (chapter three).
These studies have shown direct evidence that blood-brain barrier
permeability increases during reproductive senescence and the blood-brain
barrier responds bi-directionally to E2 as a function of ovarian cycling; acyclic
rats show increased blood-brain barrier permeability with E2 treatment while
younger normal cycling rats show decreased permeability with E2 treatment.

Another component in the role of astrocytes in blood-brain barrier dysfunction
and inflammation is accumulation of iron in astrocytes, which has a role in
oxidative stress (Schipper et al. 1998, Dringen et al. 2007). Iron is a necessary
molecule for many biological processes, and its passage into the brain is
regulated by the blood-brain barrier (Rouault and Cooperman 2006). Excess
iron may promote oxidative stress due to the role of ferrous (Fe2+) and ferric
iron (Fe3+) and free radical production in the classic Fenton reaction:
Fe2+ + H2O2 ----> Fe3+ + .OH + OH-
Fe3+ + H2O2 ----> Fe2+ + .OOH + H+

69
! !
Also, as discussed above, there is more peroxide production as a direct result
of ER! transcription due to its use in modifying DNA structures to enable
recruitment of transcription machinery. This raises the possibility that
increased ER! and subsequent increased hydrogen peroxide production due
to ER! transcription may increase oxidative stress through reaction with
accumulated iron stores. In addition there is also an observed age-increase in
iron accumulation in microglia and astrocytes of the cortex and hippocampus
(Connor et al. 1990, Zecca et al. 2004). Astrocytic iron accumulation and an
increase in astrocytic ER! may be contributing to the overall oxidative load in
the aging brain.

CONCLUSIONS
The picture of astrocytic contributions to changing response to estrogen and
neurotophic support that is emerging involves interactions between various
mechanisms intertwined in normal aging and ovarian cycling decline. These
changes involves astrocytic changes including increase in ER" and the
ER"/! ratio, iron accumulation, increased hydrogen peroxide production,
increased GFAP, and glial reactivity, which contribute to and occur in concert
with increased blood-brain barrier permeability, which contributes to increased
brain inflammation, which can lead to further glial activation and disruption of
the blood-brain barrier. Multifaceted and interwoven downward spirals are a
common theme in aging and neurodegenerative degenerative disease.
70
! !
Estrogen loses efficacy in providing neuro-protection as a function of age as
well as reproductive senescence. A hallmark feature of aging and cessation of
ovarian cycling is an increase in astrocytic ER" and the ER"/! ratio. The loss
of neuro-protection with age and cessation of ovarian cycling can therefore be
partially attributed to changes in astrocytic estrogen receptors. Astrocytic
estrogen receptors are a potential target for therapeutic interventions in
restoring positive neurotrophic activities of estrogen that is lost with age and
slow the downward spiral brought on by aging and ovarian cycling decline.

71
! !
BIBLIOGRAPHY

Anderson CP, Rozovsky I, Stone DJ, Song Y, Lopez LM, Finch CE (Aging and
increased hypothalamic glial fibrillary acid protein (GFAP) mRNA in
F344 female rats. Dissociation of GFAP inducibility from the luteinizing
hormone surge. Neuroendocrinology 76:121-130.2002).

Azcoitia I, Santos-Galindo M, Arevalo MA, Garcia-Segura LM (Role of
astroglia in the neuroplastic and neuroprotective actions of estradiol.
Eur J Neurosci 32:1995-2002.2010).

Azcoitia I, Sierra A, Garcia-Segura LM (Localization of estrogen receptor beta-
immunoreactivity in astrocytes of the adult rat brain. Glia 26:260-
267.1999).

Azcoitia I, Sierra A, Veiga S, Garcia-Segura LM (Aromatase expression by
reactive astroglia is neuroprotective. Ann N Y Acad Sci 1007:298-
305.2003).

Bake S, Sohrabji F (17beta-estradiol differentially regulates blood-brain barrier
permeability in young and aging female rats. Endocrinology 145:5471-
5475.2004).

Banks WA, Kastin AJ, Broadwell RD (Passage of cytokines across the blood-
brain barrier. Neuroimmunomodulation 2:241-248.1995).
Baracskay KL, Duchala CS, Miller RH, Macklin WB, Trapp BD
(Oligodendrogenesis is differentially regulated in gray and white matter
of jimpy mice. J Neurosci Res 70:645-654.2002).

Baracskay KL, Kidd GJ, Miller RH, Trapp BD (NG2-positive cells generate
A2B5-positive oligodendrocyte precursor cells. Glia 55:1001-
1010.2007).

Bechmann I, Goldmann J, Kovac AD, Kwidzinski E, Simburger E, Naftolin F,
Dirnagl U, Nitsch R, Priller J (Circulating monocytic cells infiltrate layers
of anterograde axonal degeneration where they transform into
microglia. FASEB J 19:647-649.2005).

Bechmann I, Nitsch R (Astrocytes and microglial cells incorporate
degenerating fibers following entorhinal lesion: a light, confocal, and
electron microscopical study using a phagocytosis-dependent labeling
technique. Glia 20:145-154.1997).

72
! !
Blau CW, Cowley TR, O'Sullivan J, Grehan B, Browne TC, Kelly L, Birch A,
Murphy N, Kelly AM, Kerskens CM, Lynch MA (The age-related deficit
in LTP is associated with changes in perfusion and blood-brain barrier
permeability. Neurobiol Aging.2011).

Bruce-Keller AJ, Keeling JL, Keller JN, Huang FF, Camondola S, Mattson MP
(Antiinflammatory effects of estrogen on microglial activation.
Endocrinology 141:3646-3656.2000).

