The role of Ryk and Smek in neurogenesis; Mechanisms of CBP/β-catenin signaling inhibitor and IL-6 mediators in head and neck cancer

PDF

Download

Open document

Flip pages

Summarize

Download a page range

Download transcript

Copy asset link

Request this asset

Transcript (if available)

Content

Part I: The Role of Ryk and Smek in Neurogenesis
Part II: Mechanisms of CBP/β β β β-Catenin Signaling Inhibitor and IL-6 Mediators
in Head and Neck Squamous Cell Carcinoma

By
Vicky N. Yamamoto

A Dissertation Presented to the
FACULTY OF THE USC GRADUATE SCHOOL
KECK SCHOOL OF MEDICINE OF USC
UNIVERSITY OF SOUTHERN CALIFORNIA
In Partial Fulfillment of the
Requirements for the Degree
DOCTOR OF PHILOSOPHY
(BIOCHEMISTRY AND MOLECULAR BIOLOGY)

May 2013

Copyright 2013 Vicky N. Yamamoto

ii

Acknowledgments
Foremost, I would like to thank Dr. Vijay Kalra and Dr. Uttam Sinha for being my
Ph.D. mentor. Their training, mentorship, and philosophy had a life-long impact on
me. Because of them, I learned the importance of basic science as well as
translational research and received an excellent training in the two areas.
Dr. Kalra’s enthusiasm and long years of contributions in the field of molecular
biology inspired me to learn and receive training in molecular biology. I also
learned a lot of “secret recipe” to become a successful, productive scientist from
him. While standard of research quality is rigorous and demanding in his lab, he
exactly knows how to create a cheerful, happy working environment. His optimistic
attitude, along with his precise guidance and suggestions, always helped me move
forward and make a progress in research.
Dr. Sinha’s passion and dedication to help patients with head and neck cancer
inspired me to pursue this important field in medicine and research. His knowledge,
resources, and guidance were instrumental in building my successful research
career. He provided me with numerous opportunities to present my work in front of
physicians, scientists, patients, and corporate audience that sharpened my
presentation skills. Outside of research, I learned how to be visionary, empowering,
and professionalism from him.
Both Dr. Kalra and Dr. Sinha are exceptional mentors, role models, and my heroes.
I am extremely fortunate to have the two amazing mentors I can only hope to
emulate one day.

I sincerely thank the dedicated members of my thesis committee, Dr. Zoltan Tokes
and Dr. Stanley Tahara, for their valuable input, wisdom, and decisive guidance
throughout the final years of my PhD training. I am fortunate to have professors
like them, who truly care about a student’s future career.
I am grateful to our collaborator Dr. Michael Kahn and his lab members for their
contributions to my work, including ICG-001, plasmids, and valuable discussion
and input for my research.
I would like to thank all the current and former Kalra lab members: Monisha
Ravichandran, Chen Li, Jo Lee, Caryn Gonsalves, and the newest members
Prenali and Ruchika. To my students, Rohit Khanna, Karin Wu, David Thylur, and
Isaac Schmale: Thank you for being attentive, dedicated, and enthusiastic about

iii

our research. I immensely enjoyed mentoring all of you. You made my research
move forward. I have no doubt that you will all be successful doctors.
To Michelle MacVeigh-Aloni, thank you for your support in microscope imaging.
“Seeing is believing” applies to science too and your help has been essential in
generating convincing, publishable data for my manuscripts.
To my former PI Dr. Wange Lu, thank you for your support for the first half of my
Ph.D. journey. To Drs. Jungmook Lyu and Peilin Zhang, it has been a privilege to
work alongside and to learn from dedicated, knowledgeable scientists like you.
To Dr. Rizwan Masood and Dr. Sutao Zu, thank you for providing me with the cell
lines. I thank all the members in the Otolaryngology department, especially Jim
Mopsikoff, Florence Ner and Hovsep Derboghossian. I would also like to extend a
special thank you to Kavita Munjal for providing me with all the resources and
support for funding our research. I would like to acknowledge the hard work and
dedication to Erlinda Tieng, Anne Rice and other staff members in the
Biochemistry Department who provided me with administration support.
I would like to thank the Edwin Everest Foundation for the generous support and
funding for my project. I cannot wait to share my research findings with Dr. Everest
soon.
To my colleagues and friends, thank you for making my time as a PhD candidate
enjoyable, for sharing a lot of laughs and precious moment, and for helping each
other to overcome hardships. Special thanks to Chen-Yin Ou, Tomoyo Sasaki,
Krishnakali Dasgupta, and Ankita Das.
To Neri Recinos and Rachel De La Paz, I am fortunate to have friends who still
keep in touch and encourage each other ever since we met at our alma mater, the
Mount St. Mary’s college. To the faculty members at the Mount, thank you for
giving me all the necessary education and training that prepared me to become a
successful scientist.
To Babak Kateb, thank you for being my biggest fan and supporter for the past 12
years. I am very lucky to have someone that can share my dream, passion and joy
in life. Together, we will achieve more in life, personally and professionally.
Last but not least, I would like to thank my parents, Shintaro and Hisako
Yamamoto and my brother, Don. Without their unconditional support and love,
completing the projects and the dissertation would not have been possible.

iv

Table of Contents

Acknowledgments ii

List of Tables vii

List of Figures viii

Abstract xii

Chapter I. Roles of Ryk and Smek in Neurogenesis 1
Introduction 1
1. Neurogenesis and cell signaling 1
2. Intrinsic and extrinsic factors that regulate cell fate determination 3
3. Wnt signaling in neurogenesis 4
4. Ryk, the atypical receptor tyrosine kinase 5
5. Specific aims of the neurogenesis section 7

Chapter 2. Cleavage of the Wnt Receptor Ryk Regulates Neuronal Differentiation
During Cortical Neurogenesis. 9
1. Introduction 9
2. Material and Methods 11
3. Results 17
a) Ryk is expressed in the cortical plate and ventricular zone during
neurogenesis and the number of TUJ1-positive cells is reduced in Ryk-/-
mice. 17
b) Cleavage of Ryk is essential for neuronal differentiation of NPCs 25
4. Discussion 33
5. Future Direction 33
6. Role of Ryk-ICD in in neurogenesis in developing mouse embryo 34
7. Material and Methods: in vivo electroporation 35
8. Results 38
a) Persistent expression of Ryk in the ventricular zone promoted neuronal
differentiation 38
9. Discussion 40
10. Future Direction 41

v

Chapter 3. Roles Smek1 in Neurogenesis 42
1. Introduction 42
2. Material and Methods 45
3. Resutls 49
a) Smek1 is expressed in the mouse brain during early development. 49
b) Unique Smek1 subcellular localization 51
c) Generation of Smek1 knockout mice. 54
d) Verification of Smek1 knockout mice. 56
e) Depletion of Smek1 either by shRNA in NPC or in knockout mice
enhanced histone H3 phosphorylation, an indicator of chromosome
condensation and cell-cycle progression during mitosis 59
f) Depletion of Smek1 causes a NPCs expansion and impairs the production
of neurons 65
g) Knocking down of Smek1 reduced expression of Tuj-1 positive cells and
increased PAX6 positive cells, markers of neuronal differentiation 70
4. Discussion 77
5. Future Direction 79

Chapter 4. Introduction to Head and Neck Cancer 82
1. Epidemiology 82
2. Risk factors 87
3. Carcinogenesis 92
4. Challenges in treating HNSCC 95
5. Molecular biology and targeted therapy of HNSCC 102
6. microRNA and its roles in cancer 108
7. ICG-001, a small molecule inhibitor for Wnt/β-catenin signaling 115

Chapter 5. Inhibition of β β β β-catenin/CBP signaling enhances chemo-radiation
sensitivity and reverses Epithelia-to Mesenchymal Transition (EMT)
in head and neck cancer. 119
1. Background and Significance 119
2. Material and Methods 122
3. Results 128
a) Treatment with ICG-001 has anti-proliferative effect on HNSCC cell
lines. 128
b) Treatment of HNSCC cell lines with ICG-001, reduces CBP/β-catenin
mediated target gene expression levels of Cyclin D1, Survivin and
S100A4. 130

vi

c) Does radiation enhance the sensitivity of HNSCC to ICG-001 as
determined by expression of suvivin? 131
d) ICG-001 pre-treatment enhanced radiation sensitivity in HNSCC 135

e) Pre-treatment of HNSCC cells with ICG-001 augments radiation mediated
cell death due to apoptosis. 138
f) ICG-001 treatment of HNSCCs induces epithelial-mesenchymal transition
141
g) Treatment of SCC-71 with ICG-001 reduces invasiveness in a Matrigel
assay 145
h) Treatment of SCC-71 with ICG-001 attenuates expression of Twist-1
and Slug-1, repressors of E-cadherin 146
i) ICG-001 treatment of HNSCC enhanced expression of EGFR and
concomitantly cetuximab sensitivity 148
4. Discussion 151
5. Future Direction 156

Chapter 6. IL-6 mediated signaling in HNSC augments IL-6 receptor expression
via increasing its stability 159
1. Background and Significance 159
2. Material and Methods 162
3. Results 165
a) IL-6 treatment of Scc-71 augments IL6R expression and increases
IL6R mRNA stability 165
b) IL6’s attenuates E-cadherin expression and induces EMT, but not cell
proliferation, in head and neck cancer cell line (SCC-71) 168
c) IL-6 selectively induces PlGF but not VEGF in SCC-71 168
d) Role of microRNAs in the stability of IL-6R 171
4. Discussion 174
5. Future Direction 176

Bibliography 177

vii

List of Tables

TABLE 1: miRNA candidates predicted to be bound on the IL6R 3’- UTR 172

viii

List of Figures
FIGURE 2-1: Ryk protein is cleaved and localized in the nuclus 19
FIGURE 2-2: Deficiency of Ryk leads to the defect of neuronal differentiation
in the CP 22

FIGURE 2-3: Immunostaining analysis of the coronal sections and the gene
expression analysis of E14.5 Ryk+/+ and Ryk-/- mouse forebrains 23

FIGURE 2-4: Ryk is specifically expressed in neurons and oligodendrocytes 24

FIGURE 2-5: Western blot analysis using polyclonal anti-Ryk antibody 24

FIGURE 2-6: Cleavage of Ryk Is required for neuronal differentiation 29

FIGURE 2-7: Expression of cleaved- Ryk protein correlates with Wnt3 mRNA
expression in the developing cortex, and during neuronal
differentiation 32

FIGURE 2-8: Schematic presentation of in vivo electroporation 35

FIGURE 2-9: Forced expression of Ryk-ICD-NLS promoted differentiation of
neural progenitors in vivo. 39

FIGURE 3-1: Expression of Smek1 in the mouse forebrain 50

FIGURE 3-2: Subcellular localization of Smek1 in vitro and in vivo 52

FIGURE 3-3: Generation of Smek1gt/gt mice 54

FIGURE 3-4: Expression of Smek1 in Smek1gt/gt mice 57

FIGURE3-5: Immunostaining of LacZ in Smek +/gt brains 58

FIGURE 3-6: Knockdown of Smek1 by shRNA enhanced cell proliferation 60

FIGURE 3-7: The number of phosphorylated Histone H3 positvive cells was
increased in the brains of Smek1 gt/gt at E11.5 63

FIGURE 3-8: Defect of neurogenesis in Smek1 knockout mice. 66

FIGURE 3-9: Smek1 depletion caused an increase in Pax6 and decrease in
Tbr1 68

ix

FIGURE 3-10: Images of the distribution of the BrdU-positive cells in coronal
sections from Smek1+/+ 69

FIGURE 3-11: Smek1 is essential for regulating neuronal differentiation
versus maintenance of NPCs 72

FIGURE 3-12: Reduction of neurons in Smek1 knockdown cells 74

FIGURE 3-13: Representative images of immunostaining with anti-TUJ1, -
Nestin, -Pax6, or -Ki67 antibodies in control or Smek1 shRNA-
expressing cells 75

FIGURE 3-14: Smek1 depletion increased GFAP protein expression level 76

FIGURE 4-1: Anatomy of head and neck 84

FIGURE 4-2: Estimated age-standarized incidence rate per 100,000 for head
and neck cancer 85

FIGURE 4-3: Relative survival rate of head and neck cancer patients 85

FIGURE 4-4: Trends in 5-year survival rate according to the tumor site and
year of diagnosis 86

FIGURE 4-5: Histological evolution of oral epithelial cells and the
accumulated genetic mutations in carcinogenesis of head and neck
cancer 95

FIGURE 4-6: Head and neck cancer recurrence 101

FIGURE 4-7: Field cancerization which may cause local relapse 102

FIGURE 4-8: Biogenesis of miroRNA 111

FIGURE 4-9: Causes of microRNA dysregulation in cancer 115

FIGURE 4-10: The chemical structure of ICG-001 118

FIGURE 4-11: The mode of action of ICG-001 119

FIGURE 5-1: Schematics of molecular mechanisms of metastasis 121

FIGURE 5-2: Inhibiting b-catenin/CBP signaling by ICG-001 reduced viable
HNSCC cells in a dose-dependent manner 129

x

FIGURE 5-3: Treatment of HNSCC cell with ICG-001 at 5, 10, and 25mM
attenuates the number of cells in cycle 130

FIGURE 5-4: ICG-001 treatment attenuated CBP/b-catenin mediated
expression of target genes 133

FIGURE 5-5: Survivin expression is reduced in response to ICG-001 treatment
134
FIGURE 5-6: ICG-001 treatment reduces TOPFLASH 135

FIGURE 5-7: ICG-001 treatment enhanced radiation sensitivity 137

FIGURE 5-8: Expression of survivin mRNA in SCC-71 cells pretreated with
ICG-001 followed by exposure to radiation dose of 2.5Gy 138

FIGURE 5-9: ICG-001 treatment enhanced cell death in irradiated HNSCC 140

FIGURE 5-10: Treatment of HNSCC with ICG-001 increases E-cadherin mRNA
and promoter-luciferase activity, and reduces vimentin mRNA
expression 143

FIGURE 5-11: Treatment of SCC-71 with ICG-001 reduces migration of cells in
a Matrigel Assay 147

FIGURE 5-12: The mRNA expression of Twist1 and slug in HNSCC was
attenuated by ICG-001 148

FIGURE 5-13: ICG-001 treatment enhanced cetuximab sensitivity and
upregulated EGFR expression 150

FIGURE 6-1: Schematic diagram of IL-6 signaling complex 160

FIGURE 6-2: Schematic of IL6R 161

FIGURE 6-3A: IL6 treatment increased IL6R expression level in HNSCC 166

FIGURE 6-3B: IL6 treatment increased IL6R protein expression level in
HNSCC 167

FIGURE 6-3C: IL6 treatment enhanced mRNA stability of IL6R: implication in
post-transcriptional regulation 167

xi

FIGURE 6-4A: Treatment with IL-6 does not affect on proliferation of SCC-71
169

FIGURE 6-4B: IL-6 treatment in SCC-71 cells reduced E-Cadherin
expression 170

FIGURE 6-4C: IL-6 augmented angiogenic growth factor PLGF in scc-71
cells 170

FIGURE 6-5A: The expression of miRNA 23a, 27, 34a, 34b, 449a, and 451 are
downregulated in response to IL6 treatment in SCC-71 cells 173

FIGURE 6-5B: Schematics of binding sites of miRNA on 3’-UTR of IL6R mRNA
174

xii

Abstract
The Role of Ryk and Smek in Neurogenesis/ Mechanisms of Head and Neck
Cancer Progression and Targeted Therapy

The Role of Ryk and Smek in Neurogenesis: Ryk, a single-pass membrane
receptor and a Wnt co-receptor, is expressed in the brain during
neurodevelopment and required for proper axon guidance. However, the roles of
Ryk in neurogenesis and how it transmits its signal from membrane to nucleus
were unknown. We further characterized the function and mechanism of Ryk
signaling during early neurodevelopment. Here, we report that Ryk is highly
expressed in neurons as they start to differentiate and Ryk deficiency resulted in
less neuron production, as well as reduction of several post-mitotic neuronal
markers. We also found that Ryk is expressed in the nucleus of differentiating
neurons. Later, we found that Ryk is proteolytically cleaved, and its cleaved
intracellular domain (Ryk-ICD) is required for neuronal differentiation.
In the earlier study, we found that Ryk requires Smek2, one of several Ryk-binding
proteins, to facilitate nuclear localization of Ryk. In the process, we found that
Smek2 has an isoform called Smek1 and that it was expressed in the developing
mammalian brain. In vitro studies revealed that Smek1 is highly expressed in
proliferating neuronal progenitor cells (NPC) as well as in post-mitotic neurons.
Smek1 is a nuclear protein; however, Smek1 exited into the cytoplasm during
mitosis, and was highly enriched in mitotic spindles. By utilizing gain- and loss-of-

xiii

function analysis, we found that Smek1 is required for early neuronal differentiation
and implicated in the regulation of neuronal/glial fate determination as well as in
cell cycle progression.
Collectively, our in vitro and in vivo studies underscored the importance of Ryk and
Smek1 functions during neuronal development and deciphered molecular
mechanisms required for normal brain development.
Mechanisms of Head and Neck Cancer Progression and Targeted Therapy:
Cancer is a major burden of disease in the United States and worldwide. Cancer
in head and neck is no exception as over a million people are diagnosed each year
and approximately half of which succumb to death each year worldwide.
Treatment resistance and metastasis are the primary causes of the high mortality
rate of the cancer, yet their molecular mechanisms are still poorly understood.
ICG-001 is a newly discovered small molecule inhibitor which can specifically
inhibit CBP and β-catenin binding. Inhibition of CBP/β-catenin signaling is known
to inhibit transcription of several gene expressions which are known to play a role
in cancer progression, including survivin, S100A4, and cyclin-D1. In head and
neck cancers and some other solid tumors, survivin overexpression and S100A4
overexpression are attributed to chemo-radiation resistance and for metastasis,
respectively. In our study, we found that ICG-001 treatment enhanced radiation
resistance by its anti-proliferative effect and by increasing cell death. Our study
revealed that inhibition of CBP/β-catenin signaling may induce caspase-6

xiv

activation but not caspase-3/7 in head and neck squamous cell carcinoma. In
addition, ICG-001 reduced tumor cell invasiveness by reducing epithelial-to-
mesenchymal transitions mediated by attenuation of E-cadherin suppressors.
Finally, we demonstrated that ICG-001 enhanced cetuximab sensitivity, possibly by
EGFR signaling dependency or hyperactivation. By utilizing CBP/β-catenin
inhibition by ICG-001, we attempted a) to assess the chemotherapeutic efficacy of
this newly discovered small molecule inhibitor in head and neck cancer and b) to
precisely define the molecular mechanisms of head and neck cancer progression,
aiming to discover additional novel therapeutic targets.
Increased IL-6 expression is common in head and neck cancer and is known to
correlate with poor prognosis, possibly due to an increased incidence of metastasis.
IL-6 signaling is initiated by two receptor components: gp130 and IL6R. The
former is necessary for transducing the signal but IL6R is required for IL6 binding
to gp130. It has been reported that IL6R is expressed in head and neck cancer but
its biogenesis, transcription regulation, and functional roles in cancer are not well
defined. We found that IL6 treatment reduced an epithelial cell marker, a
signature that EMT has been triggered, and significantly increased placental-
growth factor. In addition, IL6 stabilized IL6R mRNA. We identified several miRNA
candidates which may be directly responsible for regulating IL6R mRNA stability;
thus indicating their effecter role in response to IL6.

1

Chapter 1: Roles of Ryk and Smek in Neurogenesis
Introduction
Our laboratory is interested in understanding molecular mechanisms of early
developmental events in the mammalian central nervous system (CNS). The
mammalian CNS may be the most complex, intricate organ with incredibly diverse
functions, including learning, memory, movement coordination, sensation,
reasoning, and endocrine system. Cell-to-cell communication plays an important
role during early CNS development.

1.1. Neurogenesis and cell signaling
Neural stem cells (NSC) are self-renewing multipotent cells that are capable of
differentiating into several cell types of the nervous system, including neurons,
oligodendrocytes, and astrocytes. NSC can generate neurons and glial cells with
a variety of morphology and molecular characteristics, depending upon the
developmental stage and their location. Intense investigations on how the NSC
can give rise to such diverse cell types have resulted in many exciting discoveries,
some unequivocal questions and some inconclusive observations. It is known that
there are fate-restricted progenitor cells that produce only certain types of neurons
or glia, while there are single multipotent progenitor cells that can generate diverse
neuronal and glial cell types, and that both progenitor types can even co-exist in

2

the cortex (Kriegstein and Alvarez-Buylla, 2009). Nevertheless, understanding
how neuronal/glial cell differentiation is regulated is critical for understanding
normal central nervous system (CNS) development. Such information is needed
also to unravel pathogenesis of certain neurological disorders and development of
rationale therapeutics.
During early mammalian development, the neocortex develops from neuroepithelial
cells. The neuroepithelial cells typically exhibit apical-basal polarity and divide
symmetrically into two identical daughter cells that exhibit progenitor cell fate
(Wodarz and Huttner, 2003; Gotz and Huttner, 2005) until neurogenesis begins. In
mouse, neurogenesis starts around E9-E10 and this is characterized by the
acquisition of radial glial cell feature by the epithelial cells and asymmetrical
division in which one cell become progenitor and the other cell differentiates into a
neuron. Interestingly, the nuclei of the neuroepithelial cells displace as they
progress through the cell cycle, which is called interkinetic nuclear migration;
however, its functional significance is less known, although evidence suggests that
it may be linked with cell cycle progression (Latasa et al., 2009; Kriegstein and
Alvarez-Buylla, 2009). Neuronal progenitor cell proliferation and differentiation are
tightly controlled in part by numerous intrinsic and extrinsic signals. These signals
contribute to the fine adjustment of cell numbers and diversity of neuronal
progenitor cells and neurons, which differ in morphological and molecular
characteristics.

3

1.2: Intrinsic and extrinsic factors that regulate cell fate determination.
Neural cell-fate determination is regulated by a coordinated interplay by intrinsic
and extrinsic factors. For example, when the neocortex cells from early mouse
embryos (E10) are plated at clonal density, vast majority of the cells give rise to
neurons. On the other hand, if the neocortex from older embryos (E14) is used, a
higher proportion of glial and other type of cells is observed. As cortical
development progresses, the number of multipotent cells declines and by E18 and
beyond, neurogenesis will eventually halt. Neuronal progenitor cells are
multipotent at the beginning, but as the time progresses, they lose ability to self-
renew and lose multipotency. It is likely that populations of neocortex cells become
progressively restricted in their fate potential as neuronal development progresses.
This suggests control by an intrinsic factor mediated mechanism (Qian et al., 2000).
Beside the biological clock, intrinsic (or autonomous) regulators include the nuclear
factors controlling gene expression and chromosomal modifications (Watt and
Hogan, 2000). The competence states of progenitor cells appear to regulate cell
fate choice in an intrinsic manner. The generation of a particular types of cells can
be regulated by extrinsic factors within a given competence state (Edlund and
Jessell, 1999). The examples of extrinsic factors include secreted growth factors,
such as basic fibroblast growth factor (bFGF) and epidermal growth factor (EGF),
both of which are essential in directing cell fate choices in cultured neural stem
cells (Kelly et al., 2005). Other extrinsic factors involved in neuronal stem cell

4

proliferation and differentiation include Notch, Shh, and Wnt signaling (Kriegstein
and Alvarez-Buylla, 2009; Caviness et al., 2009; Shi et al., 2008).

1.3: Wnt signaling in neurogenesis
a) Wnt proteins and its receptors:
Wnts are secreted glycoproteins that are important for neuronal development, both
in embryo and adult (Chenn and Walsh, 2002; Ciani and Salinas, 2005; Inestrosa
and Arenas, 2009). Knockout of Wnt1, Wnt3, Wnt3a, Wnt5a, and Wnt7 in mouse
shows that these Wnts play an important role in neuronal progenitor cell
proliferation and/or differentiation (McMahon and Bradley, 1990; McMahon et al.,
1992; Lie et al., 2005, Ikeya et al., 1997; Lee et al., 2000; Andersson et al., 2008;
Hirabayashi et al., 2004). Recently, Wnt4 and Wnt11 were shown to be involved in
neurogenesis (Elizalde et al., 2011), thus expanding the list of Wnt proteins
involvement in neurogenesis. However, relatively less is known of the molecular
mechanisms of Wnt-mediated signaling regulating neurogenesis. For instance, it is
not understood which type of Wnt ligands bind to particular Frizzled receptors in
neuronal stem cells (NSC) during development. Some studies show that Frz3 and
Frz6 regulate midbrain morphogenesis, though Frz9 is found in neuronal precursor
cells. Additionally, the biological response of neuronal precursor cells to Wnt/β-
catenin -mediated effect has been shown to be time and cell stage dependent,

5

though its molecular mechanism remains to be elucidated (Stuebner et al., 2010;
Toledo et al., 2008; Michaelides and Lie, 2008).
b) Wnt co-receptors:
Wnt proteins can also bind to co-receptors. In recent years, many co-receptors of
Wnt have been reported, including low-density lipoprotein receptor-related protein
(LRP), receptor Tyr kinase-like orphan receptor (ROR), Syndecan, and receptor
Tyr kinase (Ryk) (Niehrs, 2012). Among these, ROR, LRP5/6, and Ryk have been
shown to play a role in neurodevelopment (Endo et al., 2012; Sahores and Salinas,
2011).

1.4: Ryk, the atypical receptor tyrosine kinase.
Ryk was first discovered in 1992 during the screening for receptor tyrosine kinases
(RTK) using murine cDNA, while its chromosomal location in humans was
identified a year later. Ryk has a highly hydrophobic transmembrane domain,
which is a characteristic for receptor tyrosine kinases. Moreover, its extracellular
domain is unusually short as an RTK, and its intracellular domain is devoid of
known kinase activity (Hovens et al., 1992; Stacker et al., 1993). In Drosophila,
Ryk is important for learning, memory and axon guidance (Dura et al., 1995;
Fradkin et al., 2009). Ryk is also known to be involved in neurite outgrowth, axon
guidance and axon regeneration in mammals (Lu et al., 2004; Keeble et al., 2006;

6

Liu et al., 2008; Miyashita et al., 2009). It has been reported that Ryk is involved in
spinal cord and brain repair, as Ryk appears to be overexpressed during injury and
may interfere with injury healing/repair (Liu et al., 2008; Hollis and Zou, 2012).
Ryk can regulate neurite outgrowth in mammals and can serve as a co-receptor for
Wnt, as Ryk has a Wnt-Inhibitory-Factor (WIF) domain in its extracellular domain
and has a PDZ-binding motif in its intracellular domain, which can bind to
Dishevelled to induce canonical Wnt signaling (Lu et al., 2004). Ryk can also
induce non-canonical Wnt signaling via a Frizzled-independent pathway (Halford
and Stacker, 2001; Lu et al., 2004; Bejsovec, 2005). Recently, it was reported that
Ryk is regulated by the E3 ubiquitin ligase mind bomb 1 (MIB1) and both Ryk and
MIB1 are necessary for Wnt/β-catenin signaling in HEK293T cells (Berndt et al.,
2011). MIB is expressed in mature neurons in the rodent brain (Yoon et al., 2012),
thus it is possible that Ryk and MIB1 cooperatively regulate Wnt/b-catenin
signaling during neurogenesis.

7

1.5: Aim of the neurogenesis section (Ch 2 and Ch 3)
Wnt signaling is essential in normal cellular function and development, including
embryogenesis and brain development. However, much less is known regarding
the molecular mechanisms underlying Wnt signaling in neurodevelopment. Earlier,
our team found that Ryk, a typical receptor tyrosine kinase, is a Wnt co-receptor
and functions in Wnt3 mediated axonal guidance (Lu et al., 2004). While I was in
David Baltimore’s lab, I found that Ryk is expressed highly in the mouse cortex and
that the cortex’s thickness is somewhat thinner in knockout animals than in wild-
type littermates. Although not all Ryk knockout mice exhibited this phenotype,
possibly due to variability in penetrance, we hypothesized that Ryk may play a role
in mammalian neurogenesis.
By yeast-two-hybrid assay, we identified several Ryk binding proteins. One of
which is Smek2 and we found that Ryk requires Smek2 to facilitate nuclear
localization of Ryk. In the process, we found that Smek2 has an isoform called
Smek1. Intrigued by the fact that Smek1 is also expressed in mammalian brain,
we embarked to investigate the function and molecular mechanisms in
neurogenesis.
Specific aims 1 and 2 will focus on Ryk’s roles in neurogenesis and specific aims 3
through 5 will focus on possible involvement of smek1 in neuro-development.

8

Specific Aim 1: Investigation of the role of Ryk in neurogenesis.
Specific Aim 2: Elucidation of the signaling mechanism employed by Ryk.
Specific Aim 3: Determination of the expression pattern of Smek1 in developing
mammalian brain.
Specific Aim 4: Characterization of roles of Smek1 through gain/loss of function
using in vitro model.
Specific Aim 5: Generation of Smek1 KO mice and characterization of its
phenotype.

9

Chapter 2: Cleavage of the Wnt Receptor Ryk Regulates Neuronal
Differentiation during Cortical Neurogenesis
2.1 Introduction:
The embryonic neocortex contains multipotent neuronal progenitor cells (NPC) in
the ventricular zone (VZ). NPC has an ability to self-renew, proliferate, and
differentiate into astrocytes, oligodendrocytes, and neurons (Temple, 2001). Once
immature neurons are generated from NPC, they undergo radial migration out of
the VZ and form the cortical plate (CP). While migrating toward CP, the immature
neurons further undergo maturation and position themselves in an ‘‘inside-out’’
manner. The CP eventually establishes six distinct neocortical layers (Olson and
Walsh, 2002; Kriegstein et al., 2006). Proliferation and differentiation of NPCs are
regulated by intrinsic factors and extrinsic cell signaling, such as Wnt signaling.
There are at least 19 different Wnt genes in vertebrates. Wnt signaling plays
essential roles in neurogenesis; however, detailed molecular mechanisms are not
well characterized (Roelink et al., 1990; Parr et al., 1993; Grove et al., 1998;
Hirabayashi et al., 2004; Israsena et al., 2004). Wnt genes encode cysteine-rich
secreted glycoproteins that activate intracellular signaling, and they are known to
induce at least three different pathways; the β-catenin/TCF pathway (the canonical
pathway), the planar cell polarity pathway, and the Wnt/Ca
2+
pathway. Signaling
through the canonical β-catenin/TCF pathway is mediated by one of 9 different
Frizzled (Fz) receptors and low-density lipoprotein receptor-related protein (Lrp)

10

families (He et al., 2004; Kuhl et al., 2000). Ryk is an atypical member of the
receptor tyrosine kinase (RTK) family (Halford and Stacker, 2001). Studies have
shown important roles of Ryk as a co-receptor for Wnt ligands (Yoshikawa et al.,
2003). For example, Ryk is required for the neurite outgrowth of dorsal root
ganglion neurons induced by Wnt3a (Lu et al., 2004), for the inhibition of extension
of cortical axons by Wnt5a (Keeble et al., 2006), and for repulsive axon guidance
by Wnt3 (Schmitt et al., 2006). The RTK family consists of 59 cell-surface
receptors with similar structure and functional characteristics: a ligand-binding
extracellular domain, a transmembrane domain, and an intracellular domain (ICD)
possessing tyrosine kinase activity. Their signaling, upon ligand binding, is
mediated by specific kinase-dependent cascades (Schlessinger, 2000). The
structure of Ryk, with a glycosylated extracellular domain and an intracellular
kinase domain, is consistent with other members of the RTK family. Unlike other
RTK members, the Ryk intracellular kinase domain is mutated and has no known
tyrosine kinase activity (Katso et al., 1999; Hovens et al., 1992).
The molecular mechanism(s) of of how Ryk transduces signals from the cell
surface to the nucleus in response to Wnt ligand binding, remains elusive. In this
study, we report a) an unexpected mechanism of Ryk-mediated Wnt signaling, and
b) the role of Ryk in mediating the neuronal differentiation, both in vitro and in vivo.

11

2.2 Material and Methods:
Neural Progenitor Cell Culture
Neocortices were dissected from embryonic day 11.5 (E11.5) brain of Ryk
+/+
and
Ryk
-/-
mice in Hank’s balanced salt solution (HBSS) (Cellgro). Embryos of Ryk
-/-

mice were generated as described previously (Halford et al., 2000) and were kindly
provided by Dr. Steven A. Stacker (Ludwig Institute of Royal Melbourne Hospital).
Neocortices were mechanically dissociated into single cells by using a flame-
polished Pasteur pipette. Dissociated cells (1X10
6
cells/dish) were seeded onto
polyornithine- (15 mg/ml; Sigma) and fibronectin- (2 mg/ml; Life Technologies)
coated 10 cm dishes in DMEM/F12 medium containing B27 supplement (GIBCO-
BRL) and were cultured in the presence of fibroblast growth factor 2 (FGF2, 20
ng/ml) to expand the neural progenitor cell (NPC) population (proliferation
condition; “UD”). To induce the differentiation of NPCs, cells were seeded and
further cultured in the absence of FGF2 (differentiation condition; “D”). Expression
of Wnt3, wild-type Ryk, or Ryk mutants in NPCs was transduced by lentiviral
infection. For western blot and qPCR, 1.5X10
6
cells were seeded onto coated 10
cm dishes and further cultured under undifferentiation or differentiation conditions.
For immunostaining, cells were plated onto polyornithine- and fibronectin-coated
coverslips (5X10
4
cells/well in 24-well dishes).

12

Immunoprecipitation, Western Blotting, and Immunostaining
For immunoprecipitation, 500 μg of protein samples were incubated with a specific
antibody for 2 hours at 4
o
C followed by incubation overnight with Protein A/G
agarose beads (Pierce). The beads were centrifuged and washed extensively. The
immune complexes were eluted from beads by SDS sample buffer. Each protein
sample was run on 10% SDS-PAGE, and transferred onto PVDF membranes.
After blocking, the blots were incubated with a primary antibody as indicated and
subsequently with a peroxidase-conjugated secondary antibody. The bound
secondary antibody was then detected by enhanced chemiluminescence (ECL)
reagent (Santa Cruz Biotechnology). To detect the full-length form of Ryk in this
study, lysates were subjected to immunoprecipitation, followed by western blot.
For immunostaining, cells grown on coverslips were fixed with 4%
paraformaldehyde for 15 min and permeabilized with 0.2% Triton X-100. Fixed
cells were incubated with blocking solution containing 2% BSA for 1 hr, and were
incubated with antibodies overnight at 4° C. After washing with PBS, cells were
incubated with secondary antibodies at room temperature for 1 hr, and were
counterstained with Hoechst dye. Images were obtained by using a fluorescence
microscope with an AxioCam camera (Zeiss) or confocal microscope (LSM5
PASCAL, Zeiss). The percentage of antibody labeled cells was evaluated by
quantifying a minimum of 1000 cells in 10 randomly chosen microscopic fields, and
the values were obtained from at least 3 independent experiments.

13

Quantitative Analysis of Nuclear Ryk
To determine the nuclear localization of Ryk in differentiated and undifferentiated
neuronal cells in vitro and in vivo, mouse brain sections or cultured neuronal cells
were immunolabeled with anti-Ryk and anti-TUJ1 for detection of differentiating
neurons or anti-Nestin for detection of undifferentiated neural progenitors. Hoechst
33258 was used for nuclear staining. Fluorescent images were obtained with a
fluorescent microscope and an AxioCam camera (Zeiss). Within each nuclear area,
fluorescent intensity of the secondary antibody for anti-Ryk antibody was measured
by using Axio Imager software. A minimum of 100 cells randomly chosen from
TUJ1-positive cells at the CP and Nestinpositive cells at the VZ, or from
differentiated cells (TUJ1-positive cells) cultured in vitro, were examined. The
values obtained from at least three samples were averaged and expressed as
means ± SD.
Generation of Ryk Antibody
To detect the Ryk C-terminal fragment (CTF), peptides corresponding to residues
314–562 of mouse Ryk in the form of a GST fusion were inoculated in rabbits and
the collected antisera were affinity purified using GST-isolation kit (Pierce). The
specificity to the C- terminus was confirmed by western blot analysis with lysates
from wild-type and Ryk knockout E14 and E18 mouse brain, NPCs, embryonic
stem cells, and HEK293T cells transfected with Ryk plasmids (Fig. 2-5).

14

Antibodies
The monoclonal anti-GFAP and anti-MAP2 (a+b) antibodies were purchased from
Sigma-Aldrich, and monoclonal anti-O4 and anti-Nestin antibodies were purchased
from Chemicon/Millipore. The monoclonal anti-Myc (9E10), HA (F-7) and anti-beta-
actin antibodies were from Santa Cruz Biotechnology. The monoclonal anti-E-
cadherin, N-cadherin, and GFP antibodies were from BD Biosciences. The
secondary antibodies were from Jackson ImmunoResearch and Alexa Fluor 350,
and Hoechst 33258 were from Molecular Probes.
Plasmid Construction
Myc-tagged or GFP-tagged Ryk cDNA was subcloned into pCDNA3.1 vector by
the polymerase chain reaction (PCR). The Ryk RC mutant was generated by
swapping the Ryk transmembrane domain (amino acids 212 to 239) with that of
EGFR (amino acids 601 to 623). Other Ryk mutants, including Ryk ICD (amino
acids 239 to 594), Ryk extracellular domain (amino acids 44 to 206) deletion
mutant, Ryk intracellular domain (amino acids 239 to 594) deletion mutant, and
Ryk juxtamembrane region (amino acids 242 to 283) deletion were generated as
described (Lu et al., 2004). Plasmid encoding Ryk NLS-ICD was generated by
fusing an SV40 nuclear localization signal (NLS) peptide (SPKKKRKVEAS) to ICD
at the N-terminus. All constructs were confirmed by DNA sequencing.

15

Cellular Fractionation
For whole-cell extracts, cells were lysed in kinase lysis buffer containing 25 mM
Tris-HCl, pH 7.4, 150 mM NaCl, 5 mM EDTA, 1% Triton X-100, 10 mM sodium
pyrophosphate, 10 mM β-glycerophosphate, 1 mM sodium orthovanadate, 10%
glycerol, and protease inhibitors (Roche). For subcellular fractionation, cells were
suspended in hypotonic buffer (50m M HEPES, pH 7.5, 10 mM KCl, 1.5 mM MgCl
2
,
1 mM EDTA, 1 mM Na
3
VO
4
, 50 mM NaF, 1 mM PMSF, protease inhibitors mixture),
incubated on ice for 30 min, and sheared by being passed 25 times through a 26-
gauge needle. The nuclei were obtained by centrifugation at 800 × g for 5 min, and
the supernatants were recentrifuged at 100,000 × g for 30 min to obtain the
membrane fraction (pellet) and the cytosolic fraction (supernatant). The nuclei and
membrane pellets were washed in hypotonic buffer, resuspended in hypotonic
buffer containing 1% Triton X-100 and 150 mM NaCl for 30 min on ice, and the
insoluble fractions were discarded after centrifugation at 16,000 × g for 20 min.
RT-PCR and Q-PCR Analysis
Total RNA was isolated from NPCs or mouse cortices using an RNeasy kit
(Qiagen) Two micrograms of total RNA was reverse transcribed using the
Superscript III kit (Life Technologies) and random hexamers. The following
individual primer sets were used for PCR amplification: for Tbr-1, 5’-
TAGGAGACCTGGGCAATCC-3’ and 5’- CTGAGAAGTGAGAAAGCCACC-3’; for
βIII-tubulin, 5’-GAGGACAGAGCCAAGTGGAC-3’ and 5’-

16

CAGGGCCAAGACAAGCAG-3’; for Pax6, 5’-CTGTACCAACGATAACATACC-3’
and 5’- CCCTTCGATTAGAAAACC-3’; for Nestin, 5’-
AGTCAGAGCAAGTGAATGG-3’ and 5’-AGAAACAAGATCTCAGCAGG-3’. Q-
PCR was carried out using SYBR Green I fluorescence (BD Biosciences).
Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) transcript levels were used
to normalize the samples. Each experiment was performed at least three times.
PCR amplification was performed using the following individual primers sets: for
Wnt-3, 5’-CTTCTGCCGCAATTACATCGA -3’ and 5’-
AAGTTGGGGGAGTTCTCGTAG -3’; for Ryk, 5’-TGATTCTAATGCAGCTCA-3’
and 5’-ATCTTTCAGTGTGATCCT-3’; for GAPDH, 5’-
ACGGCAAATTCAACGGCACAG-3’ and 5’-GGTCATGAGCCCTTCCACAAT-3’.
Cell Culture and Transfection
293T and Cos-7 cells were cultured in Dulbecco’s Modified Eagles Medium
(DMEM) supplemented with 10% fetal bovine serum. Transfection of 293T cells
were achieved by the calcium phosphate precipitation method. Cos-7 cells were
transfected using Lipofectamine (Life Technologies). Forty-eight hours after
transfection, cells were analyzed for the indicated assays.

