University of Southern California Dissertations and Theses

Structural and biochemical studies of large T antigen: the SV40 replicative helicase

(USC Thesis Other)

Structural and biochemical studies of large T antigen: the SV40 replicative helicase

PDF

Download a page range

Download transcript

Copy asset link

Request this asset

Transcript (if available)

Content

STRUCTURAL AND BIOCHEMICAL STUDIES OF LARGE T ANTIGEN: THE
SV40 REPLICATIVE HELICASE

by

Bo Zhou

A Dissertation Presented to the
FACULTY OF THE USC GRADUATE SCHOOL
UNIVERSITY OF SOUTHERN CALIFORNIA
In Partial Fulfillment of the
Requirements for the Degree
DOCTOR OF PHILOSOPHY
(MOLECULAR BIOLOGY)

May 2012

Copyright 2012 Bo Zhou
ii

Epigraph
Live Laugh Love

iii

Dedication
This thesis is dedicated to my dear families, husband and little Emma

iv

Acknowledgements
The work described in this thesis would not have been possible without guidance
from many people. First, I would like to thank my advisor, Xiaojiang Chen, for the space,
funding, and intellectual support he has provided, but more importantly, his patience and
inspiration. I never left his office without being motivated and excited to further my
research no matter how frustrated I was when I stepped in. Thank you to the rest of my
defense committee and qualifying exam committee, namely Dr. Fengzhu Sun, Dr. Ian
Haworth, Dr. Lin Chen, Dr.Steven Goodman, Dr. Susan Forsburg and Dr. Xuelin Wu. It
has been an honor to work with such a distinguished group of scientists. I like to
acknowledge my previous PIs, Dr. Jialin Yu and Dr. Dawei Li, for leading me into the
world of science and giving me, for the first time in my life, a feeling for exactly what it
means to perform research.
I am truly grateful to have worked with my research collaborators: members of
Dr. Ellen Fanning’s group at Vanderbilt University, Diana Arnett, Gregory Sowd and
Charlies Xie for their help and dedication in understanding the biological importance of
LTag/p68N interaction; Aaron Brewster and Ian Slaymaker for their helpful assistance
and discussion with crystallography; Xian Jessica Yu for being one of my best friends in
life and a brilliant collaborator in our biochemical studies. Thanks to Damian Wang,
Jessica Yu, Yuan Zhong, and Yuanxiang Mu for proofreading my thesis.
Thanks to everyone in Xiaojiang Chen group, previous and current, for taking
care of me in research and in life and for your ideas, supports, suggestions, and warm
v

smiles. Special thanks to Stefan Vila, a bright undergraduate. His hard work and
dedication make me look like a good mentor.
I greatly appreciate the USC/Norris Comprehensive Cancer Center Wang
Predoctoral Scholarship Committee and USC Women in Science and Engineering
Program for granting me foundations for my education.
I thank the staff at Advanced Light Source (Lawrence Berkeley National
Laboratory, Berkeley, CA) beamlines 8.2.1, 8.3.1, and 5.0.2 as well as at Advanced
Photon Source (Argonne National Laboratory, Chicago, IL) beamline 21-ID-D for their
assistance in diffraction data collection, the USC Biophysics Core laboratory for their
support, Dr. W. J. Chazin for a p68N expression vector and discussion, Dr. J. Hurwitz
and Dr. V. Bermudez for p58-FLAG baculovirus, Dr. E. Kremmer for anti-48 antibody,
and U. Dadwal for assistance with mutagenesis. We thank Dr. A. Brunger for giving us
access to the pre-release version of the program DEN, designed for refining low-
resolution structures.
Importantly, I thank my loved ones who are always a constant source of support:
my wonderful parents who taught me the value of unconditional love; my husband who
has always been there for me, sharing my happiness and success, cheering me up when
science treated me unfriendly, I am truly lucky to have found such a great person to share
my life with; my daughter Emma for letting me enjoy this totally incredible feeling of
being a mom, making me laugh and simply sleeping sound so that I can sit down and
write; my in-laws for helping me taking care of Emma day and night without any
complaints. At last, I want to say sorry to my dear grandfather, for not being able to be
vi

around to fulfill your last wish of seeing your little granddaughter when you left us, it’s
all my bad grandpa, and wish you and grandma peace in heaven.
vii

Table of Contents
Epigraph ii
Dedication iii
Acknowledgements iv
List of Tables x
List of Figures xi
Abstract xiii
Chapter 1 Introduction 1
1.1 Simian Virus (SV40) 1
1.2 SV40 Large T Antigen (LTag): Structural and
Functional Overview

3
1.3 LTag in DNA Replication Initiation 6
1.3.1 Overview 6
1.3.2 DNA Polymerase α/Primase (pol-prim) 7
1.3.3 p68 Subunit of pol-prim and Its Interaction with
LTag

10
1.4 LTag in DNA Replication as an Initiator and Helicase:
Zoom in the Central Channel Structures

11
1.5 Overview of Chapters

16
Chapter 2 Crystal Structure of p68 Subunit of Pol-prim in Complex
with SV40 LTag Hexameric Helicase

19
2.1 Overall Structure of the LTag-p68N Complex
Hexamer

19
2.2 The LTag-p68N Interface 23
2.3 Specificity of the LTag-p68N Binding Interface 26
2.4 Role for LTag-p68 Interaction in Primosome Activity 29
2.5 Biological Role of LTag-p68 Interaction in SV40
DNA Replication in vivo

32
2.6 Discussion 34
2.6.1 Interaction of Replicative Helicase and Primase
in DNA Replisome

34
2.6.2 LTag K425 – a Plausible Site Previous Identified
for p68N Docking

35
2.6.3 A Conserved Polyomaviral Interface for
Pol-prim Interaction

37
viii

2.6.4 An Emerging Eukaryotic Primosome
Architecture

38
2.6.5 Biological Indication of the Overlapping Binding
of p68 vs. TopoI on LTag

40
2.6.6 Indication of Adjacent Binding Surfaces of
p68N and p53DBD

43

Chapter 3 Roles of the Residues on the Central Channel β Hairpin and
DR/F Loop Structures of SV40 Hexameric Helicase

45
3.1 WT LTag DNA-Stimulated ATPase Activity and
Helicase Activity

46
3.2 Function of DR/F Loop Tip Residue F459 49
3.3 β Hairpin Tip Residues K512 and H513 53
3.4 Function of β Hairpin H513 56
3.5 Future Direction 61

Chapter 4 Experimental Procedures 63
4.1 Cloning and Construction of Protein Mutants 63
4.2 Protein Purification 63
4.2.1 Expression and Purification of SV40 LTag and
p68N

63
4.2.2 Preparation of Other Proteins 64
4.3 Crystallization, Structure Determination and
Refinement

65
4.3.1 Crystallization 65
4.3.2 Data Collection and Structure Determination
before Refinement

65
4.3.3 Model Refinement – Deformable Elastic
Network (DEN) Refinement

67
4.4 Affinity Pull-down Study 69
4.5 ATPase Stimulation Assays 70
4.6 DNA Unwinding Assays 71
4.7 Initiation of SV40 DNA Replication Assay 72
4.8 SV40 DNA Replication in Monkey Cells 72
4.8.1 Cloning of Mutations into Genomic SV40 72
4.8.2 Western Blot 73
4.8.3 Southern Blot Analysis 73

Bibliography 75

Appendices 87
Appendix A Full Length LTag Expression and Purification
by Using Baculovirus Insect Cell System

87
ix

A.1 Overview 87
A.2 FL-LTag Expression in Insect Cells by Using
Baculavirus-Mediated Expression System

88
A.2.1 Why Do We Go Insect Cell System 88
A.2.2 Obtaining of Recombinant Viruses 89
A.2.3 Detection and Optimization of FL-LTag
Expression

90
A.3 Purification of FL-LTag from Infected Insect Cell
Pellet

91
A.4 Unwinding Activity of Purified FL-LTag 94
A.5 Conclusions and Future Direction 94
Appendix B Towards a Co-Crystal of Near Full Length
LTag (nFL-LTag) and Human Retinoblastoma
protein (pRb)

96
B.1 Overview 96
B.2 nFL-LTag and pRb Pocket Domain Purification 97
B.3 Binding between nFL-LTag and pRb 101
B.4 Crystallization and Optimization 104
B.5 Elimination of nFL-LTag Degradation 106
B.6 Conclusions and Future Direction 107

x

List of Tables

Table 2.1 Data collection and refinement statistics

21
Table 2.2 List of LTag-HD mutants and p68N mutants located at
LTag/p68N interface

25
Table 3.1 List of LT131 central channel mutants

49
Table B.1 List of mutants aiming to reduce the nFL-LTag231 degradation 107
xi

List of Figures
Figure 1.1 Large T antigen functional domains and domain structures

5
Figure 1.2 Schematic diagram of the interactions of hexameric LTag with
pol-prim

9
Figure 1.3 Activities LTag needs to carry out DNA unwinding 12
Figure 1.4 LTag central channel: structural features and residues

14
Figure 2.1 Overall structure of the LTag-p68N complex

22
Figure 2.2 Detailed LTag-p68N interface interactions

24
Figure 2.3 Mutational analysis of the LTag-p68N interface and functional
validation

28
Figure 2.4 Specific role of LTag-p68 interaction in primosome activity

31
Figure 2.5 LTag-p68 interaction is required to replicate SV40 chromatin in
monkey kidney cells

33
Figure 2.6 K425 location relative to LTag-p68N interface

36
Figure 2.7 Multiple sequence alignments

38
Figure 2.8 Models for regulation of SV40 replication via p68N interaction
with LTag

42
Figure 3.1 WT LTag131 DNA-stimulated ATPase activity

47
Figure 3.2 WT LTag131 helicase activity

48
Figure 3.3 ATPase stimulation activity of LTag131 F459 mutants

51
Figure 3.4 Helicase activity of LTag131 F459 mutants

52
Figure 3.5 Sequence alignment of the representative members of the SF3
helicase family

53
Figure 3.6 Comparison of the activities of LTag 131 β hairpin K512 and
H513 mutants

55
xii

Figure 3.7 ATPase stimulation activity of LTag131 H513 mutants

58
Figure 3.8 Helicase activity of LTag131 H513 mutants

60
Figure 4.1 Sections of electron density maps of a p68N subunit

68
Figure A.1 FL-LTag expression (708-His
6

) detected by Western blot 90
Figure A.2 Purification of FL-LTag from insect cells

93
Figure A.3 Helicase activity of purified FL-LTag

94
Figure B.1 Purification of nFL-LTag.

99
Figure B.2 Purification of pRb pocket domain

100
Figure B.3 Binding test of nFL-LTag and pRb

103
Figure B.4 Crystallization of nFL-LTag/pRb

105
Figure B.5 Elimination of nFL-LTag231 degradation 106

xiii

Abstract
Simian Virus 40 (SV40) replication has long been regarded as a useful model
system in circumventing the complexity of studying the eukaryotic DNA replication
process. SV40 large T antigen (LTag), as the only virus-encoding protein required for
viral genome replication, extensively uses cellular proteins to function as a replication
initiator at replication origins and as a helicase during nascent DNA elongation.
During replication initiation, DNA polymerase alpha-primase (pol-prim) plays an
essential role in eukaryotic DNA replication, initiating synthesis of the leading strand and
of each Okazaki fragment on the lagging strand. At least three subunits of pol-prim
interact physically with the hexameric SV40 LTag to carry out its functions. However,
structural understanding of these interactions and their role in viral chromatin replication
in vivo remains incomplete.
Further DNA elongation substantially depends on the helicase function of LTag.
In the presence of DNA, LTag forms an efficient molecular motor fueled by ATP binding
and hydrolysis. Significant progress has been made in gaining insight into the mechanism
of LTag helicase function by structural and biochemical studies. However, the detailed
mechanism by which LTag couple the ATP hydrolysis to translocation and DNA
separation is not yet clear.
This dissertation is organized to further the understanding of these areas via a
literature review and presentation of findings I discovered through my PhD research:
In Chapter 1, I will give a thorough review about the current understanding of
LTag mediated SV40 replication.
xiv

In Chapter 2, I will present a co-crystal structure of SV40 hexameric helicase and
the regulatory subunit (p68) of eukaryotic DNA polymerase α/primase (pol/prim). The
structure reveals the detailed LTag-p68 interface, which is validated by site-directed
mutagenesis, and demonstrated to be critical in activating the SV40 primosome in cell-
free reactions with purified pol-prim, as well as in monkey cells in vivo.
In Chapter 3, I will demonstrate the roles of the residues along the LTag central
channel structure elements in DNA unwinding. By substituting these residues with a
series of amino acids carrying diverse side chain properties and systematically examining
the DNA stimulated ATPase activity and helicase function of these mutants, my study
reveals the significant roles of these central channel residues in DNA unwinding. More
intriguingly, careful data analysis suggests that even though these residues are spatially
proximal to each other, they might affect DNA unwinding through different mechanisms.
Chapter 4 describes the detailed experimental procedures.
Last but not the least, efforts and preliminary results are included in the
appendices towards understanding of structure and function of the complete LTag
protein, as well as its tumorigenesis through interacting with human retinoblastoma
protein.
Altogether, the information presented here advances the understanding of the
mechanism of SV40 LTag in DNA replication and provides a solid base for future studies
with this incredible molecule. We anticipate results accumulated in this model system
will eventually facilitate the understanding of the replication process as well as
tumorigenesis in eukaryotic cells.
1