Burger HG, Hale GE, Dennerstein L, Robertson DM (Cycle and hormone
changes during perimenopause: the key role of ovarian function.
Menopause 15:603-612.2008).

Butler L, Santoro N (The reproductive endocrinology of the menopausal
transition. Steroids 76:627-635.2011).

Cambiasso MJ, Colombo JA, Carrer HF (Differential effect of oestradiol and
astroglia-conditioned media on the growth of hypothalamic neurons
from male and female rat brains. Eur J Neurosci 12:2291-2298.2000).

Carrer HF, Cambiasso MJ, Gorosito S (Effects of estrogen on neuronal growth
and differentiation. J Steroid Biochem Mol Biol 93:319-323.2005).

Choi JM, Romeo RD, Brake WG, Bethea CL, Rosenwaks Z, McEwen BS
(Estradiol increases pre- and post-synaptic proteins in the CA1 region
of the hippocampus in female rhesus macaques (Macaca mulatta).
Endocrinology 144:4734-4738.2003).

Conde JR, Streit WJ (Microglia in the aging brain. J Neuropathol Exp Neurol
65:199-203.2006).

Connor JR, Menzies SL, St Martin SM, Mufson EJ (Cellular distribution of
transferrin, ferritin, and iron in normal and aged human brains. J
Neurosci Res 27:595-611.1990).

Costa S, Planchenault T, Charriere-Bertrand C, Mouchel Y, Fages C, Juliano
S, Lefrancois T, Barlovatz-Meimon G, Tardy M (Astroglial permissivity
for neuritic outgrowth in neuron-astrocyte cocultures depends on
regulation of laminin bioavailability. Glia 37:105-113.2002).

73
! !
Cushman M, Legault C, Barrett-Connor E, Stefanick ML, Kessler C, Judd HL,
Sakkinen PA, Tracy RP (Effect of postmenopausal hormones on
inflammation-sensitive proteins: the Postmenopausal
Estrogen/Progestin Interventions (PEPI) Study. Circulation 100:717-
722.1999).

Cutler SM, Pettus EH, Hoffman SW, Stein DG (Tapered progesterone
withdrawal enhances behavioral and molecular recovery after traumatic
brain injury. Exp Neurol 195:423-429.2005).

Davison S, Davis SR (New markers for cardiovascular disease risk in women:
impact of endogenous estrogen status and exogenous postmenopausal
hormone therapy. J Clin Endocrinol Metab 88:2470-2478.2003).

Decensi A, Omodei U, Robertson C, Bonanni B, Guerrieri-Gonzaga A,
Ramazzotto F, Johansson H, Mora S, Sandri MT, Cazzaniga M,

Franchi M, Pecorelli S (Effect of transdermal estradiol and oral conjugated
estrogen on C-reactive protein in retinoid-placebo trial in healthy
women. Circulation 106:1224-1228.2002).

Dick AD, Pell M, Brew BJ, Foulcher E, Sedgwick JD (Direct ex vivo flow
cytometric analysis of human microglial cell CD4 expression:
examination of central nervous system biopsy specimens from HIV-
seropositive patients and patients with other neurological disease. AIDS
11:1699-1708.1997).

Dimayuga FO, Reed JL, Carnero GA, Wang C, Dimayuga ER, Dimayuga VM,
Perger A, Wilson ME, Keller JN, Bruce-Keller AJ (Estrogen and brain
inflammation: effects on microglial expression of MHC, costimulatory
molecules and cytokines. J Neuroimmunol 161:123-136.2005).

Farrall AJ, Wardlaw JM (Blood-brain barrier: ageing and microvascular
disease--systematic review and meta-analysis. Neurobiol Aging 30:337-
352.2009).

Finch CE (Neurons, glia, and plasticity in normal brain aging. Neurobiol Aging
24 Suppl 1:S123-127; discussion S131.2003).

Finch CE, Felicio LS, Mobbs CV, Nelson JF (Ovarian and steroidal influences
on neuroendocrine aging processes in female rodents. Endocr Rev
5:467-497.1984).

74
! !
Finch CE, Holmes DJ (Ovarian aging in developmental and evolutionary
contexts. Ann N Y Acad Sci 1204:82-94.2010).

Garcia-Segura LM, Wozniak A, Azcoitia I, Rodriguez JR, Hutchison RE,
Hutchison JB (Aromatase expression by astrocytes after brain injury:
implications for local estrogen formation in brain repair. Neuroscience
89:567-578.1999).

Geddes JW, Monaghan DT, Cotman CW, Lott IT, Kim RC, Chui HC (Plasticity
of hippocampal circuitry in Alzheimer's disease. Science 230:1179-
1181.1985).

Ghoumari AM, Ibanez C, El-Etr M, Leclerc P, Eychenne B, O'Malley BW,
Baulieu EE, Schumacher M (Progesterone and its metabolites increase
myelin basic protein expression in organotypic slice cultures of rat
cerebellum. J Neurochem 86:848-859.2003).

Giulian D, Baker TJ (Characterization of ameboid microglia isolated from
developing mammalian brain. J Neurosci 6:2163-2178.1986).

Giulian D, Baker TJ, Shih LC, Lachman LB (Interleukin 1 of the central
nervous system is produced by ameboid microglia. J Exp Med 164:594-
604.1986).

Gosden RG, Laing SC, Felicio LS, Nelson JF, Finch CE (Imminent oocyte
exhaustion and reduced follicular recruitment mark the transition to
acyclicity in aging C57BL/6J mice. Biol Reprod 28:255-260.1983).

Goss JR, Finch CE, Morgan DG (Age-related changes in glial fibrillary acidic
protein mRNA in the mouse brain. Neurobiol Aging 12:165-170.1991).