17

2.3 Results:
Ryk is expressed in the cortical plate and ventricular zone during
neurogenesis and the number of TUJ1-positive cells is reduced in Ryk
-/-
mice.
We analyzed forebrain coronal sections from Ryk
+/+
and Ryk
-/-
embryonic day 14.5
(E14.5) mouse embryos to investigate Ryk’s function in vivo. Immunostaining of
the immature neuronal marker TUJ1 (beta-III-tubulin) (Alexander et al., 1991)
showed that the number of TUJ1-positive cells in the CP, which are the newly
generated neurons derived from NPCs in the VZ (McConnell et al., 1989;
Kriegstein et al., 2006), is reduced in Ryk
-/-
forebrain compared to that of wild-type
(Fig 2-1A). Reduction in the number of neurons can be caused by a defect in NPC
proliferation (Heins et al., 2002) or neuronal apoptotic cell death (Oppenheim,
1991). However, no significant difference in the number of proliferative NPCs (as
determined by the BrdU incorporation assay) or apoptotic neurons (as determined
by TUNEL staining) was observed between Ryk
+/+
and Ryk
-/-
mice (data not
shown). In addition, RT-PCR analysis demonstrated that expression of the NPC
markers Pax6 and Nestin is not changed in Ryk
-/-
forebrain, whereas expression of
the neuronal markers βIII-tubulin and Tbr1 is reduced in the cortex of Ryk
-/-

forebrain compared to that of wild-type forebrain (Fig 2-2).
To investigate the expression pattern of Ryk protein, coronal sections of wild-type
forebrains were immunostained using an anti-Ryk antibody that recognizes the C
terminus of Ryk. In E14.5 brains, Ryk protein was detected at the CP and at the VZ

18

(Fig2-1B; Fig2-3A). The immature neuronal marker TUJ1 was strongly expressed
in the CP, but not detected in the VZ, whereas the NPC marker Nestin was
restricted within the VZ (Fig2-1B). Expression of Ryk protein is consistent with Ryk
gene expression, which we demonstrated by β-gal immunostaining in Ryk
-/+
brain
in which the Ryk gene is replaced with the LacZ gene (Fig2-3B). Interestingly,
higher magnification of the CP and the VZ (Fig2-1B) showed that some Ryk protein
is localized in the nucleus of TUJ1-positive cells, whereas in Nestin-positive cells
Ryk it is mainly localized in the plasma membrane. Quantification of cells exhibiting
a nuclear Ryk signal revealed that nuclear Ryk was more frequently present in
TUJ1-positive cells than in Nestin-positive cells (Fig2-1C). These studies showed
that there is a link between the nuclear localization of Ryk and neuronal
differentiation.
Development of the cerebral cortex is initiated by progenitor cells in the E11.5
mouse neocortex (Lopez-Bendito and Molnar, 2003). We found that Ryk protein is
expressed in the cortex of the E11.5 mouse forebrain (unpublished data). To
examine if the nuclear Ryk protein level is regulated through neuronal development
and whether the nuclear Ryk protein is a cleavage product, we performed western
blot on the cell lysates of neocortices of E11.5, E14.5, and E18.5 mouse embryos.
A C-terminal fragment (CTF) of Ryk of ~42 kDa was detected in the E14.5 mouse
cortex (Fig2-1D). Moreover, the abundance of this fragment increased with
development of the cortex, whereas full-length Ryk decreased. To examine the
cleaved CTF at the cellular level, we generated a Ryk construct whose C-terminal

19

end is tagged with a myc epitope, and we transiently transfected HEK293T cells
with the construct. Western blot analysis of whole-cell lysate using an anti-myc
antibody revealed not only full-length Ryk, but also a smaller, cleaved Ryk
fragment of ~42 kDa (Fig2-1E, lane 1). Subsequent western blot analysis of
subcellular fractions showed that the full-length Ryk band was localized in the
membrane fraction and that the CTF band was localized exclusively in the
cytoplasmic fraction (Fig2-1E, lanes 2 and 3). Therefore, we refer to the latter as
the Ryk ICD fragment (Fig2-1E). Ryk expression in NPC cultures was detected
mostly in neurons as well as oligodendrocytes (Fig2-4).

A

20

Figure 2-1: Ryk Protein Is Cleaved and Localized in the Nucleus In Vivo
(A) The number of TUJ1-positive cells is reduced in Ryk
-/-
mice. Representative
immunostaining of TUJ1 (red) in coronal sections from forebrain of E14.5 Ryk
+/+

and Ryk
-/-
mouse embryos, counterstained with Hoechst 33258. TUJ1 expression
was reduced in the cortical plate (CP) of Ryk
-/-
compared with that of Ryk
+/+
mouse
cortex. Scale bars are 50 μm (left) and 10 μm (right).

21

(B) Expression and localization of Ryk in the E14.5 Ryk
+/+
mouse forebrain cortex.
Ryk proteins are expressed in both the CP and the ventricular zone (VZ). Ryk is
detectable specifically in the nuclei of TUJ1 (green)-positive cells at the region of
the CP, and at the membrane of Nestin (green) positive cells of the VZ. The
nuclear signal is revealed by Hoechst staining. The arrowhead and arrow indicate
the fluorescent signal for Ryk in the nuclear and membrane, respectively. Scale
bars are 50 μm (left) and 10 μm (right).
(C) Quantitative analysis of nuclear-localized Ryk in TUJ1-positive cells at the CP
and in Nestinpositive cells at the VZ. Error bars represent the mean ± SD of
triplicate determinations. P<0.05.
(D) Western blot analysis of Ryk expression in the Ryk+/+ mouse forebrain cortex
at the indicated developmental stages. Ryk antibody recognizes the C terminus of
the protein. GSK3b expression was used as a loading control.
(E) Detection of the Ryk cleavage product in the cytosolic fraction. cDNA encoding
wild-type Ryk with a myc tag at the C terminus was transfected into HEK293T cells.
The whole-cell lysate, membrane, and cytosolic extracts were subjected to
immunoprecipitation, followed by western blot with an anti-myc antibody. Actin and
E-cadherin immunostaining confirmed the purity of the cytosolic and membrane
fractions, respectively. The asterisk denotes the heavy chain of the antibody.

22

Figure 2-2 Deficiency of Ryk leads to the defect of neuronal differentiation in the
CP: RT-PCR analysis of Ryk
+/+
and Ryk
-/-
forebrain cortex reveals the reduced
mRNA level of Tbr1 and βIII-tubulin in Ryk-/- when compared with that of Ryk
+/+
. In
contrast, neural progenitor markers, Pax6 (Estivill-Torrus et al., 2002) and Nestin,
are not significantly different. Tbr1 is known to be specifically expressed in the CP
of forebrain cortex during brain development (Bulfone et al., 1995; Kolk et al.,
2005).

23

A
B

Figure 2-3: Immunostaining Analysis of the Coronal Sections and the Gene
Expression Analysis of E14.5 Ryk
+/+
and Ryk
-/-
Mouse Forebrains
A) Immunostaining for Ryk and Nestin showed that Ryk protein is expressed in the
CP and VZ. VZ is revealed by the expression of neural progenitor marker Nestin.
Nuclei are visualized by Hoechst staining.

24

B) Immunostaining analysis of β-galactosidase, whose expression represents Ryk
promoter activity, in a Ryk
+/-
mouse (Halford et al., 2000). β-galactosidase gene is
strongly expressed in the CP and VZ. The expression pattern is consistent with the
localization of Ryk proteins.

Figure 2-4: Ryk Is Specifically Expressed in Neurons and Oligodendrocytes.
Cells differentiated from NPCs were immunolabeled with antibodies against the
astrocyte marker GFAP, the neuron marker TUJ1, and the oligodendrocyte marker
O4. The number of Ryk-positive cells in each of the GFAP-, TUJ1-, or O4-positive
populations was quantified. Each error bar represents the mean±S.D. of three
independent experiments. Scale bars, 40 μm. p<0.05.

25

Figure 2-5: Western Blot Analysis Using Polyclonal anti-Ryk antibody
The cell extracts were isolated from E18.5 Ryk
+/+
(lane 1) and Ryk
-/-
(lane 2) whole
forebrain, differentiated Ryk
+/+
(lane 3) and Ryk
-/-
(lane 4) NPCs, embryonic stem
cells (ESCs; lane 5), neural progenitors derived from ESCs (lane 6), and 293T cells
transiently transfected with wild-type Ryk-myc (lane 7). Cell lysates were subjected
to Western blotting using anti-Ryk antibody. The blots show the specific reactivity
to the C-terminus of Ryk protein. Asterisk (lane 4) denotes a non-specific band due
to overexposure.

Cleavage of Ryk Is essential for Neuronal Differentiation of NPCs
To further investigate the role of cleavage of Ryk in neuronal differentiation, we
employed an in vitro culture system using NPCs, which have the ability to
differentiate into astrocytes, oligodendrocytes, or neurons (Sauvageot and Stiles,
2002; Bani-Yaghoub et al., 2006). When Ryk
+/+
and Ryk
-/-
NPCs were isolated from
the neocortex of E11.5 mouse forebrain and cultured under differentiation
conditions, the numbers of TUJ1-positive cells and MAP2-positive cells were
significantly reduced in cultures from Ryk
-/-
neocortex compared to cultures from
Ryk
+/+
neocortex, confirming that the Ryk gene is required for neuronal
differentiation (Fig2-6A). The amount of Ryk cleavage product increased with
neuronal development. Therefore, we sought to test if Ryk cleavage is also
regulated during neuronal differentiation in vitro. When NPCs were cultured under

26

differentiation conditions without basic fibroblast growth factor (FGF), Ryk ICD was
detected; however, no Ryk ICD was detected in cultures under proliferation
conditions in the presence of basic FGF (Fig2-6B). Furthermore, we detected Ryk
expression in the nucleus and cytoplasm of TUJ1-positive neurons by
immunostaining with fluorescence microscopy (Fig2-6C); western blot analysis of
subcellular extracts from differentiating NPCs further confirmed that Ryk is cleaved
and that Ryk ICD is localized in the nucleus in differentiating NPCs (Fig2-6C, right).
These data showed that cleavage of Ryk occurred during neuronal differentiation.
The size of Ryk ICD suggests that Ryk is cleaved in its transmembrane or
juxtamembrane region.

To map the potential Ryk cleavage site, we generated two constructs: Ryk RC, a
chimeric construct in which the transmembrane region of Ryk was replaced with
that of the EGF receptor; and another deletion mutant of Ryk (Ryk DS/T), in which
the juxtamembrane region including the serine/threonine-rich domain was deleted.
Ryk ICD was used as a control to show the cleaved ICD size. Both wild-type Ryk
and Ryk DS/T were cleaved when expressed in HEK293T cells. However, no
cleavage product was detected in cells expressing Ryk RC (Fig2-6D). These data
showed that the cleavage site of Ryk lies within the transmembrane region.
Moreover, western blot analysis of subcellular extracts confirmed that Ryk RC is
resistant to cleavage. In cells transfected with the Ryk RC construct, Ryk RC was
not cleaved, and was localized only in the plasma membrane (Fig2-6D). In cells

27

transfected with a DNA construct encoding wild-type Ryk, the full-length Ryk
protein localized only in the membrane, and the cleaved C terminus was localized
in the cytoplasm (Fig2-6D). However, in cells with the transfected Ryk ICD
construct, Ryk ICD was localized in both the nucleus and cytoplasm (Fig2-6D). We
further confirmed these findings by immunocytochemistry of Cos-7 cells
transfected with different Ryk constructs. The Ryk RC mutant localized to the
membrane, whereas Ryk ICD primarily localized in the nucleus (Fig2-6E). Taken
together, these data revealed a novel mode of Ryk-mediated signaling involving
first the cleavage of Ryk from transmembrane domain and then release of the ICD
fragment of Ryk to the cytoplasm followed by translocation into the nucleus.

To examine if cleavage of Ryk is important for its function in neuronal
differentiation, we introduced genes encoding wild-type Ryk, Ryk RC, Ryk ICD, or
nuclear localization signal-fused Ryk ICD (Ryk NLS-ICD) into Ryk
-/-
NPCs by using
a lentivirus vector. Our studies showed that expression of wild-type Ryk in Ryk
-/-

NPCs rescued the mutant phenotype, as the percentage of differentiating neurons
was significantly increased from 2.1% ± 0.74% to 16.8% ± 1.24% for TUJ1-positive
cells per total cells, and from 4.1% ± 1.4% to 15.5% ± 2.25% for MAP2-positive
cells per total cells compared to control Ryk
-/-
NPCs (Fig2-6F). The number of
differentiated neurons in these cultures was comparable to that of Ryk
+/+
NPCs
(10.06% ± 2.21% and 6.96% ± 1.5% for TUJ1- and MAP2-positive cell per total
cells, respectively). Ryk ICD in Ryk
-/-
NPCs also promoted neuronal differentiation

28

(9.23% ± 1.30% and 8.53% ± 1.58% for TUJ1- and MAP2- positive cells per total
cells, respectively), although it did not rescue the phenotype as completely as wild-
type Ryk. Furthermore, Ryk NLS-ICD in Ryk
-/-
NPCs further increased neuronal
differentiation (21.79% ± 1.89% and 17.36% ± 2.13% for TUJ1- and MAP2-positive
cells per total cells, respectively), when compared to wild-type Ryk expression. By
contrast, the Ryk RC failed to rescue the defect in neuronal differentiation in Ryk
-/-

cells. Taken together, results from these experiments demonstrated that the
cleavage of Ryk and the nuclear localization of cleaved ICD were necessary for its
function in neuronal differentiation.

29

Figure 2-6: Cleavage of Ryk Is Required for Neuronal Differentiation
(A) NPCs derived from Ryk
+/+
or Ryk
-/-
mouse cortex were cultured under
differentiating conditions, and then subjected to immunostaining for neuronal
markers. There are fewer TUJ1- and MAP2-positive cells in Ryk
-/-
mice. Scale bars
are 20 μm.

30

(B) Cleavage of Ryk protein in NPCs cultured under undifferentiated (UD) or
differentiation (D) conditions. Ryk ICD protein levels increase under D conditions.
(C) Localization of Ryk protein in the nucleus of TUJ1-positive cells differentiated
from NPCs is demonstrated by immunocytochemistry (left panels) and by western
blot of subcellular fractions of NPCs cultured under D conditions (right panels).
Lamin A/C, actin, and N-cadherin confirmed the purity of the nuclear, cytosolic, and
membrane fractions, respectively. The scale bar is 10 μm.
(D) Western blot analysis of subcellular extracts of HEK293T cells demonstrates
the presence of Ryk RC only in the membrane fraction, and Ryk ICD in both the
cytoplasm and the nucleus. Cells transfected with different Ryk constructs were
fractionated and the subcellular extracts were subjected to western blot analysis to
determine the expression of Ryk, lamin A/C, actin, and E-cadherin. Lamin A/C,
actin, and E-cadherin confirmed the purity of the nuclear, cytosolic, and membrane
fractions, respectively.
(E) Expression of Ryk and its mutants in Cos-7 cells was determined by
immunostaining with an anti-myc antibody. Nuclei were visualized by Hoechst
staining. Ryk ICD is primarily localized in the nucleus, whereas wild-type Ryk and
Ryk RC are localized in the membrane. The scale bar is 20 μm.
(F) Wild-type Ryk, ICD, and Ryk NLSICD can rescue the defects in Ryk
-/-
cells,
whereas Ryk RC cannot. Ryk
-/-
NPCs were transduced with lentivirus expressing

31

wild-type Ryk, Ryk RC, Ryk ICD, or Ryk NLS-ICD. The cells were cultured under D
conditions prior to immunostaining for TUJ1 or MAP2. The percentage of
differentiating cells was evaluated by quantifying the number of TUJ1- or MAP2-
positive cells per total cells. Hoechst dye was used for counterstaining. Each error
bar represents the mean ± SD of four independent experiments; each assay was
performed in duplicate. The scale bar is 20 μm. p<0.05.
The expression of Ryk mRNA remains constant during development while the
expression of Wnt3 mRNA increases in the developing cortex (Fig2-7A) (Roelink et
al., 1990) and in NPCs cultured under differentiation conditions (Fig2-7B), it
remains to be determined how Wnt3 plays a role in Ryk-mediated signaling. Since
expression of Wnt3 correlates with the cleavage of Ryk, we hypothesized that
Wnt3 is a key factor in cleaved- Ryk mediated signaling during neuronal
differentiation of NPCs.

32

Figure 2-7: Expression of cleaved-Ryk protein correlates with Wnt3 mRNA
expression in the developing cortex, and during neuronal differentiation.
(A and B) Expression of the Wnt3 and Ryk genes was determined by qPCR
analysis of total RNA isolated from (A) forebrain cortices of the indicated stages
and from (B) NPCs cultured under UD or D conditions. Expression of GAPDH was
used as an internal control. Wnt3 expression correlated with cleavage of Ryk
protein in the developing cortex and during neuronal differentiation from NPCs.
Each error bar represents the mean ± SD of four independent experiments.
P<0.05.

33

2-4 Discussion:
Our study demonstrated for the first time that Ryk was involved in neuronal
differentiation during neurogenesis. My colleague, Dr. Jungmook Lyu, found that
Ryk protein is cleaved by γ-Secretase, and this cleavage is critical for its role in
neuronal differentiation of cortical NPCs. He provided further evidence that Wnt3
stimulated the nuclear localization of Ryk ICD. Our data demonstrated that nuclear
signaling of Ryk plays a critical role in regulating the neuronal differentiation of
NPCs. In our unpublished microarray analysis, expression of Ryk ICD fused to a
nuclear localization signal (NLS) was found to regulate expression of some of the
same downstream target genes as observed with wild-type Ryk, when compared
with Ryk
-/-
cells (unpublished data). The study was later published in as Lyu J,
Yamamoto V, and Lu W. 2008, Development Cell, Nov.15 (5)773-80. PMID:
19000841)
2.5 Future Directions:
Future research should focus on identifying the target genes of the Ryk-mediated
Wnt3 signaling cascade that regulates the expression of key genes in cortical
neurogenesis. Although technically challenging, it may be meaningful to validate
the role of Ryk-ICD through in vivo electroporation. Also, we have identified earlier
that Ryk has several binding partners and finding the functional roles of these Ryk
binding proteins may reveal additional mechanisms of the Ryk-mediated
neurogenesis.

34

Role of Ryk-ICD in in neurogenesis in developing mouse embryo:
2.6 Introduction: The role of Ryk in neuronal proliferation and differentiation has
been demonstrated in vitro utilizing cultured cells. However, the brain has a
complex shape and structures, thus how one gene regulates the developing brain
cannot be fully determined in cell culture systems where cells are artificially grown
as a single layer in a petri dish. Furthermore, transgenic mice with a gene of
interest knocked-out or knocked-in is a powerful method to study a gene’s function;
however, generation of transgenic mice is time-consuming and expensive.
Another pitfall is that ~ 15 percent of gene knockouts are developmentally lethal
(http://www.genome.gov/12514551). Thus newer strategies are needed to validate
the role of a particular gene in cellular function in vivo.
In utero elecroporation is a useful technique to ectopically express genes of
interest or the corresponding shRNA in the living mouse brain. In utero
electroporation could provide a convenient and quick functional assay for studying
the roles of a gene in the cerebral cortex development. The technique combines
ventricular DNA injection and targeted electroporation to efficiently deliver DNA into
the developing cerebral cortex (Fig. 2-8). A weak electronic current will temporarily
disrupt the membrane of the brain cells that will allow a gene to pass into the cells
without harming the mouse brain or embryo. The embryos are allowed to develop
normally, within their natural physiological condition, after the gene electroporation
until collection and assay of the samples (Saito and Nakatsuji, 2001; Tabata and

Nakajima, 2001). Here, in order to fully understand the mechanism and functions
of Ryk in neuronal development,
performed.
Figure 2-8: Schematic presentation of in vivo electroporation.

2.7 Material and Methods:
Plasmids
The lentiviral vector FUWIG and FUWIG with Ryk ICD
594) were used in this study. Plasmids were prepared by using the QIAfilter
Plasmid Maxi Kit (Qiagen, Hilden, Germany). The plasmids
adjusted to have a concentration of 3 to 4ug/

Nakajima, 2001). Here, in order to fully understand the mechanism and functions
of Ryk in neuronal development,the in-vivo electroporation approach was
chematic presentation of in vivo electroporation.
2.7 Material and Methods:
The lentiviral vector FUWIG and FUWIG with Ryk ICD-NLS (amino acids 239 to
594) were used in this study. Plasmids were prepared by using the QIAfilter
Plasmid Maxi Kit (Qiagen, Hilden, Germany). The plasmids solutions were
adjusted to have a concentration of 3 to 4ug/μl and contained 0.025% Trypan Blue.
35
Nakajima, 2001). Here, in order to fully understand the mechanism and functions
was

(amino acids 239 to
594) were used in this study. Plasmids were prepared by using the QIAfilter
were
0.025% Trypan Blue.

36

Inutero electroporation
For DNA microinjection, 75-mm glass capillary tubes (Drummond Scientific,
Broomall, PA) were pulled by using a micropipette puller P-97 (Sutter Instrument,
Novato, CA). In utero electroporation was performed as described previously
(Saito T and Nakatsuji N, Dev Biol. 2001; 240(1):237-46 and Saito T, Nature Prot,
2006, 1(3):1552-8). Briefly, time mated E13.5 pregnant mice (strain: C57/B6) were
anesthetized with an intra-peritoneal injection of Avertin (240 mg/kg, administered
once) or Nembutal (50-75 mg/kg, administered once). An eye ointment was
applied to both eyes to prevent dehydration. After cleaning the abdomen with 70%
ethanol and Betadine, a 2 to 3-cm midline laparatomy was performed, and the
uterus was removed. Two to four micrograms of plasmid DNA with Ryk-ICD-GFP
or with GFP alone as control were injected into the lateral ventricle using a
microinjector. Five electric pulses at 40V for E13.5 were delivered in the brain
using an electroporator CUY21SC/CUY650P5 (Nepagene, Chiba, Japan). Each
pulse duration was 50 msec. The electroporated embryos in the uterus were
returned to the mother and repositioned in the abdominal cavity. The abdominal
cavity was filled with warm saline. The abdominal wall and the skin were sutured
shut with C17 reverse cutting, 3/8 circle 12 mm needle and size 6-0 monofilament
Nylon sterile suture; Ethicon, Somerville, NJ). Betadine was applied to the surgical
wound. The mice were given analgesia (Buprenex, 0.1 mg/kg, twice, every 12
hours) for post-operative pain. The overall embryo survival rate was about 80%.
The mice were returned to the vivarium and monitored once or twice per day for

37

post-surgical complications. The embryos were collected 24 to 48 hours after the
electroporation. All animal procedures conformed to United States Department of
Agriculture regulations and were approved by the IACUC of USC.
Processing and microscopic observation of brain tissue samples.
Electroporated embryo brains were harvested at E14.5 or E15.5 and fixed in 4%
paraformaldehyde (PFA) overnight at 4
o
C. Following fixation, the samples were
immersed in 30% sucrose overnight at 4C for cryoprotection. The brains were
embedded in Tissue-Tek OCT compound (Sakura Finetek USA, Torrance, CA) and
frozen on dry ice. The brain samples were cryosectioned into 40 μm slices and
mounted on glass slides. Fluorescent images were taken using a LSM 510
confocal microscope (Carl Zeiss, Heidelberg, Germany). The GFP-signal
expressed from the electroporated DNA construct was readily visible. For co-
staining with primary antibodies, the brain sections were permeabilized with 0.2%
Triton X-100 (Sigma-Aldrich, St. Louis, MO), blocked with 10% normal goat serum
in PBS containing 0.1% triton X-100. The sections were then stained with anti-Tuj1
(Millipore, Billerica, MA) or anti-Tbr1 (Abcam, Cambridge, MA) primary antibodies
and Cy3 anti-(species) secondary antibody (Jackson ImmunoResearch, West
Grove, PA).

38

2.8 Results:
Persistent expression of Ryk in the ventricular zone promoted neuronal
differentiation.
Ryk-ICD-NLS transfected cells radially migrated farther than GFP control, and was
more localized in the CP region compared to GFP-control (figure 2-9A).
Quantitative analysis showed that 23 +/- 5 % of Ryk-ICD-NLS positive cells
showed CP localization while only 5 +/- 3% of the control-GFP positive cells
exhibited such localization. These cells are most likely differentiating cell into
neurons, as cells undergoing neuronal differentiation begin to migrate out into CP
(Fig 2-9 A and B).
In order to confirm that the Ryk-ICD-NLS positive cells were differentiating neurons,
we stained the brain sections with anti-Tbr1. Tbr1 is a transcription factor involved
in neuronal differentiation, and can be used as a post-mitotic neuronal marker
(Hevner RF et al., 2001; Bedogni F et al., 2010). Immunostaining withTbr1
confirmed that Ryk-ICD-NLS (GFP) positive cell in the cortex are also Tbr1 positive
(red), confirming that they are neurons (Figure 2-9C).

*
39

40

Figure 2-9: Forced expression of Ryk-ICD-NLS promoted differentiation of neural
progenitors in vivo
Ryk-ICD-NLS and control vectors were electroporated (5 pulses, 50 ms at 40V)
into the lateral ventricle of E13.5 mouse embryos. The embryos were returned to
the mother’s uterus. The brains were harvested 48 hours after the electroporation,
fixed, cryosectioned, and monitored for GFP expression.
(A) CP: cortical plate; LV: lateral ventricle. Scale bars: 50 μm.
(B) Quantification of GFP-positive cells in the cortical plate. The percentage of GFP
positive cells in the cortical plate (CP) versus the total GFP-positive cells through
the entire thickness of the cortex was plotted. The results shown are the means ±
s.e.m. of three sections for each electroporated brain samples, n=3 or more from
two independent experiments. *, p <0.01.
(C) Double immunostaining for GFP and Tbr1 showed the Ryk-ICD-NLS (GFP)
positive cells expressed post-neuronal marker, Tbr1. Cells that had left the VZ
early due to the forced expression of Ryk-ICD-NLS positively stained for the
neuronal marker Tbr1. Scale bars: 50 μm.
2.9 Discussion:
Here, our study demonstrated that Ryk-ICD-NLS has an effect in inducing neuronal
differentiation. As shown in Fig 2-9A, RYK-ICD electroporated cells leave the VZ
earlier than in control brains, and more Ryk-ICG expressing cells are found in the

41

IVZ and CP, compared to the control. Immunostaining with anti-Tbr1 confirmed
that Ryk-ICD-GFP expressing cell in the cortex are Tbr1 positive, established that
they are neurons. The results from these experiments suggest a role of Ryk in
promoting neuronal differentiation in the cerebral cortex. The in vivo
electroporation results confirmed the role of Ryk in neurogenesis in vivo, and
corroborated our data obtained earlier using Ryk KO in vitro and in transgenic
mouse model.
2.10 Future Directions:
In this study, we evaluated the effect of Ryk-ICD domain with NLS in neurogenesis.
However, further studies are warranted to delineate whether the nuclear
localization signal in Ryk-ICD is required for neuronal differentiation in vivo.
Approach: To address this, Ryk-full length, Ryk-RC, Ryk-ICD (no NLS) and Ryk-
ICD-NLS will be electroporated into brains mouse embryos. Neuronal cells will be
examined for their differentiation pattern in response to the Ryk-ICD mediated
signaling effect on neuronal differentiation. It is anticipated that Ryk-ICD-NLS
signal will be effective in mediating neuronal differentiation in vivo, providing novel
insight into the mechanism of neurogenesis

42

Chapter 3: The role of Smek in Neurogenesis
3.1 Introduction:
During mammalian neocortical development, neurons, astrocytes, and
oligodendrocytes are generated from common multipotent neural progenitor cells
(NPCs) occupying the ventricular zone (VZ) (Lui et al., 2011). NPCs in the VZ
divide in a symmetric, proliferative mode to expand the cell population (Wodarz
and Huttner, 2003; Noctor et al., 2004, Gotz and Huttner, 2005). NPCs in the VZ
either divide asymmetrically to produce postmitotic neurons, which migrate radially
out of the VZ and form the cortical plate (CP) or divide asymmetrically to produce
intermediate progenitor (IP) cells, while simultaneously self-renewing. The IP cells
migrate into the sub-ventricular zone (SVZ) then divide symmetrically to produce
post-mitotic neurons (Miyata et al., 2004; Kriegstein et al., 2006, Farkas and
Huttner, 2008, Wang et al., 2011). The proper transition and timing of the NPC
fate from the “expansion phase” to the “neurogenic phase” is important in
determining the number of neurons (Miyata et al., 2010).
The fate of NPCs in the developing mammalian brain is believed to be determined
by internal cellular programs and external cues which are tightly regulated (Ross et
al., 2003; Takizawa et al., 2003; Hsieh and Gage, 2004). Studies show that some
extrinsic factors, such as Wnt and Stat3, can determine the timing of neuronal
differentiation in a stage-dependent manner (Hirabayashi and Gotoh, 2005;
Kuwahara et al., 2010). Other studies show that a zinc finger protein Zfp521 plays

43

a role in regulation of neural differentiation of embryonic stem cells in a cell-
intrinsic manner (Kamiya et al., 2011). However, relatively little is known about
cell-intrinsic mechanisms that determine the switch between the proliferative and
the neurogenic phases during mammalian neocortical development. Epigenetic
control, such as DNA methylation, protein kinases and phosphatases are some of
the emerging mechanisms regulating cell-fate through a cell-intrinsic program
(Takizawa et al., 2003; Bononi et al., 2011).
Phosphatases can be classified into two main groups; the Serine/Threonine
(Ser/Thr) protein phosphatases (STPs) and protein tyrosine phosphatases (PTPs).
STPs can be further classified into three groups; phosphoprotein phosphatases
(PPPs), metal-dependent protein phosphatases (PPM), and aspartate-based
phosphatases (Sun and Wang, 2012). PP2A, for instance, is a trimeric
holoenzyme composed of three major subunits; structural subunit A, regulatory
subunit B, and catalytic subunit C. The catalytic C subunit’s amino acid sequences
are relatively conserved among different protein phosphatases, such as PP1 and
PP4. It is known that substrate specificity of a serine/threonine PPs depends on
the regulatory subunits. The regulatory subunits are comprise four families: B
(B55), B’(B61), B”(PR72), B”’(PTP/PR53) (Wurzenberger and Gerlich, 2011;
Eichhorn et al., 2009). Thus, in order to understand molecular mechanisms in
controlling the NPC cell fate determination, identification and characterization of PP
subunits are crucial.

44

It has been reported that alpha-PKC regulates cell proliferation of neuroblasts, a
mammalian equivalent of NPC (Rolls et al., 2003); however, there have been very
few reports on the study of phosphatases and alpha-PKC phosphorylation. In
2009, several studies have shown that the cell fate of drosophila neuroblasts is
regulated by the serine/threonine protein phosphatases 2A (PP2A), which
negatively regulates alpha-PKC signaling (Chabu and Doe, 2009; Wang et al.,
2009; Ogawa et al., 2009). PP2A also antagonizes Par3 phosphorylation, which
controls apical-basal polarity in drosophila embryonic neuroblasts (Krahn et al.,
2009).
In 2009, one study reported that PP4 may be involved in cell fate determination. In
the study, Falafel (flfl), which is a homologue of Smek and a regulatory subunit of
PP4, regulates the cell fate of drosophila neuroblasts by targeting an adaptor
protein Miranda (Sousa-Nunes et al., 2009). Miranda has been identified as a
critical cell fate determinant in drosophila (Ikeshima-Kataoka, et al., 1997);
however, to date, no mammalian ortholog of Miranda has been yet identified. On
the contrary, mammals have a homologue of flfl, i.e.PP4R3α and PP4R3β (also
known as Smek1 and Smek2, respectively). In this study, we will investigate the
role of Smek1 in neurogenesis.

45

3.2: Material and Methods:
Generation of transgenic mice and genotyping:
Smek1 KO ES clones (cat#: RRF167) were obtained from International Gene Trap
Consortium (IGTC). Microinjection was done at the USC core facility. Male
chimera mice were mated with C57/Bl6 females to obtain agouti-colored mice in
which the engineered sequence was incorporated into the germ cells (germ-line
transmission). Genotyping was done using Taq Polymerase PCR kit (Invitrogen)
and approximately 50% of the mice were Smek1 KO heterozygotes. Purified
genomic DNA from mouse tail or ear was used as a template for PCR. Primers
used were: Smek1 R: TGA GGC AAT TGG AGA GGT TT; Smek1 F: TGC TTG
ACT TAC TGG GCT GA; En Intron: CTT CAC ATC CAT GCT GAG GA. The
animal study was approved by USC-IACUC, and all animal experiments were
carried out in compliance with IACUC and NIH guidelines.
Neural progenitor cell culture
Neocortices were dissected from embryonic day 11.5 (E11.5) brain of Smek
+/+
and
Smek
gt/gt
mice in Hank’s balanced salt solution (HBSS; Cellgro). Embryos of
Smek
gt/gt
mice were generated by cross-mating Smek
+/gt
males and females.
Genotyping was performed to determine the genotype of each embryo.
Neurocortices were mechanically dissociated into single cells by using a flame-
polished Pasteur pipette. Dissociated cells (1X10
6
cells/dish) were seeded onto

46

poly-ornithine (15 mg/ml; Sigma-Aldrich) and fibronectin (2 mg/ml; Life
Technologies) coated 6-cm dishes in DMEM/F12 medium containing B27
supplement (GIBCO-BRL) and 1% Penicillin-Streptomycin, and were cultured in
the presence of fibroblast growth factor 2 (FGF-2, 20 ng/ml, Life Technologies) to
expand the neural progenitor cell (NPC) population (proliferation condition; “UD”).
To induce the differentiation of NPCs, cells were seeded and further cultured in the
absence of FGF2 (differentiation condition; “D”).
Western blotting:
For western blotting, 10 μg of whole cell lysate in RIPA buffer was used. For
immunoprecipitation, 500 μg of protein samples were incubated with a specific
antibody for 2 to 4 hours at 4° C, followed by overn ight incubation with Protein A/G
agarose beads (Pierce). The beads were precipitated by centrifugation and
washed extensively. The immune complexes were eluted by SDS sample buffer.
Each protein sample was separated by 8 to 10% SDS-PAGE, and transferred onto
PVDF membranes. After blocking with 5% milk, the blots were incubated with a
primary antibody as indicated and subsequently with a peroxidase-conjugated
secondary antibody. The bound secondary antibody was then detected by
enhanced chemiluminescence (ECL) reagent (Santa Cruz Biotechnology).

47

Antibodies:
The antibodies used in the study for western blotting and immunohistochemistry
were: Smek1 (Sigma-Aldrich), LacZ (Santa Cruz Biotechnology), Tuj-1(Cortex),
Nestin (BD), Tbr1 (Abcam), Pax6 (Abcam), NeuN(Milipore), beta-tubulin (Millipore),
phospho-Histone H3 (Millipore), GFAP (Sigma Aldrich), O4 (Millipore), Ki67 (Dako),
BrdU(Sigma-Aldrich), and β-Actin-HRP (Santa Cruz Biotechnology).
Immunihistochemistry:
For immunostaining, cells grown on coverslips were fixed with 2%
paraformaldehyde at pH 7.4 for 30 min, and permeabilized with 0.2% Triton X-100.
Fixed cells were incubated with blocking solution containing 10% BSA for 1 hour
and were incubated with antibodies overnight at 4° C . After several rinses with PBS,
cells were incubated with secondary antibodies at room temperature for 1 hour and
were counterstained with Hoechst (Promega). Images were obtained by using a
fluorescence microscope with an AxioCam camera (Zeiss) or confocal microscope
(LSM5 PASCAL, Zeiss). The percentage of antibody labeled cells was evaluated
by quantifying a minimum of 1000 cells in 10 randomly chosen microscopic fields,
and the values were obtained from at least 3 independent experiments.
BrdU labeling:
Time-mated pregnant mice were injected intraperitoneally with 50 mg/kg of BrdU in
PBS (Sigma-Aldrich). Mice were sacrificed 12 hours after the BrdU administration

48

and embryos were harvested. Fetal brains were fixed in 4% paraformaldehyde
overnight in 4° C, then cryosectioned at 10 micron t hickness. Brain sections were
pretreated in 2N hydrochloride solution for 30 minutes at 37° C, followed by
neutralization in 0.1 M borate buffer at pH 8.5 for 15 minutes.
Immunohistochemistry was performed as described as above in the
immunohistochemistry section.
RT-PCR:
Total RNA was isolated using an RNeasy kit (Qiagen) from cultured NPCs or
mouse cortices. Two micrograms of total RNA was reverse transcribed using the
Superscript III kit (Life Technologies) and random hexamers. The following
individual primer sets were used for PCR amplification: for Tbr-1, 5’-
TAGGAGACCTGGGCAATCC-3’ and 5’- CTGAGAAGTGAGAAAGCCACC-3’; for
βIII-tubulin, 5’-GAGGACAGAGCCAAGTGGAC-3’ and 5’-
CAGGGCCAAGACAAGCAG-3’; for Pax6, 5’-CTGTACCAACGATAACATACC-3’
and 5’- CCCTTCGATTAGAAAACC-3’; for Nestin, 5’-
AGTCAGAGCAAGTGAATGG-3’ and 5’-AGAAACAAGATCTCAGCAGG-3’; for
GAPDH, 5’-ACGGCAAATTCAACGGCACAG-3’ and 5’-
GGTCATGAGCCCTTCCACAAT-3’.
Q-PCR was carried out using SYBR Green I fluorescence kit (BioRad).
Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) transcript levels were used
to normalize the samples. Each experiment was performed at least three times.

49

3.3: Results
Smek1 is expressed in the mouse brain during early development.
During cortical development, Smek1 expression showed distinct temporal and
spatial patterns (Fig 3-1). Smek1 is expressed in the VZ of E11.5 forebrain where
NPCs are actively proliferating; Smek1 expression was not observed in the cortical
pre-plate, where post-mitotic neurons are found. At E14.5, Smek1 expression was
restricted to proliferating NPCs, while post-mitotic neurons throughout the cortex
from the VZ to the CP expressed high levels of Smek1. Smek1 was detectable
only in the neurons from the postnatal mouse. Based on this expression pattern,
we hypothesized that Smek1 could play a role in proliferation and/or neuronal
differentiation of NPC.

50

Figure 3-1. Expression of Smek1 in the mouse forebrain. (A) The coronal sections
of E11.5, (B) E14.5, and (C) P1 (postnatal 1 month) mouse forebrains were
immunostained with anti-Smek1. Nuclei are stained with Hoechst dye. The section
of E11.5 cortex shows strong Smek1 expression in the VZ. In the E14.5 brain,

51

Smek1 is highly expressed in the CP. In P1 brain, Smek1 is highly expressed in
the DG.
(D-E) Images of coronal sections derived from forebrain cortex of E11.5 and E14.5
mouse embryos immunostained with anti-Smek1 and anti-TUJ1 (immature
neuronal marker) antibodies. Hoechst dye was used for nuclear staining. Smek1
proteins are detectable mainly in the VZ of E11.5 cortex (D) and in TUJ1-positive
cells of the CP of E14.5 cortex (E). Smek1 is observed in the TUJ1-positive cells
(insets b-e) of E14.5 cortex in which cells are radially-oriented neurons from the VZ
to the CP as well as the cells at the ventricular surface (inset a). CP: cortical plate,
Ctx: cortex, DG: dentate gyrus, GE: ganglion enhancement, PP: preplate; VZ:
ventricular zone.