Chapter 1 Introduction

This work originated from the need to further understand one of the most basic,
but complicated processes: eukaryotic DNA replication. This process starts from a
hierarchical-packed genome and requires the precise control of timing in machinery
assembly and also depends on concerted efforts of components within this machinery in a
highly dynamic manner. By adopting a eukaryotic Simian Virus 40 as the study model,
structural and biochemical studies of viral large T antigen are dedicated to provide more
pieces towards solving this enormous and intriguing puzzle.
1.1 Simian Virus (SV40)
Faithful DNA replication is required for accurate inheritance of the genetic
information at each cell division. This process is much more complex in eukaryotic cells
than in prokaryotic system. It has been estimated that at each cell division in humans,
30,000 to 50,000 replication origins are activated though till now, it remains elusive how
they are selected. A complex cellular machinery consisting of over 200 polypeptides are
involved to carry out the eukaryotic replication process. Therefore, understanding of
replication in eukaryotes has been hampered greatly by uncertainty in the eukaryotic
origin sequences as well as the complicated protein networks involved in eukaryotic
replication. (Masai et al., 2010; Mechali, 2010).
To circumvent these complexities, Simian Virus 40 (SV40) has long been
investigated as a useful model to understand the eukaryotic DNA replicative mechanism
and control (Bullock, 1997; Fanning and Zhao, 2009; Kelly, 1988). SV40 is a
polyomavirus whose genome replication is the best understood eukaryotic DNA
2

replication process to date. The viral genome contains a 5243 bp double stranded DNA
organized in a single replicon.
There are several reasons that make SV40 an ideal, simple, and powerful
eukaryotic replication model: 1) the SV40 replication occurs in the nucleus of infected
cells. Its genome is packed with host cell histones into nucleosomes and organized as a
minichromosome that closely resembles that of the host chromatin (Bonner et al., 1968;
Germond et al., 1975; Griffith, 1975); 2) unlike the case in eukaryotic cells, the SV40
genome contains a specific replication origin and the constitution of the origin has been
well defined (Borowiec et al., 1990); 3) SV40 replication is accomplished by extensively
using the host cell replication machinery, with the assistance of only one virus-encoding
protein, the large T antigen (LTag). The availability of LTag domain structures have
provided significant insights into the LTag catalyzed DNA initiation and elongation
processes (Bochkareva et al., 2006; Kim et al., 2001; Li et al., 2003; Luo et al., 1996;
Meinke et al., 2007); and 4) with extensive efforts in establishing a cell-free SV40 DNA
replication system, an in vitro replication system containing the SV40 origin DNA and
primate cell extracts supplemented with purified LTag to duplicate a DNA template from
the viral origin, has been successfully established (Li and Kelly, 1984; Stillman and
Gluzman, 1985; Wobbe et al., 1985). Most of the cellular factors, together with LTag,
consisting of this replication machinery have been identified (Waga and Stillman, 1994,
1998; Wang et al., 2008). Therefore, SV40 provides a simplified system to elucidate the
basic mechanisms of DNA replication and the organization of the cellular proteins.
Structural and functional evidence indicate that SV40 LTag serves as a paradigm for the
3

eukaryotic minichromosome maintenance complex (MCM) complex (Brewster et al.,
2008; Fletcher et al., 2003; Li et al., 2003). Mechanisms for replication uncovered in this
system are potentially applicable to the more complicated eukaryotic organism.
1.2 SV40 Large T Antigen (LTag): Structural and Functional Overview
LTag, as the only replicative protein encoded by SV40 genome, is a highly
streamlined protein that contains several functional domains. Functioning as a homologue
of the eukaryotic MCM, it coordinates origin DNA recognition, binding, and local
melting as a replication initiator as well as a helicase for double stranded DNA
unwinding. Upon binding to the DNA origin, it orchestrates a series of protein-DNA and
protein-protein interactions in eukaryotic cells through its different domains as a
replication organizer. It also interacts with cell cycle progression proteins to induce and
maintain cellular transformation.
LTag was first detected as an 88-100 kDa polypeptide from infected cell extracts
in late 1970s (Rundell et al., 1977). Shortly after the protein was purified in its native and
biologically active form in the Tjian lab (Tjian, 1978), the protein was shown to display
the ability to interact with the SV40 origin in a multimerization state (Borowiec et al.,
1990; Challberg and Kelly, 1989; Stillman, 1989), and exhibited the ability to bind and
hydrolyze ATP in the presence of single-stranded DNA (Cole et al., 1986; Giacherio and
Hager, 1979). In an ATP-hydrolysis dependent manner, LTag can unwind duplex DNA
with a 3’ to 5’ directionality bidirectionally (Stahl et al., 1986) in which double stranded
DNA goes into the LTag double hexamer, and the unwound single stranded DNA is
spooled out as replication template (Wessel et al., 1992).
4

Investigations of functional domains of LTag by structural biology, molecular
genetics and biochemical studies have revealed that LTag carries out a bewildering array
of functions through its several structural domains (Figure 1.1).
The N-terminal domain (residues 1-82) of LTag, also termed as J-domain due to
its functional homology with E.coli DnaJ, functions as a cofactor by regulating the
activity of molecular chaprone DnaK in E.coli (Srinivasan et al., 1997). Though not
required for SV40 replication in vitro, the J-domain of LTag has been shown to control
viral DNA replication in vivo as a molecular chaprone through its interaction with hsc70
(Campbell et al., 1997). It is also determined to be critical for cell transformation through
its interaction with a number of host cell proteins that are involved in regulating cell
cycle progression and gene expression (Ahuja et al., 2009; Dickmanns et al., 1994;
Dobbelstein et al., 1992; Sullivan and Pipas, 2002). The atomic structure of N-terminal J-
domain (residues 7-117) was resolved incomplex with the pocket domain (boxes A and
B) of the retinoblastoma tumor suppressor protein (pRb) (Kim et al., 2001). The origin
DNA binding domain (OBD) has been mapped to residues 131-259. The OBD structure
was determined by NMR (Luo et al., 1996), as well as in complex with origin DNA in
structural studies (Bochkareva et al., 2006; Meinke et al., 2007). Together with previous
mutagenesis studies, significant insights have been discovered in the mechanism of origin
recognition by LTag and its assembly as double hexamers at origins (Bullock, 1997; Joo
et al., 1997). The atomic structure of LTag helicase domain (residue 251-627) resolved in
our lab in 2003 represents a key advancement in understanding of the mechanism of viral
DNA replication (Li et al., 2003). LTag helicase domain consisting of a zinc domain and
5

Figure 1.1 Large T antigen functional domains and domain structures. (A)
Schematic representation of functional domains of SV40 LTag. J-domain, origin
binding domain (OBD), helicase domain consisting of Zn domain and ATPase activity
domain, and host range domain are depicted. Minimal regions of LTag that retain
binding activity to polymerase α-primase (pol-prim), tumor suppressor proteins Rb and
p53, and human heat shock protein 70 (hsc70) are illustrated; (B) Modular organization
of LTag domains and linkers. Atomic structures of DnaJ (PDB entry 1GH6), OBD
(PDB entry 2FUF) and helicase (PDB entry 1N25) domains are shown approximately to
scale with the intervening peptides as dotted lines. The structure of the host-range
domain has not been determined.
6

an AAA+ ATPase domain is similar to the architecture of the helicase domain of archeal
MCM as revealed by structural studies (Brewster et al., 2008; Fletcher et al., 2003;
Gomez-Llorente et al., 2005). The helicase domain forms the structural basis for
hexamerization of the helicase and contains a positive charged central channel potentially
accommodating DNA (Li et al., 2003). It also serves as docking site for interacting with a
series of cellular proteins including p53, Pol/Prim subunits, TopoisomeraseI (Arunkumar
et al., 2005; Dornreiter et al., 1993; Dornreiter et al., 1990; Huang et al., 2010a; Khopde
and Simmons, 2008; Lilyestrom et al., 2006; Simmons et al., 1996). The structure of host
range domain located at the C-terminus (628-708) of LTag remains elusive.
1.3 LTag in DNA Replication Initiation
1.3.1 Overview
Functioning as a replication initiator, LTag together with three cellular proteins,
RPA, DNA polymerase α/primase and topoisomerase are sufficient to reconstitute
replication initiation at a viral origin in vitro (Borowiec et al., 1990; Bullock, 1997;
Matsumoto et al., 1990; Weinberg et al., 1990). To initiate SV40 replication, LTag first
recognizes and binds to the viral core origin, a minimal 64 bp region, forming a double-
hexamer complex with the DNA origin in the presence of ATP (Borowiec et al., 1990;
Borowiec and Hurwitz, 1988; Dean et al., 1992; Dean et al., 1987; Deb and Tegtmeyer,
1987; Mastrangelo et al., 1989; Uhlmann-Schiffler et al., 2002). Either concomitantly or
subsequently upon binding to DNA, LTag induces structural changes in the origin region,
which includes untwisting the AT-rich tract, and melting the early palindrome (Borowiec
et al., 1990; Dean and Hurwitz, 1991). Along with the recruitment and binding of the
7

other cellular components including the single-stranded DNA-binding protein that binds
nascent ssDNA to prevent it from degradation by nuclease, and topoisomerase, that acts
as a swivel and continually relieves the superhelical tension generated by DNA-
unwinding (Yang et al., 1987), LTag further plays a helicase role by unwinding the origin
in a bidirectional manner. This protein complex formed at the origin of replication is
termed pre-initiation complex and the SV40 replication fork starts forming.
Biochemical evidence shows that the initiation of DNA synthesis does not occur
until another protein complex, DNA polymerase α/primase (pol/prim) is recruited and
physically interacts with the pre-initiation complex (Dornreiter et al., 1993). According to
the current model, upon emergence of a certain length of RPA-bound ssDNA template,
LTag orchestrates RPA displacement by human pol-prim for primer synthesis and
extension on both leading and lagging strands (Yuzhakov et al., 1999). These primers are
initially extended by Polα and subsequently transferred to Polδ and Polε for processive
and fast synthesis on the lagging and leading strand respectively (Kunkel and Burgers,
2008; Murakami et al., 1986). All these cellular proteins or protein complexes can
directly interact with LTag, and these contacts have been shown to be crucial for
effectively initiating DNA replication (Dornreiter et al., 1993; Melendy and Stillman,
1993; Murakami et al., 1992; Simmons et al., 1996).
1.3.2 DNA Polymerase α-Primase (pol-prim)
In eukaryotes, the core of the primosome at replication initiation is the DNA
polymerase α/primase. Pol-prim has limited processivity (less than 100
nucleoides/binding event) and unlike the other two eukaryotic DNA polymerases (polε
8

and polδ), lacks 3’ exonuclease activity for proofreading errors. However, current
evidence indicates that pol/prim is the only known enzyme in eukaryotic cells containing
the activity that is capable of starting de novo DNA replication (Kunkel and Burgers,
2008). It consists of four subunits. The catalytic primase subunit p48 associates with p58
to form a stable heterodimer that synthesizes an RNA primer of 8-12 nucleotides and
then, through a so far elusive mechanism, transfers it internally to the associated p180
subunit (Zerbe and Kuchta, 2002). The p180 DNA polymerase subunit then elongates the
RNA primers into RNA/DNA primers of about 30-35 nucleotides. The p68 or B subunit
is not essential for the enzymatic activities of pol-prim, but is essential in vivo and may
regulate pol-prim function in response to cell cycle signaling or at telomeres (Collins et
al., 1993; Copeland and Wang, 1993; Eichinger et al., 2009; Foiani et al., 1994; Grossi et
al., 2004; Kuchta and Stengel, 2010; Mizuno et al., 1998). Structure-function studies
indicate that the C-terminal zinc domain of p180 anchors both the p68 subunit and the
p58 subunit of the primase dimer in the complex (Eichinger et al., 2009; Klinge et al.,
2009; Kunkel and Burgers, 2008; Mizuno et al., 1998; Mizuno et al., 1999). EM
reconstructions of pol-prim domains and subcomplexes lacking the N-terminal regions
suggest a modular architecture composed of globular domains joined by flexible linkers
(Klinge et al., 2009; Nunez-Ramirez et al., 2011). Crystal structures of the p58 C-
terminal domain from human and yeast (Agarkar et al., 2011; Sauguet et al.;
Vaithiyalingam et al., 2010) and an NMR solution structure of the N-terminal domain of
human p68 (Huang et al., 2010a) have also recently become available. As in prokaryotic
primosomes, weak physical interactions among LTag, pol-prim and RPA are observed
9

and have been implicated in primosome activity (Agarkar et al., 2011; Collins et al.,
1993; Huang et al., 2010a; Huang et al., 2010b; Jiang et al., 2006; Melendy and Stillman,
1993; Yuzhakov et al., 1999). Based on these observations, in solution, LTag binds as a
hexamer to the pol-prim heterotetramer, making contacts with at least three subunits of
pol-prim (Figure 1.2).