Gottfried-Blackmore A, Sierra A, Jellinck PH, McEwen BS, Bulloch K (Brain
microglia express steroid-converting enzymes in the mouse. J Steroid
Biochem Mol Biol 109:96-107.2008).

Gougelet A, Mueller SO, Korach KS, Renoir JM (Oestrogen receptors
pathways to oestrogen responsive elements: the transactivation
function-1 acts as the keystone of oestrogen receptor (ER)beta-
mediated transcriptional repression of ERalpha. J Steroid Biochem Mol
Biol 104:110-122.2007).

75
! !
Gray F, Adle-Biassette H, Chretien F, Lorin de la Grandmaison G, Force G,
Keohane C (Neuropathology and neurodegeneration in human
immunodeficiency virus infection. Pathogenesis of HIV-induced lesions
of the brain, correlations with HIV-associated disorders and
modifications according to treatments. Clin Neuropathol 20:146-
155.2001).

Greenwood J (Mechanisms of blood-brain barrier breakdown. Neuroradiology
33:95-100.1991).

Griffin R, Nally R, Nolan Y, McCartney Y, Linden J, Lynch MA (The age-
related attenuation in long-term potentiation is associated with
microglial activation. J Neurochem 99:1263-1272.2006).

Hailer NP, Bechmann I, Heizmann S, Nitsch R (Adhesion molecule expression
on phagocytic microglial cells following anterograde degeneration of
perforant path axons. Hippocampus 7:341-349.1997).

Hailer NP, Grampp A, Nitsch R (Proliferation of microglia and astrocytes in the
dentate gyrus following entorhinal cortex lesion: a quantitative
bromodeoxyuridine-labelling study. Eur J Neurosci 11:3359-
3364.1999).

Hajszan T, Milner TA, Leranth C (Sex steroids and the dentate gyrus. Prog
Brain Res 163:399-415.2007).

Henderson VW, Popat RA (Effects of endogenous and exogenous estrogen
exposures in midlife and late-life women on episodic memory and
executive functions. Neuroscience 191:129-138.2011).

Hjorth-Simonsen A (Fink-Heimer silver impregnation of degenerating axons
and terminals in mounted cryostat sections of fresh and fixed brains.
Stain Technol 45:199-204.1970).

Hu R, Cai WQ, Wu XG, Yang Z (Astrocyte-derived estrogen enhances
synapse formation and synaptic transmission between cultured
neonatal rat cortical neurons. Neuroscience 144:1229-1240.2007).

Hyman BT, Kromer LJ, Van Hoesen GW (Reinnervation of the hippocampal
perforant pathway zone in Alzheimer's disease. Ann Neurol 21:259-
267.1987).

76
! !
Hyman BT, Van Hoesen GW, Kromer LJ, Damasio AR (Perforant pathway
changes and the memory impairment of Alzheimer's disease. Ann
Neurol 20:472-481.1986).

Jellinger K, Braak H, Braak E, Fischer P (Alzheimer lesions in the entorhinal
region and isocortex in Parkinson's and Alzheimer's diseases. Ann N Y
Acad Sci 640:203-209.1991).

Johnson AB, Bake S, Lewis DK, Sohrabji F (Temporal expression of IL-1beta
protein and mRNA in the brain after systemic LPS injection is affected
by age and estrogen. J Neuroimmunol 174:82-91.2006).

Kadish I, Van Groen T (Low levels of estrogen significantly diminish axonal
sprouting after entorhinal cortex lesions in the mouse. J Neurosci
22:4095-4102.2002).

Khaksari M, Soltani Z, Shahrokhi N, Moshtaghi G, Asadikaram G (The role of
estrogen and progesterone, administered alone and in combination, in
modulating cytokine concentration following traumatic brain injury. Can
J Physiol Pharmacol 89:31-40.2011).

Khorramizadeh MR, Tredget EE, Telasky C, Shen Q, Ghahary A (Aging
differentially modulates the expression of collagen and collagenase in
dermal fibroblasts. Mol Cell Biochem 194:99-108.1999).

Kohama SG, Anderson CP, Finch CE (Progesterone implants extend the
capacity for 4-day estrous cycles in aging C57BL/6J mice and protect
against acyclicity induced by estradiol. Biol Reprod 41:233-244.1989).

Krum JM, Khaibullina A (Inhibition of endogenous VEGF impedes
revascularization and astroglial proliferation: roles for VEGF in brain
repair. Exp Neurol 181:241-257.2003).

Kuo J, Hamid N, Bondar G, Dewing P, Clarkson J, Micevych P (Sex
differences in hypothalamic astrocyte response to estradiol stimulation.
Biol Sex Differ 1:7.2010).

Kuo J, Hamid N, Bondar G, Prossnitz ER, Micevych P (Membrane estrogen
receptors stimulate intracellular calcium release and progesterone
synthesis in hypothalamic astrocytes. J Neurosci 30:12950-
12957.2010).

77
! !
Lai AY, Todd KG (Differential regulation of trophic and proinflammatory
microglial effectors is dependent on severity of neuronal injury. Glia
56:259-270.2008).

Lalonde R (The neurobiological basis of spontaneous alternation. Neurosci
Biobehav Rev 26:91-104.2002).

Lalonde R, Dumont M, Staufenbiel M, Sturchler-Pierrat C, Strazielle C (Spatial
learning, exploration, anxiety, and motor coordination in female APP23
transgenic mice with the Swedish mutation. Brain Res 956:36-44.2002).

Lamour Y, Dutar P, Jobert A (Septo-hippocampal neurons: altered properties
in the aged rat. Brain Res 416:277-282.1987).