Unique Smek1 subcellular localization
The subcellular localization of Smek1 protein was exclusively nuclear both in vitro
and in vivo. However, Smek1 protein expression was detected in cytoplasm during
mitosis (Figure 3-2 A to D). It is noteworthy that Smek1 is also highly localized in
the mitotic spindle of metaphase and anaphase cells (Fig 3-2D).

A
B

52

Figure 3-2: Subcellular localization of Smek1 in vitro and in vivo.
Smek1 is primarily nuclear,
during mitosis, both in vivo and in vitro. A) m
neuronal progenitor cells cultured
expression in the E14.5 intermediate zone,
progenitor cells. (C) The detailed
NPCs in the VZ of E11.5 cortex
prometaphase, metaphase, anaphase, and telophase
characteristics of microtubules labeled with anti
denote the condensed chromosomes
phase. Scale bars: 10 μm.

Subcellular localization of Smek1 in vitro and in vivo.
, although it is localized exclusively to the cytoplasm
during mitosis, both in vivo and in vitro. A) m-Cherry tagged Smek1 transduced
neuronal progenitor cells cultured from E11.5 mouse cortices. B) Smek1
expression in the E14.5 intermediate zone, due to the dividing intermediate
detailed Smek1 sub-cellular localization during mitosis of
NPCs in the VZ of E11.5 cortex, and (D) in vitro cultures. Prophase,
prometaphase, metaphase, anaphase, and telophase cells were ascertained
characteristics of microtubules labeled with anti-β-tubulin antibody. Arrows in (C)
denote the condensed chromosomes, and in (D) denote mitotic spindle
m.
53

cytoplasm
Cherry tagged Smek1 transduced
from E11.5 mouse cortices. B) Smek1
the dividing intermediate
during mitosis of
ascertained by
Arrows in (C)
and in (D) denote mitotic spindles in each

Generation of Smek1 knockout mice.
To investigate a possible role of Sme
Smek1
gt/gt
mice (schematic
ES clones were obtained from Internation
microinjection was done at the USC core facility. From chimera mice mated with
C57/Bl6 females (Fig 3-3B,
which the engineered sequence was
Genotype analysis showed
heterozygotes. Genotyping result is shown in Fig 3
by crossing Smek1
+/gt
males and females. The Smek1
(Fig 3-3E).
A)
B)
Generation of Smek1 knockout mice.
a possible role of Smek1 in neurogenesis, we generated mutant
chematic of the Smek1 locus is shown in Fig 3-3A). Smek1 KO
obtained from International Gene Trap Consortium (IGTC)
icroinjection was done at the USC core facility. From chimera mice mated with
3B, C), we obtained agouti-colored mice (Fig 3
which the engineered sequence was successfully incorporated into the germ cells
that approximately 50% of the mice were
. Genotyping result is shown in Fig 3-3E. KO mice were generated
males and females. The Smek1
gt/gt
is morphologically normal
C) D)
54
, we generated mutant
). Smek1 KO
al Gene Trap Consortium (IGTC) and
icroinjection was done at the USC core facility. From chimera mice mated with
(Fig 3-3D) in
the germ cells..
KO mice were generated
is morphologically normal

E)

F)
Figure 3-3: Generation of Smek1
genome where the En2-SA
chimeric male mouse. C) Agouti
C57/BL6 (bottom). D) Off-spring from a chimeric male and C57/BL6 female.
PCR results of Smek1 wild-
embryos of Smek wt (left) and Smek1
normal.

Generation of Smek1
gt/gt
mice. A) Schematic representation of the
SA-6-geo-SV40 cassette was inserted. B) Ago
C) Agouti-colored chimeric mouse (top) with a regular
spring from a chimeric male and C57/BL6 female.
-type, heterozygote, and knockout mice. F) E15.5
embryos of Smek wt (left) and Smek1
gt/gt
genotype. The general morphology is
P1 +P3
P1+ P2
55
A) Schematic representation of the
SV40 cassette was inserted. B) Agouti-colored
with a regular
spring from a chimeric male and C57/BL6 female. E)
) E15.5
genotype. The general morphology is

56

Verification of Smek1 knockout mice.
mRNA expression levels from embryonic brain extracts of wild-type and mutant
embryos were analyzed by semi-quantitative PCR. The results showed low levels
of Smek1 mRNA level (Fig 3-4A). Western blot analysis of brain and liver extracts
showed reduced levels of Smek1 in the brain (hypermorphic) (Fig 3-4B). LacZ (β-
galactosidase) staining was performed to examine the Smek1 promoter activity in
Smek1 transgenic mice. Figure 3-5A shows representative expression patterns in
E14.5 embryos (Fig 3-5A). At E11.5, LacZ is expressed in the inner half of the
cortex, where most cells are still actively proliferating. At E14.5, LacZ staining was
localized to the ventricular zone where neuronal progenitor cells are found, as well
as in the cortical plate where neurons are localized. In E16.5 brains, cells in the
ventricular zone/sub-ventricular zones displayed LacZ staining and in the cortical
layer, although the intensity of LacZ was higher in the upper layers. In terms of
temporal distribution, it appeared that E11.5 and E14.5 brains displayed higher
LacZ expression than in E16.5 brains (Fig 3-5B).

A)

B)
Figure 3-4: Expression of
extract and B) protein in the

Smek1 in Smek1
gt/gt
mice. A ) mRNA in the brain
the whole cell extract from brain and liver.
57

the brain

A)

B)
Figure 3-5: Immunostaining of LacZ

Immunostaining of LacZ in Smek
+/gt
brains.
58

59

A) Representative picture of LacZ immunostaining of wildtype and E14.5 Smek
heterozygote mouse brain. B) LacZ staining of E11.5, E14.5, and E16.5 Smek
heterozygote mouse brains. CP: cortical plate, VZ: ventricular zone.

Depletion of Smek1 either by shRNA in NPC or in knockout mice enhanced
histone H3 phosphorylation, an indicator of chromosome condensation and
cell-cycle progression during mitosis
When we knocked down Smek1 expression using shRNA, the first thing we noticed
was that the Smek1 knockdown NPC seemed to grow faster than the control
shRNA transduced NPC (Fig 3-6A). On the other hand, overexpression with
Smek1-mCherry somewhat slowed overall growth rate (data not shown). Intrigued
by these phenomena, we stained the NPC with phosphorylated Histone H3 (pH3).
Phosphorylation of the N-terminus of histone H3 is crucial for proper chromosome
condensation and cell-cycle progression during mitosis (Nowak S and Corces V,
2004). PH3 positive NPCs were significantly increased in Smek1 knockdown cells
(Fig 3-6B-D). Smek1 overexpresion as expected, attenuated PH3 levels and cells
in active cycle, the latter demonstrated by Ki67 staining (Fig 3-6E).

These results were further validated in Smek
gt/gt
mice, which showed increased
expression of PH3 (Fig 3-7). In addition, Pax6 expression level was moderately
increased in the brains of Smek
gt/gt
mice compared to wild-type littermates (Fig 3-

7A). Studies have shown that f
stem/progenitor cells, and
context-dependent manner(Osumi
our data showed that Smek1 functions
and glial cell differentiation.

A

B
Control shRNA
Studies have shown that function of Pax6 gene is to maintain neural
promote neuronal or radial glia differentiation in
manner(Osumi et al., 2008; Gotz et al., 1998). Taken together,
mek1 functions during the cell cycle as well as
and glial cell differentiation.

Smek1 shRNA
60
maintain neural
differentiation in a
Taken together,
in neuronal

C
D

P<0.05

61

E
Figure 3-6: Knock down of
Phase contrast image of NPCS transfected with
B) The quantity of phosphorylated
condition was significantly increased in Smek1 knockdown
blue: nuclei. C) Quantitative analysis of Fig. 3
analyzed by western blotting. E) NSC
staining and levels of PH3 and Ki67.

of Smek1 by shRNA enhanced cell proliferation.
NPCS transfected with control shRNA and Smek1 shRNA
of phosphorylated histone H3 (PH3) in NPCs under proliferati
condition was significantly increased in Smek1 knockdown of NPCs. Red: PH3,
blue: nuclei. C) Quantitative analysis of Fig. 3-6B. D) PH3 protein level was
analyzed by western blotting. E) NSC overexpressing Smek1 showed decreased
PH3 and Ki67. Control vs Smek1 overexpression,
62

Smek1 by shRNA enhanced cell proliferation. A)
control shRNA and Smek1 shRNA
histone H3 (PH3) in NPCs under proliferative
NPCs. Red: PH3,
6B. D) PH3 protein level was
Smek1 showed decreased
ontrol vs Smek1 overexpression, P<0.05.

A
B

LV
LV
CP
63
LV

C
Figure 3-7: The number of phosphorylated
increased in the brains of Smek1
forebrain cortex of E11.5. PH3 positive (green)
where new NPCs are being
more PH3 positive cells. The expression level of Pax6 (red) was enhanced in the
Smek
gt/gt
brains. Hoechst dye was used for nuclear staining.
image of the VZ in 3-7A. C) Quantitative analysis. The number of PH3 positive
cells was calculated by normalizing with

Smek1 +/+ Smek1 gt/gt
P<0.05

The number of phosphorylated histone H3 (PH3) positive cells
increased in the brains of Smek1
gt/gt
at E11.5. A) Images of coronal sections from
. PH3 positive (green) cells were observed in the VZ
being actively generated. Smek
gt/gt
brains have significantly
The expression level of Pax6 (red) was enhanced in the
Hoechst dye was used for nuclear staining. B) A close
7A. C) Quantitative analysis. The number of PH3 positive
culated by normalizing with number of cells lining the VZ.
Smek1 gt/gt

64
cells
Images of coronal sections from
were observed in the VZ
brains have significantly
The expression level of Pax6 (red) was enhanced in the
B) A close-up of the
7A. C) Quantitative analysis. The number of PH3 positive
cells lining the VZ.

65

Depletion of Smek1 causes a NPCs expansion and impairs the production of
neurons.
To investigate if Smek1 is involved in NPC proliferation and/or neuronal
differentiation, we examined the forebrains of Smek1
+/+
and Smek1
gt/gt
mice for
NPCs and neuronal markers, using immunochemistry. The expression of PH3 and
Pax6 increased in the E11.5 brains of Smek
gt/gt
mice compared to wild-type mice
(Fig 3-8A,B; Fig 3-9A). We also found that at E14.5, the expression of Pax6, a
NPC marker, increased in the Smek1
gt/gt
cortex (Fig 3-8C, D; quantitative analysis
in Fig 3-9B). In addition, we found that the neurons of the CP decreased as shown
by the expression of the cortical neuronal marker Tbr1 (Fig 3-8E, F; quantitative
analysis in Fig 3-9C). Taken together, these data showed that Smek1 is involved
in differentiation but not in proliferation, during the peak phase of neurogenesis.
Moreover, we also observed a decrease in the number of post-mitotic neurons,
which express TUJ1 (an immature neuronal marker) but not the proliferative
marker Ki67, in the VZ of Smek1
gt/gt
forebrain cortex compared to those of
Smek1
+/+
control littermates (Fig 3-8G, H, arrows).
These data indicated that there is a reduction of neuron production from NPCs in
the Smek1 KO mice. To test the hypothesis, BrdU was administered to E14.5
embryos 12 hrs before the collection of the brain samples. The coronal sections
from Smek1
+/+
and Smek1
gt/gt
were analyzed by immunostaining of TUJ1 and BrdU.
BrdU-positive cells were distributed throughout the VZ (Fig 3-10 A, B). Small

66

populations of cells were positive for both TUJ1 and BrdU (Fig 3-8 I, J, arrows).
These cells are considered to be newly formed post-mitotic neurons, as these cells
were able to take up BrdU (Menezes and Luskin, 1994; Coskun and Luskin, 2001).
Quantitative analysis of TUJ1 and BrdU double-positive cells showed a reduction in
the production of neurons from NPCs in Smek1
gt/gt
mouse compared to Smek1
+/+

mouse (Fig 3-10C). Our results showed that decreased neuron production in the
CP of Smek1
gt/gt
mouse frontal cortex was a result of impaired neurogenic
competence of NPCs.

Figure 3-8: Defect of neurogenesis in Smek1 knockout mice
(A-F) Confocal microscope immunostaining images of Pax6 and phosphorylated-
histone H3 in E11.5 (A, B), and Pax6 (C, D) and Tbr1 (E, F) in E14.5 in coronal

67

sections from the forebrain of wild type Smek
+/+
(A, C and E) and hypomorphic
mutant Smek1
gt/gt
mice (B, D, and F). Scale bars: 100 μm.
(G-H) Immunostaining of TUJ1 and Ki67 in coronal sections from the forebrain of
E14.5 Smek1
+/+
(G) and Smek1
gt/gt
mouse (H). Nuclei were stained with Hoechst
dye. The number of the post-mitotic neurons that were labeled for TUJ1 but not
Ki67 (arrows in higher magnification panels) decreases in the region of the VZ of
Smek1
gt/gt
cortex compared with Smek1
+/+
.
(I-J) Immunostaining of TUJ1 and BrdU in the coronal sections from E14.5
Smek1
+/+
(I) and Smek1
gt/gt
(J) forebrain 12 hr after BrdU pulse. The newly formed
neurons labeled with both TUJ1 and BrdU are detectable in the region of the VZ
(arrows). The number of new neurons decreases in Smek1
gt/gt
forebrain compared
to that of Smek1
+/+
. Scale bars, 100 μm.
PP, preplate; VZ, ventricular zone; CP, cortical plate.

68

Figure 3-9: Smek1 depletion caused an increase in Pax6 and decrease in Tbr1.
(A) Immunostaining for Pax6 and TUJ1 in coronal section from E11.5 Smek1
+/+
and
Smek1
gt/gt
mice forebrains. Scale bars, 100 μm. Quantitative analysis of (B) Pax6-
positive cells at the VZ; and (C) Tbr1-positive cells at the CP in coronal section
from E14.5 Smek1
+/+
and Smek1
gt/gt
mice forebrains. Error bars represent the
mean ± S.D. of triplicate tests. CP: cortical plate; VZ: ventricular zone

69

Figure 3-10: Images of the distribution of BrdU-positive cells in coronal sections
from Smek1
+/+
(A) and Smek1
gt/gt
(B) mice forebrains 12 hrs after BrdU
administration. The 10 μm tissue sections were immunostained with anti-BrdU
antibody. Scale bars, 100 μm. (C) Quantitative analysis of TUJ1 and BrdU
double-positive cells in the VZ of E14.5 Smek
+/+
and Smek
gt/gt
forebrain. The fold
difference in the number of newly differentiated neurons was evaluated by
normalization using the average number of TUJ1 and BrdU double-positive cells
per coronal sections in mutant mouse. Error bar represents the mean ± S.D. of four
independent experiments. Wild-type vs Smek1
gt/gt
, P<0.05. CP: cortical plate;
SVZ: sub-ventricular zone; VZ: ventricular zone.

70

Knocking down of Smek1 reduced expression of Tuj-1 positive cells and
increased PAX6 positive cells, markers of neuronal differentiation
To elucidate the role of Smek1 in neurogenic competence of NPCs, we employed
an in vitro culture system using NPCs isolated from neocortex of E11.5 mouse.
NPCs transduced with either lentivirus expressing shRNA against Smek1 or control
shRNA, under control of a doxycycline-inducible promoter. Transduced cells were
cultured with medium containing doxycycline for 6 days under differentiating
condition. The number of TUJ1-positive cells decreased significantly in cultures
with knock down for Smek1 compared to cultures expressing control shRNA;
whereas the number of Pax6-and GFAP-positive cells increased (Fig 3-11A). The
reduction of TUJ1 positive cells was observed as early as the 1
st
and 3
rd
days post-
differentiation (Fig 3-12).
NPCs are known to undergo differentiation into neurons and astrocytes during
CNS development (Kriegstein and Alvarez-Buylla, 2009). We hypothesized that
Smek1, prior to astrocyte differentiation, is involved in regulating neuronal versus
NPC fate specificity. To address this, NPCs were knocked down for Smek1
expression prior to differentiation, and then the NPCs were allowed to differentiate.
Neuronal and astrocyte differentiation was analyzed at Day 0.2(5 hours), 1, and 2
by western blotting for detection of TUJ1, NeuN (mature neuronal marker), and
GFAP (Fig 3-11B). Astrocyte differentiation started at the 2nd day, while neuronal

71

differentiation was detected from 0.2th day onwards as determined from
expression levels of TUJ1 and GFAP. Compared to the NPCs expressing control
shRNA, western blotting analysis of the NPCs expressing Smek1 shRNA showed a
significant decrease in the TUJ1 expression level at day 1 (Fig 3-11B). The
increased GFAP expression was confirmed later in Smek1
gt/gt
differentiated cells as
well as for in vivo brain tissues (Fig 3-14)
We further observed that the percentage of TUJ1-positive cells significantly
decreased in cultures expressing Smek1 shRNA compared to those of control
(Fig3-11C), while the percentage of NPCs expressing both Nestin and Ki67 (Fig 3-
11D) or Pax6 (Fig 3-11E) increased. Figure 3-13 shows representative images of
the immunostaining with the respective antibodies. Taken together these results
showed that Smek1 was involved in neuronal differentiation but not in neuronal
fate specificity.

72

Fig 3-11: Smek1 is essential for regulating neuronal differentiation versus
maintenance of NPCs
(A) Depletion of Smek1 reduces differentiation into neurons, but increases
astrocyte differentiation. NPCs expressing Smek1 shRNA or control shRNA under
control of doxycycline-inducible promoter were cultured 6 days in differentiation
medium containing doxycycline and then subjected to immunostaining for TUJ1,

73

GFAP, Pax6, or Smek1 (top). The percentages of TUJ1-, GFAP-, and Pax6-
positive cells per total cells are shown in the bottom panel. Scale bar, 40 μm.
Control shRNA vs Smek1 shRNA, P<0.05.
(B) Western blot analysis in the early phase of NPC differentiation using anti-TUJ1,
-NeuN, and -GFAP antibodies. Two days prior to differentiation, the Smek1 shRNA
and control shRNA were induced with the addition of doxycycline. Cells were then
cultured under differentiation conditions for the indicated times. Antibodies against
Smek1 and β-actin served as internal expression controls. Western blot analysis
from cells knocked down for Smek1 showed decreased protein levels for TUJ1 and
NeuN but GFAP expression was increased.
(C-E) Depletion of Smek1 decreases neuronal differentiation. NPCs were cultured
as described in B, and then were immunostained with anti-TUJ1, -Nestin, -Pax6, or
-Ki67 antibodies. The percentages of neuronal cells and undifferentiated NPCs
were calculated by counting the number of TUJ1-positive cells (C) and double-
positive cells for Nestin and Ki67 (D) or Pax6-positive cells (E) per total cells,
respectively. Each error bar represents the mean ± S.D. of four independent
experiments; each assay was performed in duplicate. Control shRNA vs Smek1
shRNA, P<0.05.

Fig 3-12: Reduction of neurons in Smek1 knockdown cells.
Tuj1 and Nestin in cultures for

Reduction of neurons in Smek1 knockdown cells. Immunostaining of
in cultures for 1 day and 3 day under differentiation condition
74
mmunostaining of
differentiation conditions.

75

Figure 3-13: Representative images of immunostaining with anti-TUJ1, -Nestin, -
Pax6, or -Ki67 antibodies in control or Smek1 shRNA-expressing cells cultured for
1 day under differentiating condition. Nestin and Ki67 double- or Pax6-positive
cells are represented as an undifferentiated NPC. Scale bar: 50 μm.

A
B
Figure 3-14: Smek1 depletion increased GFAP protein expression level. A)
Smek1
gt/gt
neuronal progenitor cells are cultured from E11.5 Smek1
allowed to differentiate for 5 days.

Smek1 depletion increased GFAP protein expression level. A)
neuronal progenitor cells are cultured from E11.5 Smek1
gt/gt
ed to differentiate for 5 days. GFAP positive cells (green) are significantly
76
Smek1 depletion increased GFAP protein expression level. A)
gt/gt
cortices and
are significantly

77

increased in the Smek1
gt/gt
cells. GFAP: green; Smek1: red. (B) Immunostaining
of P1.5 mouse brain. GFAP: red

3.4: Discussion.
During early development in the mouse brain, we observed that Smek1 was
differentially expressed in the forebrain. Smek1 was localized predominantly to the
VZ of E11.5 forebrain where NPCs were actively proliferating, but not in the cortical
pre-plate, where post-mitotic neurons are forming. However at E14.5, Smek1
expression was observed in proliferating NPCs and neurons. In addition, Smek1
expression was concentrated in mitotic spindles during mitosis, suggesting a role in
microtubule regulation.
Next, we examined whether Smek1 played a role in neuronal differentiation and
proliferation. We utilized a gain and loss of function approach in cultured cells and
in mouse to delineate the role of Smek1 in neurogenesis.
Our studies showed that Smek1 was involved in differentiation of NPCs as
demonstrated by knockdown of Smek1 by shRNAs for Smek1 in NPCs.
Specifically, knockdown of Smek1 resulted in an increased phosphorylation of
histone H3, a marker of cell-cycle progression during mitosis. Conversely,
overexpression of Smek1 led to reduced histone H3 phosphorylation and
concomitantly a decrease in cell cycle progression, indicating that Smek1 was anti-

78

proliferative. These results were substantiated in Smek1 knockout mice
(Smek1
gt
/
gt
) wherein we showed increased expression of phosphorylated histone
3(PH3) in the brain. Moreover, we showed that PAX6, a marker of NPC levels,
was increased in brains of Smek1 knockout mice. PAX6 has also been shown to
promote neuronal or radial glia differentiation (Osumi et al., 2008; Gotz et al., 1998).
When NPCs from Smek1 KO mice were allowed to differentiate, GFAP positive
cells, presumably glial/astroglial, increased. Furthermore, there was a reduction in
the production of neurons in Smek1 KO mouse compared to Smek1
+/+
mouse.
Thus, these results showed that Smek1 was involved in progression of cell cycle,
and in neuronal and glial cell differentiation, both in vitro and in vivo.
In the drosophila model, mutation of flfl, a homolog of Smek, has been shown to
result in a delayed mitotic progression (Sousa-Nume et al., 2009). On the contrary,
Smek1 knockout in mouse NPC caused an apparent increase in mitotic
progression. This may be due to the fact that mammals have two Smek isoforms,
Smek1 and Smek2, thus flfl in drosophila may not be an exact homologue to
Smek1. Alternatively, there may be additional functions or redundant activities in
mammals. It is noteworthy that Smek1 may function to promote the fate of NPC
from a proliferative fate to a neurogenic and/or glial fate. Since previous studies
have identified nuclear Smek1 as a transcriptional repressor (Wolff et al., 2006;
Lyu et al., 2011), we propose that Smek1 coordinates gene transcription machinery
that suppresses cell fate determinants to promote neuronal differentiation.

79

Next, our collegue, Dr. Jungmook Lyu found that Smek1 directly binds to Par3
through the DUF625 domain of Smek1, and that this may regulate NPC
specification (data not shown). Par3 is an upstream component of Notch signaling
(Bultje et al., 2009). Thus, our data suggest that the capability of Par3 to activate
Notch signaling may be inhibited by Smek1 during mitosis, thereby ensuring
neuronal fate. Dr. Lyu also demonstrated that Smek1-deficient mouse forebrain
cortex exhibited a decrease in the number of NPCs with asymmetry of Par3
distribution (data not shown here). In drosophila, Par3 distribution pattern is crucial
in guiding distribution of cell-fate determinants. This indicates that Smek1 is
required for asymmetric inheritance of Par3 in mammals.
In conclusion, we demonstrated that Smek1, an evolutionarily conserved regulatory
subunit of PP4, is required to regulate neuronal differentiation and is involved in
neuronal/glial cell fate and cell cycle progression.

3.5: Future direction.
As we unravel the function of Smek1 in neuronal development, there are so many
questions that we still need to solve, such as the ability of pp4/Smek1 to
dephosphorylate Par3 and identification of other targets. In regards to
neurodevelopment, we are interested in finding in-depth the characterization of two
roles of Smek1: Neuron-to-glial switching and cell cycle progression.

80

1) Role in glial cell/ asctrocyte production. Our studies showed that Smek1
deficiency resulted in more glial cells, as well as increased GFAP transcription
(data not shown) and translation. This suggests that Smek1 could directly or
indirectly function in negatively regulating GFAP transcription or translation or even
the stability of GFAP mRNA or protein. It was reported that Smek/PP4c complex
binds to HDAC1 and occupies the Tcf/Lef binding region of brachyury promoter,
thereby inhibiting brachyury transcription in ES cells (Lyu et al., 2011), which is a
mesoderm marker. A similar mechanism may occur for Smek1/pp4 participation in
GFAP transcription inhibition. Necessary approaches to solve these questions will
involve determining the cis-binding elements for Smek1 binding in GFAP promoter
by employing a luciferase reporter construct. 2) Cell cycle and cytoskeleton.
Smek1 is enriched in the mitotic spindle during mitosis and loss of Smek1
enhanced cell cycle progression. Our studies showed that Smek1 overexpression
inhibited proliferation of NPC. Smek1 overexpression, however, did not affect
much in terms of neuronal differentiation (data not shown). It is likely that Smek1
may regulate cell cycle progression by suppression of mitotic spindle microtubule
dynamics. In fact, it was reported that Smek1 arrests cell cycle progression in G
1
-
G
0
phase in ovarian carcinoma (Byun, et al., 2012). PP4 itself could regulate the
cell cycle via Cdk1, as a loss of PP4 resulted in abnormal phosphorylation in
NDEL1, which in turn resulted in defective microtubule assembly or structure?
(Toyo-oka et al., 2008). We do not know if this process would be similarly
influenced by Smek1. In order to address this question, we need to confirm if

81

tubulin stability is enhanced by Smek1. We may also need to identify which
microtubule components and related co-factors could be bound to Smek1.

82

Chapter 4: Introduction to Head and Neck Cancer
Head and neck cancers (HNC) arise in four major regions in the head and neck:
Oral cavity, nasal cavity, pharynx, and larynx. The oral cavity includes lips, palate,
tongue, and salivary glands. The pharynx can be further divided into nasopharynx,
oropharynx, and hypopharynx (fig 4-1). As with other types of solid tumors, HNC
are heterogeneous and exhibit a wide range of biologic behaviors (Lalwani, 2007).
Although there are various different tumor types, squamous cell carcinomas
comprise 90% or more in head and neck cancers (Klein and Grandis, 2010). Head
and neck squamous cell carcinomas (HNSCC) arise from epithelial (squamous)
cells that line the head and neck region. Other less common head and neck
cancer types include adenocarcinoma, mucoepidermoid carcinoma, and sarcoma,
which arise from ducts, cartilage, muscle, and soft tissues (Lalwani, 2007).
4.1. Epidemiology. Head and neck cancer (HNC) is the 6
th
most common cancer
in the world and is a major cause of morbidity and mortality worldwide. A recent
statistic showed that approximately 640,000 diagnoses were made and 360,000
deaths were reported worldwide (GLOBOCAN 2008, fig 4-2). In the U.S., head
and neck cancers account for approximately 3 to 5% of all malignancies. It is
estimated that more than 52,000 diagnoses will be made, in which more than 70%
are of males, and approximately 11,500 will die from head and neck cancers
(Siegel et al., 2012). According to the National Cancer Institute, head and neck

83

cancers are diagnosed more often among people over the age of 50 than they are
among younger people (NCI fact sheet, 2012).
Head and neck cancers occur more frequently in males than females (Siegel et al.,
2012; Cook et al., 2009). Cancer of the oropharynx, for instance, afflicts 3 to 5
times more males than females (Lalwani, 2007). As it will be discussed in more
detail in section 4.2., alcohol and tobacco usages are the major risk factors for
head and neck cancers.
African Americans have a higher incidence of HNC, and the associated mortality
rate is higher than in whites. This is possibly due to a combination of factors, such
as socioeconomic status, genetics contributing to differential metabolism of
carcinogen, cultural beliefs, and HPV tumor status (Goodwin et al., 2007; Ragin et
al., 2011; Schrank et al., 2010; Settle et al., 2009, Lazarus and Park, 2000;
Caraballo et al., 1998, Caraballo et al., 2011, Stingone et al., 2012). Weng et al.
found that there was a statistically significant disparity in surgical recommendations
for African-Americans diagnosed with oropharyngeal cancer (Weng and Korte,
2011). As surgery is normally the first-line of oropharyngeal cancer treatment, the
authors concluded that this may be the leading cause of the poor survival among
African- Americans (Weng and Korte, 2011). A recent study conducted in 2011
showed that racial disparity among oropharyngeal cancer is diminishing possibly
due to the reduction in overall smoking and heavy alcohol consumption among
African Americans in general, while the HPV-associated head and neck cancer

84

rate has increased among white males (Brown et al., 2011). Increased
accessibility and proper quality of treatment may improve the outcome among
African Americans and other minorities (Ragin et al., 2011; Chen et al., 2009).

The 5-year survival rate of patients with head and neck cancer is among the lowest
among the major cancer types, as approximately 50% of patients die within 5 years
after initial diagnosis (Fig 4-3). The prognosis of head and neck cancer has not
improved much in the past three decades, except for oropharyngeal and
nasopharyngeal cancers where a marginal improvement was achieved (Fig 4-4,
Carvalho et al., 2005).

Figure 4-1: Anatomy of head and neck

85

Figure 4-2: Estimated age-standarized incidence rate per 100,000 for head
and neck cancer.

Figure 4-3: Relative Survival Rate of Head and Neck cancer Patients: SEER
1988-2001 (Ref: Piccirillo et al., NCI, SEER, Survival Monograph)

86

Figure 4-4: Trends in 5-year survival rate according to the tumor site and
year of diagnosis (Carvalho et al.).

The economic health burden of head and neck cancer can be substantial. It has
been reported that in the U.S., average Medicare payments among patients with
head and neck cancer were $25,542 higher than those of matched patients with
other solid tumors (Lang et al., 2004). The National Cancer Institute estimated that
$3.64 billion were spent annually for head and neck cancer treatment in the US;
more than 43% of the cost was accrued for care during the terminal year of life.
Moreover, the lost productivity due to head and neck cancer death in the U.S. was
estimated at $3.4 billion dollars in 2005 (Ref: Cancer Trends Progress Report –
2011/2012 Update, National Cancer Institute, NIH, DHHS, Bethesda, MD, August
2012, http://progressreport.cancer.gov).

87

4.2. Risk factors:
Excessive consumption of alcohol and smoking greatly increases the risk of head
and neck cancers.
It is known that heavy alcohol consumption (more than 3 to 5 drinks per day), is
associated with a higher risk of devloping head and neck cancer (Freedman et al.
2007, Hashibe et al., 2012, Franceschi et al., 1999). Occasional to moderate
drinkers who are non-smokers, especially those who routinely consume less than
20 drinks per week, do not have increased head and neck cancer risk compared to
non-smoker/non-drinking subjects (Franceschi et al., 1999; Jaberet al., 1998,
Anantharaman et al., 2011). Possible mechanisms for head and neck cancer
development due to heavy alcohol consumption include cellular proliferation,
production of carcinogenic metabolites of alcohol, and reduction of the protective
effect of retinoic acid (Yu et al., 2012; Balbo et al., 2012; Viswanathan and Wilson,
2004; Figuero Ruiz et al., 2004)
Hallmark of the carcinogenic process for head and neck cancer is tobacco smoking.
It may be the leading and most preventable cause of head and neck cancer. The
risk for head and neck cancer for tobacco smokers is estimated to be 4- to 12-fold
over that of non-smokers. This risk increases in a dose response manner with
duration and extent of smoking. (Lubin et al., 2011; Hashibe et al., 2007; Sturgis et
al., 2004)

88

The number of smokeless tobacco users, including chewing tobacco and snuff, is
relatively unchanged or has slightly declined in the U.S. for the past 20 years
(Substance Abuse and Mental Health Services Administration. 2009; Results from
the 2008 National Survey on Drug Use and Health: National Findings (Office of
Applied Studies, NSDUH Series H-36, HHS Publication No. SMA 09-4434; Nelson
et al., 2009). Some smokers switch from traditional smoking to smokeless
tobacco as the smoking restriction is tightened in the U.S. In a 2009 survey,
almost 9 million people were smokeless tobacco users (2009 National Survey on
Drug Use and Health: Volume I. Summary of National Findings (Office of Applied
Studies, NSDUH Series H-38A, HHS Publication No. SMA 10 4856Findings.
Substance Abuse and Mental Health Services Administration, 2010.). Several
studies suggest that long term use of smokeless tobacco does increase the risk of
head and neck cancer by 2- to 4- times compared to non-smokers; animal
carcinogenicity studies further support these clinical findings (Zhou et al., 2012;
Boffetta et al., 2008).
Involuntary smoking, or commonly called second-hand smoking, is also known to
increase head and neck cancer risk by 1.5- to 4- times (Malliset al., 2011; Lee et al.,
2008; Zhang et al., 2000; Tan et al., 1997). Involuntary smoking is termed as
environmental tobacco smoking (ETS) and has been classified as a human
carcinogen by the Environmental Protection Agency since 1993.

89

Tobacco use has been well established as an inducer of cancer in animal models.
Smoking causes broad effects on the entire mucosa of the head and neck region,
as well as the entire body systems (Lalwani, 2007, Adelstein, 2005). The
carcinogenic effect due to smoking results from, but not limited to, the formation of
DNA/protein adducts (such as nitrosoamines), production of reactive oxygen
species (ROS), modulation in cellular signaling (i.e., AKT), and epigenetic
modulation. To date, more than 60- different known carcinogens have been found
in cigarette smoke (Weber et al., 2011; Coppe et al., 2008; Hecht , 2003). In vivo,
cellular injury and gene expression changes occur even from smokeless tobacco
(Avti et al., 2010; Mishra and Das, 2009).
Thus the risk of head and neck cancer synergistically increases in individuals who
are both smokers and heavy drinkers (Radoi et al., 2012; Goldstein et al., 2010;
Hashibe et al., 2009; Franceschi et al., 1999; Zygogianni et al., 2011).

Viral infection has also been shown to cause cancer in the head and neck region.
Human papilloma virus (HPV) infection is known to increase the risk of head and
neck squamous cell carcinoma 15 years or more, on average, after the initial
exposure (Chaturvedi and Gillison, 2010). Double-stranded DNA virus, HPV type-
16 strain is the most common infection associated with HPV-positive head and
neck cancer patients while HPV type-18 is the second common strain (Goon et al.,
2009). In fact, the HPV positive head and neck cancer cases are on the rise in the

90

U.S. The HPV infection rate has increased in the past 20- to 30- years among
young adults, and it is the eighth most common cancer among men in the United
States (Chaturvedi et al., 2011; Marur et al., 2010, Brown et al., 2011; Sturgis and
Cinciripini, 2007; Siegel et al., 2012). The viral E6 oncogene is known to degrade
P53, thus inactivating its normal function (details will be presented in the section
4.5). The viral E7 gene is thought to inactivate the retinoblastoma tumor
suppressor gene product pRB. Interestingly, HPV-positive HNC patients are
known to fare better than HPV-negative HNC patients (Ang et al., 2010; Rischin et
al., 2010). Although there is clear, established evidence, some speculate that this
is due to the fact that cancer resulting from a series of mutations, notably 11q13
gene amplification, is much more aggressive compared to the cancer arising from
P53/pRB inactivation by HPV (Michl et al., 2010). An HPV vaccine was approved
for use by FDA in 2006 (www.fda.gov), Thus it will be of interest to see if routine
HPV vaccination will reduce the incidence of oropharyngeal cancer in 15 to 20
years post-vaccination.
Another virus, which is well-known to be linked with head and neck cancer, is
Epstein-Bar Virus (EBV) (Adelstein, 2005). Hepatitis C virus is also linked to the
development of head and neck squamous cell carcinoma, as the virus can
replicate in oral lichen tissue and may damage the mucosa (Adelstein, 2005). Both
viruses encode viral proteins that can transform normal cells into cancer
(Gondivkar et al., 2012).

91

Cultural/habitual factors known to excessively stimulate or injure the oral cavity
mucosa are known to increase head and neck cancer incidence. Areca nut
chewing (also known as betel nut, since areca nut is often chewed with betel leaf)
in Southeast Asia, is a well- known risk factor for head and neck cancer (Sharan et
al., 2012; Akhtar et al., 2012; Chen et al., 2011; Lee et al., 2010; Thomas et al.,
2007; Trivedy et al., 2002; Goldenberg et al., 2004). Also mate drinking in South
America, usually consumed very hot through a metal straw, is associated with an
increased oral and esophageal cancer risk (Deneo-Pellegrini et al., 2012;
Szymanska et al., 2010; Dasanayake et al., 2010; Sewram et al., 2003). Marijuana
smoking has been postulated to have a role in head and neck cancer development
(Zhang et al., 1999; Feng et al., 2009), while some studies showed no association
or were inconclusive (Berthiller et al., 2009; Hashibe et al., 2006; Rosenblatt et al.,
2004).
Other risk factors, which may be less common but nevertheless significant are
Fanconi’s Anemia, poor oral hygiene, oral lichen planus (OLP), and
gastroesophageal reflux disease (GERD). Fanconi’s Anemia is an autosomal
recessive disorder in which DNA repair genes are mutated. These patients suffer
from bone marrow failure and multiple malignancies, including head and neck
cancer in which the risk is 700 times higher than the general population
(Rosenberg et al., 2003). Poor oral hygiene, defined by poor dentition such as,
damaged teeth, infrequent tooth-brushing, and infrequent dental visits, is also
associated with a 2- to 12- times higher risk of head and neck squamous cell

92

carcinoma (Adelstein DJ, 2005). OLP is a chronic inflammatory mucocutanous
disorder in which T-cells accumulate in the oral epithelial layer. The persistent
inflammation in individuals with OLP (approximately 1% of the general US
population) is known to moderately increase head and neck cancer risk (Adelstein,
2005; Bombeccari et al., 2011). GERD is a condition in which stomach contents,
often highly acidic, leak into the esophagus and the upper digestive tract. This
condition causes “heart burn” and severe/chronic GERD may increase the risk of
head and neck cancer, up to 2-4 folds, notably in laryngeal and pharyngeal areas
(El-Serag et al., 2001; Galli et al., 2006).
Alcohol consumption is one a well- known risk factor of head and neck squamous
cell carcinoma, thus numerous studies have been conducted to determine if using
mouthwash, which often contains 5-20% alcohol, poses a risk for head and neck
cancer. Currently, there is no clear association in risk with head and neck cancer,
even with daily use of mouthwash, although Winn et al. reported that use of
mouthwash with 25% or higher alcohol content is associated with increased oral
cancer risk (Gandini et al., 2012; Cole et al., 2003; Winn et al., 1991).
4.3. Carcinogenesis:
Carcinogenesis, a process by which normal cells are transformed into cancerous
cells, is characterized by progressive changes at both cellular and genetic levels
that ultimately transform a normal cell into dysregulated growing cells. This

93

progression can be characterized by appearance and/or histological examination,
starting from hyperkeratosis, dysplasia, carcinoma-in-situ, and carcinoma.
Hyperkeratosis is a condition in which the epithelial layer accumulates an
excessive keratin layer. In some cases, hyperkeratosis is visible as a whitish
plaque, while in other instances it is only visible microscopically or histologically.
Dysplasia is a condition in which microscopic phenotypic alterations of and/or an
increase in the number of epithelial cells is evident. Dysplasia can be divided into
low grade and high grade presentations. Low grade dysplasia can be seen as
leukoplakia and erythroplakia, depending upon the tissue appearance.
Leukoplakia is present as a white plaque of the oral mucosa. Erythroplakia
appears as reddish patch or papule and is often presented in more advanced
dysplasia. Both are abnormal but not necessarily neoplastic. Approximately 5% of
leukoplakia and 51% of erythroplakia will progress into cancer, if left untreated
(Lalwani, 2007). Carcinoma-in-Situ (CIS) is a high grade dysplasia where the
abnormal cell growth involves the entire squamous layer but there is no evidence
of invasion into the underlying connective tissues. Both dysplasia and carcinoma in
situ (CIS) are considered precancerous. Once abnormally growing cells become
invasive, meaning the cells have grown beneath the epithelial cells into deeper
tissue layer called mucosa, they are now defined as squamous cell carcinoma.
In terms of molecular biology, a multi-step model is proposed, especially for
tobacco-induced cancers. In this model, cancers are thought to arise through the

94

stepwise accumulation of multiple somatic mutations in genes of normal cells. As
these genetic mutations accumulate, the transformation of a pre-cancerous lesion
can be observed to progress histologically.
For head and neck cancers, the initial molecular event often begins from allelic
losses and hypermethylation in specific regions, notably 9q21 and 3p, which
encode several important tumor suppressor genes including P16 and P14, followed
by 17p13 mutation which encodes TP53, another crucial tumor suppressor gene
(fig 4-5). Thus, early genetic events leading to cancers tend to start from
inactivation of tumor suppressor function(s). After cumulative exposure to
carcinogens, further mutations could occur thus raising the risk of progression from
pre-cancerous lesions to cancer. Later molecular events frequently involve gene
amplification. 11q13 amplification often occurs in severe dysplasia, CIS, and
carcinoma, which is the locus for proto-oncogenes which contribute to inflammation
(Perez-Ordonez et al., 2006; Argiris et al., 2008; Leemans et al., 2011). Loss of
heterozygosity in18q is frequently seen in a very aggressive primary and
metastatic head and neck cancer, and is associated with poor outcome
(Takebayashi et al., 2000).
We do not know precisely which genetic mutation is more important than the others,
as the order of mutations may not progress in a sequential manner as described in
figure 4-5. However, accumulated gene mutations are often seen in head and
neck cancer patients. Thus the combined mutations are believed to lead to the

95

progression from normal to pre-cancerous lesions and to invasive cancer (Argiris et
al., 2008; Leemans et al., 2011).