Figure1.2 Schematic diagram of the interactions of hexameric LTag with pol-
prim. Hexameric LTag (light grey) contacts pol-prim (dark grey) through at least three
subunits (curved arrows). The N-terminal regions of p180 and p68 are dispensable for
enzymatic activity, but interact physically with LTag.

10

Proper physical interactions between LT and all subunits of pol/prim are required
for stimulation of their respective activity (Collins et al., 1993; Dornreiter et al., 1993;
Weisshart et al., 2000). However, the overall architecture of this primosome assembly,
the functional interplay among the proteins that gives rise to activity, and the path of the
DNA through the assembly are not known. To our knowledge, no structures of pol-prim
subunits or domains in complex with a replicative helicase or RPA are currently
available.
1.3.3 p68 Subunit of pol-prim and Its Interaction with LTag
The full-length human p68 subunit of pol/prim contains 598 amino acids. The
sequence and structure of the C-terminal domain (CTD) of p68 are conserved in the B-
subunits of all known eukaryotic DNA polymerases. The conserved CTD domain of B
subunit interacts with the CTD of DNA polymerase, which represents the functional core
of all three replicative polymerases (Klinge et al., 2009). In contrast, the overall N-
terminal region of p68 shows little amino acid sequence conservation, it is hence
traditionally viewed as a disordered region without defined function. However,
biochemical studies indicated that the N-terminal 240 amino acids are sufficient to
mediate p68/LTag interaction, and this interaction is indispensable for physical
interaction between LTag and p180, as well as stimulating the activity of the pol/prim
polymerase and primase subunits (Collins et al., 1993). Till very recently, the required
LTag-binding region on p68 is further mapped to an N-terminal globular domain (p68N)
containing 1-78 residue of p68. NMR structure of this domain showed that it folds as a
four helix bundle which is not only necessary and effective for p68 interaction with the
11

LTag helicase domain (LTagHD), but also indispensable for cooperating with LTag to
synthesize primers and extend them on RPA-coated template (Huang et al., 2010a).
Despite the importance of the interaction between p68 and LTag, the precise docking site
of p68 on LTag is still unknown, which is one of the focuses of my study.
1.4 SV40 LTag in DNA replication as an Initiator and Helicase: Zoom in the Central
Channel Structures
As a replicative initiator and helicase, LTag is an efficient molecular motor fueled
by ATP binding and hydrolysis for viral DNA melting and unwinding. Even though
significant progress has been made in gaining insight of the mechanism of LTag helicase
function by structural, genetic and biochemical approaches, the exact mechanism by
which LTag couples the ATP hydrolysis to translocation and DNA separation is not yet
clear. Based on the knowledge accumulated so far, if we dissect the helicase unwinding
process, on the top of the pyramid, accomplishment of unwinding activity is dependent
on the occurrence of several enzyme activities of LTag. As in the most cases of
hexameric helicases, LTag oligomerizes in the presence of NTP, which is necessary for
the DNA binding. DNA binding stimulates the NTPase activity, which in turn fuels the
helicase movement of unwinding through a process of energy transduction. Therefore,
mutant helicases defective in any activity of hexamerization, DNA binding, NTP
hydrolysis or energy transduction could abolish unwinding activity (Patel and Picha,
2000) (Figure 1.3)
12

One group of sites on LTag, which are of particular importance in mediating
helicase unwinding activity, would be those that participate in direct contacts with DNA.
Structure of the LTag helicase domain (residues 251-627) revealed that the ring-shaped
hexameric helicase forms a long, positively charged channel (Li et al., 2003) (Figure
1.4A), indicating its possible role in binding DNA. Despite the fact that opening of the
hexameric ring observed in this structure is too narrow (15 Ǻ) to accommodate dsDNA,
Figure 1.3 Activities LTag needs to carry out DNA unwinding. The diagram shows
the hierarchy and the interdependence of the various activities of LTag to unwind DNA
(Patel and Picha, 2000).
13

hexameric LTag helicase domain binds to both ssDNA and dsDNA according to
biochemical results and supported by EM observation (Cuesta et al., 2010; Li et al., 2003;
Shen et al., 2005).
LTag structures characterized in different nucleotide (Nt) binding states provided
further insights into the molecular mechanism of LTag-mediated DNA melting and
unwinding through its conformational changes elicited by ATP binding and hydrolysis
(Gai et al., 2004). Two structural features located at the central channel of hexameric
LTag, the β-hairpin and DR/F loop, are speculated to interact with DNA directly. Six
planar β-hairpins on the channel surface move longitudinally along the central channel
from Nt free to ADP-binding to ATP-binding state (Figure 1.4B), indicating its possible
role as a sensor to sense the DNA in the central channel, relay the signal to the ATPase
pocket and result in stimulated ATPase activity, or alternatively suggesting its function as
a mechanic finger to pull DNA into the channel for unwinding, or both. Analysis of
properties of the residues located at the tip the central channel structures further drew our
attention to three “tip residues”, including two ring-shaped residues, H513 and F459 on β
hairpin and DR/F loop respectively, and one positively charged residue K512 that is
adjacent to H513 (Figure 1.4C).

14

Figure 1.4 LTag central channel: structural features and residues. (A) Left:
Surface representation of LTag hexamer with the Zn domain tier in front, showing the
positively charged (blue) central channel. Red, negatively charged surface; white,
uncharged surface, Right: The interior of the central channel, showing the large
positive charged 'chamber' (Li et al., 2003); (B) Left: The six β hairpins (residues 508–
517) in the central channel, viewing along the hexameric channel axis, Right: Overlap
of LTag monomer structures between the Nt-free structure (green) and the ATP bound
structure (pink). The yellow dash line shows the moving distance of the β hairpin upon
ATP binding (Gai et al., 2004); (C) Illustration of central channel β hairpin (magenta)
and DR/F loop (yellow), K512, H513 on β hairpin and F459 on DR/F loop are marked.
15

If the central channel β hairpin and DR/F loop structures are the points making
contact with DNA, these residues as well as their side chain features are presumably
playing significant roles in helicase function. Our recent study of the complex structure of
LTag hexamer bound to origin dsDNA (unpublished data) in the central channel further
confirms that DNA in the central channel makes bonding contacts with three regions of
LTag hexamer: the N-terminal Zn domains, the C-terminal β-hairpins and DR/F loops.
Since the N-terminal Zn-domain does not bind DNA in a sequence-dependent manner,
nor does it undergo conformational changes through the ATP binding/hydrolysis cycle
(Gai et al., 2004), the interaction between LTag Zn domain and DNA may not be
dedicated to the DNA origin melting or unwinding process. In contrast to the Zn domain,
LTag makes specific interactions with DNA through its C-terminal, β-hairpins and DR/F
loops, in which six β-hairpins and six DR/F loops, emanating from a hexameric LTag and
arranged in two narrow planes, make contacts with DNA mainly through their tip
residues.
This recent structural study in our lab provides more insight with regards to the
possible mechanisms by which LTag utilizes to melt and unwind dsDNA through
LTag/DNA interaction, even though the detailed roles of these central channel LTag
residues in DNA unwinding remain sketchy. We therefore systematically explored the
function of three tipping residues, namely F459 of DR/F loop, K512 and H513 of β
hairpin of the central channel. All these residues are highly conserved in SF3 helicase
family members (Liu et al., 2007). We constructed a series of mutants to substitute these
ring-shaped or positive-charged residues with amino acids carrying diverse side chain
16

properties in size, charge or shape. Then we systematically studied the DNA-stimulated
ATPase activity and helicase function of these mutants in the presence of various DNA
substrates. Our study is trying to address several questions: 1) how important are these
tipping residues and their side chain properties in LTag ATPase activity stimulation in
the presence of DNA 2) how important are they in mediating the helicase function of
LTag 3) if they are important, are they playing same roles in the process or are they
affecting DNA unwinding through different mechanisms and 4) does the energy
produced by ATP hydrolysis coupled to unwinding/translocation activity? Taken together,
we dissected the complicated unwinding process, and generally understood the allocation
of functions for each of these central channel residues in DNA unwinding.
1.5 Overview of Chapters
Even though the available LTag domain structures correlate very well with the
functional domains of LTag deduced by biochemical and molecular genetics studies,
there are still unknown pieces to be characterized in order to elucidate the functions of
LTag. This includes mapping the detailed protein/protein interactions, ideally at an
atomic level during replication and transformation; revealing the modes LTag interacts
with DNA in its different functional states, determining how the protein/DNA
interactions control the functions of LTag; and ultimately, visualizing the relative
positions of LTag functional domains as an intact entity as well as its variations. Trying
to get closer to these goals, my studies have been concentrated on the following
directions:
17

In chapter 2, I describe the complex structure of hexameric LTag bound with the
p68 subunit of human DNA polymerase α-primase. In this direction, I present a 5Å
crystal structure of the p68N domain of human pol-prim bound to LTag hexameric
helicase. By using newly developed refinement methods, the complex structure shows for
the first time the detailed molecular interactions between p68 and LTag. Mutational
analysis of residues within the interface confirms the importance of these sites for LTag-
p68 interaction and for the pol/prim priming activity and SV40 DNA replication in vitro
and in vivo, indicating that this site represents one of the docking sites critical for
assembling the functional architecture of pol-prim/helicase complex of the SV40
primosome.
In chapter 3, I investigated the roles of the residues located on the central channel
of LTag in DNA replication, with focuses on the β-Hairpin and DR/F loop structures of
SV40 hexameric helicase. By pursuing this direction, I found that residues located on the
LTag central channel that make direct contacts with DNA are of great significance in
facilitating DNA unwinding. However, these central channel residues have been
characterized to influence the DNA replication process through different mechanisms.
Last but not the least at all, at the end in the appendices, I include my efforts
dedicated in getting near full-length LTag expression in E.coli as well as full-length LTag
expression by using a baculovirus insect cell expression system. Both near full-length and
WT full-length LTag purified as an oligomer in favor of the double hexamer state and are
active in helicase activity. By using the purified near full-length LTag fragments, I was
able to co-crystallize LTag with the pocket domain of human retinoblastoma protein
18

(pRb). With the methods and experiences gained, plus future efforts, the outcomes of
these directions may reveal the complete organization of full-length LTag, which we do
not anticipate to be the simple sum of the known parts. This study also sets up a platform
to elucidate the LTag transformation mechanism by its interplaying with pRb, a cellular
tumor suppressor.
19

Chapter 2 Crystal Structure of p68 Subunit of Pol-prim in
Complex with SV40 LTag Hexameric Helicase

Reproduced with permission from Zhou, B., Arnett, D.R., Yu, X., Brewster, A., Sowd,
G.A., Xie, C.L., Vila, S., Gai, D., Fanning, E., Chen, X.S. 2012. Structural basis for the
interaction of a hexameric replicative helicase with the regulatory subunit of human DNA
polymerase alpha-primase. (Manuscript in preparation for submission)
Author contributions: B.Z. designed, purified and crystallized the protein construct;
collected diffraction data and solved the structure; designed, purified mutants and
carried out affinity pull-down assay to test the importance of observed interface in LTag-
p68N complex formation. D.R.A., G.A.S. and C.L.X. examined the significance of LTag-
p68 interaction for pol-prim priming activity in vitro and in mammalian cells. X.Y.
carried out helicase assay. A.B. provided advice for structure determination. S.V.
assisted in mutants’ construction and purification. D.G. provided advice for the design of
the project. E.F. and X.S.C. supervised the project.
2.1 Overall Structure of the LTag-p68N Complex Hexamer
To advance understanding of the molecular basis for replicative helicase
interactions with pol-prim in eukaryotes, we obtained a co-crystal of LTag helicase
domain (residues 260-627) and the N-terminal domain of the human pol-prim regulatory
subunit p68 (p68N, residues 1-78). The LTag-p68N complex crystallized in the space
group p4
1
2
1
2 (a = 249.0 Å, b= 249.0 Å, c= 387.0 Å, α= 90º, β= 90º, γ= 90º, Table 2.1).
Using conventional refinement methods, the low-resolution diffraction data obtained
from the crystal would ordinarily be insufficient to build to a detailed structural model of
20

the protein complex. However, this problem can be addressed using a recently developed
extension of the structure refinement method known as a deformable elastic network
(DEN) (Schroder et al., 2010). DEN incorporates specific information from a known
high-resolution structure that serves as a reference model, together with the
stereochemical information used in conventional refinement methods, and allows local
and global deformations of the reference model to computationally improve the electron
density map of the experimental data. Here we used the high-resolution structure of LTag
(Gai et al., 2004) as a reference model, and 12-fold non-crystallographic symmetry
(NCS) to solve the LTag-p68N structure (see Experimental Procedures for a detailed
description). This approach allowed us to place most of the side chains in the structure at
5.0 Å and yielded good refinement statistics (Table 2.1).
In the structure, one asymmetric unit contains twelve molecules of LTag and
eleven molecules of p68N. The twelve LTag molecules assemble into two hexamers. In
one hexamer, each individual LTag subunit binds to one molecule of p68N (Figure 2.1A
and 2.1B), whereas the other LTag hexamer binds to only five p68N molecules, with the
sixth p68N absent due to crystal packing. In the LTag-p68N complex, the LTag hexamer
adopts a conformation very similar to that of the ATP-bound LTag crystal structure (Gai
et al., 2004). The p68N domain adopts a compact four helical bundle structure similar to
that in the previously reported NMR solution structure (Huang et al., 2010a), but parts of
the main chain display some differences from the NMR p68N structure (Figure 2.1E and
2.1F). Each p68N molecule binds to a surface at the outermost tip of the LTag subunit,
remote from the central channel formed by the hexamer (Figure 2.1C and 2.1D).
21