Landfield PW, Rose G, Sandles L, Wohlstadter TC, Lynch G (Patterns of
astroglial hypertrophy and neuronal degeneration in the hippocampus
of ages, memory-deficient rats. J Gerontol 32:3-12.1977).

LaPolt PS, Matt DW, Lu JK (Progesterone implants delay age-related declines
in regular estrous cyclicity and the ovarian follicular reserve in Long-
Evans rats. Biol Reprod 59:197-201.1998).

Lefrancois T, Fages C, Peschanski M, Tardy M (Neuritic outgrowth associated
with astroglial phenotypic changes induced by antisense glial fibrillary
acidic protein (GFAP) mRNA in injured neuron-astrocyte cocultures. J
Neurosci 17:4121-4128.1997).

Lepore G, Gadau S, Peruffo A, Mura A, Mura E, Floris A, Balzano F, Zedda M,
Farina V (Aromatase expression in cultured fetal sheep astrocytes after
nitrosative/oxidative damage. Cell Tissue Res 344:407-413.2011).

Lewis DK, Johnson AB, Stohlgren S, Harms A, Sohrabji F (Effects of estrogen
receptor agonists on regulation of the inflammatory response in
astrocytes from young adult and middle-aged female rats. J
Neuroimmunol 195:47-59.2008).

Lewis DK, Woodin HR, Sohrabji F (Astrocytes from acyclic female rats exhibit
lowered capacity for neuronal differentiation. Aging Cell 7:836-
849.2008).

Li R, Shen Y, Yang LB, Lue LF, Finch C, Rogers J (Estrogen enhances uptake
of amyloid beta-protein by microglia derived from the human cortex. J
Neurochem 75:1447-1454.2000).
78
! !
Lindberg C, Crisby M, Winblad B, Schultzberg M (Effects of statins on
microglia. J Neurosci Res 82:10-19.2005).

Liu MH, Tsuang FY, Sheu SY, Sun JS, Shih CM (The protective effects of
coumestrol against amyloid-beta peptide- and lipopolysaccharide-
induced toxicity on mice astrocytes. Neurol Res 33:663-672.2011).

Liu X, Fan XL, Zhao Y, Luo GR, Li XP, Li R, Le WD (Estrogen provides
neuroprotection against activated microglia-induced dopaminergic
neuronal injury through both estrogen receptor-alpha and estrogen
receptor-beta in microglia. J Neurosci Res 81:653-665.2005).

Lynch G, Matthews DA, Mosko S, Parks T, Cotman C (Induced
acetylcholinesterase-rich layer in rat dentate gyrus following entorhinal
lesions. Brain Res 42:311-318.1972).

Marriott LK, Hauss-Wegrzyniak B, Benton RS, Vraniak PD, Wenk GL (Long-
term estrogen therapy worsens the behavioral and neuropathological
consequences of chronic brain inflammation. Behav Neurosci 116:902-
911.2002).

Masliah E, Mallory M, Hansen L, DeTeresa R, Terry RD (Quantitative synaptic
alterations in the human neocortex during normal aging. Neurology
43:192-197.1993).

McCarthy KD, de Vellis J (Preparation of separate astroglial and
oligodendroglial cell cultures from rat cerebral tissue. J Cell Biol 85:890-
902.1980).

McMillian MK, Thai L, Hong JS, O'Callaghan JP, Pennypacker KR (Brain
injury in a dish: a model for reactive gliosis. Trends Neurosci 17:138-
142.1994).

Meier S, Brauer AU, Heimrich B, Nitsch R, Savaskan NE (Myelination in the
hippocampus during development and following lesion. Cell Mol Life Sci
61:1082-1094.2004).

Merkler D, Metz GA, Raineteau O, Dietz V, Schwab ME, Fouad K (Locomotor
recovery in spinal cord-injured rats treated with an antibody neutralizing
the myelin-associated neurite growth inhibitor Nogo-A. J Neurosci
21:3665-3673.2001).

79
! !
Micevych P, Bondar G, Kuo J (Estrogen actions on neuroendocrine glia.
Neuroendocrinology 91:211-222.2010).

Micevych P, Sinchak K (Estradiol regulation of progesterone synthesis in the
brain. Mol Cell Endocrinol 290:44-50.2008).

Miehlke RK, Schneider S, Sorgel F, Muth P, Henschke F, Fedder M ([6-
methoxy-2-naphthylacetic acid level in plasma, synovial fluid and
adjacent tissue in patients with rheumatoid arthritis or gonarthroses
after a 4-day therapy with nabumetone (Arthaxan)]. Z Rheumatol
50:103-108.1991).

Miller LA, Lai R, Munoz DG (Contributions of the entorhinal cortex, amygdala
and hippocampus to human memory. Neuropsychologia 36:1247-
1256.1998).

Miller MM, Hyder SM, Assayag R, Panarella SR, Tousignant P, Franklin KB
(Estrogen modulates spontaneous alternation and the cholinergic
phenotype in the basal forebrain. Neuroscience 91:1143-1153.1999).

Mitchell ES, Woods NF (Cognitive symptoms during the menopausal transition
and early postmenopause. Climacteric 14:252-261.2011).

MohanKumar SM, Kasturi BS, Shin AC, Balasubramanian P, Gilbreath ET,
Subramanian M, Mohankumar PS (Chronic estradiol exposure induces
oxidative stress in the hypothalamus to decrease hypothalamic
dopamine and cause hyperprolactinemia. Am J Physiol Regul Integr
Comp Physiol 300:R693-699.2011).

Morgan TE, Laping NJ, Rozovsky I, Oda T, Hogan TH, Finch CE, Pasinetti
GM (Clusterin expression by astrocytes is influenced by transforming
growth factor beta 1 and heterotypic cell interactions. J Neuroimmunol
58:101-110.1995).