Figure 4-5: Histological evolution of oral epithelial cells and the accumulated
genetic mutations in carcinogenesis of head and neck cancer.

4.4. Challenges in treating HNSCC: As it was discussed in the section 4.1., the
mortality rate in head and neck cancer patients has not improved in the past
several decades, and the 5-year survival rate has remained at ~50% during this
period. Although the cure rate of HNSCC patients with stages I and II is 90% and
70% respectively, about two-thirds of patients present with more advanced stages
(stage III or IV). However, HNSCC in the oropharynx, which includes base of the
tongue, tonsils, soft palate, and posterior pharyngeal wall, is often difficult to

96

diagnose in the early stage as the lesions are silent and not externally visible.
Thus, the cancer is frequently advanced at the time of diagnosis (Argiris, et al.,
2008; Lalwani, 2007) thus contributing to the observed high mortality. In this
regard, three major factors are considered as challenges in HNSCC treatment.
a) Loco-regional and distant metastasis. Advanced or aggressive HNSCC tend to
metastasize locally, while distant metastasis is less common compared to other
malignancies (Leon et al., 2000; Ferlito et al., 2001). Attention has been focused
to determine possible molecular mechanisms of metastasis in HNSCC.
Transcriptional profiling in cervical lymph node metastasis reveals that expression
of distinct sets of genes , related to cell adhesion, extracellular matrix,
cytoskeleton, and angiogenesis are dysregulated (Colella et al., 2008; Karatzanis
et al., 2012). Epithelial-to-mesenchymal transition (EMT) is a concept, which is a
subject of intense investigation in cancer research, and this may explain the overall
process of metastasis. It has been hypothesized that EMT is the major mechanism
that is responsible for the spread of cancer. This is shown by loss of epithelial cell
markers and a gain of mesenchymal markers, which allow cancer cells to detach
from the primary site of origin, through motile and invasive mechanism(s) (Wu et al.,
2012; Tiwari et al., 2012). However, to date, detailed molecular mechanisms of
metastasis have not been elucidated. In addition, there is no effective animal
model for metastasis. Once metastasis occurs, the survival is dismal. The
average survival for loco-regional and distant metastasis is 6- to 10- months and 4-
to 5- months, respectively (Al-Othman, 2003; Vermorken and Specenier, 2010)

97

b) Chemo and radiation resistance in HNSCC.
i) Chemotherapy resistance in HNSCC:
There are currently 20 FDA-approved drugs to treat HNSCC, including 5-
fluorouracil, methotrexate, and cisplatin. However, the tumor response rate is
approximately 10- to 30% for a monotherapy, while combination chemotherapy
produces a slightly higher response rate ref. Even combination chemotherapy
regimens normally do not have a clear benefit in terms of patient survival,
especially for advanced or recurrent HNSCC. For example, cetuximab is the
newest FDA-approved chemotherapeutic agent indicated for late-stage HNSCC
treatment and one of the most promising agents that is known to prolong survival,
when combined with other chemotherapy or radiation therapy. However, its tumor
response rate is only about 10 to 15%. (www.FDA.gov, www.cancer.gov, Baselga
et al., 2005). Both intrinsic resistance to chemotherapy and acquired resistance
are major issues (Lippert et al., 2011).
Cancers are known to have or develop multiple processes/pathways to protect
themselves from chemotherapy. These mechanisms include, enhanced drug efflux,
reduced uptake of chemotherapeutic agents, cellular compartmentalization,
alteration in drug targets, inhibition of apoptosis, and others. Many aberrant,
redundant signaling pathways are considered to play a role in multifactorial
chemotherapy resistance (Gottesman, 2002; Perez-Sayans, et al., 2010; Mimeault
et al., 2007).

98

Predictive biomarkers for the use of chemotherapy is seriously lacking in HNSCC.
In the case of colon cancer, presence of KRAS mutation, which is present in about
half of colorectal cancer patients, can be used to predict responsiveness to
cetuximab. In HNSCC, presence of KRAS mutation is less than 5% and yet still
only about 10% of the KRAS wild-type patients respond to cetuximab (Misale et al.,
2012; De Roock et al., 2010; Wang et al., 2011; Smilek et al., 2012; Modjtahedi
and Essapen, 2009). We still do not know enough about molecular mechanisms
of chemotherapy resistance in HNSCC. Delineating possible molecular
mechanisms of chemotherapy resistance is important as this will allow avoidance
of resistance mechanisms or at the very least we may be able to predict
responsiveness to specific chemotherapeutic agents.
ii) Radiation therapy resistant HNSCC:
Radiation therapy (RT) is the common treatment after surgery in HNSCC.
However, RT causes serious side effects, such as mucositis, dysphasia, fibrosis,
cervical dystonia, loss of taste sensation, and loss of saliva secretion. Currently,
re-irradiation after the recurrence in patients who already received a prior RT is
normally not performed (Langendijk, and Bourhis, 2007; McDonald et al., 2011;
www.cancer.gov).
There are many factors which may directly or indirectly be involved in RT
resistance. Hypoxia, in which solid tumors often grow, is known to cause RT
resistance (Moeller et al., 2007; Karar and Maity, 2009, Meijer, 2012). Reactive

99

free radicals and reactive oxygen species produced by irradiation are known to
damage DNA (Moeller et al., 2007; Karar and Maity, 2009; Meijer, 2012). The cells
with damaged DNA succumb to cell death. The presence of oxygen is known to
facilitate RT-induced DNA damage, while hypoxia can enhance RT resistance. In
addition, hypoxia-inducible factor -1 (HIF-1) and its downstream target genes are
known to alter tumor glucose metabolism and inhibit cell death, both of which are
known to enhance RT resistance (Moeller et al., 2007; Karar and Maity, 2009;
Meijer, 2012). Cancers are known to aberrantly express certain factors that
enhance radiation-induced cell death. Notably, survivin, a member of Inhibitor of
Apoptosis Protein family, is known to increase radiation resistance in many solid
tumors, including HNSCC (Pennati et al., 2012, Farnebo et al., 2011; Rodel et al.,
2011). Although mechanisms of RT resistance are still being investigated, tumor
repopulation during and after irradiation also contributes to RT resistance (Kim and
Tannock, 2005).
c) Recurrence.
Head and neck squamous cell carcinoma has a poor overall prognosis and a high
tendency to recur. Approximately, half of the patients eventually have recurrence
within 12 months after the initial RT treatment ref. Clinically, tumor development
within three years and 2 cm or less, proximal to the primary tumor site is
considered as local relapse. Tumor development for more than three years or
more than 2 cm removed from the primary site is considered to be a secondary

100

tumor (Leemans et al., 2011). Most patients with recurrence may receive palliative
treatment, as re-irradiation and salvage by second surgery are not recommended.
Although chemotherapy can be used in recurrent patients, the median survival
range is approximately 5- to 8- months (Vermorken, 2005).
Three factors can be considered in HNSCC recurrence. 1) the cancer was not
resected or treated completely; microscopically, residual cancer cells still persisted
at the time of initial treatment. 2) The field cancerization theory, the most
accepted hypothesis in cancer development, proposes molecular alteration and
cellular damages contributing to cancer development. Sometimes called pre-
neoplastic fields, in which the area made up of genetically altered tissues can
produce another primary recurrence (Fig 4-6 and 4-7). 3) Cancer stem cells may
be linked to cancer recurrence, as several studies showed higher presence of
increased stem cell markers in cancer patients. Currently, however, the concept of
cancer stem cell existence is still controversial (Mannelli and Gallo, 2012; Begg,
2012; Siddique and Saleem, 2012; Chinn et al., 2012).

101

Figure 4-6: Head and neck cancer recurrence (Reference: adapted from
www.hoku-iryo-u.ac.jp, University of Hokkaido Health Sciences)

102

Figure 4-7: Field cancerization which may cause local relapse. Reference:
Leemans et al., Nature Reviews Cancer, 2011.

4.5: Molecular biology and targeted therapy of HNSCC
One would expect that since 90% or more head and neck cancer is HNSCC, it
would be relatively homogeneous. On the contrary, HNSCC is quite
heterogeneous just like many other types of cancers, genetically and biologically.
The fact that there has been no significant change in 5-year survival rate for the
past 30 years indicates that we still do not know much about the molecular
pathogenesis of HNSCC. Thus, delineating molecular mechanisms of HNSCC
development is crucial for molecular targeted therapeutic discovery and testing of
efficacy and safety in HNSCC treatment. In the following section, I will discuss

103

briefly the molecular pathogenesis of HNSCC and its targeted therapies
established or being tested.
a) TP53 TP53 is the most commonly mutated gene in HNSCC (Nichols et al.,
2012; Skinner et al., 2012; Stransky et al., 2011). In response to cellular stress or
DNA damage (such as double-strand breaks), TP53 can activate p21 and other
proteins to suppress the cell cycle and induce apoptosis (Goh et al. 2010; Olivier et
al., 2010, Negrini et al., 2010). P53 function can also be abrogated by HPV E6
protein via ubiquitination (Scheffner, et al., 1990; Stewart et al. 2004). In either
case, this leads to an absence of cell cycle inhibition and a lack of apoptosis, which
promote the tumorigenic phenotype. There are several TP53 targeted therapies
that restore P53 function under investigation, some of which are in clinical trials
(Bauman et al., 2012; Zandiet al., 2011; Messina, et al., 2011; Roh, 2012; Zache
et al., 2008; Muret et al., 2012).
b) VEGF receptor Growing solid tumors induce neo-angiogenesis, in an attempt
to obtain oxygen and nutrients by producing angiogenic factors, such as VEGF
(Abdollahi and Folkman, 2010; Sitohy et al., 2012). The secreted VEGF binds to
VEGF receptors on vascular endothelial cells, which increases proliferation and
migration of endothelial cells toward tumors (Yigitbasi et al., 2004, Christopoulos et
al., 2011). VEGF may also increase expression of VEGF receptors (VEGFR-1 and
VEGFR-2) in the tumor vasculature by an autocrine mechanism (Jackson et al.,
2002; Kyzas et al., 2005; Smith et al. 2010). VEGF overexpression has been

104

associated with poor prognosis, among head and neck cancer patients (Zang et al.,
2012; Cheng SJ, 2011). For these reasons, VEGF signaling or VEGF receptor
targeted therapies include the use of monoclonal antibody, small molecules, and
chemical inhibitors that are being tested in clinical trials; unfortunately these have
shown limited efficacy (Berlin et al., 2012; Chou and Finn, 2012; You, 2011; Klein
and Grandis, 2010).
c) EGFR. Approximately 50- to 90% of HNSCC overexpress epidermal growth
factor receptor (EGFR), either by gene amplification, increased gene copy number,
increased mRNA stability, or aberrantly enhanced transcription (Irish and Bernstein,
1993; Grandis and Tweardy, 1993; Grandis et al., 1998; Bei et al., 2004; Ang et al.,
2002; Nakazaki et al., 2010). Moreover, the degree of EGFR overexpression
correlates with poor prognosis (Muller et al., 2008; Szabo et al., 2011; Wheeler et
al., 2012). The known ligands for EGFR are EGF, TGF-α, and amphiregulin, all of
which are known to be produced by cancer cells (Grandis and Tweardy, 1993;
Kalyankrishna and Grandis, 2006; Tinhofer et al. 2011; Tsai et al. 2006).
Upon binding of the ligands to the EGFR receptors, the receptor dimerizes and
activates a receptor-associated tyrosine kinase-mediated signal transduction
pathway. The signaling leads to activation of MAPK through the Ras/Raf,
PI3K/AKT, and STAT3 pathways. EGF/EGFR signaling is capable of
simultaneous activation of multiple signaling pathways, which affect cell
proliferation, survival/cell death, migration, invasion, and angiogenesis. Although

105

the EGFR signaling has been extensively studied, the mechanisms by which
receptor dimerization induced by ligand binding occurs, and resultant activation of
signaling have not been thoroughly understood (Gan et al., 2012; Brand et al.,
2011). Recent studies show that HNSCC have frequently truncated EGFR
(EGFRvIII), which can be found in 40-50% of HNSCC patients. In EGFRvIII, exons
2-8 of the coding sequence are deleted. This receptor isoform is generally
expressed only in cancers and can constitutively activate the STAT3 and other
signaling pathways (Sok et al., 2006; Chau et al., 2011; Wheeler et al., 2010).
A number of EGF/EGFR signaling targeted therapies are being tested including
antibody targeting EGFR, small molecule inhibitors, and EGFR tyrosine kinase
inhibitors (Kono et al., 2012; Dequanter et al., 2012; Baba et al., 2012). .
Monotherapy has been shown to have limited success in clinical trials but
combination therapy using one or more modalities, such as irradiation or other
chemotherapy resulted in improved clinical outcome in some phase I/II clinical
trials (Kono et al., 2012; Dequanter et al., 2012; Baba et al., 2012). To date, the
only FDA-approved monoclonal antibody based therapy for head and neck cancer
patients is cetuximab, as a phase III clinical trial showed that there was increased
survival in patients treated with cetuximab in combination with radiation therapy
(Bonner et al., 2006; Bonner et al., 2010).
d) IL6/STAT signaling: Cytokines and chemokines and their corresponding
receptors have been implicated as important mediators in the pathogenesis of

106

cancer (Mukaida and Baba, 2012; Dranoff, 2004). In particular, IL-6 is important in
HNSCC, as it is secreted by HNSCC cell lines in vitro and its levels are similarly
high in the plasma of HNSCC patients (Linkov et al., 2007; Chen et al., 1999).
Upon binding of IL-6 to its receptor, which consists of two subunits, gp130 and
gp80, Janus kinase (JAK) tyrosine kinase is activated and in turn phosphorylates
STAT3. STAT3 activation and translocation into the nucleus induces transcription
of several genes that are important for cell proliferation, invasion, and motility.
However, over-activation of IL-6/STAT3 signaling may contribute to cancer
progression (Guo et al. 2012). In fact, overexpression of IL-6 is correlated with
poor survival and more recurrence in HNSCC patients (Duffy et al., 2008; Meyer et
al., 2010). There are several IL-6/IL-6R targeted therapies for NHSCC cancer in
various stages of development in clinical trials, including STAT3 decoy, JAK1/2
inhibitors, and monoclonal antibodies against IL-6 (Sansone and Bromberg, 2012).
e) TGF-β β β β pathway: Transforming Growth Factor-β (TGF-β) is another important
cytokine in cancers, including head and neck squamous cell carcinoma. The TGF-
β signaling pathway is activated by binding of TGF-β to the TGF-β receptors
(TGFBR-1 and TGFBR-2), which causes the formation of SMAD complex
(Leemans et al., 2011). . The complex then translocates into the nucleus to
activate targeted gene transcription (Leemans et al., 2011). The TGF-β pathway
can also induce a non-SMAD mediated pathway, through regulation of Rho-like
GTPases, the latter are involved in controlling cytoskeletal organization and cell

107

motility (Zhang, 2009). Many TGF-β induced genes are known to suppress cell
proliferation and activate apoptosis; this factor also plays important roles in
immune system activation.
Down-regulation of TGF-β receptor and SMAD are often found in many types of
cancer, including head and neck cancer (Leemans et al., 2011; Malkoski and
Wang, 2012). Aberrant TGF-β signaling components are associated with poor
survival and prognosis in head and neck cancer patients (Mangone et al., 2010).
A loss of TGF-β signaling leads to an increased cyclin-dependent kinase (CDK)
activity due to reduction of endogenous CDK inhibitors, such as p15 (Sandhu et al.,
1997). Pharmacological CDK inhibitors, such as seliciclib, are being tested in
clinical trials but have shown limited efficacy (Benson et al., 2007; Mihara et al.,
2002).
f) Tumor microenvironment: Alterations in the cellular microenvironment
surrounding stromal cells and endothelial cells, often occurring in head and neck
cancer, support cancer progression. For instance, hepatocyte growth factor (HGF)
secreted by stromal fibroblasts, activates Akt/MAPK in head and neck squamous
cell carcinoma, which in turn increases IL-8 and other growth factors that promote
angiogenesis, invasion, metastasis, and proliferation (Klein and Grandis, 2010; Le
et al., 2012). In addition, VEGFR, PDGFR, and matrix metalloproteases are often
overexpressed in fibroblasts and endothelial cells adjacent to cancer, which all
contribute to tumor progression. There are numerous targeted inhibitors against

108

factors overexpressed in the tumor microenvironment, which are currently being
tested in head and neck cancer patients. However, these studies are either at
early stages or have demonstrated very limited success in improving disease
outcome (Klein and Grandis, 2010; Fountzilaset al., 2010; Witschet al., 2010).
4.6. miRNA and its roles in cancer
a) The discovery, biogenesis and function of miRNA
miRNAs are a small non-coding RNAs which are endogenously produced and
have been found to post-transcriptionally regulate gene expression. The first
miRNA was discovered in worms in 1993, as a ~22 nucleotide non-coding RNA
which regulates key developmental transitions in larvae of C. elegans. Later,
miRNAs were determined to be evolutionarily conserved, and found in many
different species from plants to humans (Lee and Ambros, 2001; Fabian and
Sonenberg, 2012). It has been estimated that approximately 30% of human genes
could be regulated by miRNAs (Filipowicz et al., 2008).
miRNAs are transcribed mostly by RNA polymerase II or by RNA polymerase III in
some cases as a pri-miR. The transcript typically has a 5’-cap and 3’-poly-A tail
and may contain several precursor miRNAs, each of which forms a hairpin
structure required for further processing. The pri-miR undergoes endonucleolytic
processing by RNAse III-like enzyme Drosha and the dsRNA binding partner
DCGR8, yielding a shorter stem-loop like structure (about 70nt) called pre-miR.
While many miRNAs are transcribed from non-coding transcriptional units, some

109

miRNAs are present in introns within protein coding genes, in which case mRNA
splicing and pri-miR processing can occur simultaneously (Kim and Kim, 2007).
After the first processing of miRNA in the nucleus is completed, pre-miR is
exported into the cytoplasm by exportin-5 and Ran-GTP. The pre-miR is further
processed by another RNAse III-like enzyme called Dicer to produce miR duplex
consisting of the guide strand and the passenger strand. The guide strand is
incorporated into RISC, which subsequently recognizes its target mRNA (Fig 4-8;
Liu et al., 2005; Iorio and Croce, 2012).

miRNA can hybridize to with variable complementarity to its target mRNA, which
can induce translation repression followed by deadenylation and mRNA
degradation (Krol et al., 2010; Iorio and Croce, 2012). Translational activation by
miRNA has also been reported due to functional changes in AGO2, which is a key
mediator in mRNA cleavage and a part of the RISC complex (Krol et al., 2010). It
has been reported that the levels of miRNAs can be regulated by miRNases, which
can degrade miRNA and thus affect basal miRNA levels (Groshans and Chatterjee,
2010).

The function of miRNA is essential in animal development as Dicer knockout mice
are embryonic lethal, indicating the important global role of miRNAs (Bernstein et
al., 2003). Additional studies in the past 20 years have demonstrated that miRNAs
play a role in virtually every normal biological function, such as embryonic stem cell

110

self-renewal/differentiation, brain development, skeletal muscle development and
differentiation to name a few, as well as in pathological processes (Praff et al.,
2012; Goljanek-Whysall et al., 2012; Fabian and Sonenberg, 2012; Iorio and Croce,
2012). The discovery of miRNA was a scientifically exciting event as it has added
a new layer of gene regulation control. This also suggests that there may be
additional significant roles of other non-coding RNAs, which will likely be defined in
the near future.

111

Figure 4-7: Biogenesis of miroRNA (ref: Iorio and Croce, 2012)
b) miRNA target prediction
miRNA-mediated post-transcriptional regulation occurs when the miRNA perfectly
or partially base-pairs with a specific target sequence of mRNA usually in the 3’-
UTR. The specificity of miRNA pairing with its target mRNA is determined by the

112

nucleotides 2 to 8 in the 5’ end of miRNA, which often is referred to as the “seed
region” and the targeted sequence in the 3’-UTR of mRNA (Farazi et al., 2011).
Several important factors can be ascribed in terms of predicting which miRNAs
target a certain mRNA. Foremost is the strength of miRNA hybridization to the
target mRNA, which can be described as -ΔG (Gibb’s free energy), and the dgree
to which this relationship is between miRNA and mRNA is evolutionarily conserved.
Other important factors are AU-rich sequence near the miRNA binding site, and
presence of additional miRNA binding sites in the particular mRNA target gene
(Grimson et al., 2007). Currently, there are numerous databases, which are
publicly available, that allow investigators to predict candidate miRNAs for a
particular mRNA. Nevertheless, validation of binding site(s) by site-directed
mutagenesis and functional verification are crucial in making a conclusion of the
miRNA function.
c) miRNA in pathological condition, including cancer.
Roles of miRNAs are implicated in various pathological conditions, such as
hypertension, hepatic fibrosis, and cancer (McDermott et al., 2011). miRNA
mutations may also contribute to human diseases, such as genomic
rearrangement involving miRNA, mutations in miRNA target site in mRNA 3’-UTR,
and mutations in miRNA mature sequences (Fig 4-9; Meola et al., 2009).
Expression levels of miRNAs are often dysregulated in cancer. This is not
surprising as more than half of miRNA genes are localized in the cancer

113

associated genomic regions or fragile sites in which gene deletions or amplification
frequently occur in cancer (Bracken et al., 2009). The first such case was reported
in 2002 by a group led by Croce in chronic lymphocytic leukemia. It was shown
that down-regulation of miR-15α and miR-16 expression was responsible for
upregulating bcl-2 gene expression, contributing to suppression of apoptosis in
cancer cells (Cimmino et al., 2005). Dysregulated miRNA expression levels are
responsible for many physiological processes relevant to cancer development and
progression, such as activity of P53 and other tumor suppressors, cell cycle control,
oncoproteins, EMT, cell death/apoptosis, and neo-angiogenesis (Hermeking, 2012;
Lages et al., 2012; Bracken et al., 2009)
d) miRNA in HNSCC
miRNA studies involving head and neck squamous cell carcinoma began to appear
in 2007, with two reports on miRNA expression profiles of HNSCC cell lines, and
the role of miR-98 in genotoxic response (Tran et al., 2007; Hebert et al., 2007).
Among approximately 70 published papers archived in PubMed on miRNA and
HNSCC as of November 2012, miR-21 appears to be the most frequently
mentioned and the most studied miRNA in HNSCC. Several studies concluded
that miR-21 overexpression was prominent in head and neck cancer cell lines and
human HNSCC tissue samples. miR-21 overexpression was shown to result in
increased cell proliferation, and its target mRNAs appear to be programmed cell
death 4 (PDCD4) and Grainy head-like 3 (Grhl3), the latter is a transcriptional

114

regulator of PTEN (Babu et al., 2011; Scapoli et al., 2010; Tran et al., 2007; Darido
et al. 2011). These studies indicated that miR-21 plays a role in inhibition of
apoptosis and proliferation, the latter mediated by and upregulation of
PI3K/AKT/mTOR pathway in HNSCC. There are approximately 50 miRNA, which
are differentially expressed in HNSCC. However, there are not many miRNAs
which are determined to be causal HNSCC-associated miRNAs (Babu et al., 2011),
as the vast majority of reports are lacking detailed in vitro and/or in vivo functional
studies, miRNA roles with other types of cancer, and targeted mRNAs by various
miRNAs.
e) Future of miRNA in cancer biology.
Delineating the mechanism of miRNA regulation and function in cancer is important
for identifying a clinically useful prognostic biomarker and therapeutic target in
human cancers, including head and neck squamous cell carcinoma. Heterogeneity
has been a major issue in cancer treatment. Thus, classifying cancers using
miRNA profiles may help us to further categorize cancer types. We can also see if
miRNA expression patterns correlate with radiation/chemotherapy responsiveness.
In addition, anti-miR and miR mimics could be used to correct dysregulated
functions in human diseases, including cancer. In fact, one phase II clinical trial
using Miravirsen, an anti-miR against miR-122, produced a positive result in
Hepatitis C treatment in April 2012 (www.santaris.com). Circulating miRNAs in
serum/plasma could serve as a biomarker for cancer and other diseased

115

conditions (Ajit, 2012). In the case of lung cancer, it has been known that miRNA
profiles can predict development and prognosis of cancer and that miRNA profiles
in the early phase and late phase of the disease are different (Boeri et al., 2011).
Thus, it is quite possible that we may be able to identify miRNAs that are
dysregulated in the very early stage(s) of HNSCC.

Figure 4-9: Causes of miRNA dysregulation in cancer (Ref: Chan et al., 2011)

4.7. ICG-001, a small molecule inhibitor for Wnt/β β β β-catenin signaling.
Wnt signaling is one of the most studied signaling systems, and has been shown to
play major roles in embryogenesis, development, and tissue homeostasis (Logan
and Nusse, 2004). Aberrant Wnt signaling is linked to various types of
pathogenesis, including cancer (Clevers and Nusse, 2012). For instance, β-

116

catenin overexpression is a main cause of development of colorectal cancer
(Schneikert and Behrens, 2007). Abnormal Wnt/β-catenin expression is linked to
proliferation and invasion in HNSCC (Ueda et al., 2006; Yang et al., 2006;
Mahomed et al., 2007; Molinolo et al., 2009; Goto et al., 2010; Schultz et al., 2012).
Thus, targeting of Wnt signaling is a rational therapeutic target for cancer.
However, Wnt signaling is extremely complex as one ligand can bind to multiple
Wnt receptors and activate multiple gene transcriptional or inhibitory pathways.
Co-activators also appear to play a role in the signaling cascade (Angers and
Moon, 2009).
There are number of small molecule inhibitors, which have been developed to
inhibit Wnt signaling, e.g. β-catenin/TCF complex, in an attempt to inhibit growth of
cancer cells. However, targeting β-catenin/TCF complex itself is elusive as it has a
large binding surface that is not dislodged by small molecules easily (Clevers H
and Nusse R, 2012).

ICG-001 is a small molecule inhibitor discovered by a group led by Michael Kahn
via high-throughput screening (Teo and Kahn, 2010). ICG-001 has a molecular
weight of 548 g/mol and its chemical structure is shown

(Fig 4-10). The first
extensive characterization of the small molecule inhibitor was reported by Emami
and coworkers (Emami et al., 2004). The study of the molecular mechanism of
ICG-001 revealed that it specifically interfered with the interaction between CBP

117

and β-catenin, but not the interaction between P300 and β-catenin (Emami et al.,
2004). Furthermore, cDNA microarray analysis revealed that ICG-001 inhibited
expression of survivin and S100A4 at the mRNA level (figure 4-11).
The ICG-001 study by Emami et al. implicated that there is differential
transcriptional regulation depending on which co-activator, CBP or P300, binds to
β-catenin in the Wnt/β-catenin signaling pathway. Other workers showed that
ICG-001 selectively abrogated survivin and S100A4 expression levels, the two
most important proteins known to be overexpressed in many types of solid tumors
(Velculescu et al., 1999; Mishra et al., 2012; Church and Talbot, 2012). Therefore,
ICG-001 has the potential to be an anti-cancer drug. Indeed, ICG-001 has been
shown to selectively induce apoptosis in colon cancer cell lines, while apoptosis of
normal colon cells was not affected (Emami et al., 2004), thus demonstrating the
specific mode of action of ICG-001in cancer cells.
Inhibition of β-catenin/CBP-signaling led to neuronal differentiation and neurite
outgrowth in a mouse model (Teo et al., 2005). In an ES cell study, ICG-001
significantly increased the β-catenin/P300 interaction at the expense of the β-
catenin/CBP interaction. Conversely, when the β-catenin/P300 interaction was
inhibited using another small molecule inhibitor, IQ-1, the pluripotency of mouse
ES cells was significantly maintained (Miyabayashi et al., 2007). In another study,
inhibition of β-catenin/CBP signaling reversed bleomycin-induced lung fibrosis,
preserved the normal epithelium, and improved survival in mice (Henderson et al.,

118

2010). These studies underscore the important roles of Wnt/β-catenin/CBP
signaling in regulating normal and disease physiological processes.
Survivin enhances radiation resistance in solid tumors (Lu et al., 2004; Konduri et
al., 2009; Farnebo et al., 2011) and S100A4 is known as an important metastatic
factor (Mishra et al., 2012). The increased expression of survivin and S100A4 is
implicated in chemotherapeutic resistance (Cheung et al., 2011; Rodel et al., 2011;
Mencia et al., 2010; Mahon et al., 2007).

Figure 4-10: The chemical structure of ICG-001.

Figure 4-11: The mode of action of ICG

Chapter 5: Inhibition of β β β β
sensitivity and reverses Epithelia
The dismal 5-year survival rat
changed in the last three decades
metastasis, in spite of intense surgical and chemo
Besides surgery, radiation therapy (RT) is the most effective treatment
has serious side-effects. Thus, RT is not
who have had prior RT. Moreover, some HNSCCs are
necessitating the need for alternative strategies.
resistance to radiation therapy
mediated by DNA and cellular damages.
11: The mode of action of ICG-001.
β β β β-catenin/CBP signaling enhances chemo
sensitivity and reverses Epithelial-to Mesenchymal Transition (EMT)
and neck cancer.
year survival rate for advanced stage HNSCC of <30% has not
decades. It is a result of local and nodal recurrences
in spite of intense surgical and chemo-radio therapies.
Besides surgery, radiation therapy (RT) is the most effective treatment
effects. Thus, RT is not prescribed in recurrent HNSCC patients
RT. Moreover, some HNSCCs are radiation resistant,
need for alternative strategies. It has been thought that
radiation therapy in cancer is mainly caused by abnormal cell death
DNA and cellular damages. Studies suggest that increased
119

chemo-radiation
to Mesenchymal Transition (EMT) in head
0% has not
recurrences, and
Besides surgery, radiation therapy (RT) is the most effective treatment; however, it
ent HNSCC patients
resistant,
It has been thought that
in cancer is mainly caused by abnormal cell death,
Studies suggest that increased

120

expression of survivin, a member of Inhibitor of Apoptosis Protein (IAP) family,
contributes to radiation resistance in cancer (Chakravarti et al., 2004; Saxena et al.,
2005; Lu et al., 2005; Rodel et al., 2005; Asanuma et al., 2002; Shen , et al., 2012).
Metastasis is the spread of cancer to other parts of the body, which can be either
proximal or distant. In HNSCC, loco-regional failure of therapies due to metastasis
is responsible for most of the cancer deaths. Although the detailed molecular
mechanism of metastasis is not yet elucidated, it is thought that epithelial-to-
mesenchymal transition (EMT) plays an important role in metastasis (Fig 5-1;
Bracken et al., 2009; Gavert and Ben-Zeev; 2008). EMT can be characterized by a
change in morphological characteristics of cells, from epithelial-like to
mesenchymal-like, and is associated with molecular changes in the master
transcription factors, such as twist and snail (Fig 5-1). Although EMT plays an
essential role in gastrulation during embryogenesis and normal wound healing,
cancers are known to exhibit EMT characteristics during metastasis or invasion.

121

Figure 5-1: Schematics of molecular mechanisms of metastasis (ref: Bracken et al.,
2009)

ICG-001 is a small molecule inhibitor that specifically disrupts CBP and β-catenin
binding. It has been shown to suppress the expression of survivin and S100A4 in
colorectal cancer (Emami et al., 2004). Since survivin is implicated in
radiation/chemotherapy resistance and S100A4 is one of the EMT markers, the
small molecule inhibitor has a potential as an anti-cancer agent.
Hypothesis: The small molecule inhibitor ICG-001 augments sensitivity to
radiation/chemo therapy and reverses EMT in head and neck cancer by
modulating CBP/β-catenin signaling pathway. Therefore does ICG-001 augment
sensitivity to chemoradiation therapy and prevent metastasis in head and neck
cancer cells?

122

To address this, we have developed the following specific aims:
Specific Aim 1: Determine the anti-proliferative activity of ICG-001 and its possible
effect in enhancing radiation sensitivity in human head and neck squamous cell
carcinoma cell lines.
Specific Aim 2: Determine the molecular mechanism of enhanced radiation
sensitivity in HNSCC pre-treated with ICG-001.
Specific Aim 3: Determine the molecular mechanism of ICG-001 mediated
inhibition in EMT in head and neck squamous cell carcinoma cell lines.
Specific Aim 4: Determine whether EGFR antagonists in combination with ICG-
001, have additive or synergistic effect on proliferation of HNSCC.
5.2: Experimental Procedures:
Cells culture and reagents: Human head and neck squamous cell carcinoma cell
lines SCC-15 and SCC-71 were purchased from American Type Culture Collection.
USC-HN1 is derived and established by Sinha lab and Epstein lab (Liebertz et al.,
2010). All SCC cells were cultured in DMEM containing 10% FBS and 100 units/ml
penicillin and 100 μg/ml streptomycin (Corning/Cellgro, Manassas, VA) and grown
in a humidified incubator with 5% CO
2
at 37° C. ICG-001 was kindly provided by
Michael Kahn’s laboratory at University of Southern California. Cetuximab is
provided by BMS (New York, NY). Irradiation was performed using a Gammacell
40 irradiator with a
137
Cs source, located in the USC/Norris Cancer Center.

123

Transfection and Luciferase assay: All SCC cells were transfected using
Nucleofector kit V and the Nucleofector electroporation apparatus (Lonza, Basel,
Switzerland). For each electroporation, 2X10
6
cells were used. The plasmids
used in the studies were TOPGAL/FOPGAL, pGL-survivin-promoter luciferase
construct containing 585 nucleotides upstream of the initiating ATG of the human
survivin gene (kind gifts from Dr. Michael Kahn). pGL2-E-cadherin-luciferase and
pGL2-E-cadherin-EBOX mutated-luciferase were purchased from Addgene,
(Cambridge, MA). Cells were co-transfected with β-galactosidase reporter to
standardize the samples for transfection efficiency. The transfected SCC cells
were grown overnight then treated with or without ICG-001 for 24 hours. The cells
were harvested and assayed for luciferase expression using luciferase detection kit
and β-galactosidase was determined using the beta-galactosidase assay kit
(Promega, Madison, WI).
Western blotting and immunohistochemistry: SCC cells were harvested in
RIPA buffer (1 mM EDTA, 150 mM NaCl, 50 mM Tris-HCL, 1% NP-40, 0.1% SDS,
0.5% sodium deoxycholate). The whole cell lysates were separated by 10% SDS-
PAGE and transferred onto polyvinylidene difluoride membranes. Non-specific
binding was blocked by incubating membranes with 5% milk in Tris-buffered saline
with 1% Tween-20 (TBST). The blots were incubated with primary antibodies in
the 5% milk blocking buffer overnight at 4° C and fo llowed by incubation with the
secondary antibody for one hour at room temperature. The primary antibodies

124

used in this study were anti-survivin (Novus Biologicals, Littleton, CO), anti-E-
cadherin, anti-EGFR (Cell Signaling Technology, Danvers, MA), and anti-beta-actin
(Sigma-Aldrich, St. Louis, MO). The anti-rabbit, anti-goat, and anti-mouse IgG-HRP
secondary antibodies were obtained from Santa Cruz Biotechnology (Santa Cruz,
CA). The ECL-detection reagent (Pierce/Thermo Scientific, Rockford, IL) was used
to detect protein bands. The detected bands were normalized to beta-actin
expression.
For immunohistochemistry, the SCC cells were fixed with 4% paraformaldehyde,
blocked with 5% normal goat serum, and incubated with the primary antibody
overnight at 4° C. The cells were incubated with Cy2 conjugated IgG secondary
antibody for one hour at room temperature. The cells were counter stained with
DAPI (Life Technologies, Carlsbad, CA). The primary antibodies were the same as
in the western blotting. The secondary antibodies were purchased from Jackson
ImmunoResearch (West Grove, PA). Images were obtained with a confocal
fluorescence microscope (LSM510, Zeiss, Switzerland) or a standard fluorescence
microscope (Eclipse TE300, Nikon, Japan), and processed by the MetaMorph
software (Molecular Devices, Sunnyvale, CA).

Real-time RT-PCR: After incubation with ICG-001 for the indicated time, RNA
from SCC cell lines were isolated using Trizol reagent (Life Technologies, Carlsbad,
CA). mRNA expression level was determined using the one-step RT-PCR kit
(BioRad, Hercules, CA) with the following primers: survivin fw 5’-AGC CCT TTC

125

TCA AGG ACC AC-3’ ; survivin rev 5’-GCA CTT TCT TCG CAG TTT CC-3’;
cyclin-D1 fw 5’-ATG TGT GCA GAA GGA GGT CC-3’; cyclin-D1 rev 5’-CTT AGA
GGC CAC GAA CAT GC-3’; S100A4 fw 5’-GGT GTC CAC CTT CCA CAA GT-3’;
S100A4 rev 5’-GCT GTC CAA GTT GCT CAT CA-3’; slug fw 5’-CCC AAT GGC
CTC TCT CCT CTT T-3’; slug rev 5’-CAT CGC AGT GCA GCT GCT TAT GTT T-
3’; E-cadherin fw 5’-GGA ACT ATG AAA AGT GGG CTT G-3’ ; E-cadherin rev 5’-
AAA TTG CCA GGC TCA ATG AC-3’ EGFR fw 5’- GGA GAA CTG CCA GAA
ACT GAC C-3’ ; EGFR rev 5’- GCCTGCAGCACACTGGTTG-3’; GAPDH fw: 5’-
ACC TGC CAA GTA CGA TGA CAT C-3’; GAPDH rev: 5’-GTA GCC CAG GAT
GCC CTT GA-3’. Real-time qRT-PCR was performed using ABI 7900HT (Life
Technologies, Carlsbad, CA). The amplification protocol was set as follows:
denaturation at 95 ° C for 10 min followed by 40 cyc les of 15 seconds of
denaturation at 95 ° C, 30 seconds of annealing/exte nsion, and data collection at
60 ° C. Relative mRNA abundance was calculated and normalized to the levels of
GAPDH as follows: ΔCt=Ct-
genes
– Ct-
GAPDH
, and ΔΔCt=ΔCt-
sample
– ΔCt-
reference
.