Table 2.1 Data collection and refinement statistics (molecular replacement)
LTag-p68N

Data collection
Space group p4
1
2
1
Cell dimensions
2

a, b, c (Å) 249.1, 249.1, 387.0
α, β, γ ( °) 90, 90, 90
Resolution (Å) 50.01-5.00 (5.18-5.00)
R
a

sym
or R
merge
9.3 (96) (%)
I / σI 22.7 (1.6)
Completeness (%) 74.7 (78.5)
Redundancy 4.7 (4.7)

Refinement
Resolution (Å) 50.0-5.0
No. reflections 35,234
R
work
/ R
free
30.47 / 31.39 (%)
No. atoms
Protein 41,874
R.m.s. deviations
Bond lengths (Å) 0.002597
Bond angles ( °) 0.65442

Ramachandran Plot
Most favored regions (%)
Additional allowed regions (%)
Generously allowed regions (%)
Disallowed regions (%)
81.7
17.2
0.7
0.3
Protein Data Blank code 4E2I

a

Values in parentheses are for highest-resolution shell.
22

Figure 2.1 Overall structure of the LTag-p68N complex. (A)The top and (B) side
views of the LTag hexamer in complex with p68N. The six molecules of p68N are
colored in green, and each LTag subunit is in a discrete color; For comparison, (C) the
top and (D) side views of LTag hexamer alone; (E) Sections of electron density of a
p68N subunit, electron density map is calculated from final model after the refinement
by the DEN program; (F) The superposition of a p68N molecule determined here with
that of the NMR structure of p68N (PDB 2KEB), showing some small conformational
differences at the turns of the backbone.

23

2.2 The LTag-p68N Interface
The buried surface area in each LTag-p68N interface is ~858 Å
2
(Figure 2.2A and
2.2B), consistent with the weak interaction measured in solution by isothermal titration
calorimetry (K
d
Huang et al., 2010a 6 +/-1 µM) ( ). The p68N-docking surface of LTag is
formed by elements of the α-helical D3 domain and faces away from the AAA+ motor
domain (D2) and the Zn domain (D1). Specifically, the LTag α-helix 7 (α7), α13, the
loop connecting α13 and β-strand 5, and α16 interact with p68N α1 and α3 (Figure 2.2A).
The interface on LTag consists of a hydrophobic patch centered on Y552, F617 and
M621, flanked on one edge by a few positively charged residues. We note that a single
LTag residue K425 that had been implicated in p68N binding (Huang et al., 2010b) is not
part of this interface (Figure 2.2B). The interface on the p68N side also displays a
hydrophobic patch, centered on I14, F15 and I46 and flanked by negatively charged
residues E11, E39 and E44 (Figure 2.2B), consistent with previously reported two-hybrid
screening, pull-down assays, and NMR studies of p68N (Huang et al., 2010a). Thus, the
structural model reveals an LTag-p68N interface composed of hydrophobic and
oppositely charged electrostatic surfaces that complement each other to form the complex
(Figure 2.2C and 2.2D).

24

Figure 2.2 Detailed LTag-p68N interface interactions. (A) A ribbon illustration of the
complex structure of one LTag molecule (in cyan) binding to one p68N (in green). LTag
domains D1, D2 and D3 are indicated. Secondary structures involved in the interaction
of both proteins are labeled for LTag and p68N respectively. Two regions featuring
hydrophobic and electrostatic interactions are indicated; (B) The surface representation
of LTag (bottom) and p68N (top), showing the interface areas on both proteins. The
residues involved in the interface contacts are colored as follows, hydrophobic residues
in yellow, positively charged residues in blue, and negatively charged residues in red.
The LTag K425 is not part of the p68N binding residues, but is located immediately next
to the interface; (C, D) The close-up views of the detailed LTag-p68N interactions
within region 1 (C) and region 2 (D), showing the charge-charge interactions in region 1
and the hydrophobic interactions in region 2, respectively.

25

Nevertheless, given the low-resolution diffraction data and the relatively new
DEN refinement methods used to build the structural model of the LTag-p68N binding
interface, a thorough biochemical validation of the interface and the functional specificity
of the binding interaction are imperative. Toward this end, LTag and p68N residues at the
observed interface were substituted by alanine using site-directed mutagenesis (Table
2.2).
Table 2.2 List of LTag-HD mutants and p68N mutants at LTag/p68N interface
(residues important for LTag-p68 interactions are colored in orange)

LTag-HD H395A, C396A, K400A, R548A, K550A, D551A, Y552A, L609A, S610A,
Q613A, K614A, K616A, F617A, M621A and K425E
P68N Q7A, E10A, E11A, I14A, F15A, E39A, E44A, I46A, H53A, K54A, V55R,
G56R and T58A

Soluble purified wild type (WT) or mutant LTag helicase domain proteins were
pulled down on His-tagged p68N-beads and bound proteins were visualized by
denaturing gel electrophoresis and Coomassie staining (Figure 2.3A). The results
indicated that the background binding of LTag to the Ni-resin alone was low (lane 1), but
significant binding of LTag to the Ni-resin pre-bound with His6-p68N was detected (lane
2). In contrast, with the exception of K425E, which showed a reduction in binding
relative to WT (lane 3), all LTag mutants had near background binding (lanes 4-11). This
result was further confirmed by mutations on the p68N surface. Six mutant His-tagged
p68N proteins bound poorly to WT LTag (Figure 2.3B, compare lanes 3-7 with lane 2).
These results demonstrate the critical role of each of these residues in the LTag-p68N
interface identified in the structural model.
26

2.3 Specificity of the LTag-p68N Binding Interface
As a first approach to validate the functional specificity of the LTag-p68 interface
in the structural model, we monitored the DNA helicase activity of WT LTag and four
LTag proteins with alanine substitutions that disrupt interaction with p68N. The WT
LTag helicase unwound about half of the substrate DNA (Figure 2.3C left, lane 3). All
four LTag variants displayed helicase activity comparable to that the WT (Figure 2.3C
left, lanes 4-7; Figure 2.3 right panel), implying that disruption of p68 interaction by
these substitutions does not indirectly affect the enzymatic activity of the LTag helicase
domain.
To further corroborate the specificity of the p68-docking interface in LTag, we
examined LTag interaction with the human tumor suppressor protein p53. Like p68N, the
DNA binding domain (DBD) of p53 binds to the helicase domain of LTag with 1:1
stoichiometry. A high-resolution co-crystal structure of six p53 DBDs with hexameric
LTag revealed a large binding interface that was fully validated by site-directed
mutagenesis of the interface (Lilyestrom et al., 2006). Interestingly, the conformation of
p53 DBD-bound LTag hexamer closely resembles that of ATP-bound LTag.
Furthermore, bound p53 inhibits LTag ATPase, DNA helicase, and hence replication
activities, and directly interferes with pol-prim binding to LTag (Braithwaite et al., 1987;
Gannon and Lane, 1987). These observations suggested the possibility that p68N and p53
might dock on overlapping surfaces of LTag. However, a comparison of the previously
defined p53 interface (Lilyestrom et al., 2006) with that of p68N on LTag in our
27

structural model predicts that the two proteins recognize adjacent, but non-overlapping,
binding interfaces (Figure 2.3D).
To test this prediction, GST-p53 DBD pull-down assays were conducted with
soluble LT108 WT and four of the alanine substitution mutants defective in binding to
p68N (Figure 2.3E, compare lanes 4-7 with lane 3). No significant differences between
WT and mutant LT108 binding to p53 DBD were detected. We conclude that p53 DBD
and p68N bind to adjacent but distinct surfaces on LTag, suggesting that the observed
competition may arise through steric hindrance. Taken together, our data strongly suggest
that the substitutions in LTag that disrupt binding to p68N do not abrogate other known
functions of the helicase domain, implying that the p68N-binding surface of LTag
identified in our structural model is specific for p68.

28

Figure 2.3 Mutational analysis of the LTag-p68N interface and functional
validation. (A) Pull-down assay to evaluate the effect of LTag mutations of the residues
with the p68N-binding interface. The result showed that LTag residues within the
interface that are important for p68N binding. Lane 1, the LTag retained on Ni-resin
alone; Lane 2, the LTag retained on His
6
-p68N bound Ni resin; Lanes 3-11, mutant
LTags (as marked) retained on His
6
-p68N bound Ni resin; (B) Pull-down assay to
evaluate the effect of p68N mutations of the residues within the LTag-binding interface.
The result showed that p68 residues within the observed interface that are important for
LTag-binding. Lane 1, the LTag retained on Ni-resin in the absence of His
6
-p68N; Lane
2, the LTag retained on His
6
-p68N-bound Ni-resin; Lane 3-8, LTags retained on Ni-resin
bound to mutant His
6
-p68Ns (as marked). For the pull-down assays in panels A and B,
the input LTag for initial incubation for each lane was 100 µg (see Experimental
Procedures); (C) Assay for helicase activity of LTag mutants that have disrupted p68N
binding. Lanes 1 & 2, unboiled and boiled DNA substrate; lanes 3-7: WT LTag, LTag
H395A, R548A, K550A and K616A, respectively. Quantitative analysis of the helicase
activities is shown as bar chart on the right. Error bars represent the standard error from
three repeats; (D) The binding interfaces on LTag for p53 (red) (Lilyestrom et al., 2006)
and for p68 (blue) are adjacent but distinct; (E) Glutathione agarose beads bound to
either GST (lane 2) or GST-p53 DBD (lanes 3-7) were incubated with LT108 WT or
substitution proteins as indicated. Retained proteins were visualized by western blot with
the indicated antibodies. Lane 1, 15% of the LT108 input amounts used in lanes 2-7.
29

2.4 Role for LTag-p68 Interaction in Primosome Activity
The SV40 primosome activity of pol/prim containing a p68 mutation that either
abolished or reduced LTag binding was diminished in proportion to its defect in binding
to LTag (Huang et al., 2010a), suggesting that p68N docking on LTag was crucial for this
activity. The detailed LTag-p68N interactions revealed here now allow us to further test
the importance of the LTag interface residues in SV40 primosome activity.
Recombinant full-length WT and four mutant LTags were stable and purified in similar
yields (Figure 2.4A). Binding of p68N to purified full-length WT LTag was easily
detected, but p68N bound poorly to the mutant proteins (Figure 2.4B). In contrast,
interactions of the mutant LTags with the primase and p180 subunits of pol-prim were
indistinguishable from those of WT LTag (Figure 2.4C, 2.4D). We conclude that the
substitutions in LTag specifically weaken its interaction with p68, but not other pol-prim
subunits.
To monitor the primosome activity of the full-length LTag mutant proteins, we
used theSV40 monopolymerase assay, which measures primer synthesis coupled with
unwinding of supercoiled DNA containing the SV40 origin (Matsumoto et al., 1990).
Although newly synthesized primers can be directly detected in this assay in the absence
of deoxyribonucleotides, measurement of primer-dependent extension into RNA-DNA
products in the presence of radiolabeled dCTP was used here to provide greater
sensitivity (Matsumoto et al., 1990) . In reactions containing DNA, WT LTag, RPA, and
topoisomerase, radiolabeled products accumulated in proportion to the amount of purified
pol-prim present in the assay (Figure 2.4E, lanes 2-4). No products were observed when
30

LTag was omitted (lane 1). LTag substitutions H395A, R548A, K550A, and K616A
significantly reduced primosome activity relative to that of an equal amount of WT LTag
(Figure 2.4E, lanes 4-8; Figure 2.4F). The magnitude of this defect is essentially identical
to the ~60% drop in primosome activity observed in reactions conducted with pol-prim
containing the Ile14Ala substituted p68 disrupts binding to LTag (Huang et al., 2010a).
The results demonstrate that interaction of p68 with the LTag interface identified in our
structural model is important for primosome activity.