Morgan TE, Xie Z, Goldsmith S, Yoshida T, Lanzrein AS, Stone D, Rozovsky I,
Perry G, Smith MA, Finch CE (The mosaic of brain glial hyperactivity
during normal ageing and its attenuation by food restriction.
Neuroscience 89:687-699.1999).

Morse JK, DeKosky ST, Scheff SW (Neurotrophic effects of steroids on lesion-
induced growth in the hippocampus. II. Hormone replacement. Exp
Neurol 118:47-52.1992).

80
! !
Neese SL, Korol DL, Katzenellenbogen JA, Schantz SL (Impact of estrogen
receptor alpha and beta agonists on delayed alternation in middle-aged
rats. Horm Behav 58:878-890.2010).

Nelson JF, Felicio LS, Osterburg HH, Finch CE (Differential contributions of
ovarian and extraovarian factors to age-related reductions in plasma
estradiol and progesterone during the estrous cycle of C57BL/6J mice.
Endocrinology 130:805-810.1992).

Nelson JF, Felicio LS, Randall PK, Sims C, Finch CE (A longitudinal study of
estrous cyclicity in aging C57BL/6J mice: I. Cycle frequency, length and
vaginal cytology. Biol Reprod 27:327-339.1982).

Nelson JF, Gosden RG, Felicio LS (Effect of dietary restriction on estrous
cyclicity and follicular reserves in aging C57BL/6J mice. Biol Reprod
32:515-522.1985).

Nichols NR, Day JR, Laping NJ, Johnson SA, Finch CE (GFAP mRNA
increases with age in rat and human brain. Neurobiol Aging 14:421-
429.1993).

Nichols NR, Finch CE, Nelson JF (Food restriction delays the age-related
increase in GFAP mRNA in rat hypothalamus. Neurobiol Aging 16:105-
110.1995).

Oka A, Belliveau MJ, Rosenberg PA, Volpe JJ (Vulnerability of oligodendroglia
to glutamate: pharmacology, mechanisms, and prevention. J Neurosci
13:1441-1453.1993).

Paris JJ, Walf AA, Frye CA (II. Cognitive performance of middle-aged female
rats is influenced by capacity to metabolize progesterone in the
prefrontal cortex and hippocampus. Brain Res 1379:149-163.2011).

Patel NV, Wei M, Wong A, Finch CE, Morgan TE (Progressive changes in
regulation of apolipoproteins E and J in glial cultures during postnatal
development and aging. Neurosci Lett 371:199-204.2004).

Pettus EH, Wright DW, Stein DG, Hoffman SW (Progesterone treatment
inhibits the inflammatory agents that accompany traumatic brain injury.
Brain Res 1049:112-119.2005).

81
! !
Phinney AL, Calhoun ME, Woods AG, Deller T, Jucker M (Stereological
analysis of the reorganization of the dentate gyrus following entorhinal
cortex lesion in mice. Eur J Neurosci 19:1731-1740.2004).

Poirier J, Hess M, May PC, Finch CE (Astrocytic apolipoprotein E mRNA and
GFAP mRNA in hippocampus after entorhinal cortex lesioning. Brain
Res Mol Brain Res 11:97-106.1991).

Poirier J, Hess M, May PC, Finch CE (Cloning of hippocampal poly(A) RNA
sequences that increase after entorhinal cortex lesion in adult rat. Brain
Res Mol Brain Res 9:191-195.1991).

Popescu BO, Toescu EC, Popescu LM, Bajenaru O, Muresanu DF,
Schultzberg M, Bogdanovic N (Blood-brain barrier alterations in ageing
and dementia. J Neurol Sci 283:99-106.2009).

Prior JC, Hitchcock CL (The endocrinology of perimenopause: need for a
paradigm shift. Front Biosci (Schol Ed) 3:474-486.2011).

Proia P, Schiera G, Mineo M, Ingrassia AM, Santoro G, Savettieri G, Di Liegro
I (Astrocytes shed extracellular vesicles that contain fibroblast growth
factor-2 and vascular endothelial growth factor. Int J Mol Med 21:63-
67.2008).

Prolla TA, Mattson MP (Molecular mechanisms of brain aging and
neurodegenerative disorders: lessons from dietary restriction. Trends
Neurosci 24:S21-31.2001).

Rapalino O, Lazarov-Spiegler O, Agranov E, Velan GJ, Yoles E, Fraidakis M,
Solomon A, Gepstein R, Katz A, Belkin M, Hadani M, Schwartz M
(Implantation of stimulated homologous macrophages results in partial
recovery of paraplegic rats. Nat Med 4:814-821.1998).

Reuss B, Dono R, Unsicker K (Functions of fibroblast growth factor (FGF)-2
and FGF-5 in astroglial differentiation and blood-brain barrier
permeability: evidence from mouse mutants. J Neurosci 23:6404-
6412.2003).

Roberts JA, Gilardi KV, Lasley B, Rapp PR (Reproductive senescence
predicts cognitive decline in aged female monkeys. Neuroreport
8:2047-2051.1997).

82
! !
Roof RL, Duvdevani R, Stein DG (Gender influences outcome of brain injury:
progesterone plays a protective role. Brain Res 607:333-336.1993).

Roof RL, Zhang Q, Glasier MM, Stein DG (Gender-specific impairment on
Morris water maze task after entorhinal cortex lesion. Behav Brain Res
57:47-51.1993).

Rozovsky I, Finch CE, Morgan TE (Age-related activation of microglia and
astrocytes: in vitro studies show persistent phenotypes of aging,
increased proliferation, and resistance to down-regulation. Neurobiol
Aging 19:97-103.1998).