Clonogenic Colony Assay: 2X10
4
HNSCC cells were seeded in 35 mm cell
culture dishes and grown overnight. The cells were incubated with or without ICG-
001 at 10 μM and were irradiated at 2.5, 5, or 10 Gy. Thereafter, media was
replaced every 3 days. After 14 days of culture, the colonies were stained with
0.5% crystal violet in 20% methanol. Colonies with cells greater than 50 were
counted.

126

Cell Death and Apoptosis Assays: Cells were pre-incubated with ICG-001 at 10
μM overnight, followed by irradiation at the indicated dose. After 48 hours, cells
were harvested and stained for caspase activity detection using Caspase-Glo 3/7
and caspase-Glo 6 assay kits (Promega, Madison WI) or Sytox green dead cell
staining reagent (Life Technologies, Carlsbad, CA) according to the manufacturer’s
instruction. The caspase activity was measured using a luminometer. The
imaging of Sytox-Green cells was captured using fluorescence microscope using
488nm channel. In the Sytox-green staining, DAPI was also used to counterstain
the nucleus. For counting, percentage of Sytox-green positive cells was
normalized with total number of cells.

Proliferation Assay: SCC cell lines were treated with different concentrations of
ICG-001with or without radiation (0, 2.5, 5, 10Gy). After 24 or 48 hours, cell
proliferation was assessed by trypan blue exclusion assay (Sigma Aldrich, St.
Louis, MO) or WST-1 assay (Roche, Mannhelm, Germany). The percentage cell
growth for each test group was normalized to the control group.

127

Invasion Assay: Matrigel invasion chambers with 8 μm pore size were used for
migration assay (BD Bioscience, Billerica, MA). SCC-71 cells were seeded at 5 ×
10
4
in 1% serum media to the upper chamber. 10% serum media was added to
the lower chamber. Cells were grown overnight then treated with or without 10 μM
ICG-001 for 48 hours. Cells on the surface of the upper chamber were removed by
swiping with cotton swabs. The cells in the chambers were fixed with 70% ethanol
and stained with 1% Toludine blue solution. The number of invaded cells in the
lower chamber was determined by light microscopy. The invaded cells were
counted in five random visual fields for each experiment. The data are shown as a
mean +/-s.d. for three independent experiments.
Statistical Analysis: The data were expressed as the means +/- standard
deviation and statistical analysis using InStat3 (GraphPad, San Diego, CA).
Statistical significance was set as p<0.05.

128

5.3: Results.
Treatment with ICG-001 has anti-proliferative effect on HNSCC cell lines.
Previous studies show that ICG-001 reduced cell viability in colorectal cancer cell
lines while there was essentially no cytotoxic effect in normal colon cells (Emami et
al., 2004). Thus, we examined if the small molecule inhibitor, ICG-001, had an
anti-proliferative effect in head and neck cancer cell lines. We tested three
HNSCC cell lines: SCC-71, SCC-15 and USC-HN1. Three different doses of ICG-
001 were tested and cell viability was determined using WST-1 assay at 24 and 48
hours after the treatment with ICG-001. ICG-001 treatment reduced viability of cells
in a dose-responsive manner in all three HNSCC cell lines tested (the data from a
representative cell line is shown in fig.5-1). There was up to ~60% inhibition in the
viability of HNSCC.
The reduced cell viability could occur either by inhibition in cell proliferation or cell
death or both. ICG-001 has been shown to inhibit expression of cyclin D1 in
colorectal cancer (Emami et al., 2004). Cyclin D1 is involved in G1-S transition
during the cell cycle. Cyclin-D1 forms a complex with cyclin-dependent kinases
and the complex is known to phosphorylate Rb protein, thereby initiating DNA
replication (Carlos de Vicente et al., 2002; Albrecht and Hansen, 1999). In order to
test if ICG-001 may be involved in slowed cell cycle progression, we measured the
expression level of Ki-67. Ki-67 is a classical cell cycle marker expressed during
the cell cycle (G1, M, G2, S-phases) and is absent during G
o
phase. The degree

of Ki-67 positive cells in cancer
and clinical prognosis of cancer (Cordes
cell lines were incubated with ICG
then stained with for Ki-67. As
was reduced in a dose responsive manner.
that ICG-001 reduced the number of
proliferation.
Figure 5-1: Inhibiting β-catenin/CBP signaling by ICG
cells in a dose-dependent manner.
three independent experiments
n cancer has been shown to correlate with the progression
cancer (Cordes, et al., 2009; Tonini et al., 2008). HNSCC
cell lines were incubated with ICG-001 at three different doses for 24 hours and
67. As shown in Fig. 5-2, the number of Ki-67 positive cells
was reduced in a dose responsive manner. Taken together, these data showed
001 reduced the number of viable cells, possibly due to inhibition in

tenin/CBP signaling by ICG-001 reduced viable HNSCC
dependent manner. The data are shown as the mean
three independent experiments. Control vs ICG-001treated, P<0.01.
129
correlate with the progression
et al., 2009; Tonini et al., 2008). HNSCC
three different doses for 24 hours and
67 positive cells
Taken together, these data showed
cells, possibly due to inhibition in
001 reduced viable HNSCC
+/-s.d. from

Figure 5-2: Treatment of HNSCC cell
decreased the number of dividing

Treatment of HNSCC cell lines with ICG
mediated target gene expression leve
ICG-001 specifically interferes
thereby reducing expression levels of its downstream target genes, notably
S100A4, and cyclin D1 (Emami et al., 2004; Teo and Kahn, 2010).
examined the effect of ICG-
HNSCC cell lines. The SCC
with ICG-001 at two different
and subjected to real-time RT

Treatment of HNSCC cell (SCC-71) with ICG-001 at 5, 10, and 25
dividing cells.
Treatment of HNSCC cell lines with ICG-001, reduces CBP/β β β β-catenin
target gene expression levels of Cyclin D1, Survivin and S
interferes with the binding between CBP and β-catenin
thereby reducing expression levels of its downstream target genes, notably
S100A4, and cyclin D1 (Emami et al., 2004; Teo and Kahn, 2010). Thus, we
-001 on the expression of down-stream target genes in
The SCC-71, SCC-15, and USC-HN1 cell lines were treated
different drug doses for 48 hours. mRNAs were harvested
time RT-PCR. ICG-001 treatment significantly reduced
130
, 10, and 25 μM
catenin
ls of Cyclin D1, Survivin and S100A4.
catenin,
thereby reducing expression levels of its downstream target genes, notably survivin,
Thus, we
stream target genes in
were treated
48 hours. mRNAs were harvested
001 treatment significantly reduced the

131

expression of Survivin, S100A4 and Cyclin D1 mRNAs in all three HNSCC cell
lines, a representative result is shown in Figure 5-3. The mRNA levels of Cyclin-
D1 was not significantly affected at 5 μM but was reduced (60 ± 10%) at a higher
dose, viz. 10μM. However, mRNA levels of Survivin and S100A4 gene were
reduced both at 5 and 10 μM, in a dose dependent manner. The mRNA levels of
Survivin were reduced by 50 ± 10% and 75 ± 18% by ICG-001 at 5 μm and 10 μM,
respectively. Additionally, the mRNA levels of S100A4 were reduced by 60 ± 15%
and 80 ± 12% by ICG-001 at 5 μm and 1 0μM, respectively. Taken together, these
results showed that ICG-001 at 10 μM was highly effective in attenuating gene
expression of Cyclin D1, Survivin and S100A4 in HNSCC cell lines.

We hypothesized that ICG-001 treatment may enhance radiation sensitivity by
reducing survivin expression, a marker of cellular proliferation. SCC-71 cells
were treated with 10 μM ICG-001 for 48 hours followed by Western blotting with
antibody to survivin. As shown in Figure 5-4A, treatment with ICG-001 (10 μM)
significantly reduced survivin protein levels. Furthermore, immunostaining of ICG-
001 treated cells showed reduced survivin expression (green fluorescence) (Figure
5-4B). Next, we examined survivin transcriptional activity in response to ICG-001
treatment. We transfected SCC-71 cells with survivin-promoter-luciferase reporter
plasmid. After transfection, cells were allowed to recover for 24 hours. The cells
were then treated with 10 μM ICG-001 for 24 hours, and cells were harvested for

132

assay of luciferase activity. ICG-001 reduced Survivin promoter activity by ~50%,
while control vector luciferase activity was not affected (Figure 5-4C).
Previous studies show that ICG-001inhibited β-catenin/TCF-mediated transcription
(Emami et al., 2004). To establish that ICG-001 could induce the same effect in
HNSCC, TOPFLASH (TCF-reporter construct) and FOPFLASH (mutated TCF sites
in the reporter) constructs were used to assess the β-catenin promoter activity.
The SCC-71 cells were transfected with either TOPFLASH or FOPFLASH via
electroporation, followed by recovery of cells for additional 24 hours. The cells
were then treated with 10 μM ICG-001and luciferase assay was performed 24
hours later. ICG-001 treatment reduced (60 ± 8 %) the β-catenin/TCF-promoter
activity (TOPFLASH), while it had no effect on the control FOPFLASH reporter
construct, which contains mutated TCF sites (Figure 5-5).

Figure 5-3: ICG-001 treatment
selected target genes: Survivin, SA100A4 and CyclinD1, in HNSCC cell line.
Control vs ICG-001 treated HNSCC cells,

001 treatment attenuated CBP/β-catenin mediated expression of
: Survivin, SA100A4 and CyclinD1, in HNSCC cell line.
001 treated HNSCC cells, P<0.05.
133
mediated expression of
: Survivin, SA100A4 and CyclinD1, in HNSCC cell line.

134

Survivin/Nuclei
Control ICG-001 treated
survivin
β β β β-actin
1 2 3 4 5 6
Lane s #1-3: control
Lanes #4-6: ICG-001 treated cells (10mM)
A) B)
C)

Figure 5-4: Survivin expression is reduced in response to ICG-001 treatment. A)
Western blot, B) immunohistochemistry, and C) survivin promoter luciferase
activity. Control vs. ICG-001 treated HNSCC, P<0.05.

Figure 5-5: ICG-001 treatment reduces TOPFLASH (TCF promoter activity) but
does not affect FOPFLASH (mutated TCF promoter) activity
treated HNSCC, P<0.05

ICG-001 pre-treatment enhanced r
To examine the effect of ICG
first tested cell lines, SCC-71 and USC
resistant to irradiation at a dose of
utilizing WST-1 assay (data not shown).
overnight, and then treated with ICG
irradiation at a dose of 2.5 Gy and
viability of cells was tested by WST

001 treatment reduces TOPFLASH (TCF promoter activity) but
does not affect FOPFLASH (mutated TCF promoter) activity. Control vs. ICG
treatment enhanced radiation sensitivity in HNSCC.
To examine the effect of ICG-001 treatment in enhancing radiation sensitivity, we
71 and USC-HN1, as these cell lines were relatively
at a dose of 2.5 Gy as determined by cell viability assay
1 assay (data not shown). Briefly, cells were first seeded, grown
treated with ICG-001(10 μM) for 12-18 hr, followed by
Gy and incubation for additional 48 hours at 37° C.
was tested by WST-1 assay. The viability of SCC-71 cells was not
135
001 treatment reduces TOPFLASH (TCF promoter activity) but
Control vs. ICG-001

001 treatment in enhancing radiation sensitivity, we
relatively
cell viability assay
cells were first seeded, grown
hr, followed by
at 37° C. The
71 cells was not

136

affected by irradiation alone (Figure 5-6A). However, pretreatment of SCC-71 with
ICG-001 followed by radiation treatment resulted in an additional 50% increase in
cell death or reduced viability of cells, above the level observed with ICG-001 alone
(Figure 5-6A). A similar result was obtained in USC-HN1 cells (data not shown).
To further examine the ability of ICG-001 to sensitize HNSCC for radiation therapy,
clonogenic colony assay was performed on both SCC-71 and USC-HN1 cell lines.
The advantage of clonogenic colony assay is that it often reflects more closely to
the in vivo behavior of cancer cells. The cells were seeded at low density that
each resulting cell colony arose from a single cell. The cells were irradiated at
three different doses, 2.5 Gy, 5 Gy, and 10 Gy, followed by incubation in the
absence and presence of ICG-001 (10 μM) for 14 days. As shown in Figure 5-6B,
the surviving viable cell fraction for the ICG-001 treated SCC cell lines was
significantly lower than for the control at different doses of radiation. At a radiation
dose of 5 Gy, ICG-001 reduced the surviving cell fraction by 80% compared to
30% of surviving cell fraction without ICG-001 (A representative experiment of
SCC-71 is shown in Figure 5-6B).
The survivin mRNA expression level remained low in the ICG-treated group with or
without radiation, as determined by real-time qRT-PCR (Figure 5-7). These data
showed that inhibiting β-catenin/CBP signaling by ICG-001 enhanced radiation
sensitivity in HNSCC cell lines.

Figure 5-6: ICG-001 treatment enhanced radiation sensitivity. A) Cell viable assay
by WST-1 assay. B) Clonogenic colony assay
±s.d. for three independent experiments

001 treatment enhanced radiation sensitivity. A) Cell viable assay
1 assay. B) Clonogenic colony assay. The data are shown as the mean
three independent experiments, with each experiment done in
P<0.05
137

001 treatment enhanced radiation sensitivity. A) Cell viable assay
data are shown as the mean
with each experiment done in triplicate.

Figure 5-7: Expression of survivin mRNA in SCC
followed by exposure to radiation dose of 2.5
S.D. for three independent experiments

Pre-treatment of HNSCC cells with ICG
death due to apoptosis.
We hypothesized that pre-treatment with
mediated by irradiation. To test this, SCC
ICG-001 overnight. Next, cells were
by incubation for 48 hours, and
nucleic acid stain. The dye cannot penetrate cells unless their plasma membranes
are compromised, such as in dead cells (Life Technologies/ Invitrogen). Thus,
only dead cells exhibit the nuclear

Expression of survivin mRNA in SCC-71 cells pretreated with ICG
followed by exposure to radiation dose of 2.5 Gy. The data are shown as a mean
three independent experiments. P<0.05.
treatment of HNSCC cells with ICG-001 augments radiation mediated cell

treatment with ICG-001 will potentiate cell death
. To test this, SCC-71 cells were treated with or without
cells were exposed to irradiation or untreated
for 48 hours, and then stained with Sytox-green, a cell-impermeant
The dye cannot penetrate cells unless their plasma membranes
are compromised, such as in dead cells (Life Technologies/ Invitrogen). Thus,
nuclear staining. As shown in Figure 5-8A, a s
P<0.05
138
71 cells pretreated with ICG-001
Gy. The data are shown as a mean ±
001 augments radiation mediated cell
death
with or without
irradiation or untreated, followed
impermeant
The dye cannot penetrate cells unless their plasma membranes
are compromised, such as in dead cells (Life Technologies/ Invitrogen). Thus,
8A, a significant

139

increase in cell death was observed after ICG-001+irradiation treatment as
compared to irradiation or ICG-001 treatment alone. Approximately 4% of
irradiated cells and 12% of ICG-001 treated cells were Sytox-Green positive while
approximately 20% of the cells treated with irradiation + ICG-001 combination were
Sytox-Green positive (Figure 5-8B).
ICG-001 has been shown to induce apoptosis selectively in colorectal cancer cell
lines but not in normal colon cells (Emami et al., 2004). Our studies showed ICG-
001 did not increase caspase 3/7 activity in HNSCC, even with irradiation (data not
shown). However, caspase-6 activity was enhanced (~2-fold) in response to ICG-
001 alone and in combination with irradiation treatment at a dose of 2.5 Gy and 5.0
Gy (Figure 5-8C). ICG-001 alone was ineffective in augmenting caspase-6 activity.
Taken together, these data showed that ICG-001 in combination with irradiation
augmented apoptosis via activation of caspase-6 activity, independently of
caspase-3/caspase-7 activity, the latter are classical markers of apoptosis.

A)
B)

140

C)
Figure 5-8: ICG-001 treatment enhanced cell death in irradiated HNSCC.
A) Immunohistochemistry of
001 treatment and in combination with
positive cells in ICG-001 and/or irradiated SCC
ICG-001 treated or the combination, P<0.05P
pre-treated with ICG-001 fol
irradiated or ICG-001 treated or the combination, P<0.05

ICG-001 treatment of HNSCCs induces epithelial
(EMT)
Epithelial-to-mesenchymal transition (EMT) is thought to be involve
EMT progression is thought to occur when there

001 treatment enhanced cell death in irradiated HNSCC.
Immunohistochemistry of SCC-71 cells stained with Sytox green dye,
in combination with irradiation; B) Percentage of Sytox
001 and/or irradiated SCC-71 cells. Control vs irradiated or
001 treated or the combination, P<0.05P. C) Caspase- 6 activity in SCC
001 followed by irradiation at different doses. Control vs
001 treated or the combination, P<0.05.
of HNSCCs induces epithelial-mesenchymal transition
mesenchymal transition (EMT) is thought to be involved in metastasis.
EMT progression is thought to occur when there is an increase in mesenchymal
141
001 treatment enhanced cell death in irradiated HNSCC.
dye, after ICG-
B) Percentage of Sytox-Green
Control vs irradiated or
6 activity in SCC-71
Control vs
mesenchymal transition
d in metastasis.
mesenchymal

142

markers (Boye and Maelandsmo, 2010), such as S100A4, and a decrease in
epithelial marker such as E-cadherin (Bracken et al., 2009). Treatment of HNSCC
cell lines with ICG-001 led to reduced S100A4 mRNA expression in the HNSCC
cell lines we tested as shown earlier (Figure 5-3).
Thus, we determined the mRNA levels of E-cadherin in SCC-71, SCC-15, and
USC-HN1 with and without ICG-001 treatment after 48 hours. As shown in Figure
5-9A, E-cadherin expression level was increased by ~3- and ~4-fold in response to
5- and 10 μM doses of ICG-001, respectively, in Scc-71 cell line. Similar results
were obtained with SCC-15 and USC-HN1 (data not shown). Next, we
determined the transcriptional activity of E-cadherin in SCC-71 cells, with and
without treatment with ICG-001. In this study, SCC-71 cells were transfected with
E-cadherin promoter luciferase construct, as well as a mutated E-cadherin
promoter construct. The transfected cells were allowed to recover overnight and
treated with or without ICG-001 for 24 hours. ICG-001 treatment increased E-
cadherin promoter activity by ~2-fold, while there was no change in cells
transfected with a mutated E-cadherin promoter construct (Figure 5-9B).
Vimentin is another mesenchymal marker which is known to be overexpressed in
cancer cells undergoing metastasis. Vimentin is a member of type III intermediate
filament family of proteins mainly expressed in mesenchymal cells. Vimentin
participates in wide variety of physiological process, including maintaining cyto-
architecture and tissue integrity, mediating cell signaling and transcription in

nucleus (Satelli and Li, 2011). Overexpression of vimentin is correlated
increased cell motility and invasiveness in many different types of cancer and
blocking its expression by siRNA
aggressiveness (Paccione et al., 2008). We examined if the expression level of
vimentin is attenuated in response to ICG
of vimentin was reduced 40 ±
10μ M of ICG-001, respectively (Fig
USC-HN1, showed similar result

A)

nucleus (Satelli and Li, 2011). Overexpression of vimentin is correlated
increased cell motility and invasiveness in many different types of cancer and
blocking its expression by siRNA has been shown to reduce head and neck tumor
et al., 2008). We examined if the expression level of
ttenuated in response to ICG-001 treatment. Indeed, the mRNA level
40 ± 6% and 75 ± 10% in SCC-71 treated with 5
, respectively (Figure 5-9C). Two other cell lines, SCC
, showed similar results for the expression of vimentin.

143
nucleus (Satelli and Li, 2011). Overexpression of vimentin is correlated with
increased cell motility and invasiveness in many different types of cancer and
reduce head and neck tumor
et al., 2008). We examined if the expression level of
001 treatment. Indeed, the mRNA level
treated with 5 μM and
SCC-15, and

B)
C)

144

145

Figure 5-9: Treatment of HNSCC with ICG-001 increases E-cadherin mRNA and
promoter-luciferase activity, and reduces vimentin mRNA expression, markers of
EMT in SCC-71. A) Treatment of SCC-71 with indicated doses of ICG-001
increases E-cadherin mRNA levels. Control vs. ICG-001 treated HNSCC, P<0.01.
B) Transfection of SCC-71 with E-cadherin promoter reporter construct followed by
ICG-001 treatment augments E-cadherin luciferase activity. Control vs. ICG-001
treated HNSCC, P<0.05. C) Treatment with ICG-001 reduces vimentin mRNA
expression level, another EMT marker. These results showed that ICG-001, in a
dose response manner, affected markers of epithelial-mesenchymal transition
(EMT) in HNSCC. Control vs. ICG-001 treated HNSCC, P<0.05.

Treatment of SCC-71 with ICG-001 reduces invasiveness in a Matrigel assay
EMT is a physiological process that is accompanied by increased cell motility and
tissue invasion. Thus, we examined the functional effect of ICG-001 with respect
to metastatic potential. In this study, we assayed invasion activity in vitro using a
Matrigel-coated Transwell chamber with 8 μM pores. The assay measures the
ability of cells to traverse a Matrigel-coated membrane, which is known to be a
correlate of metastatic potential in vivo. SCC-71 cells were treated with 10 μM
ICG-001 for 48 hours. The migration of SCC-71 cells was attenuated by ~80% by
ICG-001 treatment compared to the non-treated control in a Matrigel invasion

146

assay (Figure 5-10). These results showed that ICG-001 inhibited invasiveness of
HNSCC.

Treatment of SCC-71 with ICG-001 attenuates expression of Twist-1 and
Slug-1, repressors of E-cadherin
E-cadherin transcription is regulated by transcriptional repressors of E-cadherin
that function by binding to E-box elements located on the E-cadherin promoter.
We hypothesized that transcriptional repressors, Twist-1 and Slug were attenuated
by ICG-001, thereby enhancing E-cadherin expression. The mRNA levels of
Twist-1 were reduced by 40 ± 17% and 75 ±22 %, by ICG-001 at 5μM and 10 μM,
respectively (Figure 5-11, left). Similarly, slug mRNA expression was reduced by
ICG-001 treatment in a dose dependent manner (Figure 5-11, right). These data
showed that ICG-001 reduced the expression of repressors, Twist-1 and slug,
concomitantly leading to increase in E-cadherin expression and thus EMT
transition. Taken together these data showed that ICG-001 reduced the
expression of Twist-1 and slug repressor, which are involved in transcription
regulation of E-cadherin.

Figure 5-10: Treatment of SCC
Matrigel Assay. * = P<0.01.

Treatment of SCC-71 with ICG-001 reduces migration of cells in a
P<0.01.
*
147
001 reduces migration of cells in a

Figure 5-11: The mRNA expression of Twist1 and slug
by ICG-001. Control vs. ICG

ICG-001 treatment of HNSCC
concomitantly cetuximab sensitivity
We hypothesized that inhibiting CBP/
enhance sensitivity to some of the commonly used chemotherapy. Cetuximab, a
humanized mouse monoclonal antibody against EGFR, recently approved
in head and neck cancer patients
combination with radiation in metastatic cancer.
expression of EGFR in head and neck. However, for reasons still unknown,
cetuximab is effective in only 10 to 15% of the head and neck
addition, acquired resistance to cetuximab is a major problem. Thus, we embarked
to examine if ICG-001 treatment could overcome cetuximab resistance.
The mRNA expression of Twist1 and slug in HNSCC was attenuated
Control vs. ICG-001 treated HNSCC, P<0.05.
of HNSCC enhanced expression of EGFR and
cetuximab sensitivity
e hypothesized that inhibiting CBP/β-catenin signaling by ICG-001 may
enhance sensitivity to some of the commonly used chemotherapy. Cetuximab, a
humanized mouse monoclonal antibody against EGFR, recently approved
in head and neck cancer patients, and shown to clinically improve outcome
with radiation in metastatic cancer. This is likely due to over
head and neck. However, for reasons still unknown,
cetuximab is effective in only 10 to 15% of the head and neck cancer patients. In
resistance to cetuximab is a major problem. Thus, we embarked
001 treatment could overcome cetuximab resistance.
148

was attenuated
may also
enhance sensitivity to some of the commonly used chemotherapy. Cetuximab, a
humanized mouse monoclonal antibody against EGFR, recently approved for use
and shown to clinically improve outcome in
over-
head and neck. However, for reasons still unknown,
cancer patients. In
resistance to cetuximab is a major problem. Thus, we embarked
001 treatment could overcome cetuximab resistance.

149

To investigate the capability of ICG-001 to enhance cetuximab sensitivity, SCC-71,
SCC-15, and USC-HN1 were treated with cetuximab (50μg/ml) with or without ICG-
001 (10μM) for 48 hours. Cell viability was assessed by WST-1 assay. As shown
in figure 5-12A, ICG-001 treatment reduced viability of SCC-15 cell line, more than
cetuximab or ICG-001 alone (Figure 5-12A). In contrast, there was statistically no
effect in enhancing cetuximab sensitivity in the other two cell lines (data not shown).
In order to determine possible mechanisms of the enhanced cetuximab sensitivity,
we first examined the expression level of EGFR by ICG-001. Real-time RT-PCR
shows that EGFR mRNA expression level was significantly upregulated in
response to ICG-001 treatment in SCC-15 (Figure 5-12B). Immunohistochemistry
of EGFR expression also showed upregulation of EGFR (Figure 5-12C). It is
noteworthy that EGFR mRNA level in SCC-15 cells was two to three times higher
than SCC-71 and USC-HN1 and that EGFRvIII level was not affected by ICG-001
treatment (data not shown), suggesting that increase in wild-type EGFR may play a
role in the increased cetuximab sensitivity.

A)
B)

P<0.0

05
P<0.05
150

C)
Figure 5-12: ICG-001 treatment enhanced cetuximab sensitivity and upregulated
EGFR expression in SCC-1
Immunohistochemistry staining of control and ICG
Green fluorescence was used to identify EGFR

Discussion:
Important role of ICG-001 in enhancing radiation sensitivity
Our studies show that ICG-
sensitivity to radiation of HNSCC cell lines.
enhanced cell death in irradiated SCC cell lines, possibly by caspase
apoptosis.
Our study showed ICG-001
was not affected in HNSCC cell lines.

001 treatment enhanced cetuximab sensitivity and upregulated
15: A) Viability assay. B) RT-PCR. C)
Immunohistochemistry staining of control and ICG-001 (10uM) treated SCC
reen fluorescence was used to identify EGFR and counter-stained with DAPI.
001 in enhancing radiation sensitivity.
-001 has anti-proliferative effect and enhance
of HNSCC cell lines. Moreover, we showed that ICG
cell death in irradiated SCC cell lines, possibly by caspase-dependent
001 increased caspase-6 activity, while caspase 3/7 activity
was not affected in HNSCC cell lines. Previous study has shown that ICG
151
001 treatment enhanced cetuximab sensitivity and upregulated
001 (10uM) treated SCC-15.
stained with DAPI.
proliferative effect and enhances
e showed that ICG-001
dependent
6 activity, while caspase 3/7 activity
Previous study has shown that ICG-001

152

increases caspase-3/7 activity in colon cancer cell lines (Emami et al., 2004). The
caspase 3/7, the most commonly tested caspase pathway for apoptosis, was not
enhanced significantly in HNSCC cell lines even after irradiation, and cleaved-
PARP expression changes were inconclusive (data not shown). Studies have
shown that both caspase 3/7 and caspase 6 are the effector caspases, and their
function is to activate endonuclease, which in turn cleave specific substrates (Enari
et al., 1998). Although the activation process of caspase-3/7 is well established,
relatively less is known of caspase-6. Although initiator caspase-8 and -9 can
activate caspase-6, it has also been reported that caspase-6 can self-activate itself
without initiator caspases (Wang, 2010). This potentially novel function of ICG-
001-mediated caspase-6 activation warrants further study to help uncover the
mechanisms of radiation resistance in HNSCC.
The increased expression of survivin in cancer cells has been shown to cause
radiation resistance and its down-regulation sensitize cancers to radiation therapy
(Chakravarti et al., 2004; Saxena et al., 2005; Lu B. et al., 2004; Rodel et al., 2005;
Asanuma et al., 2002; Shen et al., 2012). Our studies showed, ICG-001
attenuated the expression of survivin in HNSCC cell lines, which was further
reduced in response to radiation. These results suggest that attenuation in survivin
expression contributes to enhanced radiation sensitivity in HNSCC cell lines as has
been observed in other cancer. ICG-001 can affect several other downstream
target genes, regulated by CBP/β-catenin pathway (Teo and Kahn et al., 2010);
thus, there may be other factors which may contribute to the enhanced radiation

153

sensitivity. We found expression of several genes involved in EMT was
modulated by ICG-001 treatment, specifically: mesenchymal markers (vimentin
and S100A4) were decreased and an epithelial marker (E-cadherin) was increased.
It has been suggested that cancer stem cells exhibit more radiation resistance,
which may be associated with modulated expression of EMT related gene in these
stem cells (Takebe et al., 2011). At present, there is no supportive evidence,
which shows that EMT has a role in radiation resistance in cancer.
Reversing Epithelial-to-Mesenchymal Transition by ICG-001 treatment. Metastasis
is another factor, which contributes to high mortality rate in head and neck cancer
patients. ICG-001 is known to reduce expression of S100A4 gene (Emami et al.,
2004), a known EMT markers. Our study showed that ICG-001 significantly
reduced expression of S100A4 gene in HNSCC cell lines. Moreover, we showed
that ICG-001 increased expression of E-cadherin, while expression of vimentin was
reduced, showing that EMT was reversed by ICG-001treatment of HNSCC.
Our studies showed that ICG-001 reduced the expression of Twist-1 and slug in
HNSCC. Twist-1 has been shown to act as a repressor of E-cadherin, as it binds
to the E-box sites (CANNTG) on the E-cadherin promoter region (Vesuna et al.,
2008). Slug has been shown to mediate repression of E-cadherin and augment
expression of vimentin, indicating that slug acts as a repressor and an inducer for
different sets of genes (Kim et al., 2012). Hao et al. reported that ICG-001 reduced
fibrosis in kidney by abolishing TGF-β induced expression of snail1 and snail2

154

(also known as slug) (Hao et al., 2011), providing proof that ICG-001 may be
involved in EMT. Moreover, Slug has been shown to act as a direct transcription
target of Twist1, thereby promoting Twist-1 mediated EMT in breast cancer (Casas
et al., 2011). Our studies indicate that ICG-001 reduces the expression of
repressors of E-cadherin transcription, thereby augmenting E-cadherin expression
and concomitantly attenuating or reversing EMT transition of HNSCC.
Our studies, to the best our knowledge, showed for the first time that Twist-1 and
vimentin expression level was significantly down-regulated by ICG-001. The role
of vimentin in EMT transition is relatively less known. Thus, these studies provide
new avenues to delineate the role of vimentin in cancer chemotherapy.
Combination chemotherapy of ICG-001 with Cetuximb augments cell viability in
HNSCC
Since survivin can cause resistance to chemotherapy, we explored whether
combination of chemotherapy could be more effective in killing or inducing
apoptosis in HNSCC. Our studies showed that ICG-001 enhanced the sensitivity
to cetuximab, a commonly used chemotherapy in advanced/metastatic head and
neck cancer. Since Cetuximb mediates its effect via EGFR receptor (Li et al.,
2009), we determined whether ICG-001 modulated expression of EGFR. Our
studies showed that the SCC-15 cell line that showed the most effectiveness in the
combination therapy had the highest EGFR expression level compared to the other
two cell lines, SCC-71 and USC-HN1 (data not shown). However, expression of

155

EGFR vIII (a variant form of EGFR) was not altered by ICG-001 (data not shown).
This suggests that the enhanced cetuximab sensitivity is due to the cell line’s
dependence on EGFR signaling due to wild-type EGFR. It has been reported that
increased membrane bound EGFR re-sensitized against cetuximab (Li et al., 2009)
although the exact mechanism is unknown at this moment. Further studies are
warranted to determine the molecular mechanism of ICG-001 or β-catenin/CBP
mediated upregulation of EGFR. Guturi et al. recently reported that EGFR has a β-
catenin binding site and that β-catenin binding is necessary for its transcription
activation (Guturi et al., 2012). CBP and P300 compete for β-catenin and that ICG-
001 treatment cause dissociation of β-catenin from CBP, thereby increasing pool of
free β-catenin (Emami et al., 2004; Ma et al., 2005). The free β-catenin could be
available to bind to the EGFR promoter, thereby increasing expression of EGFR
gene.
In conclusion, our studies for the first time demonstrated that pretreatment of
HNSCC with ICG-001 increased sensitivity to radiation therapy as demonstrated by
inhibition in proliferation or increased cell death due to apoptosis of HNSCC. We
also found that ICG-001 attenuated epithelia-to-mesenchymal transition, as
demonstrated by reduced tumor invasiveness of HNSCC, as well as reduced
expression of EMT genes, possibly through a novel mechanism involving
repressors (Twist-1 and Slug) of E-cadherin transcription. In addition, our study
demonstrated for the first time that ICG-001 could enhance the sensitivity of the

156

EGFR inhibitor cetuximab. These studies provide new therapeutic approach to
attenuate or ameliorate progression of head and neck cancer.

Future Direction:
Although surgical treatment of head and neck squamous cell carcinoma has
improved in the past 20 years or so, the survival of advanced or metastatic head
and neck cancer patients has not improved as much. There is an urgent need to
improve the effect of chemoradiation therapy and to understand the molecular
mechanisms underlying chemoradiation resistance. The findings from our study
provide new insights into the obstacles for treatment for HNSCC. However, there
were some unanswered questions in our study, which we would like to pursue in
future, so as to shed more light on the molecular mechanisms of cell death in
response to ICG-001 and combination of radiation.
1. To determine the role of caspase-6, independent of caspase-3/caspase-7, in
ICG-001 induced cell death in HNSCC.
Approach: It is proposed to utilize anti-apoptotic Z-VaD or a caspase-6 specific
inhibitor to determine whether these inhibitors could rescue cell death. Since
caspase-6, among other caspases, has been shown to selectively cleave lamin A
(Mintzer et al., 2012), we will measure lamin A degradation as a surrogate to
assess the effect of caspase- 6 in cell death. Finally, ICG-001 could induce cell

157

death via autophagy or cell necrosis, and the expression of genes associated with
autophagy will be examined.
2. To determine whether Twist-1, repressor of E-cadherin, is transcriptionally
regulated by β-catenin/CBP.
Approach: Twist-1 is a helix-loop-helix transcription factor and is one of the known
wnt-activated genes (Howe et al., 2003). In addition, it has been shown that CBP
knockout results in failure of Twist expression in Drosophila (Akimaru et al., 1997).
We will utilize loss and gain of function of β-catenin by expression of shRNA and
expression plasmid for β-catenin, respectively, to determine its effect on Twist-1
expression. Also, ChiP will be performed to assess the binding of CBP and Twist-1.
3. To determine whether Vimentin expression is transactivated by β-catenin/TCF or
CBP.
Approach: Studies have shown that vimentin expression is transactivated by β-
catenin/TCF, which binds to the putative site located 468 bp upstream of the
transcription initiation site of vimentin promoter (Gilles et al., 2003). We will
determine whether the transcription of vimentin gene expression is regulated by
CBP/β-catenin signaling. We will utilize ChIP to determine the occupancy of CBP
in vimentin promoter.
4. To determine the molecular mechanism(s) of ICG-001-mediated enhanced
cetuximab sensitivity in HNSCC

158

Approach: EGFR is a membrane receptor. Upon ligand binding or cetuximab
binding, EGFR internalizes into cytoplasm, in which some of them undergo
degradation (Yoshida et al., 2008; Doody et al., 2007). Recently, however, it has
been reported that EGFR itself could functions as a transcription factor and nuclear
EGFR may alter cetuximab sensitivity (Brand et al., 2011). We will determine the
level of EGFR in different cellular components, such as membrane, cytoplasm, and
nuclear fractions in ICG-001 treated SCC-15 cells. Also, we will extensively
examine the EGFR downstream signaling altered by ICG-001 treatment.
5. To determine the effect of ICG-001 in animal model system to validate the
results obtained in vitro.
Approach: We will utilize mouse model to investigate the efficacy of ICG-001 in
enhancing chemoradiation sensitivity and verify the in vitro data using tissue
samples.

159

Chapter 6: IL-6 mediated signaling in HNSC augments IL-6 receptor
expression via increasing its stability.
6.1: Background and Significance
Interleukin 6 (IL-6) is a pleiotropic cytokine that was originally found and
characterized as a factor regulating the immune response. IL-6 is secreted by
variety of immune cells, such as T-cells, B-cells, as well as adipocytes and
fibroblasts. IL-6 signaling regulates inflammation, hematopoiesis, B-cell
differentiation, and cell growth (Mihara et al., 2012; Kishimoto, 2005). P53 is a
known suppressor of IL-6, which binds to the IL-6 promoter region and inhibits IL-6
transcription. In many type of cancer, p53 is often dysregulated and thus this may
contribute to aberrant IL-6 transcription (Hong et al., 2007). IL-6 signaling is
initiated when IL-6 binds to its cognate receptor, gp130, also known as IL-6Rβ.
The ligand binding causes dimerization of gp130, which triggers a cascade of
signaling through JAK-STAT, Ras-MAPK, and PI3K-Akt pathways, all of which are
often dysregulated in head and neck cancers (Molinolo et al., 2009). Gp130 is
necessary as a signal transducer and is ubiquitously expressed in virtually all
tissues (Kishimoto, 2005). However, gp130 alone is thought to be unable to bind
IL-6. IL-6 signaling requires a co-receptor called IL6R, also known as gp80 or
IL6Rα. Membrane bound IL6R is expressed in limited tissues, such as the liver, B-
cells, and macrophages. However, some cancers are known to express IL6R,
which may be responsible for the aberrant IL-6 signaling (Shinriki et al., 2009;

160

Rose-John et al., 2006). Soluble IL6R (sIL6R) can be generated by shedding of
the extracellular domain of the membrane bound IL6R by proteolytic cleavage by A
Disintegrin And Metalloproteinases-10 and 17 (ADAM 10 and ADAM17). Also
sIL6R can be produced from alternative splicing (Chalaris et al., 2011). sIL6R has
IL-6 binding activity and may facilitate binding of IL-6 ligand-sIL6R complex to
gp130 thereby activating IL-6 signaling pathway even in tissues or cancers that
lack IL6R expression (Figure 6-1; Chalaris et al., 2011).

Figure 6-1: Schematic diagram of IL-6 signaling complex (ref: Chalaris et al.,
2011)
As its alternative name gp80 suggests, IL-6R is an 80 KDa protein, located on
chromosome 1q21, and has three different transcript isoforms, variants 1, 2, and 3.
Variant 1 is the longest and considered the membrane bound IL6R (NCBI). The IL-

6R gene encodes a 5 Kb mRNA containing
5’-UTR and 3'-UTR consist
Mutational analyses of IL-6R identified
for IL-6 and gp-130 mediated signaling
amino acids, comprising an IgG
domain, and SHP2 domain (Fig 6
and intracellular regions is 339aa, 28aa, and 82aa respectively (Yamasaki et al.,
1988; Heinrich et al., 1998).
Figure 6-2: Schematic of IL6R (adapted from Heinrich et al., 1998)

Several groups reported that high IL
samples of cancer patients, including head and neck cancer, correlated with poor
mRNA containing a coding region of 1401 bp
of approximately 2.1Kb and 1.5kb, respectively.
6R identified amino acids 106-322 of IL6R as
mediated signaling (Keller et al., 1996). IL6R consists of 468
ing an IgG-like domain, cytokine binding module (CBM)
, and SHP2 domain (Fig 6-2). The size of the extracellular, transmembrane,
339aa, 28aa, and 82aa respectively (Yamasaki et al.,
1988; Heinrich et al., 1998).

of IL6R (adapted from Heinrich et al., 1998)
Several groups reported that high IL-6 expression level found in serum and tissue
samples of cancer patients, including head and neck cancer, correlated with poor
161
a coding region of 1401 bp, while the
respectively.
s responsible
(Keller et al., 1996). IL6R consists of 468
, cytokine binding module (CBM)
extracellular, transmembrane,
339aa, 28aa, and 82aa respectively (Yamasaki et al.,
6 expression level found in serum and tissue
samples of cancer patients, including head and neck cancer, correlated with poor

162

prognosis, metastasis, and increased cancer progression. Although IL-6 signaling
is now perceived as one of key regulators in cancer development, relatively less is
understood of IL-6 mediated cellular signaling mechanism in cancer progression
and metastasis (Wang et al., 2002; Riedel et al., 2005; Duffy et al., 2008; Hong et
al., 2007; Kishimoto, 2005; Waldner et al., 2012; Guo et al., 2012). In addition,
there has been no report on the role of IL-6 in transcriptional regulation of its
cognate receptor, IL6R, and the role of IL6R in cancer progression, including EMT.
To address this, we developed the following specific aims:
Specific Aim1: Does IL-6 participate in its receptor’s transcriptional regulation in
head and neck cancer?
Specific Aim 2: Does IL-6 affect the stability of IL-6R, and if so which miRNAs
bind the 3’UTR of IL-6 R affect post-transcriptional regulation of IL-6R.