31

Figure 2.4 Specific role of LTag-p68 interaction in primosome activity. (A) Purified
WT and the indicated mutant LTags were separated by SDS-PAGE and stained with
Coomassie Brilliant Blue. Marker proteins are shown at the left; (B) Pull-down assay and
western blot to evaluate the effect of full-length LTag point mutants of the interface
residues on p68N binding, showing that full-length LTag mutants are also defective in
p68N binding. Glutathione agarose beads bound to either GST (lane 2) or GST-p68N
(lanes 3-7) were incubated with full-length WT or the indicated point mutant LTags.
Retained proteins were analyzed by western blot with the indicated antibodies. Lane 1,
15% of the LTag input used for pulldowns in lanes 2-7; (C, D) FLAG beads without
(lane 2) or with bound p48/His
6
-FLAGx2-p58 heterodimer (C) or SJK237-31-sepharose
beads without (lane 2) or with bound p180 (D) were incubated with soluble purified full-
length WT or the point mutant LTags as indicated. Lanes 1, 7.5% of the LTag input used
for pulldowns in lanes 2-7; (E) Initiation of SV40 DNA replication initiation was assayed
in monopolymerase reactions containing purified LTag, RPA, topisomerase, and pol-prim
(diagram). Radiolabeled products of monopolymerase reactions lacking LTag (lane 1), or
containing 300 ng of WT or the indicated mutant LTags (lanes 2-8) and varying amounts
of pol-prim (lane 2, 125 ng; lane 3, 250 ng; lanes 1, 4-8, 500 ng) were analyzed by
denaturing gel electrophoresis and phosphor imaging; (F) Initiation activity from three
independent experiments as in panel E was quantified by phosphor imaging and the
activity of each mutant LTag was expressed relative to that of the WT LTag activity in
each experiment. Brackets indicate standard deviation.
32

2.5 Biological Role of LTag-p68 Interaction in SV40 DNA Replication in vivo
A cell-free primosome assay with purified DNA and proteins is of course highly
simplified relative to the intracellular environment in which viral chromatin replicates. To
determine whether this in vitro p68-LTag interaction contributes to viral mini-
chromosome replication in the natural host monkey cells, we prepared bacterial plasmid
DNAs that each contained a complete SV40 genome encoding the WT or one of the
mutant H395A, R548A, K550A, or K616A LTags with defective primosome activity. An
SV40 genome encoding the Walker B LTag substitution D474N, which disrupts the
essential replicative helicase activity, was used as a negative control (Huang et al.,
2010b). We introduced this panel of SV40 genomic DNAs into monkey cells and
monitored LTag expression and viral DNA replication products.
At 24 h after transfection of cells with WT and mutant SV40 DNA, whole cell
extracts were prepared and LTag expression was monitored by immunoblotting. WT and
each of the mutant LTags accumulated at detectable levels, with some variation among
samples (Figure 2.5A). Immunofluorescence microscopy confirmed that the WT and
mutant LTags accumulated in the nuclei of the transfected cells as expected (data not
shown). To evaluate viral DNA replication at 48 h after transfection, unit length SV40
genomes were isolated from cells expressing WT and mutant LTag, digested with DpnI
to eliminate unreplicated input DNA, and analyzed by southern blot and
phosphorimaging. Daughter DNA was easily detected in the WT samples, and not in the
Walker B mutant samples, as expected (Figure 2.5B, lanes 1, 2). The poor replication of
the LTag mutant genomes H395A, R548A, K550A, and K616A in monkey cells mirrors
33

their poor primosome activity in vitro (Figure 2.5B, lanes 3-6; Figure 2.5C). We conclude
that viral mini-chromosome replication in mammalian cells depends on the p68-LTag
primosome interface identified in our structural model.

Figure 2.5 LTag-p68 interaction is required to replicate SV40 chromatin in monkey
kidney cells. (A) Whole cell extracts were prepared from BSC40 cells transfected 24 h
earlier with genomic SV40 DNA encoding WT LTag, the Walker B mutant LTag
D474N, or the indicated mutant LTags with defects in p68 binding. A 4 μg sample of
total protein from each extract was analyzed by SDS-PAGE and western blotting to
evaluate LTag expression. Actin served as control for equal protein loading; (B) Low
molecular weight DNAs were extracted from a parallel experiment (panel A) at 48 h after
transfection and analyzed by Southern blotting with a radiolabeled SV40 DNA probe and
with a human mitochondrial DNA probe as a loading control; (C) The radiolabeled
signals for SV40 replication product and mitochondrial DNA in each lane were
quantified using phosphorimaging and each SV40 signal is graphed relative to that of the
mitochondrial loading control in the same sample.

34

2.6 Discussion
2.6.1 Interaction of Replicative Helicase and Primase in DNA Replisome
The DNA replisome is a multi-protein machine composed of various “moving
components” that display a high degree of dynamic coordination. Our current
understanding of the interactions of two critical components within this machine, DNA
primases with replicative helicases is based largely on prokaryotic replisomes that have
been extensively characterized in multiple systems (Kuchta and Stengel, 2010). The T7
primase and helicase are fused in gp4 so that a hexameric helicase contains six attached
primases (Guo et al., 1999; Qimron et al., 2006; Toth et al., 2003). The T4 primase
(gp61) binds to the hexameric helicase (gp41) forming a primosome complex that greatly
stimulates the primase activity (Hinton and Nossal, 1987; Valentine et al., 2001; Yang et
al., 2005) , and in bacterial cells, three copies of primase (DnaG) bind to a hexameric
helicase (DnaB) (Bailey et al., 2007; Corn et al., 2005; Johnson et al., 2000; Mitkova et
al., 2003; Wang et al., 2008).
In contrast, the eukaryotic machinery is much more complex and less well
characterized. The replicative helicase in eukaryotic cells, the mini-chromosome
maintenance protein 2-7 (MCM2-7), contains six different proteins. Moreover, multiple
additional proteins, e.g. CDC6, Cdt1, GINS and Cdc45, are involved in MCM-mediated
replication initiation at the origin. In addition, primase activity of eukaryotic cells resides
in a heterotetromeric complex, pol-prim. Partially due to this complexity, the active
eukaryotic primosome based on cellular MCM helicase has yet to be reconstituted in
vitro (Bochman and Schwacha, 2008; Costa et al., 2011; Costa and Onesti, 2009; Moyer
35

et al., 2006). And to our knowledge, no structures of pol-prim subunits or domains in
complex with a replicative helicase are currently available.
The active primosome reconstituted in vitro using LTag helicase enables detailed
analysis of the interactions between the helicase and pol/prim in a simple eukaryotic
primosome. Here we have applied a powerful new extension of DEN refinement methods
to a low-resolution co-crystal structure of a human pol-prim domain bound to the
replicative helicase LTag. The resulting structural model of the complex reveals in detail
a network of complementary hydrophobic and electrostatic interactions at the protein
interface that have been extensively validated by site-directed mutagenesis, highlighting
the effectiveness of these new refinement methods. Using this panel of mutants in
structure-guided functional analysis of the pol-prim/helicase interaction, we show that the
p68-LTag interface is not involved in LTag helicase activity or in binding to the p53
tumor suppressor protein, to the pol-prim catalytic subunit p180, or to primase. In
contrast, the integrity of the p68-LTag interface is vital for initiation of SV40 DNA
replication in a cell-free reaction reconstituted with purified proteins, as well as in the
natural monkey kidney host cells.
2.6.2 LTag K425 – a Plausible Site Previous Identified for p68N Docking
The earlier identification of the LTag binding surface on p68N as a hydrophobic
patch rimmed by acidic charge led to the expectation that the binding surface on LTag
would be comprised of a complementary hydrophobic patch bounded by basic charge. A
two-hybrid screen of charge-reverse substitutions in LTag surface residues for mutations
that disrupted binding to p68N identified LTag K425 as a potential interacting residue
36

(Huang et al., 2010b), but no hydrophobic patch could be identified in the immediate
vicinity. The structural model reported here reveals that K425 is not part of the interface
(Figure 2.2B), but rather resides on the surface of LTag near both the P-loop of the
AAA+ subdomain and R548, which is positioned at the edge of the LTag-p68 interface
(Figure 2.6). It is likely that the K425E substitution perturbed the LTag surface
sufficiently to weaken the interaction with p68N. In addition, In addition, disruption of
the P-loop might explain the low ATPase activity displayed by K425E LTag (Huang et
al., 2010b).

Figure 2.6 K425 location relative to LTag-p68N interface. Ribbon representation
of LTag showing that K425 is located outside (but nearby) the p68N-binding
interface on the surface of LTag.

37

2.6.3 A Conserved Polyomaviral Interface for Pol-prim Interaction
Analysis of LTag protein sequences from other primate polyomaviruses revealed
the LTag residues critical for binding p68 to be well conserved (Figure 2.7A, boxed),
suggesting the possibility that docking of p68N on the surface of the viral helicase may
be a common feature of polyomavirus replication. Although the p68 N-terminal region
(1-206) displays little sequence conservation among eukaryotes, the extreme N-terminal
end (residues ~1-80), and specifically the residues implicated in LTag binding (Figure
2.7B, boxed), were highly conserved among higher eukaryotes, suggesting that this p68-
LTag binding surface and its function may be conserved among the B-subunits of
mammalian pol-prim. The phylogenetic conservation of p68N may reflect its potential
role in regulating the primosome activity of pol-prim in a specific physiological setting,
which is exploited by polyomavirus replication. Consistent with this notion, a cluster of
Ser/Thr-Pro cell cycle-dependent phosphorylation sites resides in the long linker between
p68N and its C-terminal domain of both mammalian and yeast pol-prim (Foiani et al.,
1995; Foiani et al., 1994; Ott et al., 2002a; Voitenleitner et al., 1999). Phosphorylation at
four of these sites by cyclin-dependent kinases strongly inhibits the SV40 primosome
activity of pol-prim, but has little or no impact on its enzymatic activities, and alanine
substitutions at these sites protect pol-prim from this inhibition (Ott et al., 2002a;
Voitenleitner et al., 1999). However, a potential role for p68N in regulating primosome
activity in chromosomal replication remains to be identified.

38

2.6.4 An Emerging Eukaryotic Primosome Architecture
In solution, LTag binds as a hexamer to pol/prim and interacts with at least three
subunits of pol-prim includes p68, p180, and at least one of the primase subunits, but
their docking sites on LTag have not been mapped (Collins et al., 1993; Dornreiter et al.,
1993; Dornreiter et al., 1990; Huang et al., 2010a). Extensive biochemical studies
investigating the functional interplay between LTag and different pol-prim subunits have
shown that specific interactions between LTag and pol-prim are required for primosome
Figure 2.7 Multiple sequence alignments. (A) C-terminal sequence alignment of LTag
from five different polyomaviruses, showing the conservation of the residues interacting
with p68 (indicated by*); (B) Sequence alignment of the N-termini of p68 from different
eukaryotic organisms, showing the conservation of the LTag-binding residues (indicated
by*).