Rozovsky I, Wei M, Morgan TE, Finch CE (Reversible age impairments in
neurite outgrowth by manipulations of astrocytic GFAP. Neurobiol Aging
26:705-715.2005).

Rozovsky I, Wei M, Stone DJ, Zanjani H, Anderson CP, Morgan TE, Finch CE
(Estradiol (E2) enhances neurite outgrowth by repressing glial fibrillary
acidic protein expression and reorganizing laminin. Endocrinology
143:636-646.2002).

Saija A, Princi P, D'Amico N, De Pasquale R, Costa G (Aging and sex
influence the permeability of the blood-brain barrier in the rat. Life Sci
47:2261-2267.1990).

Saijo K, Collier JG, Li AC, Katzenellenbogen JA, Glass CK (An ADIOL-
ERbeta-CtBP transrepression pathway negatively regulates microglia-
mediated inflammation. Cell 145:584-595.2011).

Sandoval KE, Witt KA (Age and 17beta-estradiol effects on blood-brain barrier
tight junction and estrogen receptor proteins in ovariectomized rats.
Microvasc Res 81:198-205.2011).

Sato K, Matsuki N, Ohno Y, Nakazawa K (Estrogens inhibit l-glutamate uptake
activity of astrocytes via membrane estrogen receptor alpha. J
Neurochem 86:1498-1505.2003).

Sattar N, Perera M, Small M, Lumsden MA (Hormone replacement therapy
and sensitive C-reactive protein concentrations in women with type-2
diabetes. Lancet 354:487-488.1999).

83
! !
Saucedo R, Rico G, Basurto L, Ochoa R, Zarate A (Transdermal estradiol in
menopausal women depresses interleukin-6 without affecting other
markers of immune response. Gynecol Obstet Invest 53:114-117.2002).

Scheff SW, Benardo LS, Cotman CW (Decline in reactive fiber growth in the
dentate gyrus of aged rats compared to young adult rats following
entorhinal cortex removal. Brain Res 199:21-38.1980).

Scheff SW, DeKosky ST (Steroid suppression of axon sprouting in the
hippocampal dentate gyrus of the adult rat: dose-response relationship.
Exp Neurol 82:183-191.1983).

Schipper H, Brawer JR, Nelson JF, Felicio LS, Finch CE (Role of the gonads
in the histologic aging of the hypothalamic arcuate nucleus. Biol Reprod
25:413-419.1981).

Schmidt R, Schmidt H, Curb JD, Masaki K, White LR, Launer LJ (Early
inflammation and dementia: a 25-year follow-up of the Honolulu-Asia
Aging Study. Ann Neurol 52:168-174.2002).

Schumacher M, Guennoun R, Ghoumari A, Massaad C, Robert F, El-Etr M,
Akwa Y, Rajkowski K, Baulieu EE (Novel perspectives for progesterone
in hormone replacement therapy, with special reference to the nervous
system. Endocr Rev 28:387-439.2007).

Schumacher M, Guennoun R, Stein DG, De Nicola AF (Progesterone:
therapeutic opportunities for neuroprotection and myelin repair.
Pharmacol Ther 116:77-106.2007).

Severson JA, Marcusson J, Winblad B, Finch CE (Age-correlated loss of
dopaminergic binding sites in human basal ganglia. J Neurochem
39:1623-1631.1982).

Shughrue PJ, Lane MV, Merchenthaler I (Comparative distribution of estrogen
receptor-alpha and -beta mRNA in the rat central nervous system. J
Comp Neurol 388:507-525.1997).

Shumaker SA, Legault C, Kuller L, Rapp SR, Thal L, Lane DS, Fillit H,
Stefanick ML, Hendrix SL, Lewis CE, Masaki K, Coker LH (Conjugated
equine estrogens and incidence of probable dementia and mild
cognitive impairment in postmenopausal women: Women's Health
Initiative Memory Study. JAMA 291:2947-2958.2004).

84
! !
Siegel GJ, Agranoff BW (1999) Basic neurochemistry : molecular, cellular, and
medical aspects. Philadelphia: Lippincott-Raven Publishers.

Sierra A, Gottfried-Blackmore A, Milner TA, McEwen BS, Bulloch K (Steroid
hormone receptor expression and function in microglia. Glia 56:659-
674.2008).

Simerly RB, Chang C, Muramatsu M, Swanson LW (Distribution of androgen
and estrogen receptor mRNA-containing cells in the rat brain: an in situ
hybridization study. J Comp Neurol 294:76-95.1990).

Spence RD, Hamby ME, Umeda E, Itoh N, Du S, Wisdom AJ, Cao Y, Bondar
G, Lam J, Ao Y, Sandoval F, Suriany S, Sofroniew MV, Voskuhl RR
(Neuroprotection mediated through estrogen receptor-alpha in
astrocytes. Proc Natl Acad Sci U S A 108:8867-8872.2011).

Stein DG (Progesterone exerts neuroprotective effects after brain injury. Brain
Res Rev 57:386-397.2008).

Stone DJ, Rozovsky I, Morgan TE, Anderson CP, Finch CE (Increased
synaptic sprouting in response to estrogen via an apolipoprotein E-
dependent mechanism: implications for Alzheimer's disease. J Neurosci
18:3180-3185.1998).

Stone DJ, Rozovsky I, Morgan TE, Anderson CP, Hajian H, Finch CE
(Astrocytes and microglia respond to estrogen with increased apoE
mRNA in vivo and in vitro. Exp Neurol 143:313-318.1997).

Stone DJ, Rozovsky I, Morgan TE, Anderson CP, Lopez LM, Shick J, Finch
CE (Effects of age on gene expression during estrogen-induced
synaptic sprouting in the female rat. Exp Neurol 165:46-57.2000).