6-2Experimental Procedures:
Cell culture and reagents: Human head and neck squamous cell carcinoma cell
lines SCC-15 and SCC-71 were purchased from American Type Culture Collection
(ATCC). USC-HN1 is derived and established by our lab and the Epstein lab
(USC) (Liebertz et al., 2010). All SCC cells were maintained in Dulbecco’s
modified Eagle’s media containing 10% fetal bovine serum supplemented with
100U/ml penicillin and 100μg/ml streptomycin (Cellgro, Manassas, VA). The cells

163

were maintained a humidified incubator with 5% CO
2
at 37° C. Human recombinant
IL-6 was purchased from R&D (R&D Systems, Minneapolis, MN). SCC cells were
incubated in 1% serum media (starving media) overnight prior to IL-6 treatment.
Actinomycin-D was purchased from Sigma-Aldrich (St. Louis, MO).

miRNA isolation and miRNA real-time RT-PCR: miRNA candidates were
determined by using three software programs: TargetScanHuman version 6.1,
DIANA LAB microT, and MicroCosm version 5. miRNA was isolated after the IL6
treatment in HNSCC using the mirVana miRNA Isolation Kit (Life Technologies,
Carlsbad, CA) according to the manufacturer’s instruction. Primers, cDNA
synthesis kits, and RT-PCR kits for miRNA detection were all purchased from Life
Technologies (Life Technologies, Carlsbad, CA). The relative expression was
determined after normalization to U6 snRNA expression. qRT-PCR was done
using an ABI 7900HT instrument (Life Technologies, Carlsbad, CA).

Western Blotting: The cells treated with or without IL6 were lysed using RIPA
buffer (1mM EDTA, 150mM NaCl, 50mM Tris-HCL, 1% NP-40, 0.1% SDS, 0.5%
sodium deoxycholate). The lysates were subjected to 8% SDS-PAGE and were
transferred onto PVDF membranes. The membranes were blocked with 5% milk
and were incubated with primary antibodies at 4C overnight. The following
antibodies were used: anti-IL6R (Abcam, Cambridge, MA), anti-E-Cadherin (Cell
Signaling Technology, Danvers, MA), and anti-β-actin (Sigma-Aldrich, St. Louis,

164

MO) as a control. After washing extensively with TBST, the membranes were
incubated with HRP-conjugated anti-rabbit or mouse IgG (Santa Cruz
Biotechnologies, Santa Cruz, CA) for 1 hour at room temperature. An ECL-
detection kit (Pierce/Thermo Scientific, Rockford, IL) was used to visualize
immunoreactive protein bands. The detected bands were normalized to β-actin
expression for quantitative comparison.

Real-time RT-PCR: Total RNA was isolated using TRIzol Reagent (Life
Technologies, Carlsbad, CA). The relative quantities of specific RNAs were
measured using One-Shot RT-PCR kit (BioRad, Hercules, CA). Real-time qRT-
PCR was performed using ABI 7900HT (Life Technologies, Carlsbad, CA). The
primers used in this study were: IL6R fw 5’-TCA GCA ATG TTG TTT GTG AGT
GG-3’; IL6R rev 5’-TGC TAA CTG GCA GGA GAA CTT-3’; E-cadherin fw 5’-GGA
ACT ATG AAA AGT GGG CTT G-3’ ; E-cadherin rev 5’- AAA TTG CCA GGC TCA
ATG AC-3’, PLGF fw 5’- TGT TCA GCC CAT CCT GTG TC-3’; PLGF rev 5’-ACA
GTG CAG ATT CTC ATC GCC-3’ ; VEGF fw 5’-CGC AAG AAA TCC CGG TAT
AA-3’; VEGF rev 5’-TCTCCGCTCTGA GCA AGG; GAPDH fw: 5’-ACC TGC CAA
GTA CGA TGA CAT C-3’ ; GAPDH rev: 5’-GTA GCC CAG GAT GCC CTT GA-3’

Proliferation Assay: 1X10
^4
cells were seeded in cell culture treated 96-well
plates and grown overnight. SCC cell lines were treated with IL-6 (50ng/ml). After
24 or 48 hours, cell proliferation was measured using the WST-1 assay (Roche,

165

Mannhelm, Germany). The percentage cell growth for each group was normalized
to the control group for comparisons.

Statistical Analysis: The data were expressed as the means +/- standard
deviation and statistical analysis using InStat3 (GraphPad, San Diego, CA).
Statistical significance was set as p<0.05.

6-3: Results.
IL-6 treatment of Scc-71 augments IL6R expression and increases IL6R
mRNA stability.
To examine the role of IL-6 in the regulation of IL6R expression, HNSCC cell lines
were incubated with IL-6 at 50ng/ml for varying time intervals between 2-24hrs.
SCC-71, among the three cell lines tested, showed the highest IL6R mRNA
induction in response to IL-6 treatment. The IL-6R mRNA expression level started
to markedly increase after 4 hours of IL-6 treatment and was maintained at an
induced level up to 24 h (Fig 6-3A). In order to verify that the increased mRNA
expression corresponded to increased translation, we next examined protein
expression levels of IL6R by western blotting. Four hours of IL-6 treatment indeed
increased the protein expression level of IL6R in SCC-71 cells (Fig 6-3B). Next,
we examined the stability of mRNA in response to IL6 treatment. Actinomycin-D is

an antibiotic derived from S
synthesis by preventing RNA elongation (Sobell, 1985). It has been widely
employed to measure mRNA turnover
24 hours of IL-6 treatment (50 ng/ml), actinomycin
media by qPCR. The mRNA was collected
post-actinomycin D treatment
IL6R mRNA by two fold- (control 1.9+/
Taken together, these data showed that IL
receptor IL-6R, possibly through
stability.
Figure 6-3A: IL6 treatment increased IL6R expression level in HNSCC
Control vs IL-6 treated, P<0.05.
Streptomyces and has an ability to halt de novo mRNA
ting RNA elongation (Sobell, 1985). It has been widely
employed to measure mRNA turnover in the absence of de novo synthesis
6 treatment (50 ng/ml), actinomycin-D was added at 5μg/ml in the
media by qPCR. The mRNA was collected and analyzed at 0, 1, 2, 4, and 8 hours
actinomycin D treatment. IL-6 treatment in SCC-71 increased the half
(control 1.9+/-0.1 hours vs IL-6 3.7+/-0.3 hours)
data showed that IL-6 augments expression of its own
6R, possibly through an autocrine loop, and by increasing IL
IL6 treatment increased IL6R expression level in HNSCC
P<0.05.
166
and has an ability to halt de novo mRNA
ting RNA elongation (Sobell, 1985). It has been widely
in the absence of de novo synthesis. After
g/ml in the
and analyzed at 0, 1, 2, 4, and 8 hours
71 increased the half-life of
0.3 hours) (Fig 6-3C).
ments expression of its own
IL-6R mRNA

IL6 treatment increased IL6R expression level in HNSCC.

Figure 6-3B: IL6 treatment increased IL6R protein expression level in HNSCC

Figure 6-3C: IL6 treatment enhanced mRNA stability of IL6R: implication in post
transcriptional regulation. Control vs 1, 2, 4, 8 hour

IL6 treatment increased IL6R protein expression level in HNSCC

IL6 treatment enhanced mRNA stability of IL6R: implication in post
Control vs 1, 2, 4, 8 hour- actinomycin treatment,
167
IL6 treatment increased IL6R protein expression level in HNSCC
IL6 treatment enhanced mRNA stability of IL6R: implication in post-
actinomycin treatment, P<0.05.

168

IL6 attenuates E-cadherin expression and induces EMT, but not cell
proliferation, in head and neck cancer cell line (SCC-71)
It has been shown that IL-6 signaling induces cell proliferation as well as increased
invasiveness and metastasis in solid tumors (Culig et al., 2005; Guo et al., 2012).
To examine if IL-6 treatment influenced cell proliferation rate in HNSCC, we
conducted a cell viability assay using WST-1 reagent. WST-1 is a stable
tetrazolium salt, which react with and binds to NADPH produced by mitochondria in
living cells. After WST-1 reacts with NADPH, the salt is cleaved to produce a
soluble formazan dye, which is measured spectrophotometerically (Ngamwongsatit
et al., 2008; Roche). In the case of SCC-71, IL-6 treatment did not affect
proliferation either in starving medium (1% serum) or complete medium (10%
serum) (Fig 6-4A). Next, we examined if IL-6 altered E-cadherin expression. E-
cadherin is one of the epithelial cell markers of EMT and its loss is one of the
hallmarks of EMT (Tiwari et al., 2012). IL-6 is known to reduce E-cadherin in
HNSCC (Yadav et al., 2011). The E-cadherin mRNA and protein expression levels
were markedly reduced after 24 hours of IL-6 treatment in SCC-71 (Fig 6-4B).
Taken together, these data showed that IL-6 induces EMT transition in head and
neck cancer cell line but does not affect cell proliferation.
IL-6 selectively induces PlGF but not VEGF in SCC-71
Angiogenesis is another process that is stimulated by IL-6 signaling and also
implicated in EMT progression (Guo et al., 2012; Gonzalez-Moreno, 2009). Thus,

we examined the level of VEGF and PLGF, both of which are the
angiogenic factors (Chen et al., 2004; Fischer et al., 2008
with IL-6 showed ~2.5-fold increase in
VEGF mRNA expression remained unchanged
showed that IL-6 selectively upregulates the expression of PlGF, but not VEGF.
Figure 6-4A: Treatment with IL

we examined the level of VEGF and PLGF, both of which are the well-known
(Chen et al., 2004; Fischer et al., 2008). Treatment of SCC
fold increase in PLGF mRNA (Fig 6-4C) while the level of
remained unchanged (data not shown). These data
6 selectively upregulates the expression of PlGF, but not VEGF.

Treatment with IL-6 does not affect on proliferation of SCC
169
known
Treatment of SCC-71
4C) while the level of
These data
6 selectively upregulates the expression of PlGF, but not VEGF.
SCC-71.

Figure 6-4B: IL-6 treatment in
Control vs IL-6 treatement,

Figure 6-4C: IL-6 augmented angiogenic growth factor
Control vs IL-6 treated HNSCC,

6 treatment in SCC-71 cells reduced E-Cadherin expression
6 treatement, P<0.05.

ented angiogenic growth factor PLGF in scc-71
6 treated HNSCC, P<0.01.
170
erin expression.
71 cells.

171

Role of miRNAs in the stability of IL-6R.
Since the half-life of IL-6R mRNA increased by 2-fold in response to IL-6 in SCC-
71 cells, we examined the role of miRNAs in its stability and turnover.
To identify miRNAs that are responsible for IL6R mRNA degradation or stability,
candidate miRNAs that bind the 3’UTR of IL6R mRNA were identified utilizing three
publically available miRNA databases: Microcosms, DIANA, and Target Scan.
Candidate miRNAs were selected based on their algorithm scores; other criteria
used for selection stability of miRNA:mRNA binding (Gibb’s free energy), the extent
of 3’-UTR sequence homology (evolutionary conservation), and the number of
overlapping binding sites on the same 3’-UTR. By this approach, 11 miRNA
candidates were selected (Table 6-1). To examine any changes in expression
levels of the eleven miRNAs, SCC-71 was treated with IL-6 (50 ng/ml) for 24 hours,
miRNA was isolated, and then cDNA was synthesized. The resultant cDNAs were
subjected to qRT-PCR. The expression levels of six miRNAs were found to be
significantly downregulated in response to IL6 (Fig 6-5A). A schematic of their
binding sites is shown in figure 6-5B. The miRNA expression levels of the other
five miRNAs were not significantly altered in response to IL6 treatment (data not
shown).

172

Table 6-1: miRNA candidates which are predicted to be bound on the 3’-UTR.

miRNA Microcosm DIANA Target Scan 6
1 miR-23a X X
2 miR-27a X X
3 miR-34a X
4 miR-34b X X
5 miR-451 X X
6 miR-100 X
7 miR-495 X
8 miR-449a X
9 miR-138 X
10 miR-124 X
11 Let-7a X

Figure 6-5A: The expression of miRNA 23a, 27, 34a, 34b, 449a, and 451 are
downregulated in response to IL6 treatment in SCC
treated HNSCC, P<0.05.

The expression of miRNA 23a, 27, 34a, 34b, 449a, and 451 are
downregulated in response to IL6 treatment in SCC-71 cells. Control vs IL
173
The expression of miRNA 23a, 27, 34a, 34b, 449a, and 451 are
Control vs IL-6

Figure 6-5B: A schematic of binding sites of miRNA on 3

6.4: Discussion
There are numerous reports that IL
appear are responsible for tumor progression, metastasis, and poor prognosis in
head and neck cancer patients (Kanazawa et al., 2007; Wang et al., 2002). It is
noteworthy that a humanized anti
tumor angiogenesis and tumor growth in head and neck squamous cell carcinoma
(Shinriki et al., 2009). IL-6 signaling
metastasis in head and neck cancer (

of binding sites of miRNA on 3’-UTR of IL6R mRNA
There are numerous reports that IL-6 expression levels and its signal activation
appear are responsible for tumor progression, metastasis, and poor prognosis in
head and neck cancer patients (Kanazawa et al., 2007; Wang et al., 2002). It is
t a humanized anti-IL6R antibody suppressed in vitro and in vivo
tumor angiogenesis and tumor growth in head and neck squamous cell carcinoma
6 signaling has been shown to trigger lymph node
metastasis in head and neck cancer (Shinriki et al., 2011; Yadav et al., 2011).
174
UTR of IL6R mRNA
6 expression levels and its signal activation
appear are responsible for tumor progression, metastasis, and poor prognosis in
head and neck cancer patients (Kanazawa et al., 2007; Wang et al., 2002). It is
IL6R antibody suppressed in vitro and in vivo
tumor angiogenesis and tumor growth in head and neck squamous cell carcinoma
trigger lymph node
Shinriki et al., 2011; Yadav et al., 2011).

175

Thus, targeting the IL-6 signaling pathway could be an excellent therapeutic target
for head and neck squamous cell carcinoma. However, due to the nature of the
complex signaling system, sharing of downstream factors with other signaling
pathways, and the potential ability to induce many biological effects, the detailed
biological effects and mechanism of IL-6 signaling in head and neck cancers are
still poorly understood. In addition, the role of IL6R, one of the two IL-6 receptors,
has not been fully studied, especially in cancer. For instance, biogenesis of IL6R
has not been completely elucidated.
In this study, we investigated if IL-6, as a ligand itself has an impact in upregulating
IL6R expression. IL-6 signaling can trigger pleiotropic effects, such as enhanced
proliferation and EMT. Our results showed that IL6 treatment of HNSCC induced
EMT without significant effects on cellular proliferation. We will determine
whether expression of other EMT markers, such as vimentin, twist, snail, and slug
is altered. As for a functional assay, we will test invasiveness, cell motility, and
metastasis extensively. In addition, PLGF expression was increased in response
to IL-6 treatment in SCC-71 cells, while the level of VEGF was not altered
significantly. One of the possible reasons for this phenomenon is that PLGF may
antagonize VEGF by forming functionally inactive heterodimers (Eriksson et al.,
2002). To this date, there is no report of IL6 mediated PLGF induction. Thus,
studies are warranted to determine whether IL-6 signaling upregulates expression
of PlGF in SCC-71 by binding of known transcription factors (metal transcription
factor, HIF-1α and PPAR-α) to its promoter. Our result clearly shows that IL6R

176

mRNA stability was enhanced in response to IL6 treatment. Indeed, we identified
several down-regulated miRNAs which possibly have a role in affecting IL6R
mRNA stability. It is also possible that mRNA stability could be affected by RNA
binding proteins (Glisovic et al., 2008).
6.5: Future Direction
The role of identified miRNAs will be validated utilizing the 3’-UTR of IL-6R fused
to a luciferase reporter, wherein the effect of miRs and corresponding anti-miRs
will be evaluated. Once the candidate miRNAs are validated, which bind to the
3’UTR of IL-6R, it will be important to determine which of these miRNAs directly
affect the stability of IL-6R mRNA by in cells treated with actinomycin D and
candidate miRs and anti-miRs. These studies will be aimed to determine if miRs
and corresponding anti-miRs affect EMT marker expression, call invasiveness, and
proliferation of HNSCC.

177

Bibliography

Abdollahi A, Folkman J. Evading tumor evasion: current concepts and
perspectives of anti-angiogenic cancer therapy. Drug Resist Updat. 2010 Feb-
Apr;13(1-2):16-28.
Adelstein DJ. Squamous Cell Head and Neck Cancer: Recent Clinical Progress
and Prospects for the Future. Humana Press. ISBN: 1588294730
Ajit SK. Circulating microRNAs as biomarkers, therapeutic targets, and signaling
molecules. Sensors (Basel). 2012;12(3):3359-69
Akhtar S, Sheikh AA, Qureshi HU. Chewing areca nut, betel quid, oral snuff,
cigarette smoking and the risk of oesophageal squamous-cell carcinoma in South
Asians: a multicentre case-control study. Eur J Cancer. 2012 Mar;48(5):655-61.
Akimaru H, Hou DX, Ishii S. Drosophila CBP is required for dorsal-dependent twist
gene expression. Nat Genet. 1997 Oct;17(2):211-4.
Albrecht JH, Hansen LK. Cyclin D1 promotes mitogen-independent cell cycle
progression in hepatocytes. Cell Growth Differ. 1999 Jun;10(6):397-404.
Alexander JE, Hunt DF, Lee MK, Shabanowitz J, Michel H, Berlin SC, MacDonald
TL, Sundberg RJ, Rebhun LI, Frankfurter A. Characterization of posttranslational
modifications in neuron-specific class III beta-tubulin by mass spectrometry. Proc
Natl Acad Sci U S A. 1991 Jun 1;88(11):4685-9
Al-Othman MO, Morris CG, Hinerman RW, Amdur RJ, Mendenhall WM. Distant
metastases after definitive radiotherapy for squamous cell carcinoma of the head
and neck. Head Neck. 2003 Aug;25(8):629-33.
Anantharaman D, Marron M, Lagiou P, Samoli E, Ahrens W, Pohlabeln H,
Slamova A, Schejbalova M, Merletti F, Richiardi L, Kjaerheim K, Castellsague X,
Agudo A, Talamini R, Barzan L, Macfarlane TV, Tickle M, Simonato L, Canova C,
Conway DI, McKinney PA, Thomson P, Znaor A, Healy CM, McCartan BE,
Hashibe M, Brennan P, Macfarlane GJ. Population attributable risk of tobacco and
alcohol for upper aerodigestive tract cancer. Oral Oncol. 2011 Aug;47(8):725-31.
Andersson ER, Prakash N, Cajanek L, Minina E, Bryja V, Bryjova L, Yamaguchi TP,
Hall AC, Wurst W, Arenas E. Wnt5a regulates ventral midbrain morphogenesis and

178

the development of A9-A10 dopaminergic cells in vivo. PLoS One.
2008;3(10):e3517
Ang KK, Berkey BA, Tu X, Zhang HZ, Katz R, Hammond EH, Fu KK, Milas L.
Impact of epidermal growth factor receptor expression on survival and pattern of
relapse in patients with advanced head and neck carcinoma. Cancer Res. 2002
Dec 15;62(24):7350-6
Ang KK, Harris J, Wheeler R, Weber R, Rosenthal DI, Nguyen-Tân PF, Westra WH,
Chung CH, Jordan RC, Lu C, Kim H, Axelrod R, Silverman CC, Redmond KP,
Gillison ML. Human papillomavirus and survival of patients with oropharyngeal
cancer. N Engl J Med. 2010 Jul 1;363(1):24-35.
Angers S, Moon RT. Proximal events in Wnt signal transduction. Nat Rev Mol Cell
Biol. 2009 Jul;10(7):468-77.
Argiris A, Karamouzis MV, Raben D, Ferris RL. Argiris A, Karamouzis MV, Raben
D, Ferris RL. Lancet. 2008 May 17;371(9625):1695-709.
Asanuma K, Kobayashi D, Furuya D, Tsuji N, Yagihashi A, Watanabe N. A role for
survivin in radioresistance of pancreatic cancer cells. Jpn J Cancer Res. 2002
Sep;93(9):1057-62.
Avti PK, Vaiphei K, Pathak CM, Khanduja KL. Involvement of various molecular
events in cellular injury induced by smokeless tobacco. Chem Res Toxicol. 2010
Jul 19;23(7):1163-74.
Baba Y, Fujii M, Tokumaru Y, Kato Y. Present and Future of EGFR Inhibitors for
Head and Neck Squamous Cell Cancer. J Oncol. 2012;2012:986725.
Babu JM, Prathibha R, Jijith VS, Hariharan R, Pillai MR. A miR-centric view of
head and neck cancers. Biochim Biophys Acta. 2011 Aug;1816(1):67-72.
Balbo S, Meng L, Bliss RL, Jensen JA, Hatsukami DK, Hecht SS. Kinetics of DNA
adduct formation in the oral cavity after drinking alcohol. Cancer Epidemiol
Biomarkers Prev. 2012 Apr;21(4):601-8.
Bani-Yaghoub M, Tremblay RG, Lei JX, Zhang D, Zurakowski B, Sandhu JK, Smith
B, Ribecco-Lutkiewicz M, Kennedy J, Walker PR, Sikorska M. Role of Sox2 in the
development of the mouse neocortex. Dev Biol. 2006 Jul 1;295(1):52-66

179

Baselga J, Trigo JM, Bourhis J, Tortochaux J, Cortés-Funes H, Hitt R, Gascón P,
Amellal N, Harstrick A, Eckardt A. Baselga J, Trigo JM, Bourhis J, Tortochaux J,
Cortés-Funes H, Hitt R, Gascón P, Amellal N, Harstrick A, Eckardt A. J Clin Oncol.
2005 Aug 20;23(24):5568-77
Bauman JE, Michel LS, Chung CH. New promising molecular targets in head and
neck squamous cell carcinoma. Curr Opin Oncol. 2012 May;24(3):235-42.
Bedogni F, Hodge RD, Elsen GE, Nelson BR, Daza RA, Beyer RP, Bammler TK,
Rubenstein JL, Hevner RF. Tbr1 regulates regional and laminar identity of
postmitotic neurons in developing neocortex. Proc Natl Acad Sci U S A. 2010 Jul
20;107(29):13129-34
Begg AC. Predicting recurrence after radiotherapy in head and neck cancer.
Semin Radiat Oncol. 2012 Apr;22(2):108-18
Bei R, Budillon A, Masuelli L, Cereda V, Vitolo D, Di Gennaro E, Ripavecchia V,
Palumbo C, Ionna F, Losito S, Modesti A, Kraus MH, Muraro R. Frequent
overexpression of multiple ErbB receptors by head and neck squamous cell
carcinoma contrasts with rare antibody immunity in patients. J Pathol. 2004
Nov;204(3):317-25.
Bejsovec A. Wnt pathway activation: new relations and locations. Cell. 2005 Jan
14;120(1):11-4.
Benson C, White J, De Bono J, O'Donnell A, Raynaud F, Cruickshank C, McGrath
H, Walton M, Workman P, Kaye S, Cassidy J, Gianella-Borradori A, Judson I,
Twelves C. A phase I trial of the selective oral cyclin-dependent kinase inhibitor
seliciclib (CYC202; R-Roscovitine), administered twice daily for 7 days every 21
days. Br J Cancer. 2007 Jan 15;96(1):29-37
Berlin J, Bendell JC, Hart LL, Firdaus I, Gore I, Hermann RC, Mulcahy MF,
Zalupski MM, Mackey HM, Yauch RL, Graham RA, Bray GL, Low JA. A
Randomized Phase II Trial of Vismodegib versus Placebo with FOLFOX or
FOLFIRI and Bevacizumab in Patients with Previously Untreated Metastatic
Colorectal Cancer. Clin Cancer Res. 2012 Nov 29
Berndt JD, Aoyagi A, Yang P, Anastas JN, Tang L, Moon RT. Mindbomb 1, an E3
ubiquitin ligase, forms a complex with RYK to activate Wnt/β-catenin signaling. J
Cell Biol. 2011 Sep 5;194(5):737-50

180

Bernstein E, Kim SY, Carmell MA, Murchison EP, Alcorn H, Li MZ, Mills AA,
Elledge SJ, Anderson KV, Hannon GJ. Dicer is essential for mouse development.
Nat Genet. 2003 Nov;35(3):215-7
Berthiller J, Lee YC, Boffetta P, Wei Q, Sturgis EM, Greenland S, Morgenstern H,
Zhang ZF, Lazarus P, Muscat J, Chen C, Schwartz SM, Eluf Neto J, Wünsch Filho
V, Koifman S, Curado MP, Matos E, Fernandez L, Menezes A, Daudt AW, Ferro G,
Brennan P, Hashibe M. Marijuana smoking and the risk of head and neck cancer:
pooled analysis in the INHANCE consortium. Cancer Epidemiol Biomarkers Prev.
2009 May;18(5):1544-51.
Boeri M, Verri C, Conte D, Roz L, Modena P, Facchinetti F, Calabrò E, Croce CM,
Pastorino U, Sozzi G. MicroRNA signatures in tissues and plasma predict
development and prognosis of computed tomography detected lung cancer. Proc
Natl Acad Sci U S A. 2011 Mar 1;108(9):3713-8
Boffetta P, Hecht S, Gray N, Gupta P, Straif K. Smokeless tobacco and cancer.
Lancet Oncol. 2008 Jul;9(7):667-75.
Bombeccari GP, Guzzi G, Tettamanti M, Giannì AB, Baj A, Pallotti F, Spadari F.
Oral lichen planus and malignant transformation: a longitudinal cohort study. Oral
Surg Oral Med Oral Pathol Oral Radiol Endod. 2011 Sep;112(3):328-34.
Bonner JA, Harari PM, Giralt J, Azarnia N, Shin DM, Cohen RB, Jones CU, Sur R,
Raben D, Jassem J, Ove R, Kies MS, Baselga J, Youssoufian H, Amellal N,
Rowinsky EK, Ang KK. Radiotherapy plus cetuximab for squamous-cell carcinoma
of the head and neck. N Engl J Med. 2006 Feb 9;354(6):567-78.
Bonner JA, Harari PM, Giralt J, Cohen RB, Jones CU, Sur RK, Raben D, Baselga J,
Spencer SA, Zhu J, Youssoufian H, Rowinsky EK, Ang KK. Radiotherapy plus
cetuximab for locoregionally advanced head and neck cancer: 5-year survival data
from a phase 3 randomised trial, and relation between cetuximab-induced rash and
survival. Lancet Oncol. 2010 Jan;11(1):21-8.
Bononi A, Agnoletto C, De Marchi E, Marchi S, Patergnani S, Bonora M, Giorgi C,
Missiroli S, Poletti F, Rimessi A, Pinton P. Protein kinases and phosphatases in the
control of cell fate. Enzyme Res. 2011;2011:329098. Epub 2011 Sep 4.
Boye K, Maelandsmo GM. S100A4 and metastasis: a small actor playing many
roles. Am J Pathol. 2010 Feb;176(2):528-35

181

Bracken CP, Gregory PA, Khew-Goodall Y, Goodall GJ. The role of microRNAs in
metastasis and epithelial-mesenchymal transition. Cell Mol Life Sci. 2009
May;66(10):1682-99.
Brand TM, Iida M, Li C, Wheeler DL. The nuclear epidermal growth factor receptor
signaling network and its role in cancer. Discov Med. 2011 Nov;12(66):419-32.
Brown LM, Check DP, Devesa SS. Oropharyngeal cancer incidence trends:
diminishing racial disparities. Cancer Causes Control. 2011 May;22(5):753-63
Brown LM, Check DP, Devesa SS. Oropharyngeal cancer incidence trends:
diminishing racial disparities. Cancer Causes Control. 2011 May;22(5):753-63.
Bulfone A, Smiga SM, Shimamura K, Peterson A, Puelles L, Rubenstein JL. T-
brain-1: a homolog of Brachyury whose expression defines molecularly distinct
domains within the cerebral cortex. Neuron. 1995 Jul;15(1):63-78.
Bultje RS, Castaneda-Castellanos DR, Jan LY, Jan YN, Kriegstein AR, Shi SH.
Mammalian Par3 regulates progenitor cell asymmetric division via notch signaling
in the developing neocortex. Neuron. 2009 Jul 30;63(2):189-202.
Byun HJ, Kim BR, Yoo R, Park SY, Rho SB. sMEK1 enhances gemcitabine anti-
cancer activity through inhibition of phosphorylation of Akt/mTOR. Apoptosis. 2012
Oct;17(10):1095-103.
Caraballo RS, Giovino GA, Pechacek TF, Mowery PD, Richter PA, Strauss WJ,
Sharp DJ, Eriksen MP, Pirkle JL, Maurer KR. Racial and ethnic differences in
serum cotinine levels of cigarette smokers: Third National Health and Nutrition
Examination Survey, 1988-1991. JAMA. 1998 Jul 8;280(2):135-9.
Caraballo RS, Holiday DB, Stellman SD, Mowery PD, Giovino GA, Muscat JE,
Eriksen MP, Bernert JT, Richter PA, Kozlowski LT. Comparison of serum cotinine
concentration within and across smokers of menthol and nonmenthol cigarette
brands among non-Hispanic black and non-Hispanic white U.S. adult smokers,
2001-2006. Cancer Epidemiol Biomarkers Prev. 2011 Jul;20(7):1329-40
Carlos de Vicente J, Herrero-Zapatero A, Fresno MF, Lopez-Arranz JS.
Expression of cyclin D1 and Ki-67 in squamous cell carcinoma of the oral cavity:
clinicopathological and prognostic significance. Oral Oncol. 2002 Apr;38(3):301-8

182

Carvalho AL, Nishimoto IN, Califano JA, Kowalski LP. Trends in incidence and
prognosis for head and neck cancer in the United States: a site-specific analysis of
the SEER database. Int J Cancer. 2005 May 1;114(5):806-16.
Casas E, Kim J, Bendesky A, Ohno-Machado L, Wolfe CJ, Yang J. Snail2 is an
essential mediator of Twist1-induced epithelial mesenchymal transition and
metastasis. Cancer Res. 2011 Jan 1;71(1):245-54.
Caviness VS Jr, Nowakowski RS, Bhide PG. Neocortical neurogenesis:
morphogenetic gradients and beyond. Trends Neurosci. 2009 Aug;32(8):443-50.
Chabu C, Doe CQ. Twins/PP2A regulates aPKC to control neuroblast cell polarity
and self-renewal. Dev Biol. 2009 Jun 15;330(2):399-405.
Chakravarti A, Zhai GG, Zhang M, Malhotra R, Latham DE, Delaney MA, Robe P,
Nestler U, Song Q, Loeffler J. Survivin enhances radiation resistance in primary
human glioblastoma cells via caspase-independent mechanisms. Oncogene. 2004
Sep 30;23(45):7494-506
Chalaris A, Garbers C, Rabe B, Rose-John S, Scheller J. The soluble Interleukin 6
receptor: generation and role in inflammation and cancer. Eur J Cell Biol. 2011
Jun-Jul;90(6-7):484-94.
Chaturvedi AK, Engels EA, Pfeiffer RM, Hernandez BY, Xiao W, Kim E, Jiang B,
Goodman MT, Sibug-Saber M, Cozen W, Liu L, Lynch CF, Wentzensen N, Jordan
RC, Altekruse S, Anderson WF, Rosenberg PS, Gillison ML. Human papillomavirus
and rising oropharyngeal cancer incidence in the United States. J Clin Oncol. 2011
Nov 10;29(32):4294-301
Chaturvedi, A , Maura L. Gillison. Human Papillomavirus and Head and Neck
Cancer" In Andrew F. Olshan. Epidemiology, Pathogenesis, and Prevention of
Head and Neck Cancer (1st ed.). New York: Springer. ISBN 978-1-4419-1471-2.
Chau NG, Perez-Ordonez B, Zhang K, Pham NA, Ho J, Zhang T, Ludkovski O,
Wang L, Chen EX, Tsao MS, Kamel-Reid S, Siu LL. The association between
EGFR variant III, HPV, p16, c-MET, EGFR gene copy number and response to
EGFR inhibitors in patients with recurrent or metastatic squamous cell carcinoma
of the head and neck. Head Neck Oncol. 2011 Feb 27;3:11

183

Chen CN, Hsieh FJ, Cheng YM, Cheng WF, Su YN, Chang KJ, Lee PH. The
significance of placenta growth factor in angiogenesis and clinical outcome of
human gastric cancer. Cancer Lett. 2004 Sep 15;213(1):73-82.
Chen LM, Li G, Reitzel LR, Pytynia KB, Zafereo ME, Wei Q, Sturgis EM. Matched-
pair analysis of race or ethnicity in outcomes of head and neck cancer patients
receiving similar multidisciplinary care. Cancer Prev Res (Phila). 2009
Sep;2(9):782-91
Chen PT, Kuan FC, Huang CE, Chen MF, Huang SH, Chen MC, Lee KD.
Incidence and patterns of second primary malignancies following oral cavity
cancers in a prevalent area of betel-nut chewing: a population-based cohort of
26,166 patients in Taiwan. Jpn J Clin Oncol. 2011 Dec;41(12):1336-43.
Chen Z, Malhotra PS, Thomas GR, Ondrey FG, Duffey DC, Smith CW, Enamorado
I, Yeh NT, Kroog GS, Rudy S, McCullagh L, Mousa S, Quezado M, Herscher LL,
Van Waes C. Expression of proinflammatory and proangiogenic cytokines in
patients with head and neck cancer. Clin Cancer Res. 1999 Jun;5(6):1369-79.
Cheng SJ, Lee JJ, Kok SH, Chou CH, Chang HH, Yang H, Chiang ML, Kuo MY.
Expression of vascular endothelial growth factor is significantly associated with
progression and prognosis of oral squamous cell carcinomas in Taiwan. J Formos
Med Assoc. 2011 Jan;110(1):50-7
Chenn A, Walsh CA. Regulation of cerebral cortical size by control of cell cycle exit
in neural precursors. Science. 2002 Jul 19;297(5580):365-9.
Cheung CH, Cheng L, Chang KY, Chen HH, Chang JY. Investigations of survivin:
the past, present and future. Front Biosci. 2011 Jan 1;16:952-61.
Chinn SB, Darr OA, Peters RD, Prince ME. The role of head and neck squamous
cell carcinoma cancer stem cells in tumorigenesis, metastasis, and treatment
failure. Front Endocrinol (Lausanne). 2012;3:90. Epub 2012 Aug 3.
Chou T, Finn RS. Brivanib: a review of development. Future Oncol. 2012
Sep;8(9):1083-90. doi: 10.2217/fon.12.104.
Christopoulos A, Ahn SM, Klein JD, Kim S. Biology of vascular endothelial growth
factor and its receptors in head and neck cancer: beyond angiogenesis. Head
Neck. 2011 Aug;33(8):1220-9

184

Church DN, Talbot DC. Survivin in solid tumors: rationale for development of
inhibitors. Curr Oncol Rep. 2012 Apr;14(2):120-8.
Ciani L, Salinas PC. WNTs in the vertebrate nervous system: from patterning to
neuronal connectivity. Nat Rev Neurosci. 2005 May;6(5):351-62.
Cimmino A, Calin GA, Fabbri M, Iorio MV, Ferracin M, Shimizu M, Wojcik SE,
Aqeilan RI, Zupo S, Dono M, Rassenti L, Alder H, Volinia S, Liu CG, Kipps TJ,
Negrini M, Croce CM. miR-15 and miR-16 induce apoptosis by targeting BCL2.
Proc Natl Acad Sci U S A. 2005 Sep 27;102(39):13944-9.
Clevers H, Nusse R. Wnt/β-catenin signaling and disease. Cell. 2012 Jun
8;149(6):1192-205.
Cole P, Rodu B, Mathisen A. Alcohol-containing mouthwash and oropharyngeal
cancer: a review of the epidemiology. J Am Dent Assoc. 2003 Aug;134(8):1079-87.
Colella S, Richards KL, Bachinski LL, Baggerly KA, Tsavachidis S, Lang JC,
Schuller DE, Krahe R. Molecular signatures of metastasis in head and neck
cancer. Head Neck. 2008 Oct;30(10):1273-83
Cook MB, Dawsey SM, Freedman ND, Inskip PD, Wichner SM, Quraishi SM,
Devesa SS, McGlynn KA. Sex disparities in cancer incidence by period and age.
Cancer Epidemiol Biomarkers Prev. 2009 Apr;18(4):1174-82
Coppe JP, Boysen M, Sun CH, Wong BJ, Kang MK, Park NH, Desprez PY,
Campisi J, Krtolica A. A role for fibroblasts in mediating the effects of tobacco-
induced epithelial cell growth and invasion. Mol Cancer Res. 2008 Jul;6(7):1085-
98.
Cordes C, Münzel AK, Rudolph P, Hoffmann M, Leuschner I, Gottschlich S.
Immunohistochemical staining of Ki-67 using the monoclonal antibody Ki-s11 is a
prognostic indicator for laryngeal squamous cell carcinoma. Anticancer Res. 2009
Apr;29(4):1459-65
Coskun V, Luskin MB. The expression pattern of the cell cycle inhibitor
p19(INK4d) by progenitor cells of the rat embryonic telencephalon and neonatal
anterior subventricular zone. J Neurosci. 2001 May 1;21(9):3092-103.
Culig Z, Steiner H, Bartsch G, Hobisch A. Interleukin-6 regulation of prostate
cancer cell growth. J Cell Biochem. 2005 Jun 1;95(3):497-505.

185

Darido C, Georgy SR, Wilanowski T, Dworkin S, Auden A, Zhao Q, Rank G,
Srivastava S, Finlay MJ, Papenfuss AT, Pandolfi PP, Pearson RB, Jane SM.
Targeting of the tumor suppressor GRHL3 by a miR-21-dependent proto-
oncogenic network results in PTEN loss and tumorigenesis. Cancer Cell. 2011
Nov 15;20(5):635-48.
Dasanayake AP, Silverman AJ, Warnakulasuriya S. Maté drinking and oral and
oro-pharyngeal cancer: a systematic review and meta-analysis. Oral Oncol. 2010
Feb;46(2):82-6. Epub 2009 Dec 29.
De Roock W, Claes B, Bernasconi D, De Schutter J, Biesmans B, Fountzilas G,
Kalogeras KT, Kotoula V, Papamichael D, Laurent-Puig P, Penault-Llorca F,
Rougier P, Vincenzi B, Santini D, Tonini G, Cappuzzo F, Frattini M, Molinari F,
Saletti P, De Dosso S, Martini M, Bardelli A, Siena S, Sartore-Bianchi A, Tabernero
J, Macarulla T, Di Fiore F, Gangloff AO, Ciardiello F, Pfeiffer P, Qvortrup C,
Hansen TP, Van Cutsem E, Piessevaux H, Lambrechts D, Delorenzi M, Tejpar S.
Effects of KRAS, BRAF, NRAS, and PIK3CA mutations on the efficacy of
cetuximab plus chemotherapy in chemotherapy-refractory metastatic colorectal
cancer: a retrospective consortium analysis. Lancet Oncol. 2010 Aug;11(8):753-62
Deneo-Pellegrini H, De Stefani E, Boffetta P, Ronco AL, Acosta G, Correa P,
Mendilaharsu M. Maté consumption and risk of oral cancer: Case-control study in
Uruguay. Head Neck. 2012 Aug 23. doi: 10.1002/hed.23080
Dequanter D, Shahla M, Paulus P, Lothaire PH. The role of EGFR-targeting
strategies in the treatment of head and neck cancer. Onco Targets Ther.
2012;5:127-31
Doody JF, Wang Y, Patel SN, Joynes C, Lee SP, Gerlak J, Rolser RL, Li Y, Steiner
P, Bassi R, Hicklin DJ, Hadari YR. Inhibitory activity of cetuximab on epidermal
growth factor receptor mutations in non small cell lung cancers. Mol Cancer Ther.
2007 Oct;6(10):2642-51
Dranoff G. Cytokines in cancer pathogenesis and cancer therapy. Nat Rev Cancer.
2004 Jan;4(1):11-22.
Duffy SA, Taylor JM, Terrell JE, Islam M, Li Y, Fowler KE, Wolf GT, Teknos TN.
Interleukin-6 predicts recurrence and survival among head and neck cancer
patients. Cancer. 2008 Aug 15;113(4):750-7.