39

activity (Collins et al., 1993; Dornreiter et al., 1993; Huang et al., 2010a; Huang et al.,
1998; Weisshart et al., 2000). Surface plasmon resonance measurements indicate that pol-
prim interacts with hexameric LTag with nanomolar affinity (Weisshart et al., 2000),
whereas the interaction of p68 with a single LTag subunit is weak (Kd 6 μM) when
measured in solution by isothermal titration calorimetry (Huang et al., 2010a). The p180
and primase subunits of pol-prim interact equally well with WT LTag and four different
LTag variants that fail to bind to p68 (Figure 2.4). These results imply that the LTag
hexamer has at least three, likely different, interfaces for binding to pol-prim, of which
two remain unidentified. The p68-docking site on LTag is of course present on all six
subunits of the hexamer, but given the 1:1 (pol-prim: LTag hexamer) stoichiometry
observed in solution (Huang et al., 1998) and the similar mass of hexameric LTag and
pol-prim hetero-tetramer (~500 and 350 kDa), it seems likely that the 1:1 stoichiometry is
the functional complex. Thus, the structural arrangement of pol-prim bound to LTag is
inherently asymmetric, which is likely to be functionally significant. The present study
reveals for the first time the molecular interactions of LTag with the pol/prim regulatory
subunit p68. Based on the data presented here and in previous literature, a more complete
architecture of pol/prim complex binding to LTag hexameric helicase is shown in Figure
2.8A. Despite of the relatively small interface between LTag-p68, we show that this
interface on both LTag side and p68N side is critical for primosome activity in vitro and
SV40 genome replication in vivo, suggesting that each of these weak interactions is
important for proper function of the highly dynamic complex machine (Arunkumar et al.,
2005; Stauffer and Chazin, 2004). This mode of complex formation through multiple
40

weak interactions may be essential to provide spatial accessibility of the replication
proteins to their substrates, and concurrently, to allow the replicative proteins to be
flexibly assembled and disassembled to enable successive replication steps, such as
handoff of the primed template for clamp-loading and assembly of the DNA polymerase
delta holoenzyme (Waga and Stillman, 1998; Yuzhakov et al., 1999). It is also consistent
with the multiple weak interactions proposed by Murakami and Hurwitz based on
dilution experiments showing that pol/prim dissociates from LTag after priming and
rebinds for new primer synthesis (Murakami and Hurwitz, 1993).
2.6.5 Biological Indication of the Overlapping Binding of p68 vs. TopoI on LTag
Like pol/prim, human Topoisomerase I (Topo I) has been shown to bind to the
LTag C-terminus and to compete with pol/prim for LTag binding (Borowiec et al., 1990;
Gai et al., 2000; Roy et al., 2003; Simmons et al., 1996; Trowbridge et al., 1999).
Substitutions in any one of six LTag C-terminal residues (K550, Y552, Y612, K616,
F617 and M621) disrupted efficient binding to Topo I (Khopde and Simmons, 2008).
Interestingly, this cluster of residues overlaps significantly, if not completely shares with
the p68N-binding surface on LTag (Figure 2.8B). This may bring up an alternative
explanation for the defective primosome activity we observed in our priming assay in the
presence of TopoI. However, the fact that the SV40 primosome activity assays using
either LTag mutants or p68 mutants that disrupting LTag-p68N interactions both showed
similar negative impact on the priming activity suggests that p68N-LTag interaction may
play a more dominant role for DNA priming.
41

We then asked the biological significance of this surface overlapping. During
DNA replication, the discontinuous lagging strand synthesis can take place without losing
the coordination with the continuous and fast leading strand synthesis. There are several
models explaining the possible mechanisms for the coordination of the leading and
lagging strand synthesis. One model supported by biochemical and single-molecule
studies is that the primase acts as molecular brakes that can transiently halt or slow down
the replication fork progression and, thus, the leading strand synthesis (Lee et al., 2006;
Murakami and Hurwitz, 1993). Supporting this model, in prokaryotes, physical and
functional interactions between the replicative helicase and primase contribute to
coordination of leading and lagging strand synthesis (Hamdan and Richardson, 2009;
Hamdan and van Oijen, 2010). However, the exact molecular mechanism for the primase
“braking” effect is unclear. Based on the observation of overlapping binding surface on
LTag helicase for p68-pol/prim and Topo I, we proposed a competition model to explain
this primase braking effect by pol/prim.
In this model (Figure 2.8C), to initiate primer synthesis for the lagging strand,
competitive binding of pol/prim to LTag through its p68 subunit could temporarily
displace/disorient Topo I from LTag and, thus, inhibit Topo I function as a swivel, which
may result in the accumulation of superhelical tension ahead of the replication fork.
Consequently, the further unwinding of the fork by LTag helicase would be decelerated
and even paused, as would the leading strand synthesis. This temporary retard of fork
progression, and hence, the leading strand synthesis, enables the pol/prim to synthesize
new lagging strand primer. After the completion of one cycle of primer synthesis on
42

Figure 2.8 Models for regulation of SV40 replication via p68N interaction with
LTag. (A) Model for the interactions of a complete pol/prim complex with LTag. Left
panel diagrams the multiple interactions between LTag (orange) and subunits of pol/prim
including p180 (blue), p68 (green), p58-p48 primase (gray-magenta). The three domains
of LTag, the J domain, DNA binding domain (OBD), and helicase domain (HD), are
drawn. The interactions between pol-prim and LTag are through p180 and p68 (indicated
by solid lines with arrowheads), and one or two primase subunits (indicated by dotted
lines with arrowheads). Right panel shows the detailed molecular interaction between
p68N and LTag (purple circle) described in this report, which represents one of the
critical contacts between LTag and pol/prim for the function of the primosome; (B) The
surface representation of LTag monomer showing p68 and TopoI docking sites on LTag.
Locations of TopoI docking site are mapped according to a previous mutagenesis study
(Khopde and Simmons, 2008) and colored in red, p68-binding residues are colored in
blue, and residues involved in both TopoI binding and p68 binding are colored in green.
(C) Possible competition between p68-pol/prim and Topo I during replication. Normally,
Topo I releases the DNA superhelical tension generated ahead of the replication fork.
However, pol/prim binding to LTag via p68 at the same site as Topo I may temporarily
dislodge Topo I. The competition of p68 of pol/prim with Topo I may lead to a build-up
of DNA superhelical tension and slow down fork unwinding, providing a potential way
of coordinating leading and lagging strand synthesis.

43

lagging strand, the pol/prim is substituted by pol δ for processive and fast synthesis of the
new Okazaki fragment, enabling Topo I to restore its proper interaction with LTag to
function in releasing the superhelical tension for the fast replication fork progression and
efficient DNA synthesis for both the leading strand and Okazaki fragment.
However, this model is complicated by the fact that Topoisomerase II (Topo II) has been
shown to substitute for Topo I in the DNA unlinking function in replication fork
progression. Therefore, it is likely that SV40 fork progression and primosome activity are
subject to additional regulatory mechanisms. The functional significance of the
overlapping binding surface of pol/prim p68 and Topo I on the LTag replicative helicase
merits further investigation.
2.6.6 Indication of Adjacent Binding Surfaces of p68N and p53DBD
p53 also binds near the C-terminal end of LTag hexamer (Lilyestrom et al., 2006).
Even though we did not observed direct steric collision between the bindings of the sub-
domains of these two protein with LTag by superposing the structures directly (data not
shown), given the close proximity of the docking sites, the full-length protein or protein
complex could inhibit the bindings of each other to LTag simultaneously. Therefore, our
finding also provided structural evidence of the competition between pol/prim and p53
for binding to LTag (Braithwaite et al., 1987; Gannon and Lane, 1987), and gave one
alternative possible mechanism through which p53 may adopt to inhibit viral DNA
replication (Bargonetti et al., 1992; Miller et al., 1995).
In summary, here we describe the detailed interactions between LTag hexameric
helicase and the p68 subunit of human pol/prim complex. We also present evidence that
44

validated the interface observed in the co-crystal structure, and that the interaction
surface is crucial for the priming and DNA synthesis activity of the primosome in vitro
and in monkey cells. The high degree of sequence conservation of the residues on the
interface of LTag helicase and the p68 subunit of pol/prim suggests that this contact
between the replicative helicase and pol/prim is functionally important in recruiting
pol/prim for the DNA replication of this virus family in eukaryotic cells.
45

Chapter 3 Roles of the Residues on the Central Channel β
Hairpin and DR/F loop Structures of SV40 Hexameric Helicase

This work is collaborated with Yu, X. and results are presented with her permission.
Collaborator contributions: B.Z. analyzed LTag-dsDNA structure, designed, constructed
and purified mutants, performed DNA stimulated ATPase assays. X.Y. carried out
helicase assay. X.S.C. supervised the project.
In this section, I will describe my studies in determining the roles of LTag’s
central channel residues in the DNA unwinding process. LTag131 (residues 131-627),
expressed and purified from E.coli, was used due to its easier obtainability, higher yield,
and similar DNA binding, ATPase and helicase activities, and behaviors compared to
full-length LTag in oligomerization. As reviewed in Chapter 1, in the presence of DNA,
the ATPase activity of WT LTag can be stimulated. Through an energy transduction
process that is still not well understood, the energy produced by ATP hydrolysis is
utilized to fuel the translocation of LTag on DNA leading to the unwinding of the
dsDNA. Here, we focused our study on the function of three central channel residues,
F459, H512, and H513, since they are located at the tips of the central channel DR/F loop
and β-hairpin structures. These residues have also been determined to be critical for
LTag-DNA interaction via structural studies. By mutating them into residues carrying
different side chain properties, ATPase stimulation and DNA unwinding activities in the
presence of different types of DNA substrates were compared.

46

3.1 WT LTag DNA-Stimulated ATPase Activity and Helicase Activity
We started by testing the DNA-stimulated ATPase activity and helicase activity
with WT LTag and observed that ATP hydrolysis was stimulated for WT LTag in the
presence of different types of DNA substrates in comparison to the condition without
DNA (Figure 3.1A). The ATPase activity was stimulated most in the presence of ssDNA
by 6 to 7-fold and by 4 to 5 times in the presence of fork-DNA. However, origin-
containing or nonspecific dsDNA stimulated LTag ATPase activity was relatively less,
by around 2 to 3 times in comparison to the basal ATPase activity in the absence of any
DNA (Figure 3.1B).

47

Figure 3.1 WT LTag131 DNA-stimulated ATPase activity. (A) Absolute value of
ATPase activity in the absence (blue column) vs. in the presence (red column) of
different types of DNA; (B) ATPase stimulation times upon adding various type of DNA.

48

Helicase assays were also carried out with WT LTag by using both an 88bp fork
DNA or 146bp SV40 origin-containing dsDNA as the substrate. The results for both
DNA substrates are displayed in Figure 3.2A and 3.2B.

Figure 3.2 WT LTag131 helicase activity. (A) Helicase activity of WT LTag 131 using
88bp fork DNA as substrate; (B) Helicase activity of WT LTag 131 using 146bp SV40
origin-containing double-stranded DNA as substrate. In both panels: Lanes 1 & 2,
unboiled and boiled DNA substrate; lane3, WT LTag

In the following studies, we set the WT LTag ATPase stimulation folds or
unwinding activity as 100%. The corresponding activities of LTag mutants in the
presence of a specific type of DNA substrate are then standardized. The LTag mutants we
generated are listed in Table 3.1.

49

Table 3.1 List of LT131 central channel mutants
Residue of LTag Mutated Residues
WT None
K512 K512G, K512A, K512L, K512R and
K512E
H513 H513G, H513A, H513V, H513L, H513I,
H513M, H513F, H513W and H513Y
F459 F459A, F459L, F459I, F459D, F459M,
F459H. F459W and F459Y
L509/N515 Double deletion
K512/H513 K512H/H513V, K512W/H513V,
K512R/H513V and H512K/K513H

3.2 Function of DR/F loop Tip Residue F459
F 459 is a ring-shaped (aromatic) residue located at the tip of the central channel
structural element, the DR/F loop. Its critical position and ring-shaped (aromatic) side
chain properties caught our attention for its importance in LTag helicase function. A
series of residues were constructed to substitute F459 as shown in Table 3.1 and most of
these mutants have been shown to have the similar hexamerization and DNA binding
ability as WT LT131 in the presence of ATP and DNA (Shen et al., 2005). We then
tested the ATPase stimulation upon adding different types of DNA substrates for these
F459 mutants. As shown in Figure 3.3, when F459 is replaced by residue with a shorter
side chain compared to WT phenylalanine, the ATPase stimulation was inhibited in the
presence of all three types of DNA substrates. Only F459W and F459Y showed
comparable ATPase stimulation as the WT protein. These results indicate that the size of
the side chain at the F459 position is important to stimulate the ATPase activity of LTag,
which could potentially be affecting the direct interaction between LTag and DNA.
50

Double stranded origin DNA that is thicker in diameter, recovered the ATPase
stimulation to some extent in F459L, I, M, and H, further confirming that the interaction
of F459 and DNA is critical for stimulating ATPase activity of LTag (Figure 3.3C).
Consistent with the ATPase stimulation results, almost all of the F459
substitutions by smaller residues abolished the helicase activity of LTag in both fork and
dsDNA unwinding. The only exception was F459W, which indicated approximately
30% of WT unwinding activity (Figure 3.4). Therefore, we conclude that in addition to
the size of the side chain, the existence of an aromatic ring within the side chain at
position F459 is also critical for stimulating both ATPase activity of LTag, and
consequently the helicase unwinding activity. In this regard, the hydrophobicity also
seems to be critical for LTag’s ability to unwind dsDNA since F459W can unwind both
fork and origin-containing double stranded DNA while F459Y cannot.

51

Figure 3.3 ATPase stimulation activity of LTag131 F459 mutants. (A) single-stranded
DNA; (B) fork DNA and (C) double stranded SV40 origin-containing DNA. Activity is
expressed as the percentage (%) of the WT in hydrolyzing ATP to produce free
phosphate.

A

B

C
52

Figure 3.4 Helicase activity of LTag131 F459 mutants. Activity is expressed as the
percentage (%) of the WT in releasing ssDNA from a (A) fork DNA substrate or (B)
SV40 origin-containing dsDNA.