Stone DJ, Song Y, Anderson CP, Krohn KK, Finch CE, Rozovsky I
(Bidirectional transcription regulation of glial fibrillary acidic protein by
estradiol in vivo and in vitro. Endocrinology 139:3202-3209.1998).

Stoub TR, deToledo-Morrell L, Stebbins GT, Leurgans S, Bennett DA, Shah
RC (Hippocampal disconnection contributes to memory dysfunction in
individuals at risk for Alzheimer's disease. Proc Natl Acad Sci U S A
103:10041-10045.2006).

85
! !
Subramanian M, Balasubramanian P, Garver H, Northcott C, Zhao H,
Haywood JR, Fink GD, MohanKumar SM, MohanKumar PS (Chronic
estradiol-17beta exposure increases superoxide production in the
rostral ventrolateral medulla and causes hypertension: reversal by
resveratrol. Am J Physiol Regul Integr Comp Physiol 300:R1560-
1568.2011).

Summy-Long JY, Hu S, Long A, Phillips TM (Interleukin-1beta Release in the
SON Area during Osmotic Stimulation Requires Neural Function. J
Neuroendocrinol.2008).

Takao T, Flint N, Lee L, Ying X, Merrill J, Chandross KJ (17beta-estradiol
protects oligodendrocytes from cytotoxicity induced cell death. J
Neurochem 89:660-673.2004).

Temel S, Lin W, Lakhlani S, Jennes L (Expression of estrogen receptor-alpha
and cFos in norepinephrine and epinephrine neurons of young and
middle-aged rats during the steroid-induced luteinizing hormone surge.
Endocrinology 143:3974-3983.2002).

Teter B, Finch CE (Caliban's heritance and the genetics of neuronal aging.
Trends Neurosci 27:627-632.2004).

Teter B, Harris-White ME, Frautschy SA, Cole GM (Role of apolipoprotein E
and estrogen in mossy fiber sprouting in hippocampal slice cultures.
Neuroscience 91:1009-1016.1999).

Toku K, Tanaka J, Yano H, Desaki J, Zhang B, Yang L, Ishihara K, Sakanaka
M, Maeda N (Microglial cells prevent nitric oxide-induced neuronal
apoptosis in vitro. J Neurosci Res 53:415-425.1998).

Tokuhara D, Yokoi T, Nakajima R, Hattori H, Matsuoka O, Yamano T (Time
course changes of estrogen receptor alpha expression in the adult rat
hippocampus after kainic acid-induced status epilepticus. Acta
Neuropathol 110:411-416.2005).

Vehkavaara S, Silveira A, Hakala-Ala-Pietila T, Virkamaki A, Hovatta O,
Hamsten A, Taskinen MR, Yki-Jarvinen H (Effects of oral and
transdermal estrogen replacement therapy on markers of coagulation,
fibrinolysis, inflammation and serum lipids and lipoproteins in
postmenopausal women. Thromb Haemost 85:619-625.2001).

86
! !
Walsh BW, Paul S, Wild RA, Dean RA, Tracy RP, Cox DA, Anderson PW (The
effects of hormone replacement therapy and raloxifene on C-reactive
protein and homocysteine in healthy postmenopausal women: a
randomized, controlled trial. J Clin Endocrinol Metab 85:214-218.2000).

Wang VC, Neese SL, Korol DL, Schantz SL (Chronic estradiol replacement
impairs performance on an operant delayed spatial alternation task in
young, middle-aged, and old rats. Horm Behav 56:382-390.2009).

Waters EM, Torres-Reveron A, McEwen BS, Milner TA (Ultrastructural
localization of extranuclear progestin receptors in the rat hippocampal
formation. J Comp Neurol 511:34-46.2008).

Weaver JD, Huang MH, Albert M, Harris T, Rowe JW, Seeman TE
(Interleukin-6 and risk of cognitive decline: MacArthur studies of
successful aging. Neurology 59:371-378.2002).

Whitmer RA, Quesenberry CP, Zhou J, Yaffe K (Timing of hormone therapy
and dementia: the critical window theory revisited. Ann Neurol 69:163-
169.2011).

Wong AM, Patel NV, Patel NK, Wei M, Morgan TE, de Beer MC, de Villiers
WJ, Finch CE (Macrosialin increases during normal brain aging are
attenuated by caloric restriction. Neurosci Lett 390:76-80.2005).

Wong AM, Rozovsky I, Arimoto JM, Du Y, Wei M, Morgan TE, Finch CE
(Progesterone Influence on Neurite Outgrowth Involves Microglia.
Endocrinology.2008).

Woolley CS, McEwen BS (Roles of estradiol and progesterone in regulation of
hippocampal dendritic spine density during the estrous cycle in the rat.
J Comp Neurol 336:293-306.1993).

Xie Z, Morgan TE, Rozovsky I, Finch CE (Aging and glial responses to
lipopolysaccharide in vitro: greater induction of IL-1 and IL-6, but
smaller induction of neurotoxicity. Exp Neurol 182:135-141.2003).

Xie Z, Wei M, Morgan TE, Fabrizio P, Han D, Finch CE, Longo VD
(Peroxynitrite mediates neurotoxicity of amyloid beta-peptide1-42- and
lipopolysaccharide-activated microglia. J Neurosci 22:3484-3492.2002).

87
! !
Yaffe K, Lindquist K, Penninx BW, Simonsick EM, Pahor M, Kritchevsky S,
Launer L, Kuller L, Rubin S, Harris T (Inflammatory markers and
cognition in well-functioning African-American and white elders.
Neurology 61:76-80.2003).