186

Dura JM, Taillebourg E, Préat T. The Drosophila learning and memory gene linotte
encodes a putative receptor tyrosine kinase homologous to the human RYK gene
product. FEBS Lett. 1995 Aug 21;370(3):250-4
Edlund T, Jessell TM. Progression from extrinsic to intrinsic signaling in cell fate
specification: a view from the nervous system. Cell. 1999 Jan 22;96(2):211-24.
Eichhorn PJ, Creyghton MP, Bernards R. Protein phosphatase 2A regulatory
subunits and cancer. Biochim Biophys Acta. 2009 Jan;1795(1):1-15
Elizalde C, Campa VM, Caro M, Schlangen K, Aransay AM, Vivanco M, Kypta RM.
Distinct roles for Wnt-4 and Wnt-11 during retinoic acid-induced neuronal
differentiation. Stem Cells. 2011 Jan;29(1):141-53
Emami KH, Nguyen C, Ma H, Kim DH, Jeong KW, Eguchi M, Moon RT, Teo JL,
Kim HY, Moon SH, Ha JR, Kahn M. A small molecule inhibitor of beta-
catenin/CREB-binding protein transcription . Proc Natl Acad Sci U S A. 2004 Aug
24;101(34):12682-7.
Enari M, Sakahira H, Yokoyama H, Okawa K, Iwamatsu A, Nagata S. A caspase-
activated DNase that degrades DNA during apoptosis, and its inhibitor ICAD.
Nature. 1998 Jan 1;391(6662):43-50.
Endo M, Nishita M, Minami Y. Analysis of Wnt/planar cell polarity pathway in
cultured cells. Methods Mol Biol. 2012;839:201-14.
Eriksson A, Cao R, Pawliuk R, Berg SM, Tsang M, Zhou D, Fleet C, Tritsaris K,
Dissing S, Leboulch P, Cao Y. Placenta growth factor-1 antagonizes VEGF-
induced angiogenesis and tumor growth by the formation of functionally inactive
PlGF-1/VEGF heterodimers. Cancer Cell. 2002 Feb;1(1):99-108.
Estivill-Torrus G, Pearson H, van Heyningen V, Price DJ, Rashbass P. Pax6 is
required to regulate the cell cycle and the rate of progression from symmetrical to
asymmetrical division in mammalian cortical progenitors. Development. 2002
Jan;129(2):455-66.
Fabian MR, Sonenberg N. The mechanics of miRNA-mediated gene silencing: a
look under the hood of miRISC. Nat Struct Mol Biol. 2012 Jun 5;19(6):586-93.
Farazi TA, Spitzer JI, Morozov P, Tuschl T. miRNAs in human cancer. J Pathol.
2011 Jan;223(2):102-15.

187

Farkas LM, Huttner WB. The cell biology of neural stem and progenitor cells and its
significance for their proliferation versus differentiation during mammalian brain
development. Curr Opin Cell Biol. 2008 Dec;20(6):707-15
Farnebo L, Jerhammar F, Ceder R, Grafstrom RC, Vainikka L, Thunell L, Grénman
R, Johansson AC, Roberg K. Combining factors on protein and gene level to
predict radioresponse in head and neck cancer cell lines. J Oral Pathol Med. 2011
Nov;40(10):739-46
Farnebo L, Jerhammar F, Ceder R, Grafström RC, Vainikka L, Thunell L, Grénman
R, Johansson AC, Roberg K. Combining factors on protein and gene level to
predict radioresponse in head and neck cancer cell lines. J Oral Pathol Med. 2011
Nov;40(10):739-46
Feng BJ, Khyatti M, Ben-Ayoub W, Dahmoul S, Ayad M, Maachi F, Bedadra W,
Abdoun M, Mesli S, Bakkali H, Jalbout M, Hamdi-Cherif M, Boualga K, Bouaouina
N, Chouchane L, Benider A, Ben-Ayed F, Goldgar DE, Corbex M. Cannabis,
tobacco and domestic fumes intake are associated with nasopharyngeal carcinoma
in North Africa. Br J Cancer. 2009 Oct 6;101(7):1207-12.
Ferlito A, Shaha AR, Silver CE, Rinaldo A, Mondin V. Incidence and sites of
distant metastases from head and neck cancer. ORL J Otorhinolaryngol Relat
Spec. 2001 Jul-Aug;63(4):202-7
Figuero Ruiz E, Carretero Peláez MA, Cerero Lapiedra R, Esparza Gómez G,
Moreno López LA. Effects of the consumption of alcohol in the oral cavity:
relationship with oral cancer. Med Oral. 2004 Jan-Feb;9(1):14-23
Filipowicz W, Bhattacharyya SN, Sonenberg N. Mechanisms of post-
transcriptional regulation by microRNAs: are the answers in sight? Nat Rev Genet.
2008 Feb;9(2):102-14
Fischer C, Mazzone M, Jonckx B, Carmeliet P. FLT1 and its ligands VEGFB and
PlGF: drug targets for anti-angiogenic therapy? Nat Rev Cancer. 2008
Dec;8(12):942-56
Fountzilas G, Fragkoulidi A, Kalogera-Fountzila A, Nikolaidou M, Bobos M,
Calderaro J, Andreiuolo F, Marselos M. A phase II study of sunitinib in patients
with recurrent and/or metastatic non-nasopharyngeal head and neck cancer.
Cancer Chemother Pharmacol. 2010 Mar;65(4):649-60.

188

Fradkin LG, Dura JM, Noordermeer JN. Ryks: new partners for Wnts in the
developing and regenerating nervous system. Trends Neurosci. 2010
Feb;33(2):84-92. Epub 2009 Dec 11
Franceschi S, Levi F, La Vecchia C, Conti E, Dal Maso L, Barzan L, Talamini R.
Comparison of the effect of smoking and alcohol drinking between oral and
pharyngeal cancer. Int J Cancer. 1999 Sep 24;83(1):1-4
Freedman ND, Schatzkin A, Leitzmann MF, Hollenbeck AR, Abnet CC. Alcohol
and head and neck cancer risk in a prospective study. Br J Cancer. 2007 May
7;96(9):1469-74.
Galli J, Cammarota G, Volante M, De Corso E, Almadori G, Paludetti G. Laryngeal
carcinoma and laryngo-pharyngeal reflux disease. Acta Otorhinolaryngol Ital. 2006
Oct;26(5):260-3.
Gan HK, Burgess AW, Clayton AH, Scott AM. Targeting of a conformationally
exposed, tumor-specific epitope of EGFR as a strategy for cancer therapy. Cancer
Res. 2012 Jun 15;72(12):2924-30.
Gandini S, Negri E, Boffetta P, La Vecchia C, Boyle P. Mouthwash and oral cancer
risk quantitative meta-analysis of epidemiologic studies. Ann Agric Environ Med.
2012;19(2):173-80.
Gavert N, Ben-Zeev A. Epithelial-mesenchymal transition and the invasive
potential of tumors. Trends Mol Med. 2008 May;14(5):199-209
Gilles C, Polette M, Mestdagt M, Nawrocki-Raby B, Ruggeri P, Birembaut P,
Foidart JM. Transactivation of vimentin by beta-catenin in human breast cancer
cells. Cancer Res. 2003 May 15;63(10):2658-64.
Glisovic T, Bachorik JL, Yong J, Dreyfuss G. RNA-binding proteins and post-
transcriptional gene regulation. FEBS Lett. 2008 Jun 18;582(14):1977-86.
GLOBOCAN (http://globocan.iarc.fr/) Databases are made in 2008.
Goh AM, Coffill CR, Lane DP. The role of mutant p53 in human cancer. J Pathol.
2011 Jan;223(2):116-26.
Goldenberg D, Lee J, Koch WM, Kim MM, Trink B, Sidransky D, Moon CS.
Habitual risk factors for head and neck cancer. Otolaryngol Head Neck Surg. 2004
Dec;131(6):986-93.

189

Goldstein BY, Chang SC, Hashibe M, La Vecchia C, Zhang ZF. Alcohol
consumption and cancers of the oral cavity and pharynx from 1988 to 2009: an
update. Eur J Cancer Prev. 2010 Nov;19(6):431-65
Goljanek-Whysall K, Sweetman D, Münsterberg AE. microRNAs in skeletal
muscle differentiation and disease. Clin Sci (Lond). 2012 Dec;123(11):611-25.
Gondivkar SM, Parikh RV, Gadbail AR, Solanke V, Chole R, Mankar M, Balsaraf S.
Involvement of viral factors with head and neck cancers. Oral Oncol. 2012
Mar;48(3):195-9.
Gonzalez-Moreno O, Lecanda J, Green JE, Segura V, Catena R, Serrano D, Calvo
A. VEGF elicits epithelial-mesenchymal transition (EMT) in prostate intraepithelial
neoplasia (PIN)-like cells via an autocrine loop. Exp Cell Res. 2010 Feb
15;316(4):554-67.
Goodwin WJ, Thomas GR, Parker DF, Joseph D, Levis S, Franzmann E, Anello C,
Hu JJ. Unequal burden of head and neck cancer in the United States. Head Neck.
2008 Mar;30(3):358-71.
Goon PK, Stanley MA, Ebmeyer J, Steinsträsser L, Upile T, Jerjes W, Bernal-
Sprekelsen M, Görner M, Sudhoff HH. HPV & head and neck cancer: a descriptive
update. Head Neck Oncol. 2009 Oct 14;1:36
Goto M, Mitra RS, Liu M, Lee J, Henson BS, Carey T, Bradford C, Prince M, Wang
CY, Fearon ER, D'Silva NJ. Rap1 stabilizes beta-catenin and enhances beta-
catenin-dependent transcription and invasion in squamous cell carcinoma of the
head and neck. Clin Cancer Res. 2010 Jan 1;16(1):65-76
Gottesman MM. Mechanisms of cancer drug resistance. Annu Rev Med.
2002;53:615-27.
Götz M, Huttner WB. The cell biology of neurogenesis. Nat Rev Mol Cell Biol. 2005
Oct;6(10):777-88.
Götz M, Stoykova A, Gruss P. Pax6 controls radial glia differentiation in the
cerebral cortex. Neuron. 1998 Nov;21(5):1031-44.
Grandis JR, Tweardy DJ. Elevated levels of transforming growth factor alpha and
epidermal growth factor receptor messenger RNA are early markers of
carcinogenesis in head and neck cancer. Cancer Res. 1993 Aug 1;53(15):3579-84.

190

Grandis JR, Zeng Q, Drenning SD, Tweardy DJ. Normalization of EGFR mRNA
levels following restoration of wild-type p53 in a head and neck squamous cell
carcinoma cell line. Int J Oncol. 1998 Aug;13(2):375-8.
Grimson A, Farh KK, Johnston WK, Garrett-Engele P, Lim LP, Bartel DP.
MicroRNA targeting specificity in mammals: determinants beyond seed pairing.
Mol Cell. 2007 Jul 6;27(1):91-105
Groshans H, Chatterjee S. MicroRNases and the Regulated Degradation of
Mature Animal miRNAs. Adv Exp Med Biol. 2010;700:140-155
Grove EA, Tole S, Limon J, Yip L, Ragsdale CW. The hem of the embryonic
cerebral cortex is defined by the expression of multiple Wnt genes and is
compromised in Gli3-deficient mice. Development. 1998 Jun;125(12):2315-25
Guo Y, Xu F, Lu T, Duan Z, Zhang Z. Interleukin-6 signaling pathway in targeted
therapy for cancer. Cancer Treat Rev. 2012 Nov;38(7):904-10
Guturi KK, Mandal T, Chatterjee A, Sarkar M, Bhattacharya S, Chatterjee U,
Ghosh MK. Mechanism of β-catenin-mediated transcriptional regulation of
epidermal growth factor receptor expression in glycogen synthase kinase 3 β-
inactivated prostate cancer cells. J Biol Chem. 2012 May 25;287(22):18287-96
Halford MM, Armes J, Buchert M, Meskenaite V, Grail D, Hibbs ML, Wilks AF,
Farlie PG, Newgreen DF, Hovens CM, Stacker SA. Ryk-deficient mice exhibit
craniofacial defects associated with perturbed Eph receptor crosstalk. Nat Genet.
2000 Aug;25(4):414-8.
Halford MM, Stacker SA. Revelations of the RYK receptor. Bioessays. 2001
Jan;23(1):34-45.
Hashibe M, Brennan P, Benhamou S, Castellsague X, Chen C, Curado MP, Dal
Maso L, Daudt AW, Fabianova E, Fernandez L, Wünsch-Filho V, Franceschi S,
Hayes RB, Herrero R, Koifman S, La Vecchia C, Lazarus P, Levi F, Mates D,
Matos E, Menezes A, Muscat J, Eluf-Neto J, Olshan AF, Rudnai P, Schwartz SM,
Smith E, Sturgis EM, Szeszenia-Dabrowska N, Talamini R, Wei Q, Winn DM,
Zaridze D, Zatonski W, Zhang ZF, Berthiller J, Boffetta P. Alcohol drinking in never
users of tobacco, cigarette smoking in never drinkers, and the risk of head and
neck cancer: pooled analysis in the International Head and Neck Cancer
Epidemiology Consortium. J Natl Cancer Inst. 2007 May 16;99(10):777-89.

191

Hashibe M, Brennan P, Chuang SC, Boccia S, Castellsague X, Chen C, Curado
MP, Dal Maso L, Daudt AW, Fabianova E, Fernandez L, Wünsch-Filho V,
Franceschi S, Hayes RB, Herrero R, Kelsey K, Koifman S, La Vecchia C, Lazarus
P, Levi F, Lence JJ, Mates D, Matos E, Menezes A, McClean MD, Muscat J, Eluf-
Neto J, Olshan AF, Purdue M, Rudnai P, Schwartz SM, Smith E, Sturgis EM,
Szeszenia-Dabrowska N, Talamini R, Wei Q, Winn DM, Shangina O, Pilarska A,
Zhang ZF, Ferro G, Berthiller J, Boffetta P. Interaction between tobacco and
alcohol use and the risk of head and neck cancer: pooled analysis in the
International Head and Neck Cancer Epidemiology Consortium. Cancer Epidemiol
Biomarkers Prev. 2009 Feb;18(2):541-50.
Hashibe M, Hunt J, Wei M, Buys S, Gren L, Lee YC. Tobacco, alcohol, body mass
index, physical activity, and the risk of head and neck cancer in the prostate, lung,
colorectal, and ovarian (PLCO) cohort. Head Neck. 2012 Jun 19. doi:
10.1002/hed.23052.
Hashibe M, Morgenstern H, Cui Y, Tashkin DP, Zhang ZF, Cozen W, Mack TM,
Greenland S. Marijuana use and the risk of lung and upper aerodigestive tract
cancers: results of a population-based case-control study. Cancer Epidemiol
Biomarkers Prev. 2006 Oct;15(10):1829-34.
He X, Semenov M, Tamai K, Zeng X. LDL receptor-related proteins 5 and 6 in
Wnt/beta-catenin signaling: arrows point the way. Development. 2004
Apr;131(8):1663-77
Hebert C, Norris K, Scheper MA, Nikitakis N, Sauk JJ. High mobility group A2 is a
target for miRNA-98 in head and neck squamous cell carcinoma. Mol Cancer.
2007 Jan 14;6:5.
Hecht SS. Tobacco carcinogens, their biomarkers and tobacco-induced cancer.
Nat Rev Cancer. 2003 Oct;3(10):733-44.
Heinrich PC, Behrmann I, Müller-Newen G, Schaper F, Graeve L. Interleukin-6-
type cytokine signalling through the gp130/Jak/STAT pathway. Biochem J. 1998
Sep 1;334 ( Pt 2):297-314.
Heins N, Malatesta P, Cecconi F, Nakafuku M, Tucker KL, Hack MA, Chapouton P,
Barde YA, Götz M. Glial cells generate neurons: the role of the transcription factor
Pax6. Nat Neurosci. 2002 Apr;5(4):308-15.

192

Henderson WR Jr, Chi EY, Ye X, Nguyen C, Tien YT, Zhou B, Borok Z, Knight DA,
Kahn M. Inhibition of Wnt/beta-catenin/CREB binding protein (CBP) signaling
reverses pulmonary fibrosis. Proc Natl Acad Sci U S A. 2010 Aug
10;107(32):14309-14
Hermeking H. MicroRNAs in the p53 network: micromanagement of tumour
suppression. Nat Rev Cancer. 2012 Sep;12(9):613-26
Hevner RF, Shi L, Justice N, Hsueh Y, Sheng M, Smiga S, Bulfone A, Goffinet AM,
Campagnoni AT, Rubenstein JL. Tbr1 regulates differentiation of the preplate and
layer 6. Neuron. 2001 Feb;29(2):353-66.
Hirabayashi Y, Gotoh Y. Stage-dependent fate determination of neural precursor
cells in mouse forebrain. Neurosci Res. 2005 Apr;51(4):331-6
Hirabayashi Y, Itoh Y, Tabata H, Nakajima K, Akiyama T, Masuyama N, Gotoh Y.
The Wnt/beta-catenin pathway directs neuronal differentiation of cortical neural
precursor cells. Development. 2004 Jun;131(12):2791-801
Hollis ER 2nd, Zou Y. Reinduced Wnt signaling limits regenerative potential of
sensory axons in the spinal cord following conditioning lesion. Proc Natl Acad Sci
U S A. 2012 Sep 4;109(36):14663-8
Hong DS, Angelo LS, Kurzrock R. Interleukin-6 and its receptor in cancer:
implications for translational therapeutics. Cancer. 2007 Nov 1;110(9):1911-28.
Hovens CM, Stacker SA, Andres AC, Harpur AG, Ziemiecki A, Wilks AF. RYK, a
receptor tyrosine kinase-related molecule with unusual kinase domain motifs. Proc
Natl Acad Sci U S A. 1992 Dec 15;89(24):11818-22
Howe LR, Watanabe O, Leonard J, Brown AM. Twist is up-regulated in response
to Wnt1 and inhibits mouse mammary cell differentiation. Cancer Res. 2003 Apr
15;63(8):1906-13.
Hsieh J, Gage FH. Epigenetic control of neural stem cell fate. Curr Opin Genet
Dev. 2004 Oct;14(5):461-9
Ikeshima-Kataoka H, Skeath JB, Nabeshima Y, Doe CQ, Matsuzaki F. Miranda
directs Prospero to a daughter cell during Drosophila asymmetric divisions. Nature.
1997 Dec 11;390(6660):625-9.

193

Ikeya M, Lee SM, Johnson JE, McMahon AP, Takada S. Wnt signalling required
for expansion of neural crest and CNS progenitors. Nature. 1997 Oct
30;389(6654):966-70
Inestrosa NC, Arenas E. Emerging roles of Wnts in the adult nervous system. Nat
Rev Neurosci. 2010 Feb;11(2):77-86
Iorio MV, Croce CM. microRNA involvement in human cancer. Carcinogenesis.
2012 Jun;33(6):1126-33.
Irish JC, Bernstein A. Oncogenes in head and neck cancer. Laryngoscope. 1993
Jan;103(1 Pt 1):42-52.
Israsena N, Hu M, Fu W, Kan L, Kessler JA. The presence of FGF2 signaling
determines whether beta-catenin exerts effects on proliferation or neuronal
differentiation of neural stem cells. Dev Biol. 2004 Apr 1;268(1):220-31
Jaber MA, Porter SR, Scully C, Gilthorpe MS, Bedi R. The role of alcohol in non-
smokers and tobacco in non-drinkers in the aetiology of oral epithelial dysplasia. Int
J Cancer. 1998 Jul 29;77(3):333-6.
Jackson MW, Roberts JS, Heckford SE, Ricciardelli C, Stahl J, Choong C, Horsfall
DJ, Tilley WD. A potential autocrine role for vascular endothelial growth factor in
prostate cancer. Cancer Res. 2002 Feb 1;62(3):854-9.
Kalyankrishna S, Grandis JR. Epidermal growth factor receptor biology in head
and neck cancer. J Clin Oncol. 2006 Jun 10;24(17):2666-72.
Kamiya D, Banno S, Sasai N, Ohgushi M, Inomata H, Watanabe K, Kawada M,
Yakura R, Kiyonari H, Nakao K, Jakt LM, Nishikawa S, Sasai Y. Intrinsic transition
of embryonic stem-cell differentiation into neural progenitors. Nature. 2011 Feb
24;470(7335):503-9
Kanazawa T, Nishino H, Hasegawa M, Ohta Y, Iino Y, Ichimura K, Noda Y.
Interleukin-6 directly influences proliferation and invasion potential of head and
neck cancer cells. Eur Arch Otorhinolaryngol. 2007 Jul;264(7):815-21.
Karar J, Maity A. Modulating the tumor microenvironment to increase radiation
responsiveness. Cancer Biol Ther. 2009 Nov;8(21):1994-2001

194

Karatzanis AD, Koudounarakis E, Papadakis I, Velegrakis G. Molecular pathways
of lymphangiogenesis and lymph node metastasis in head and neck cancer. Eur
Arch Otorhinolaryngol. 2012 Mar;269(3):731-7
Katso RM, Russell RB, Ganesan TS. Functional analysis of H-Ryk, an atypical
member of the receptor tyrosine kinase family. Mol Cell Biol. 1999
Sep;19(9):6427-40
Keeble TR, Halford MM, Seaman C, Kee N, Macheda M, Anderson RB, Stacker
SA, Cooper HM. The Wnt receptor Ryk is required for Wnt5a-mediated axon
guidance on the contralateral side of the corpus callosum. J Neurosci. 2006 May
24;26(21):5840-8.
Keller ET, Wanagat J, Ershler WB. Molecular and cellular biology of interleukin-6
and its receptor. Front Biosci. 1996 Dec 1;1:d340-57.
Kelly CM, Tyers P, Borg MT, Svendsen CN, Dunnett SB, Rosser AE. EGF and
FGF-2 responsiveness of rat and mouse neural precursors derived from the
embryonic CNS. Brain Res Bull. 2005 Dec 15;68(1-2):83-94.
Kim JJ, Tannock IF. Repopulation of cancer cells during therapy: an important
cause of treatment failure. Nat Rev Cancer. 2005 Jul;5(7):516-25.
Kim JY, Kim YM, Yang CH, Cho SK, Lee JW, Cho M. Functional regulation of
Slug/Snail2 is dependent on GSK-3β-mediated phosphorylation. FEBS J. 2012
Aug;279(16):2929-39
Kim YK, Kim VN. Processing of intronic microRNAs. EMBO J. 2007 Feb
7;26(3):775-83
Kishimoto T. IL-6: from laboratory to bedside. Clin Rev Allergy Immunol. 2005
Jun;28(3):177-86.
Klein JD, Grandis JR. The molecular pathogenesis of head and neck cancer.
Cancer Biol Ther. 2010 Jan;9(1):1-7. Epub 2010 Jan 9.
Kolk SM, Whitman MC, Yun ME, Shete P, Donoghue MJ. A unique subpopulation
of Tbr1-expressing deep layer neurons in the developing cerebral cortex. Mol Cell
Neurosci. 2005 Dec;30(4):538-51
Konduri S, Colon J, Baker CH, Safe S, Abbruzzese JL, Abudayyeh A, Basha MR,
Abdelrahim M. Tolfenamic acid enhances pancreatic cancer cell and tumor

195

response to radiation therapy by inhibiting survivin protein expression. Mol Cancer
Ther. 2009 Mar;8(3):533-42.
Kono SA, Haigentz M Jr, Yom SS, Saba N. EGFR Monoclonal Antibodies in the
Treatment of Squamous Cell Carcinoma of the Head and Neck: A View beyond
Cetuximab. Chemother Res Pract. 2012;2012:901320
Krahn MP, Egger-Adam D, Wodarz A. PP2A antagonizes phosphorylation of
Bazooka by PAR-1 to control apical-basal polarity in dividing embryonic
neuroblasts. Dev Cell. 2009 Jun;16(6):901-8
Kriegstein A, Alvarez-Buylla A. The glial nature of embryonic and adult neural stem
cells. Annu Rev Neurosci. 2009;32:149-84.
Kriegstein A, Noctor S, Martínez-Cerdeño V. Patterns of neural stem and
progenitor cell division may underlie evolutionary cortical expansion. Nat Rev
Neurosci. 2006 Nov;7(11):883-90
Krol J, Loedige I, Filipowicz W. The widespread regulation of microRNA
biogenesis, function and decay. Nat Rev Genet. 2010 Sep;11(9):597-610
Kühl M, Sheldahl LC, Park M, Miller JR, Moon RT. The Wnt/Ca2+ pathway: a new
vertebrate Wnt signaling pathway takes shape. Trends Genet. 2000 Jul;16(7):279-
83.
Kuwahara A, Hirabayashi Y, Knoepfler PS, Taketo MM, Sakai J, Kodama T, Gotoh
Y. Wnt signaling and its downstream target N-myc regulate basal progenitors in the
developing neocortex. Development. 2010 Apr;137(7):1035-44
Kyzas PA, Stefanou D, Batistatou A, Agnantis NJ. Potential autocrine function of
vascular endothelial growth factor in head and neck cancer via vascular endothelial
growth factor receptor-2. Mod Pathol. 2005 Apr;18(4):485-94.
Lages E, Ipas H, Guttin A, Nesr H, Berger F, Issartel JP. MicroRNAs: molecular
features and role in cancer. Front Biosci. 2012 Jun 1;17:2508-40.
Lalwani AK, LANGE CURRENT Series, CURRENT Diagnosis and Treatment in
Otolaryngology--Head and Neck Surgery, 2nd ed. 2007.
Lang K, Menzin J, Earle CC, Jacobson J, Hsu MA. The economic cost of
squamous cell cancer of the head and neck: findings from linked SEER-Medicare
data. Arch Otolaryngol Head Neck Surg. 2004 Nov;130(11):1269-75

196

Langendijk JA, Bourhis J. Reirradiation in squamous cell head and neck cancer:
recent developments and future directions. Curr Opin Oncol. 2007 May;19(3):202-
9.
Latasa MJ, Cisneros E, Frade JM. Cell cycle control of Notch signaling and the
functional regionalization of the neuroepithelium during vertebrate neurogenesis.
Int J Dev Biol. 2009;53(7):895-908
Lazarus P, Park JY. Metabolizing enzyme genotype and risk for upper
aerodigestive tract cancer. Oral Oncol. 2000 Sep;36(5):421-31
Le QT, Fisher R, Oliner KS, Young RJ, Cao H, Kong C, Graves E, Hicks RJ,
McArthur GA, Peters L, O'Sullivan B, Giaccia A, Rischin D. Prognostic and
predictive significance of plasma HGF and IL-8 in a phase III trial of
chemoradiation with or without tirapazamine in locoregionally advanced head and
neck cancer. Clin Cancer Res. 2012 Mar 15;18(6):1798-807
Lee CH, Ko AM, Warnakulasuriya S, Yin BL, Sunarjo, Zain RB, Ibrahim SO, Liu
ZW, Li WH, Zhang SS, Kuntoro, Utomo B, Rajapakse PS, Warusavithana SA,
Razak IA, Abdullah N, Shrestha P, Kwan AL, Shieh TY, Chen MK, Ko YC.
Intercountry prevalences and practices of betel-quid use in south, southeast and
eastern Asia regions and associated oral preneoplastic disorders: an international
collaborative study by Asian betel-quid consortium of south and east Asia. Int J
Cancer. 2011 Oct 1;129(7):1741-51.
Lee RC, Ambros V. An extensive class of small RNAs in Caenorhabditis elegans.
Science. 2001 Oct 26;294(5543):862-4.
Lee SM, Tole S, Grove E, McMahon AP. A local Wnt-3a signal is required for
development of the mammalian hippocampus. Development. 2000
Feb;127(3):457-67
Lee YC, Boffetta P, Sturgis EM, Wei Q, Zhang ZF, Muscat J, Lazarus P, Matos E,
Hayes RB, Winn DM, Zaridze D, Wünsch-Filho V, Eluf-Neto J, Koifman S, Mates D,
Curado MP, Menezes A, Fernandez L, Daudt AW, Szeszenia-Dabrowska N,
Fabianova E, Rudnai P, Ferro G, Berthiller J, Brennan P, Hashibe M. Involuntary
smoking and head and neck cancer risk: pooled analysis in the International Head
and Neck Cancer Epidemiology Consortium. Cancer Epidemiol Biomarkers Prev.
2008 Aug;17(8):1974-81.

197

Leemans CR, Braakhuis BJ, Brakenhoff RH. The molecular biology of head and
neck cancer. Nat Rev Cancer. 2011 Jan;11(1):9-22.
Leon X, Quer M, Orus C, del Prado Venegas M, Lopez M. Distant metastases in
head and neck cancer patients who achieved loco-regional control. Head Neck.
2000 Oct;22(7):680-6.
Li C, Iida M, Dunn EF, Ghia AJ, Wheeler DL. Nuclear EGFR contributes to
acquired resistance to cetuximab. Oncogene. 2009 Oct 29;28(43):3801-13
Lie DC, Colamarino SA, Song HJ, Désiré L, Mira H, Consiglio A, Lein ES,
Jessberger S, Lansford H, Dearie AR, Gage FH. Wnt signalling regulates adult
hippocampal neurogenesis. Nature. 2005 Oct 27;437(7063):1370-5.
Liebertz DJ, Lechner MG, Masood R, Sinha UK, Han J, Puri RK, Correa AJ,
Epstein AL. Establishment and characterization of a novel head and neck
squamous cell carcinoma cell line USC-HN1. Head Neck Oncol. 2010 Feb 22;2:5.
Linkov F, Lisovich A, Yurkovetsky Z, Marrangoni A, Velikokhatnaya L, Nolen B,
Winans M, Bigbee W, Siegfried J, Lokshin A, Ferris RL. Early detection of head
and neck cancer: development of a novel screening tool using multiplexed
immunobead-based biomarker profiling. Cancer Epidemiol Biomarkers Prev. 2007
Jan;16(1):102-7.
Lippert TH, Ruoff HJ, Volm M. Current status of methods to assess cancer drug
resistance. Int J Med Sci. 2011 Mar 23;8(3):245-53
Liu J, Valencia-Sanchez MA, Hannon GJ, Parker R. MicroRNA-dependent
localization of targeted mRNAs to mammalian P-bodies. Nat Cell Biol. 2005
Jul;7(7):719-23
Liu Y, Wang X, Lu CC, Kerman R, Steward O, Xu XM, Zou Y. Repulsive Wnt
signaling inhibits axon regeneration after CNS injury. J Neurosci. 2008 Aug
13;28(33):8376-82
Logan CY, Nusse R. The Wnt signaling pathway in development and disease.
Annu Rev Cell Dev Biol. 2004;20:781-810.
López-Bendito G, Molnár Z. Thalamocortical development: how are we going to get
there? Nat Rev Neurosci. 2003 Apr;4(4):276-89

198

l-Serag HB, Hepworth EJ, Lee P, Sonnenberg A. Gastroesophageal reflux disease
is a risk factor for laryngeal and pharyngeal cancer. Am J Gastroenterol. 2001
Jul;96(7):2013-8.
Lu B, Mu Y, Cao C, Zeng F, Schneider S, Tan J, Price J, Chen J, Freeman M,
Hallahan DE. Survivin as a therapeutic target for radiation sensitization in lung
cancer. Cancer Res. 2004 Apr 15;64(8):2840-5
Lu W, Yamamoto V, Ortega B, Baltimore D. Mammalian Ryk is a Wnt coreceptor
required for stimulation of neurite outgrowth. Cell. 2004 Oct 1;119(1):97-108.
Lubin JH, Muscat J, Gaudet MM, Olshan AF, Curado MP, Dal Maso L, Wünsch-
Filho V, Sturgis EM, Szeszenia-Dabrowska N, Castellsague X, Zhang ZF, Smith E,
Fernandez L, Matos E, Franceschi S, Fabianova E, Rudnai P, Purdue MP, Mates
D, Wei Q, Herrero R, Kelsey K, Morgenstern H, Shangina O, Koifman S,
Lissowska J, Levi F, Daudt AW, Neto JE, Chen C, Lazarus P, Winn DM, Schwartz
SM, Boffetta P, Brennan P, Menezes A, La Vecchia C, McClean M, Talamini R,
Rajkumar T, Hayes RB, Hashibe M. An examination of male and female odds
ratios by BMI, cigarette smoking, and alcohol consumption for cancers of the oral
cavity, pharynx, and larynx in pooled data from 15 case-control studies. Cancer
Causes Control. 2011 Sep;22(9):1217-31.
Lui JH, Hansen DV, Kriegstein AR. Development and evolution of the human
neocortex. Cell. 2011 Jul 8;146(1):18-36.
Lyu J, Jho EH, Lu W. Smek promotes histone deacetylation to suppress
transcription of Wnt target gene brachyury in pluripotent embryonic stem cells. Cell
Res. 2011 Jun;21(6):911-21
Lyu J, Yamamoto V, Lu W. Cleavage of the Wnt receptor Ryk regulates neuronal
differentiation during cortical neurogenesis. Dev Cell. 2008 Nov;15(5):773-80.
Ma H, Nguyen C, Lee KS, Kahn M. Differential roles for the coactivators CBP and
p300 on TCF/beta-catenin-mediated survivin gene expression. Oncogene. 2005
May 19;24(22):3619-31
Mahomed F, Altini M, Meer S. Altered E-cadherin/beta-catenin expression in oral
squamous carcinoma with and without nodal metastasis. Oral Dis. 2007
Jul;13(4):386-92.

199

Mahon PC, Baril P, Bhakta V, Chelala C, Caulee K, Harada T, Lemoine NR.
S100A4 contributes to the suppression of BNIP3 expression, chemoresistance,
and inhibition of apoptosis in pancreatic cancer. Cancer Res. 2007 Jul
15;67(14):6786-95.
Malkoski SP, Wang XJ. Two sides of the story? Smad4 loss in pancreatic cancer
versus head-and-neck cancer. FEBS Lett. 2012 Jul 4;586(14):1984-92
Mallis A, Jelastopulu E, Mastronikolis NS, Naxakis SS, Kourousis C, Papadas TA.
Laryngeal cancer and passive smoking: the neglected factor? Eur Arch
Otorhinolaryngol. 2011 May;268(5):727-31.
Mangone FR, Walder F, Maistro S, Pasini FS, Lehn CN, Carvalho MB, Brentani
MM, Snitcovsky I, Federico MH. Smad2 and Smad6 as predictors of overall
survival in oral squamous cell carcinoma patients. Mol Cancer. 2010 May 12;9:106.
Mannelli G, Gallo O. Cancer stem cells hypothesis and stem cells in head and
neck cancers. Cancer Treat Rev. 2012 Aug;38(5):515-39
Marur S, D'Souza G, Westra WH, Forastiere AA. HPV-associated head and neck
cancer: a virus-related cancer epidemic . Lancet Oncol. 2010 Aug;11(8):781-9.
McConnell SK, Ghosh A, Shatz CJ. Subplate neurons pioneer the first axon
pathway from the cerebral cortex. Science. 1989 Sep 1;245(4921):978-82.
McDermott AM, Heneghan HM, Miller N, Kerin MJ. The therapeutic potential of
microRNAs: disease modulators and drug targets. Pharm Res. 2011
Dec;28(12):3016-29.
McDonald MW, Lawson J, Garg MK, Quon H, Ridge JA, Saba N, Salama JK,
Smith RV, Yeung AR, Yom SS, Beitler JJ; Expert Panel on Radiation Oncology-
Head and Neck Cancer. ACR appropriateness criteria retreatment of recurrent
head and neck cancer after prior definitive radiation expert panel on radiation
oncology-head and neck cancer. Int J Radiat Oncol Biol Phys. 2011 Aug
1;80(5):1292-8
McMahon AP, Bradley A. The Wnt-1 (int-1) proto-oncogene is required for
development of a large region of the mouse brain. Cell. 1990 Sep 21;62(6):1073-
85

200

Meijer TW, Kaanders JH, Span PN, Bussink J. Targeting Hypoxia, HIF-1, and
Tumor Glucose Metabolism to Improve Radiotherapy Efficacy. Clin Cancer Res.
2012 Oct 15;18(20):5585-94
Mencia N, Selga E, Rico I, de Almagro MC, Villalobos X, Ramirez S, Adan J,
Hernández JL, Noé V, Ciudad CJ. Overexpression of S100A4 in human cancer
cell lines resistant to methotrexate. BMC Cancer. 2010 Jun 1;10:250.
Menezes JR, Luskin MB. Expression of neuron-specific tubulin defines a novel
population in the proliferative layers of the developing telencephalon. J Neurosci.
1994 Sep;14(9):5399-416.
Meola N, Gennarino VA, Banfi S. microRNAs and genetic diseases.
Pathogenetics. 2009 Nov 4;2(1):7.
Messina RL, Sanfilippo M, Vella V, Pandini G, Vigneri P, Nicolosi ML, Gianì F,
Vigneri R, Frasca F. Reactivation of p53 mutants by prima-1 [corrected] in thyroid
cancer cells. Int J Cancer. 2012 May 15;130(10):2259-70. doi: 10.1002/ijc.26228.
Epub 2011 Sep 14.
Meyer F, Samson E, Douville P, Duchesne T, Liu G, Bairati I. Serum prognostic
markers in head and neck cancer. Clin Cancer Res. 2010 Feb 1;16(3):1008-15.
Michaelidis TM, Lie DC. Wnt signaling and neural stem cells: caught in the Wnt
web. Cell Tissue Res. 2008 Jan;331(1):193-210
Michl P, Pazdera J, Prochazka M, Pink R, Stosova T. Human papillomavirus in the
etiology of head and neck carcinomas. Biomed Pap Med Fac Univ Palacky
Olomouc Czech Repub. 2010 Mar;154(1):9-12
Mihara M, Hashizume M, Yoshida H, Suzuki M, Shiina M. IL-6/IL-6 receptor
system and its role in physiological and pathological conditions. Clin Sci (Lond).
2012 Feb;122(4):143-59.
Mihara M, Shintani S, Kiyota A, Matsumura T, Wong DT. Cyclin-dependent kinase
inhibitor (roscovitine) suppresses growth and induces apoptosis by regulating Bcl-x
in head and neck squamous cell carcinoma cells. Int J Oncol. 2002 Jul;21(1):95-
101.
Mimeault M, Hauke R, Mehta PP, Batra SK. Recent advances in cancer
stem/progenitor cell research: therapeutic implications for overcoming resistance to
the most aggressive cancers. J Cell Mol Med. 2007 Sep-Oct;11(5):981-1011.