Since unwinding of an origin DNA includes both a melting step of the origin and
an unwinding step of the fork-shaped DNA resulted from melting, the unwinding
disability could alternatively be resulted from the defective DNA melting. However,
unwinding deficiencies on both fork and origin substrates suggested that the inhibited
unwinding activity of F459 mutants was due to their defective interaction with DNA
substrates, which further resulted in the inhibited ATPase stimulation, rather than
malfunction of DNA melting.
53

3.3 β Hairpin Tip Residues K512 and H513
Adjacent to the DR/F loop, the β-hairpin is another structural element emanating
from each LTag monomer, which forms a planar narrow bottleneck in the LTag central
channel. This structural feature is highly conserved in papovavirus initiator proteins, such
as SV40 LTag and the Bovine Papillomavirus E1, both of which belong to the SF3
helicase family. Sequence alignment of the beta-hairpin areas of the SF3 family helicases
showed high conservation of the residues at the tip of the beta-hairpin, including a
positive charged lysine and a ring-shaped histidine. Since these two residues are also
located on the tip of the β-hairpin loops, they are regarded to be indispensible for
LTag/DNA interaction. From the sequence alignment of members in the SF3 helicase
family, it is worth noting that the lysine on the β hairpin is conserved through all of the
viral species with ds/ss DNA genome, while the histidine is also conserved, but only in
papovaviruses with a dsDNA viral genome (Figure 3.5) (Liu et al., 2007). This suggests a
potential divergence in their functional mechanism in DNA replication.

Figure 3.5 Sequence alignment of the representative members of SF3 helicase family
(Liu et al., 2007). Green, invariant residues in papova and parvoviruses. Red, conserved
residues in papovaviruses and parvoviruses. Blue, highly conserved residues in papova
viruses only.
54

The functions of two the β hairpin tip residues, K506 and H507, of the E1
initiator have been studied extensively. It has been shown that in E1, the β hairpin
element not only participates in melting dsDNA, but also unwinds DNA during
replication elongation. Further studies dissecting the functions of these tip residues
showed that E1 H507 is specifically important for DNA melting but not unwinding while
K506 is required for both functions. Since E1 is a closely related papillomavirus helicase,
we wanted to investigate whether the β-hairpin tip residues K512 and H513 of LTag
played similar or different roles than the E1 initiator residues K506 and H507?
To check this, we mutated LTag131 by replacing both the β-hairpin lysine or histidine
with alanine and compared the ATPase stimulation activity of WT, K512 A, and H513A
LTag in the presence of different types of DNA substrates.
Shown in Figure 3.6.A, while K512A is essential for ATPase stimulation for all
types of DNA, H513A shows limited to no effect for DNA-induced ATPase stimulation
when compared to WT LTag, in the presence of various DNA substrates. Unexpectedly,
further helicase assays show that both mutants kill the unwinding activity of LTag in the
presence of either fork DNA or origin-containing dsDNA (Figure 3.6B)

55

Figure 3.6 Comparison of the activities of LTag131 β-hairpin K512 and H513
mutants. (A) Column representation of ATPase stimulation of K512A and H513A in the
presence of different types of DNA, indicated as the percentage (%) of the WT in
hydrolyzing ATP to produce free phosphate; (B) Column representation of helicase
activity of K512A and H513 using fork DNA or SV40 origin-containing dsDNA as
substrate, indicated as the percentage (%) of the WT in releasing ssDNA from the
dsDNA substrate.
56

Different from the situation in E1, the β-hairpin residues, K512 and H513, are
both important in DNA unwinding independent of DNA melting since neither of them are
capable of unwinding fork-shaped DNA and origin DNA. Given the different side chain
properties of the two residues and the recent LTag131/dsDNA complex structural
findings in our lab, we speculate that these two central channel residues are propagating
LTag unwinding through different mechanisms. Both residues directly interact with DNA
substrate: K512 seems crucial in detecting the presence of DNA substrate through
binding and resulting in fast ATP hydrolysis, which is the energy source for further
unwinding activity; However, H513-DNA interaction seems not necessary in ATPase
stimulation, but the residue may facilitate LTag unwinding by other mechanism, e.g.
interacting with DNA base during unwinding. To further confirm our conclusion that
H513 is dispensable for the DNA-stimulated ATPase stimulation of LTag, as well as to
understand the importance and mechanism of H513 in DNA unwinding, we went ahead
and systematically studied the function of H513.
3.4 Function of β Hairpin H513
First, we obtained a set of H513 substituted mutants (Table 3.1). Detailed ATPase
stimulation and unwinding activities of these mutants were then studied. The
oligomerization ability of these mutants were analyzed in a previous study in our lab
(Shen et al., 2005), which showed that at high protein concentrations, WT LTag and
mutants display an equilibration between being a hexamer and a monomer. The hexamer
and monomer ratio were essentially the same for all constructs as well. The structural
integrity of some of the corresponding LTag HD mutants was also inspected. They were
57

crystallized under the same crystallization condition as WT LTag and their structures
were determined to be identical. The same study also investigated the ssDNA and dsDNA
binding ability of most of the mutants we studied here. In the presence of ATP, with
which our ATPase stimulation assays and helicase assays were carried out, our H513
mutants bound ssDNA and dsDNA comparably to the WT LTag.
We then looked at the ATPase stimulation activities of the H513 mutants. In the
absence of DNA, WT and mutant LT131 showed comparable basal ATPase activities,
providing further evidence in the structural integrity of the mutants and their ability to
form a hexamer or bind DNA as WT LTag does.
In the ATPase stimulation assay for the H513 mutants (Figure 3.7), substitution of
H513 by residues with a variety sizes of side chains (mutants labeled in orange and blue)
showed varying ATPase stimulation in the presence of all three types of DNA substrates.
This being consistent with our assumption that H513 is not critical in DNA-stimulated
ATPase activity of LTag. In addition, when the ATPase activities of this group of H513
mutants were compared using various DNA substrates, it is noticed that for mutants with
small- to intermediate-sized side chain (mutants labeled in orange), the dsDNA enhances
ATPase activity more than fork-shaped DNA and ssDNA. However, for mutants with
large-sized or ring-shaped side chain (mutants colared in blue), the ssDNA stimulated
more ATPase activity than fork-shaped and dsDNA (Fig. 3.7). This indicates that the size
of DNA substrate in the central channel also affects the ATPase stimulation. Though, it
was rather confusing to see the mutants carrying large sides chains showed inhibited
ATPase stimulation in the presence of dsDNA (Figure 3.7B and C), leading to the
58

possibility that H513 of LTag might reside in a location that actually applies some
resistance on relative translocation of LTag on DNA. The tight interaction between the
large side chain of residue 513 mutants and dsDNA may limit the translocation rate of
LTag, therefore, lowering the efficiency of ATP hydrolysis.

Figure 3.7 ATPase stimulation activity of LTag131 H513 mutants. (A) single-
stranded DNA; (B) Fork DNA and (C) double stranded SV40 origin-containing DNA.
Activity is expressed as the percentage (%) of the WT in hydrolyzing ATP to produce
free phosphate.

59

Simply from the ATPase simulation results, unlike residues K512 and F459 that
plausibly trigger the ATPase activity of LTag by sensing the presence of DNA through
their side chains, the role of residue H513 of LTag seems to be dispensable in stimulating
ATPase activity through DNA binding. Furthermore, we looked at the unwinding activity
of the H513 mutants. Despite their different ATPase stimulation patterns (Figure 3.8),
H513 mutants inhibited the unwinding activity of LTag except the ones with ring-shaped
side chains and H513M, which reserved about 35% of the unwinding activity of that of
the WT LTag. Therefore, the function of H513 is critical in unwinding DNA substrate.
By investigating the helicase activity of these mutants in unwinding both fork DNA and
origin dsDNA, we also found that H513 mutants showed quite similar unwinding pattern
on both fork-DNA and origin dsDNA substrates, indicating defective DNA unwinding is
not due to the disability of DNA melting. In this sense, H513 of LTag is different from
H507 in E1, which is only important for DNA melting but not unwinding.
It is also worthwhile noting that some H513 mutants failed to unwind dsDNA
exhibiting normal to even higher ATPase stimulation compared to WT (such as H513G,
A, V, L or I). In contrast, depending on the shape of the side chain of each H513 mutant,
when the ATPase acitivity was simulated to a similar level, some mutants exhibited
different helicase acitivity (H513G/A vs. H513 M F W Y).
60

Figure 3.8 Helicase activity of LTag131 H513 mutants. Activity is expressed as the
percentage (%) of the WT in releasing ssDNA from the (A) 88bp fork DNA substrate or
(B) 146bp SV40 origin-containing dsDNA.

61

As a summary, our preliminary data accumulated here point towards several
conclusions: 1) distinct from LTag K512 and F459 that are essential for LTag unwinding
activity through facilitating protein ATPase activity possibly by interacting with DNA
through their side chains, H513 of LTag is dispensable for ATPase stimulation, and 2) the
ATPase stimulation pattern of H513 is difficult to interpret and is not as apparent as that
of K512 or F459. We speculate that the observed ATPase stimulation by H513 mutants
may represent a combined effect due to its position, side chain properties, and
residue/DNA interaction. The factors contributing to the final reading include, but is not
limit to, the background ATPase stimulation elicited by K512, DR/F loop, or other
related structural elements. The stimulation elicited by contacts of DNA
substrate/LTag513 when DNA diameter is big enough to touch the residue, as well as the
hindrance of DNA translocation caused by residue located at LTag513 position. Helicase
results further indicate that 3) both K512 and H513 are required in the DNA unwinding
process independent of DNA melting and 4) Based on both structural and biochemical
evidence, the H513 residue of LTag may separate the dsDNA by docking/anchoring into
the DNA bases, and/or stabilizing the deformed dsDNA by interacting with flipped DNA
bases through its special side chain properties.
3.5 Future Direction
To validate our conclusions, one direct mystery waiting to be solved is where
does the stimulated energy from mutants who are competent in stimulating ATP
hydrolysis but are impaired in unwinding dsDNA go (such as H513G A V L I or
F459Y)? DNA unwinding is clearly not the only energy-consuming step. There are also
62

two pre-unwinding events that can consume energy, LTag translocation as well as origin
melting. However, given the complete matching results of helicase activity with both fork
DNA and origin-containing dsDNA substrates, we deduced that the translocation of LTag
on DNA may explain the inconsistency. By taking advantage of a DNA biotin-
streptavidin displacement assay (Morris et al., 2002) or fluorescent activation assay
(Saikrishnan et al., 2009), we are expecting to see the LTag translocation rates on its
DNA substrates to be proportional to the stimulated ATPase activity for H513 and F459
substitutions who do not support unwinding activity.
To confirm the diverse mechanisms that K512 and H513 adopt to unwind DNA,
additional mutants have been constructed. These include: 1) A series of K512 mutants
besides alanine, to further confirm the importance of K512 in facilitating DNA-
stimulated ATPase activity. 2) A few K512/H513 double mutants to see how does
substitution at K512 can rescue the loss of function of H513V (Table 3.1).
It will be very interesting to see the ATPase stimulation and unwinding activity of
these mutants.
The preliminary data accumulated in this direction answered questions that we
raised about the importance and potential mechanism of the central channel residues of
the LTag molecular motor. And at the same time, it raised several interesting questions. It
has been interesting to see the difference in the energy stimulating and unwinding
patterns some of the LTag mutants mediated. If supported by future translocation data,
this study will provide great insights into the detailed residue functions in overall LTag-
mediated DNA unwinding.
63

Chapter 4 Experimental Procedures

4.1 Cloning and Construction of Protein Mutants
Wild type LTagHD (residues 260-627) or LTag131 (residues 131-627) was
cloned into pGEX-2T vector, which encodes a GST tag and a thrombin cleavage site
between GST and LTag. Human p68N containing residues 1-78 was constructed into
pBG100 vector (L. Mizoue, Center for Structural Biology, Vanderbilt University),
encoding a His
6
-tag and PreScission Protease cutting site between His
6
Mutant E.coli GST-LTag proteins and His
-tag and p68N.
6
4.2 Protein Purification
-p68N were constructed by site-
directed mutagenesis using the WT sequence containing-vector as templates respectively.
The primers were designed to include the site mutation in the middle of the oligos. The
entire coding region of the mutant constructs was verified by DNA sequencing.
4.2.1 Expression and Purification of SV40 LTag and p68N
The LTagHD (residues 260-627) or LTag131 (residues 131-627) was expressed in
E. coli as a thrombin-cleavable GST-LTag fusion protein using the pGEX-2T vector as
described (Li et al., 2003). The fusion protein was isolated by glutathione affinity
chromatography, and LTag released by thrombin cleavage was further purified by
Superdex-200 gel-filtration chromatography (GE).
The N-terminal domain (residues 1-78) of human p68 (p68N) was expressed in E.
coli as a PreScission Protease-cleavable His6-tag fusion protein and purified by Ni-NTA
column chromatography as described (Huang et al., 2010a) . After on-column cleavage of
64

the fusion protein, p68N was further purified by S75 size exclusion chromatography and
monomeric species were pooled.
4.2.2 Preparation of Other Proteins
Full-length LTag was expressed in Hi5 cells using recombinant baculoviruses
(MOI ~ 5) and purified by Pab101-immunoaffinity chromatography essentially as
described (Ott et al., 2002b) with the following modifications. Cells were lysed in lysis
buffer (50 mM Tris-HCl pH 8; 10 µM ZnCl
2
; 1 mM EDTA pH 8; 100 mM NaCl; 0.5%
NP-40; 1 µg/ml aprotinin; 1 µM leupeptin; 200 uM PMSF) using a Dounce homogenizer.
Clarified lysates were rocked with Pab101-sepharose beads for 2 h at 4 °C. The beads
were washed extensively with wash buffer 1 (50 mM Tris-HCl pH 8; 150 mM NaCl; 5
mM EDTA pH 8; 10 µM ZnCl
2
; 0.5% NP-40) and wash buffer 2 (20 mM HEPES-KOH
pH 7.8; 5 mM NaCl; 0.1 mM EDTA pH 8; 10 µM ZnCl
2
LT108 (residues 108-627) and p53 DBD (residues 92-292) was purified as
described previously (
; 10% (v/v) glycerol). Protein
was eluted with 20% (v/v) glycerol, 20 mM triethlyamine and neutralized by addition of
0.5 M HEPES-KOH pH 7.0 to a final pH of ~ 7.5 and flash frozen. The yield from
2x10^8 cells was ~ 2 mg.
Cuesta et al., 2010; Lilyestrom et al., 2006).
Pol/prim was expressed in Hi5 insect cells infected with four recombinant baculoviruses
and purified by immunoaffinity chromatography as described previously (Ott et al.,
2002a). The human p180 subunit was purified identically, except that Hi5 cells were
infected with only the p180 baculovirus. Human topoisomerase I was expressed in Hi5
cells using recombinant baculoviruses and purified as described (Stewart and Champoux,
65