Yoshida T, Goldsmith SK, Morgan TE, Stone DJ, Finch CE (Transcription
supports age-related increases of GFAP gene expression in the male
rat brain. Neurosci Lett 215:107-110.1996).

Zecca L, Youdim MB, Riederer P, Connor JR, Crichton RR (Iron, brain ageing
and neurodegenerative disorders. Nat Rev Neurosci 5:863-873.2004).

Abstract (if available)

Abstract Glia are the most abundant cell type in the brain and perform a variety of activities in support of neuronal function. These cells are dynamic and their activation is an important aspect of the immune and inflammatory response, as well as normal aging. Estrogen-mediated effects in the brain are altered during aging, thus astrocytes and astrocytic estrogen receptors are an important area of study in understanding these age-related changes. ❧ In rat primary cortical cell culture, old (24mo) astrocytes support less E2-mediated neurite outgrowth than young (3mo) astrocytes. Chapter 2 examines estrogen receptor levels in-vivo and in-vitro in young and old rats and astrocyte support of neurite outgrowth in-vitro. ERα levels and the ERα/β ratio were found to be increased with age concurrently with decreased support of E2-mediated neurite outgrowth. The loss of E2-mediated neurite outgrowth in old astrocytes was reversed by decreasing ERα levels by siRNA and induced in young astrocytes by increasing ERα levels by cDNA transfection. ❧ Chapter 3 examines the role of reproductive senescence and perimenopausal transition in glia support of neurite outgrowth. Young (5mo) normal cycling (4-5 day cycles) animals were compared with old (12-16mo) irregular cycling (>6day cycles) and constant estrus animals (>7days consecutive estrus). An additional group of age-matched (9-10mo) normal cycling, irregular cycling and constant estrus animals were also studied. Primary cortical mixed glia cultures derived from normal cycling animals support E2-mediated increase in neurite outgrowth, but mixed glia derived from irregular cycling and constant estrus animals do not. This change in E2-mediated neurotrophic support accompanies an increase in ERα and the ERα/β ratio in astrocytes both in-vivo and in-vitro. These results suggest a component of stage of reproductive senescence separate from chronological age in E2 mediated effects in the brain that is mediated through altered expression of estrogen receptors.

Linked assets

University of Southern California Dissertations and Theses

Conceptually similar

PDF

Progesterone receptors in the rat brain and their role in steroidal regulation of neurite outgrowth

PDF

Effects of age-related glial activation on neurite outgrowth

PDF

Non-apoptotic involvement of caspases in astrogliosis

PDF

Neuroinflammatory effects of urban traffic-derived nanoparticulate matter on neural systems

PDF

Estrogen and progesterone-based hormone therapy and the development of Alzheimer's disease

PDF

Glial activation and neurotoxicity: Age-related cytokine expression, ApoJ-induced microglial activation, and role of peroxynitrite in mediating neuron death

PDF

From risk mitochondrial and metabolic phenotype towards a precision medicine approach for Alzheimer's disease

PDF

The effects of prolonged fasting/ fasting mimicking diet (FMD) on CNS protection, regeneration, and treatment

PDF

Estrogen and progesterone interactions in neurons: implications for Alzheimer's disease-related pathways

PDF

Estrogen, progesterone and BDNF interactions: roles in neuroprotection

PDF

Role of GH/IGF-1 signaling in oxidative stress, DNA damage and cancer

PDF

Age-related androgen depletion and the development of Alzheimer's disease

PDF

Unraveling the role of iron-sulfur clusters in DNA repair enzymes

PDF

Studies of Sir2 and caloric restriction mimetic pathways in aging

PDF

The effects of a fasting mimicking diet (FMD) on mouse models of Alzheimer's and Parkinson's disease

PDF

RUNX2 & sex steroids: molecular mechanisms in regulating bone turnover

PDF

The role of the proteasome & its regulators in adaptation to oxidative stress

PDF

Energy metabolism and inflammation in brain aging: significance of age-dependent astrocyte metabolic-redox profile

PDF

Estradiol regulation of cerebral metabolism: implications for neuroprotection and mitochondrial bioenergetics

PDF

Longitudinal assessment of neural stem-cell aging

Asset Metadata

Creator Arimoto, Jason M. (author)

Core Title Glial support of neurite outgrowth: effects of aging and estrogen

School College of Letters, Arts and Sciences

Degree Doctor of Philosophy

Degree Program Molecular Biology

Publication Date 05/08/2013

Defense Date 12/14/2012

Publisher University of Southern California (original), University of Southern California. Libraries (digital)

Tag aging,astrocyte,Estrogen,estrogen receptor,glia,OAI-PMH Harvest,reproductive senescence

Language English

Contributor Electronically uploaded by the author (provenance)

Advisor Finch, Caleb E. (committee chair), Longo, Valter D. (committee member), Pike, Christian J. (committee member)

Creator Email arimoto@usc.edu,jmamusic@hotmail.com

Permanent Link (DOI) https://doi.org/10.25549/usctheses-c3-36906

Unique identifier UC11290558

Identifier usctheses-c3-36906 (legacy record id)

Legacy Identifier etd-ArimotoJas-817.pdf

Dmrecord 36906

Document Type Dissertation

Rights Arimoto, Jason M.

Type texts

Source University of Southern California (contributing entity), University of Southern California Dissertations and Theses (collection)

Access Conditions The author retains rights to his/her dissertation, thesis or other graduate work according to U.S. copyright law. Electronic access is being provided by the USC Libraries in agreement with the a...

Repository Name University of Southern California Digital Library

Repository Location USC Digital Library, University of Southern California, University Park Campus MC 2810, 3434 South Grand Avenue, 2nd Floor, Los Angeles, California 90089-2810, USA