201

Mintzer R, Ramaswamy S, Shah K, Hannoush RN, Pozniak CD, Cohen F, Zhao X,
Plise E, Lewcock JW, Heise CE. A whole cell assay to measure caspase-6 activity
by detecting cleavage of lamin A/C. PLoS One. 2012;7(1):e30376.
Misale S, Yaeger R, Hobor S, Scala E, Janakiraman M, Liska D, Valtorta E,
Schiavo R, Buscarino M, Siravegna G, Bencardino K, Cercek A, Chen CT,
Veronese S, Zanon C, Sartore-Bianchi A, Gambacorta M, Gallicchio M, Vakiani E,
Boscaro V, Medico E, Weiser M, Siena S, Di Nicolantonio F, Solit D, Bardelli A.
Emergence of KRAS mutations and acquired resistance to anti-EGFR therapy in
colorectal cancer. Nature. 2012 Jun 28;486(7404):532-6.
Mishra R, Das BR. Cyclin D1 expression and its possible regulation in chewing
tobacco mediated oral squamous cell carcinoma progression. Arch Oral Biol. 2009
Oct;54(10):917-23.
Mishra SK, Siddique HR, Saleem M. S100A4 calcium-binding protein is key player
in tumor progression and metastasis: preclinical and clinical evidence. Cancer
Metastasis Rev. 2012 Jun;31(1-2):163-72.
Miyabayashi T, Teo JL, Yamamoto M, McMillan M, Nguyen C, Kahn M. Wnt/beta-
catenin/CBP signaling maintains long-term murine embryonic stem cell
pluripotency. Proc Natl Acad Sci U S A. 2007 Mar 27;104(13):5668-73.
Miyashita T, Koda M, Kitajo K, Yamazaki M, Takahashi K, Kikuchi A, Yamashita T.
Wnt-Ryk signaling mediates axon growth inhibition and limits functional recovery
after spinal cord injury. J Neurotrauma. 2009 Jul;26(7):955-64.
Miyata T, Kawaguchi A, Saito K, Kawano M, Muto T, Ogawa M. Asymmetric
production of surface-dividing and non-surface-dividing cortical progenitor cells.
Development. 2004 Jul;131(13):3133-45
Modjtahedi H, Essapen S. Epidermal growth factor receptor inhibitors in cancer
treatment: advances, challenges and opportunities. Anticancer Drugs. 2009
Nov;20(10):851-5
Moeller BJ, Richardson RA, Dewhirst MW. Hypoxia and radiotherapy:
opportunities for improved outcomes in cancer treatment. Cancer Metastasis Rev.
2007 Jun;26(2):241-8.

202

Molinolo AA, Amornphimoltham P, Squarize CH, Castilho RM, Patel V, Gutkind JS.
Dysregulated molecular networks in head and neck carcinogenesis. Oral Oncol.
2009 Apr-May;45(4-5):324-34.
Mukaida N, Baba T. Chemokines in tumor development and progression. Exp
Cell Res. 2012 Jan 15;318(2):95-102
Muller S, Su L, Tighiouart M, Saba N, Zhang H, Shin DM, Chen ZG. Distinctive E-
cadherin and epidermal growth factor receptor expression in metastatic and
nonmetastatic head and neck squamous cell carcinoma: predictive and prognostic
correlation. Cancer. 2008 Jul 1;113(1):97-107.
Muret J, Hasmim M, Stasik I, Jalil A, Mallavialle A, Nanbakhsh A, Lacroix L, Billot K,
Baud V, Thiery J, Vielh P, Terrier P, Wiels J, Vassilev L, Lecesne A, Bonvalot S,
Chouaib S. Attenuation of soft-tissue sarcomas resistance to the cytotoxic action
of TNF-α by restoring p53 function. PLoS One. 2012;7(6):e38808. Epub 2012 Jun
18.
Nakazaki K, Kato Y, Taguchi T, Inayama Y, Ishiguro Y, Kondo N, Horiuchi C,
Sakakibara A, Tsukuda M. Heterozygous mutation (G/G→G/A) at nt 2607 of the
EGFR gene is closely associated with increases in EGFR copy number and mRNA
half life, but impaired EGFR protein synthesis in squamous cell carcinomas of the
head and neck - implication for gefitinib efficacy. Oncol Lett. 2010 Nov;1(6):1017-
1020. Epub 2010 Sep 23
NCI Fact Sheet, retrieved in November 2012. (http://seer.cancer.gov/statistics/)
Negrini S, Gorgoulis VG, Halazonetis TD. Genomic instability--an evolving
hallmark of cancer. Nat Rev Mol Cell Biol. 2010 Mar;11(3):220-8.
Nelson DE, Naimi TS, Brewer RD, Nelson HA. State alcohol-use estimates among
youth and adults, 1993-2005. Am J Prev Med. 2009 Mar;36(3):218-24.
Ngamwongsatit P, Banada PP, Panbangred W, Bhunia AK. WST-1-based cell
cytotoxicity assay as a substitute for MTT-based assay for rapid detection of
toxigenic Bacillus species using CHO cell line. J Microbiol Methods. 2008
Jun;73(3):211-5.
Nichols AC, Yoo J, Palma DA, Fung K, Franklin JH, Koropatnick J, Mymryk JS,
Batada NN, Barrett JW. Frequent mutations in TP53 and CDKN2A found by next-

203

generation sequencing of head and neck cancer cell lines. Arch Otolaryngol Head
Neck Surg. 2012 Aug 1;138(8):732-9
Niehrs C. The complex world of WNT receptor signalling. Nat Rev Mol Cell Biol.
2012 Nov 15;13(12):767-79
Noctor SC, Martínez-Cerdeño V, Ivic L, Kriegstein AR. Cortical neurons arise in
symmetric and asymmetric division zones and migrate through specific phases.
Nat Neurosci. 2004 Feb;7(2):136-44. Epub 2004 Jan 4.
Ogawa H, Ohta N, Moon W, Matsuzaki F. Protein phosphatase 2A negatively
regulates aPKC signaling by modulating phosphorylation of Par-6 in Drosophila
neuroblast asymmetric divisions. J Cell Sci. 2009 Sep 15;122(Pt 18):3242-9.
Olivier M, Hollstein M, Hainaut P. TP53 mutations in human cancers: origins,
consequences, and clinical use. Cold Spring Harb Perspect Biol. 2010
Jan;2(1):a001008.
Olson EC, Walsh CA. Smooth, rough and upside-down neocortical development.
Curr Opin Genet Dev. 2002 Jun;12(3):320-7.
Oppenheim RW, Prevette D, Yin QW, Collins F, MacDonald J. Control of
embryonic motoneuron survival in vivo by ciliary neurotrophic factor. Science. 1991
Mar 29;251(5001):1616-8.
Osumi N, Shinohara H, Numayama-Tsuruta K, Maekawa M. Concise review: Pax6
transcription factor contributes to both embryonic and adult neurogenesis as a
multifunctional regulator. Stem Cells. 2008 Jul;26(7):1663-72
Paccione RJ, Miyazaki H, Patel V, Waseem A, Gutkind JS, Zehner ZE, Yeudall WA.
Keratin down-regulation in vimentin-positive cancer cells is reversible by vimentin
RNA interference, which inhibits growth and motility. Mol Cancer Ther. 2008
Sep;7(9):2894-903.
Parr BA, Shea MJ, Vassileva G, McMahon AP. Mouse Wnt genes exhibit discrete
domains of expression in the early embryonic CNS and limb buds. Development.
1993 Sep;119(1):247-61
Pennati M, Millo E, Gandellini P, Folini M, Zaffaroni N. RNA interference-mediated
validation of survivin and Apollon/BRUCE as new therapeutic targets for cancer
therapy. Curr Top Med Chem. 2012;12(2):69-78.

204

Perez-Ordonez B, Beauchemin M, Jordan RC. Molecular biology of squamous cell
carcinoma of the head and neck. J Clin Pathol. 2006 May;59(5):445-53.
Pérez-Sayáns M, Somoza-Martín JM, Barros-Angueira F, Diz PG, Rey JM, García-
García A. Multidrug resistance in oral squamous cell carcinoma: The role of
vacuolar ATPases. Cancer Lett. 2010 Sep 28;295(2):135-43
Pfaff N, Moritz T, Thum T, Cantz T. miRNAs involved in the generation,
maintenance, and differentiation of pluripotent cells. J Mol Med (Berl). 2012
Jul;90(7):747-52.
Qian X, Shen Q, Goderie SK, He W, Capela A, Davis AA, Temple S. Timing of
CNS cell generation: a programmed sequence of neuron and glial cell production
from isolated murine cortical stem cells. Neuron. 2000 Oct;28(1):69-80.
Radol L, Paget-Bailly S, Cyr D, Papadopoulos A, Guida F, Schmaus A, Cénée S,
Menvielle G, Carton M, Lapôtre-Ledoux B, Delafosse P, Stücker I, Luce D.
Tobacco smoking, alcohol drinking and risk of oral cavity cancer by subsite: results
of a French population-based case-control study, the ICARE study. Eur J Cancer
Prev. 2012 Sep 12.
Ragin CC, Langevin SM, Marzouk M, Grandis J, Taioli E. Determinants of head
and neck cancer survival by race. Head Neck. 2011 Aug;33(8):1092-8.
Riedel F, Zaiss I, Herzog D, Götte K, Naim R, Hormann K. Serum levels of
interleukin-6 in patients with primary head and neck squamous cell carcinoma.
Anticancer Res. 2005 Jul-Aug;25(4):2761-5.
Rischin D, Young RJ, Fisher R, Fox SB, Le QT, Peters LJ, Solomon B, Choi J,
O'Sullivan B, Kenny LM, McArthur GA. Prognostic significance of p16INK4A and
human papillomavirus in patients with oropharyngeal cancer treated on TROG
02.02 phase III trial. J Clin Oncol. 2010 Sep 20;28(27):4142-8
Rodel F, Hoffmann J, Distel L, Herrmann M, Noisternig T, Papadopoulos T, Sauer
R, Rodel C. Survivin as a radioresistance factor, and prognostic and therapeutic
target for radiotherapy in rectal cancer.
Rodel F, Reichert S, Sprenger T, Gaipl US, Mirsch J, Liersch T, Fulda S, Rodel C.
The role of survivin for radiation oncology: moving beyond apoptosis inhibition.
Curr Med Chem. 2011;18(2):191-9.

205

Roelink H, Wagenaar E, Lopes da Silva S, Nusse R. Wnt-3, a gene activated by
proviral insertion in mouse mammary tumors, is homologous to int-1/Wnt-1 and is
normally expressed in mouse embryos and adult brain. Proc Natl Acad Sci U S A.
1990 Jun;87(12):4519-23.
Roh JL, Ko JH, Moon SJ, Ryu CH, Choi JY, Koch WM. The p53-reactivating
small-molecule RITA enhances cisplatin-induced cytotoxicity and apoptosis in head
and neck cancer. Cancer Lett. 2012 Dec 1;325(1):35-41
Rolls MM, Albertson R, Shih HP, Lee CY, Doe CQ. Drosophila aPKC regulates cell
polarity and cell proliferation in neuroblasts and epithelia. J Cell Biol. 2003 Dec
8;163(5):1089-98
Rose-John S, Scheller J, Elson G, Jones SA. Interleukin-6 biology is coordinated
by membrane-bound and soluble receptors: role in inflammation and cancer. J
Leukoc Biol. 2006 Aug;80(2):227-36
Rosenblatt KA, Daling JR, Chen C, Sherman KJ, Schwartz SM. Marijuana use and
risk of oral squamous cell carcinoma. Cancer Res. 2004 Jun 1;64(11):4049-54.
Ross SE, Greenberg ME, Stiles CD. Basic helix-loop-helix factors in cortical
development. Neuron. 2003 Jul 3;39(1):13-25
Sahores M, Salinas PC. Activity-mediated synapse formation a role for Wnt-Fz
signaling. Curr Top Dev Biol. 2011;97:119-36
Saito T, Nakatsuji N. Efficient gene transfer into the embryonic mouse brain using
in vivo electroporation. Dev Biol. 2001 Dec 1;240(1):237-46.
Saito T. In vivo electroporation in the embryonic mouse central nervous system.
Nat Protoc. 2006;1(3):1552-8.
Sandhu C, Garbe J, Bhattacharya N, Daksis J, Pan CH, Yaswen P, Koh J,
Slingerland JM, Stampfer MR. Transforming growth factor beta stabilizes
p15INK4B protein, increases p15INK4B-cdk4 complexes, and inhibits cyclin D1-
cdk4 association in human mammary epithelial cells. Mol Cell Biol. 1997
May;17(5):2458-67
Sansone P, Bromberg J. Targeting the interleukin-6/Jak/stat pathway in human
malignancies. J Clin Oncol. 2012 Mar 20;30(9):1005-14.

206

Satelli A, Li S. Vimentin in cancer and its potential as a molecular target for cancer
therapy. Cell Mol Life Sci. 2011 Sep;68(18):3033-46
Sauvageot CM, Stiles CD. Molecular mechanisms controlling cortical gliogenesis.
Curr Opin Neurobiol. 2002 Jun;12(3):244-9.
Saxena A, Yashar C, Taylor DD, Gercel-Taylor C. Cellular response to
chemotherapy and radiation in cervical cancer. Am J Obstet Gynecol. 2005
May;192(5):1399-403.
Scapoli L, Palmieri A, Lo Muzio L, Pezzetti F, Rubini C, Girardi A, Farinella F,
Mazzotta M, Carinci F. MicroRNA expression profiling of oral carcinoma identifies
new markers of tumor progression. Int J Immunopathol Pharmacol. 2010 Oct-
Dec;23(4):1229-34
Scheffner M, Werness BA, Huibregtse JM, Levine AJ, Howley PM. The E6
oncoprotein encoded by human papillomavirus types 16 and 18 promotes the
degradation of p53. Cell. 1990 Dec 21;63(6):1129-36.
Schlessinger J. Cell signaling by receptor tyrosine kinases. Cell. 2000 Oct
13;103(2):211-25.
Schmitt AM, Shi J, Wolf AM, Lu CC, King LA, Zou Y. Wnt-Ryk signalling mediates
medial-lateral retinotectal topographic mapping. Nature. 2006 Jan 5;439(7072):31-
7.
Schneikert J, Behrens J. The canonical Wnt signalling pathway and its APC
partner in colon cancer development. Gut. 2007 Mar;56(3):417-25. Epub 2006 Jul
13.
Schrank TP, Han Y, Weiss H, Resto VA. Case-matching analysis of head and neck
squamous cell carcinoma in racial and ethnic minorities in the United States--
possible role for human papillomavirus in survival disparities. Head Neck. 2011
Jan;33(1):45-53.
Schultz JD, Sommer JU, Hoedt S, Erben P, Hofheinz RD, Faber A, Thorn C,
Hormann K, Sauter A. Chemotherapeutic alteration of β-catenin and c-kit
expression by imatinib in p16-positive squamous cell carcinoma compared to HPV-
negative HNSCC cells in vitro. Oncol Rep. 2012 Jan;27(1):270-80. doi:
10.3892/or.2011.1499.

207

Settle K, Posner MR, Schumaker LM, Tan M, Suntharalingam M, Goloubeva O,
Strome SE, Haddad RI, Patel SS, Cambell EV 3rd, Sarlis N, Lorch J, Cullen KJ.
Racial survival disparity in head and neck cancer results from low prevalence of
human papillomavirus infection in black oropharyngeal cancer patients. Cancer
Prev Res (Phila). 2009 Sep;2(9):776-81
Sewram V, De Stefani E, Brennan P, Boffetta P. Maté consumption and the risk of
squamous cell esophageal cancer in uruguay. Cancer Epidemiol Biomarkers Prev.
2003 Jun;12(6):508-13.
Sharan RN, Mehrotra R, Choudhury Y, Asotra K. Association of betel nut with
carcinogenesis: revisit with a clinical perspective. PLoS One. 2012;7(8):e42759.
doi: 10.1371/journal.pone.0042759. Epub 2012 Aug 13.
Shen X, Zheng JY, Shi H, Zhang Z, Wang WZ. Survivin knockdown enhances
gastric cancer cell sensitivity to radiation and chemotherapy in vitro and in nude
mice. Am J Med Sci. 2012 Jul;344(1):52-8.
Shi Y, Sun G, Zhao C, Stewart R. Neural stem cell self-renewal. Crit Rev Oncol
Hematol. 2008 Jan;65(1):43-53
Shinriki S, Jono H, Ota K, Ueda M, Kudo M, Ota T, Oike Y, Endo M, Ibusuki M,
Hiraki A, Nakayama H, Yoshitake Y, Shinohara M, Ando Y. Humanized anti-
interleukin-6 receptor antibody suppresses tumor angiogenesis and in vivo growth
of human oral squamous cell carcinoma. Clin Cancer Res. 2009 Sep
1;15(17):5426-34.
Shinriki S, Jono H, Ueda M, Ota K, Ota T, Sueyoshi T, Oike Y, Ibusuki M, Hiraki A,
Nakayama H, Shinohara M, Ando Y. Interleukin-6 signalling regulates vascular
endothelial growth factor-C synthesis and lymphangiogenesis in human oral
squamous cell carcinoma. J Pathol. 2011 Sep;225(1):142-50.
Siddique HR, Saleem M. Role of BMI1, a stem cell factor, in cancer recurrence
and chemoresistance: preclinical and clinical evidences. Stem Cells. 2012
Mar;30(3):372-8. doi: 10.1002/stem.1035.
Siegel R, DeSantis C, Virgo K, Stein K, Mariotto A, Smith T, Cooper D, Gansler T,
Lerro C, Fedewa S, Lin C, Leach C, Cannady RS, Cho H, Scoppa S, Hachey M,
Kirch R, Jemal A, Ward E. Cancer treatment and survivorship statistics, 2012. CA
Cancer J Clin. 2012 Jul-Aug;62(4):220-41

208

Sitohy B, Nagy JA, Dvorak HF. Anti-VEGF/VEGFR therapy for cancer:
reassessing the target. Cancer Res. 2012 Apr 15;72(8):1909-14.
Skinner HD, Sandulache VC, Ow TJ, Meyn RE, Yordy JS, Beadle BM, Fitzgerald
AL, Giri U, Ang KK, Myers JN. TP53 disruptive mutations lead to head and neck
cancer treatment failure through inhibition of radiation-induced senescence. Clin
Cancer Res. 2012 Jan 1;18(1):290-300
Smilek P, Neuwirthova J, Jarkovsky J, Dusek L, Rottenberg J, Kostrica R, Srovnal
J, Hajduch M, Drabek J, Klozar J. Epidermal growth factor receptor (EGFR)
expression and mutations in the EGFR signaling pathway in correlation with anti-
EGFR therapy in head and neck squamous cell carcinomas. Neoplasma.
2012;59(5):508-15.
Smith NR, Baker D, James NH, Ratcliffe K, Jenkins M, Ashton SE, Sproat G,
Swann R, Gray N, Ryan A, Jürgensmeier JM, Womack C. Vascular endothelial
growth factor receptors VEGFR-2 and VEGFR-3 are localized primarily to the
vasculature in human primary solid cancers. Clin Cancer Res. 2010 Jul
15;16(14):3548-61.
Sobell HM. Actinomycin and DNA transcription. Proc Natl Acad Sci U S A. 1985
Aug;82(16):5328-31.
Sok JC, Coppelli FM, Thomas SM, Lango MN, Xi S, Hunt JL, Freilino ML, Graner
MW, Wikstrand CJ, Bigner DD, Gooding WE, Furnari FB, Grandis JR. Mutant
epidermal growth factor receptor (EGFRvIII) contributes to head and neck cancer
growth and resistance to EGFR targeting. Clin Cancer Res. 2006 Sep
1;12(17):5064-73.
Sousa-Nunes R, Chia W, Somers WG. Protein phosphatase 4 mediates
localization of the Miranda complex during Drosophila neuroblast asymmetric
divisions. Genes Dev. 2009 Feb 1;23(3):359-72.
Stacker SA, Hovens CM, Vitali A, Pritchard MA, Baker E, Sutherland GR, Wilks AF.
Molecular cloning and chromosomal localisation of the human homologue of a
receptor related to tyrosine kinases (RYK). Oncogene. 1993 May;8(5):1347-56
Stewart D, Kazemi S, Li S, Massimi P, Banks L, Koromilas AE, Matlashewski G.
Ubiquitination and proteasome degradation of the E6 proteins of human
papillomavirus types 11 and 18. J Gen Virol. 2004 Jun;85(Pt 6):1419-26.

209

Stingone JA, Funkhouser WK, Weissler MC, Bell ME, Olshan AF. Racial
differences in the relationship between tobacco, alcohol, and squamous cell
carcinoma of the head and neck. Cancer Causes Control. 2012
Stransky N, Egloff AM, Tward AD, Kostic AD, Cibulskis K, Sivachenko A, Kryukov
GV, Lawrence MS, Sougnez C, McKenna A, Shefler E, Ramos AH, Stojanov P,
Carter SL, Voet D, Cortés ML, Auclair D, Berger MF, Saksena G, Guiducci C,
Onofrio RC, Parkin M, Romkes M, Weissfeld JL, Seethala RR, Wang L, Rangel-
Escareño C, Fernandez-Lopez JC, Hidalgo-Miranda A, Melendez-Zajgla J,
Winckler W, Ardlie K, Gabriel SB, Meyerson M, Lander ES, Getz G, Golub TR,
Garraway LA, Grandis JR. The mutational landscape of head and neck squamous
cell carcinoma. Science. 2011 Aug 26;333(6046):1157-60
Stuebner S, Faus-Kessler T, Fischer T, Wurst W, Prakash N. Fzd3 and Fzd6
deficiency results in a severe midbrain morphogenesis defect. Dev Dyn. 2010
Jan;239(1):246-60
Sturgis EM, Cinciripini PM. Trends in head and neck cancer incidence in relation to
smoking prevalence: an emerging epidemic of human papillomavirus-associated
cancers? Cancer. 2007 Oct 1;110(7):1429-35
Sturgis EM, Wei Q, Spitz MR. Descriptive epidemiology and risk factors for head
and neck cancer. Semin Oncol. 2004 Dec;31(6):726-33.
Sun H, Wang Y. Novel Ser/Thr protein phosphatases in cell death regulation.
Physiology (Bethesda). 2012 Feb;27(1):43-52.
Szabó B, Nelhubel GA, Kárpáti A, Kenessey I, Jóri B, Székely C, Peták I, Lotz G,
Hegedus Z, Hegedus B, Füle T, Döme B, Tímár J, Tóvári J. Clinical significance of
genetic alterations and expression of epidermal growth factor receptor (EGFR) in
head and neck squamous cell carcinomas. Oral Oncol. 2011 Jun;47(6):487-96
Szymańska K, Matos E, Hung RJ, Wünsch-Filho V, Eluf-Neto J, Menezes A, Daudt
AW, Brennan P, Boffetta P. Drinking of maté and the risk of cancers of the upper
aerodigestive tract in Latin America: a case-control study. Cancer Causes Control.
2010 Nov;21(11):1799-806.
Tabata H, Nakajima K. Efficient in utero gene transfer system to the developing
mouse brain using electroporation: visualization of neuronal migration in the
developing cortex. Neuroscience. 2001;103(4):865-72.

210

Takebayashi S, Ogawa T, Jung KY, Muallem A, Mineta H, Fisher SG, Grenman R,
Carey TE. Identification of new minimally lost regions on 18q in head and neck
squamous cell carcinoma. Cancer Res. 2000 Jul 1;60(13):3397-403.
Takebe N, Warren RQ, Ivy SP. Breast cancer growth and metastasis: interplay
between cancer stem cells, embryonic signaling pathways and epithelial-to-
mesenchymal transition. Breast Cancer Res. 2011 Jun 10;13(3):211.
Takizawa T, Ochiai W, Nakashima K, Taga T. Enhanced gene activation by Notch
and BMP signaling cross-talk. Nucleic Acids Res. 2003 Oct 1;31(19):5723-31.
Tan EH, Adelstein DJ, Droughton ML, Van Kirk MA, Lavertu P. Squamous cell
head and neck cancer in nonsmokers. Am J Clin Oncol. 1997 Apr;20(2):146-50
Temple S. The development of neural stem cells. Nature. 2001 Nov
1;414(6859):112-7.
Teo JL, Kahn M. The Wnt signaling pathway in cellular proliferation and
differentiation: A tale of two coactivators. Adv Drug Deliv Rev. 2010 Sep
30;62(12):1149-55. Epub 2010 Oct 21.
Teo JL, Ma H, Nguyen C, Lam C, Kahn M. Specific inhibition of CBP/beta-catenin
interaction rescues defects in neuronal differentiation caused by a presenilin-1
mutation. Proc Natl Acad Sci U S A. 2005 Aug 23;102(34):12171-6.
Thomas SJ, Bain CJ, Battistutta D, Ness AR, Paissat D, Maclennan R. Betel quid
not containing tobacco and oral cancer: a report on a case-control study in Papua
New Guinea and a meta-analysis of current evidence. Int J Cancer. 2007 Mar
15;120(6):1318-23.
Tinhofer I, Klinghammer K, Weichert W, Knödler M, Stenzinger A, Gauler T,
Budach V, Keilholz U. Expression of amphiregulin and EGFRvIII affect outcome of
patients with squamous cell carcinoma of the head and neck receiving cetuximab-
docetaxel treatment. Clin Cancer Res. 2011 Aug 1;17(15):5197-204
Tiwari N, Gheldof A, Tatari M, Christofori G. EMT as the ultimate survival
mechanism of cancer cells. Semin Cancer Biol. 2012 Jun;22(3):194-207.
Toledo EM, Colombres M, Inestrosa NC. Wnt signaling in neuroprotection and
stem cell differentiation. Prog Neurobiol. 2008 Nov;86(3):281-96

211

Tonini G, Fratto M, Schiavon G. Molecular prognostic factors: clinical implications
in patients with breast cancer. Cancer Therapy. 2008; (6)773-782.
Toyo-oka K, Mori D, Yano Y, Shiota M, Iwao H, Goto H, Inagaki M, Hiraiwa N,
Muramatsu M, Wynshaw-Boris A, Yoshiki A, Hirotsune S. Protein phosphatase 4
catalytic subunit regulates Cdk1 activity and microtubule organization via NDEL1
dephosphorylation. J Cell Biol. 2008 Mar 24;180(6):1133-47
Tran N, McLean T, Zhang X, Zhao CJ, Thomson JM, O'Brien C, Rose B.
MicroRNA expression profiles in head and neck cancer cell lines. Biochem
Biophys Res Commun. 2007 Jun 22;358(1):12-7.
Trivedy CR, Craig G, Warnakulasuriya S. The oral health consequences of
chewing areca nut. Addict Biol. 2002 Jan;7(1):115-25.
Tsai ST, Yang KY, Jin YT, Lin YC, Chang MT, Wu LW. Amphiregulin as a tumor
promoter for oral squamous cell carcinoma: involvement of cyclooxygenase 2.
Oral Oncol. 2006 Apr;42(4):381-90
Ueda G, Sunakawa H, Nakamori K, Shinya T, Tsuhako W, Tamura Y, Kosugi T,
Sato N, Ogi K, Hiratsuka H Aberrant expression of beta- and gamma-catenin is an
independent prognostic marker in oral squamous cell carcinoma. Int J Oral
Maxillofac Surg. 2006 Apr;35(4):356-61
Velculescu VE, Madden SL, Zhang L, Lash AE, Yu J, Rago C, Lal A, Wang CJ,
Beaudry GA, Ciriello KM, Cook BP, Dufault MR, Ferguson AT, Gao Y, He TC,
Hermeking H, Hiraldo SK, Hwang PM, Lopez MA, Luderer HF, Mathews B,
Petroziello JM, Polyak K, Zawel L, Kinzler KW, et al. Analysis of human
transcriptomes. Nat Genet. 1999 Dec;23(4):387-8.
Vermorken JB, Specenier P. Optimal treatment for recurrent/metastatic head and
neck cancer. Ann Oncol. 2010 Oct;21 Suppl 7:vii252-61.
Vermorken JB. Medical treatment in head and neck cancer. Ann Oncol. 2005;16
Suppl 2:ii258-64.
Vesuna F, van Diest P, Chen JH, Raman V. Twist is a transcriptional repressor of
E-cadherin gene expression in breast cancer. Biochem Biophys Res Commun.
2008 Mar 7;367(2):235-41
Viswanathan H, Wilson JA. Alcohol--the neglected risk factor in head and neck
cancer. Clin Otolaryngol Allied Sci. 2004 Aug;29(4):295-300.

212

Waldner MJ, Foersch S, Neurath MF. Interleukin-6 - a key regulator of colorectal
cancer development. Int J Biol Sci. 2012;8(9):1248-53
Wang C, Chang KC, Somers G, Virshup D, Ang BT, Tang C, Yu F, Wang H.
Protein phosphatase 2A regulates self-renewal of Drosophila neural stem cells.
Development. 2009 Jul;136(13):2287-96
Wang WY, Chien YC, Wong YK, Lin YL, Lin JC. Effects of KRAS mutation and
polymorphism on the risk and prognosis of oral squamous cell carcinoma. Head
Neck. 2012 May;34(5):663-6.
Wang X, Lui JH, Kriegstein AR. Orienting fate: spatial regulation of neurogenic
divisions. Neuron. 2011 Oct 20;72(2):191-3
Wang XJ, Cao Q, Liu X, Wang KT, Mi W, Zhang Y, Li LF, LeBlanc AC, Su XD.
Crystal structures of human caspase 6 reveal a new mechanism for intramolecular
cleavage self-activation. EMBO Rep. 2010 Nov;11(11):841-7
Wang YF, Chang SY, Tai SK, Li WY, Wang LS. Clinical significance of interleukin-
6 and interleukin-6 receptor expressions in oral squamous cell carcinoma. Head
Neck. 2002 Sep;24(9):850-8.
Watt FM, Hogan BL. Out of Eden: stem cells and their niches. Science. 2000 Feb
25;287(5457):1427-30.
Weber SM, Bornstein S, Li Y, Malkoski SP, Wang D, Rustgi AK, Kulesz-Martin MF,
Wang XJ, Lu SL. Tobacco-specific carcinogen nitrosamine 4-(methylnitrosamino)-
1-(3-pyridyl)-1-butanone induces AKT activation in head and neck epithelia. Int J
Oncol. 2011 Nov;39(5):1193-8.
Weng Y, Korte JE. Racial disparities in being recommended to surgery for oral and
oropharyngeal cancer in the United States. Community Dent Oral Epidemiol. 2012
Feb
Wheeler S, Siwak DR, Chai R, LaValle C, Seethala RR, Wang L, Cieply K, Sherer
C, Joy C, Mills GB, Argiris A, Siegfried JM, Grandis JR, Egloff AM. Tumor
epidermal growth factor receptor and EGFR PY1068 are independent prognostic
indicators for head and neck squamous cell carcinoma. Clin Cancer Res. 2012
Apr 15;18(8):2278-89
Wheeler SE, Suzuki S, Thomas SM, Sen M, Leeman-Neill RJ, Chiosea SI, Kuan
CT, Bigner DD, Gooding WE, Lai SY, Grandis JR. Epidermal growth factor

213

receptor variant III mediates head and neck cancer cell invasion via STAT3
activation. Oncogene. 2010 Sep 16;29(37):5135-45.
Winn DM, Blot WJ, McLaughlin JK, Austin DF, Greenberg RS, Preston-Martin S,
Schoenberg JB, Fraumeni JF Jr. Mouthwash use and oral conditions in the risk of
oral and pharyngeal cancer. Cancer Res. 1991 Jun 1;51(11):3044-7.
Witsch E, Sela M, Yarden Y. Roles for growth factors in cancer progression.
Physiology (Bethesda). 2010 Apr;25(2):85-101
Wodarz A, Huttner WB. Asymmetric cell division during neurogenesis in Drosophila
and vertebrates. Mech Dev. 2003 Nov;120(11):1297-309.
Wolff S, Ma H, Burch D, Maciel GA, Hunter T, Dillin A. SMK-1, an essential
regulator of DAF-16-mediated longevity. Cell. 2006 Mar 10;124(5):1039-53.
Wu CY, Tsai YP, Wu MZ, Teng SC, Wu KJ. Epigenetic reprogramming and post-
transcriptional regulation during the epithelial-mesenchymal transition. Trends
Genet. 2012 Sep;28(9):454-63
Wurzenberger C, Gerlich DW. Phosphatases: providing safe passage through
mitotic exit. Nat Rev Mol Cell Biol. 2011 Jul 13;12(8):469-82.
Yadav A, Kumar B, Datta J, Teknos TN, Kumar P. IL-6 promotes head and neck
tumor metastasis by inducing epithelial-mesenchymal transition via the JAK-
STAT3-SNAIL signaling pathway. Mol Cancer Res. 2011 Dec;9(12):1658-67.
Yamasaki K, Taga T, Hirata Y, Yawata H, Kawanishi Y, Seed B, Taniguchi T,
Hirano T, Kishimoto T. Cloning and expression of the human interleukin-6 (BSF-
2/IFN beta 2) receptor. Science. 1988 Aug 12;241(4867):825-8
Yang F, Zeng Q, Yu G, Li S, Wang CY. Wnt/beta-catenin signaling inhibits death
receptor-mediated apoptosis and promotes invasive growth of HNSCC. Cell Signal.
2006 May;18(5):679-87.
Yigitbasi OG, Younes MN, Doan D, Jasser SA, Schiff BA, Bucana CD, Bekele BN,
Fidler IJ, Myers JN. Tumor cell and endothelial cell therapy of oral cancer by dual
tyrosine kinase receptor blockade. Cancer Res. 2004 Nov 1;64(21):7977-84.
Yoon KJ, Lee HR, Jo YS, An K, Jung SY, Jeong MW, Kwon SK, Kim NS, Jeong
HW, Ahn SH, Kim KT, Lee K, Kim E, Kim JH, Choi JS, Kaang BK, Kong YY. Mind

214

bomb-1 is an essential modulator of long-term memory and synaptic plasticity via
the Notch signaling pathway. Mol Brain. 2012 Oct 30;5(1):40
Yoshida T, Okamoto I, Okabe T, Iwasa T, Satoh T, Nishio K, Fukuoka M,
Nakagawa K. Matuzumab and cetuximab activate the epidermal growth factor
receptor but fail to trigger downstream signaling by Akt or Erk. Int J Cancer. 2008
Apr 1;122(7):1530-8.
Yoshikawa S, McKinnon RD, Kokel M, Thomas JB. Wnt-mediated axon guidance
via the Drosophila Derailed receptor. Nature. 2003 Apr 10;422(6932):583-8
You WK, Sennino B, Williamson CW, Falcón B, Hashizume H, Yao LC, Aftab DT,
McDonald DM. VEGF and c-Met blockade amplify angiogenesis inhibition in
pancreatic islet cancer. Cancer Res. 2011 Jul 15;71(14):4758-68.
Yu HS, Oyama T, Matsuda T, Isse T, Yamaguchi T, Tanaka M, Tsuji M, Kawamoto
T. The effect of ethanol on the formation of N2-ethylidene-dG adducts in mice:
implications for alcohol-related carcinogenicity of the oral cavity and esophagus.
Biomarkers. 2012 May;17(3):269-74
Zache N, Lambert JM, Rökaeus N, Shen J, Hainaut P, Bergman J, Wiman KG,
Bykov VJ. Mutant p53 targeting by the low molecular weight compound STIMA-1.
Mol Oncol. 2008 Jun;2(1):70-80
Zandi R, Selivanova G, Christensen CL, Gerds TA, Willumsen BM, Poulsen HS.
PRIMA-1Met/APR-246 induces apoptosis and tumor growth delay in small cell lung
cancer expressing mutant p53. Clin Cancer Res. 2011 May 1;17(9):2830-41
Zang J, Li C, Zhao LN, Shi M, Zhou YC, Wang JH, Li X. Prognostic value of
vascular endothelial growth factor in patients with head and neck cancer: A meta-
analysis. Head Neck. 2012 Sep 18. doi: 10.1002/hed.23156
Zhang YE. Non-Smad pathways in TGF-beta signaling. Cell Res. 2009
Jan;19(1):128-39.
Zhang ZF, Morgenstern H, Spitz MR, Tashkin DP, Yu GP, Hsu TC, Schantz SP.
Environmental tobacco smoking, mutagen sensitivity, and head and neck
squamous cell carcinoma. Cancer Epidemiol Biomarkers Prev. 2000
Oct;9(10):1043-9.

215

Zhang ZF, Morgenstern H, Spitz MR, Tashkin DP, Yu GP, Marshall JR, Hsu TC,
Schantz SP. Marijuana use and increased risk of squamous cell carcinoma of the
head and neck. Cancer Epidemiol Biomarkers Prev. 1999 Dec;8(12):1071-8.
Zhou J, Michaud DS, Langevin SM, McClean MD, Eliot M, Kelsey KT. Smokeless
tobacco and risk of head and neck cancer: Evidence from a case-control study in
New England. nt J Cancer. 2012 Sep 14.
Zygogianni AG, Kyrgias G, Karakitsos P, Psyrri A, Kouvaris J, Kelekis N,
Kouloulias V. Oral squamous cell cancer: early detection and the role of alcohol
and smoking. Head Neck Oncol. 2011 Jan 6;3:2.

Abstract (if available)

Abstract The Role of Ryk and Smek in Neurogenesis: Ryk, a single-pass membrane receptor and a Wnt co-receptor, is expressed in the brain during neurodevelopment and required for proper axon guidance. However, the roles of Ryk in neurogenesis and how it transmits its signal from membrane to nucleus were unknown. We further characterized the function and mechanism of Ryk signaling during early neurodevelopment. Here, we report that Ryk is highly expressed in neurons as they start to differentiate and Ryk deficiency resulted in less neuron production, as well as reduction of several post-mitotic neuronal markers. We also found that Ryk is expressed in the nucleus of differentiating neurons. Later, we found that Ryk is proteolytically cleaved, and its cleaved intracellular domain (Ryk-ICD) is required for neuronal differentiation. In the earlier study, we found that Ryk requires Smek2, one of several Ryk-binding proteins, to facilitate nuclear localization of Ryk. In the process, we found that Smek2 has an isoform called Smek1 and that it was expressed in the developing mammalian brain. In vitro studies revealed that Smek1 is highly expressed in proliferating neuronal progenitor cells (NPC) as well as in post-mitotic neurons. Smek1 is a nuclear protein

Linked assets

University of Southern California Dissertations and Theses

Conceptually similar

PDF

Ethanol induced modulation of microglial P2X7 receptor expression and its role in neuroinflammation

PDF

Discovery of mature microRNA sequences within the protein- coding regions of global HIV-1 genomes: Predictions of novel mechanisms for viral infection and pathogenicity

Asset Metadata

Creator Yamamoto, Vicky N. (author)

Core Title The role of Ryk and Smek in neurogenesis; Mechanisms of CBP/β-catenin signaling inhibitor and IL-6 mediators in head and neck cancer

School Keck School of Medicine

Degree Doctor of Philosophy

Degree Program Biochemistry and Molecular Biology

Publication Date 01/25/2015

Defense Date 12/12/2012

Publisher University of Southern California (original), University of Southern California. Libraries (digital)

Tag Epithelial-to-Mesenchymal transition (EMT),head and neck cancer,IL-6,microRNA,neurodevelopment,neurogenesis,neuronal stem cell,OAI-PMH Harvest,Ryk,small molecule inhibitor,Smek,Squamous Cell Carcinoma,Wnt signaling

Language English

Contributor Electronically uploaded by the author (provenance)

Advisor Kalra, Vijay K. (committee chair), Sinha, Uttam K (committee member)

Creator Email vicky.yamamoto@gmail.com,vickyama@yahoo.com

Permanent Link (DOI) https://doi.org/10.25549/usctheses-c3-130707

Unique identifier UC11290399

Identifier usctheses-c3-130707 (legacy record id)

Legacy Identifier etd-YamamotoVi-1409.pdf

Dmrecord 130707

Document Type Dissertation

Rights Yamamoto, Vicky N.

Type texts

Source University of Southern California (contributing entity), University of Southern California Dissertations and Theses (collection)

Access Conditions The author retains rights to his/her dissertation, thesis or other graduate work according to U.S. copyright law. Electronic access is being provided by the USC Libraries in agreement with the a...

Repository Name University of Southern California Digital Library

Repository Location USC Digital Library, University of Southern California, University Park Campus MC 2810, 3434 South Grand Avenue, 2nd Floor, Los Angeles, California 90089-2810, USA