1999). Recombinant human RPA was expressed in E. coli and purified as described
(Henricksen et al., 1994).
To prepare GST-p68N for pull-down assays of full-length LTag, residues 1-78 of
p68 were cloned into pAT109, the protein was expressed in E.coli by autoinduction, and
purified on glutathione agarose. For full-length LTag pull-downs by primase, His
6
Copeland, 1997
-
FLAGx2-p58 was co-expressed with untagged p48 in E.coli and purified as described
( ).
4.3 Crystallization, Structure Determination and Refinement
4.3.1 Crystallization
Each protein was concentrated in crystallization buffer (25 mM Tris-HCl, pH 8.0,
250 mM NaCl, and 10 mM dithiothreitol). Concentrated LTag (15 mg ml
-1
) was mixed
with p68N (5.3 mg ml
-1
4.3.2 Data Collection and Structure Determination before Refinement
) at an optimized molar ratio of 1:1.5 (LTag monomer : p68N) and
crystallized by the hanging-drop vapor diffusion method. Crystals were grown at 18 °C
from 2 μl drops against 1 ml the well buffer (0.96 M sodium malonate, pH 6.0). Crystals
were soaked stepwise in increasing concentrations of sodium malonate pH 6.0 (1.25 M,
1.75 M, 2.25 M and 2.75 M) for about 5 min at each step, and then flash-frozen in liquid
nitrogen.
Data were collected at Beamline 8.3.1 at the Advanced Light Source (Berkeley,
California) and processed with HKL-2000 (Otwinowski, 1997). To solve the structure,
the previously determined nucleotide-bound forms of the LTag hexamer (Gai et al., 2004;
Li et al., 2003; Lilyestrom et al., 2006) were used as search models for molecular
66

replacement (MR). Only the ATP-bound form (PDB 1SVM) (Gai et al., 2004) yielded a
correct solution, with twelve LTag molecules in the form of two hexamers in one
asymmetric unit. Once the initial MR solution was determined, we were able to see some
p68N density around the LTag double hexamer (Figure 4.1A). To improve the electron
density, several rounds of density modification were performed using CCP4 (Dodson et
al., 1997) and 12-fold noncrystallographic symmetry (NCS) averaging for LTag further
improved the density of p68Ns. Using the improved density map, MR was carried out by
using both the ATP-bound form LTag (PDB 1SVM) and p68N NMR solution structures
(PDB 2KEB) as search models. We were originally able to find five p68N molecules
surrounding LTag. With the further refined model, the phase was recalculated. Another
around of density modification was performed with a 12-fold NCS averaging for LTag
and 5-fold NCS averaging for p68N. Successive rounds of density modification gradually
improved the phase and the density of p68Ns, such that the phase quality of the partial
model was sufficient to show clearly defined electron density for 11 p68N molecules
surrounding the two LTag hexamers. Eventual density modification with 12-fold NCS
averaging for LTag and 11-fold NCS averaging for p68 eventually improved the electron
density of the p68N even more (Figure 4.1B), which allowed model building of all 11
p68N molecules. We note that with the 12-fold NCS redundancy, the data completeness
of 75% for this structure is sufficient for correct structural determination and refinement,
based on previously reported structures determined with data completeness around 50%
(Grimes et al., 1998; Simpson et al., 1998) and in one case as low as 20% (McClain et al.,
2010).
67

4.3.3 Model Refinement – Deformable Elastic Network (DEN) Refinement
Refinement of the final model was further performed with NCS restraints for
LTag and p68N using the newly released DEN refinement method that is specifically
designed for structure refinement of low- resolution X-ray diffraction data frequently
encountered with inherently flexible protein complexes (Schroder et al., 2010). DEN
refinement has been shown to work well for structure refinement of X-ray diffraction
data of resolution around 5-6 Å (Ataide et al., 2011; Bill et al., 2011; Brunger et al.,
2012; Schroder et al., 2010). Briefly, the CNS program implements DEN (deformable
elastic network) to assist refinement by using previously solved high-resolution structures
of homologous proteins as reference structures to build springs between random pairs of
atoms within the low-resolution model being refined. These springs are deformable and
updated with each round of DEN assisted refinement, allowing for large differences
between the reference structure and the refined structure while still applying local
conserved conformational similarities that are supported by diffraction data. These
springs provided structural information to supplement the atom placement supported
solely from diffraction data. The result is a decrease in conformational space that must be
sampled making determination of the target structure computationally plausible. Strength
of springs (wDEN) and the weight of the reference data (gamma) are experimentally
defined parameters determined by multiple refinement runs and assessed by
improvements in Rfree. We created a script to test different values for wDEN and gamma
along a grid pattern, as previously described (Ataide et al., 2011; Bill et al., 2011;
Brunger et al., 2012; Schroder et al., 2010). For each pair of values, we ran 10
68

refinements, using different random numbers for the initial velocity assignments in
refinement. Using the wDEN and gamma values that gave the best average Rfree, the best
resultant structure reveals that DEN refinement changed most of the side-chain
conformations at the interface between LTag and p68N to make much better inter-
molecular interactions that those in the originally positioned model. The final refinement
statistics and geometry are very good (Table 2.1) and final map for one p68N is shown in
Figure 4.1C.
.
Figure 4.1 Sections of electron density maps of a p68N subunit. (A) The initial map
calculated from molecular replacement model without putting any p68N model in,
showing some density corresponding to p68N density; (B) The same map section as in
panel A after 12-fold NCS averaging based on 12 LTag subunits prior to any p68N model
building, revealing improved p68N density in the map that has no p68N model bias. For
convenience, the p68N backbone is shown as a guide here and in panel A; (C) The same
map section as in panels A and B of the final model after refinement by the DEN
program; (D) The superposition of a p68N molecule determined here with that of the
NMR structure of p68N (PDB 2KEB), showing some small conformational differences at
the turns of the backbone.

69

4.4 Affinity Pull-down Study
Recombinant p68N-His
6
fusion proteins (WT or mutant) and LTag helicase
domain proteins (WT or mutant) were expressed in E.coli. All of the proteins were
purified as described for crystallography except that the His
6
-tag was left intact on p68N
and the uncleaved fusion protein was eluted with lysis buffer containing high
concentration of imidazole (25 mM Tris-HCl pH 8.0, 250 mM NaCl and 30 mM
imidazole 150 mM). The LTag binding assay was carried out by first incubating 60 μg
His
6
For full-length LTag pull-downs by GST-p68N, 50 pmol of GST or GST-p68N
was bound to glutathione agarose in binding buffer (40 mM HEPES-KOH, 7.9; 10 mM
KCl; 7 mM magnesium acetate; 2% milk). For p180 or FLAG-primase pulldowns, 7 µg
of p180 was pre-bound to 237-31 anti-p180 coupled to sepharose, or 5 µg of His-FLAG-
primase was pre-bound to FLAG M2 resin (Sigma). 1 µg of full-length LTag (or mutants)
that had been preincubated for 30 min at RT in binding buffer with 2 mM ATP was
added, and beads were incubated 1 h at 4°C. Beads were washed extensively with wash
buffer (40 mM HEPES-KOH, 7.9; 25 mM KCl; 7 mM magnesium acetate; 0.25%
-tagged p68N proteins with 15 μl of Ni-NTA resin in an Eppendorf tube for 30 min
at 4°C, followed by a moderate washing step of 2 ml buffer (25 mM Tris-HCl pH 8.0,
250 mM NaCl), the resin was then incubated with 100 μg LTag helicase domain protein
for another 30 min at 4°C and washed exhaustively with 5 ml buffer (25 mM Tris-HCl
pH 8.0, 250 mM NaCl and 30 mM imidazole). All of the resin is loaded and proteins
retained on the resin after washing were analyzed by 10% SDS-PAGE and visualized by
coomassie blue staining.
70

inositol; 0.01% NP-40). Bound proteins were boiled in denaturing sample buffer,
subjected to SDS-PAGE, and visualized by western blot with monoclonal Pab101 for
LTag (Gurney et al., 1986), monoclonal 2CT25 for p180 (Dornreiter et al., 1990),
monoclonal 8G10 for p48 (Weisshart et al., 2000), polyclonal anti-GST (Invitrogen), and
chemiluminescence.
4.5 ATPase Stimulation Assays
ATPase stimulation assays were carried out by using EnzChek phosphate assay
kit (Invitrogen), which provides a fast and sensitive way for the quantification of
inorganic phosphate in solution, including phosphate released from enzymatic reactions.
The Enzchek phosphate assay is designed based on a method originally described by
Webb (Webb, 1992). Specifically, ATPase reactions were performed by incubating ATP
and WT or mutant LTag131 in the absence or in the presence of DNA at 37°C for 10 min
in a 50- μl volume reaction containing: 1mM ATP, 0.7µM WT or mutant LTag131 (as
hexamer), without or with 0.7 µM specific DNA in helicase buffer (10 mM MgCl
2

, 20
mM Tris-HCl pH 7.5). The reaction was terminated and the phosphate was reacted with
50μl detection reagent containing 20mM Tris Hcl PH7.5, 200mM EDTA, 0.4mM MESG
and 2U/mL PNPase. Detection reactions were further incubated at 25°C for 30 min. Read
the absorbance at 360nm. Background absorbance was subtracted for both samples with
or without DNA, then the reading with DNA over that without DNA is the ATPase
stimulation upon adding DNA.

71

4.6 DNA Unwinding Assays
Two types of DNA substrates were used for DNA helicase assays:
1) Partially complementary DNA oligonucleotides
5’-(dT)
30
5’-ATGTCCTAGCAAGCCAGAATTCGGCAGCGTC(dT)
GACGCTGCCGAATTCTGGCTTGCTAGGACAT-3’ and
30
were annealed to generate Y-shaped fork helicase substrate with 30-nt single-stranded
tails and a 31-nt duplex.
-3’
2) Complementary DNA oligonucleotides containing SV40 origin core sequence
(underlined)
5’TCCGCGTGGATCTCGTCGTGC(ATCTGTTGGATCCAGTACTAATTTTTTTTAT
TTATGCAGAGGCCGAGGCCGCCTCGGCCTCTGAGCTATTCCAGAAGTAGTG
5’ACGCGCGAGGCAGATCGTCAGTCAG(TCACGATGAATTCGATAT
A
TATCGAATTCATCGTGA)CTGACTGACGATCTGCCTCGCGCGT3’
CACTACTT
CTGGAATAGCTCAGAGGCCGAGGCGGCCTCGGCCTCTGCATAAATAAAAAAA
ATTA
were annealed to generate 146 bp SV40 origin containing DNA duplex. Both substrates
were radiolabeled at the 5’ ends with
GTACTGGATCCAACAGAT)GCACGACGAGATCCACGCGGA3’
32
P, and purified by S200 gel filtration
chromatography. Helicase assays were performed by incubating the substrate DNA with
WT or mutant LTag at 37°C for 30 min in a 20-μl volume reaction containing 15 nM
substrate, 250 nM (as monomer) of the indicated LTag protein, 5 mM ATP, 1 mM DTT,
and 0.1 mg ml
-1
BSA in helicase buffer (10 mM MgCl
2
, 20 mM Tris-HCl pH 7.5). The
reaction was terminated by adding 5 μl of stop solution containing 100 mM EDTA, 0.5%
72

SDS, 0.1% xylene cyanol, 0.1% bromophenol blue, and 50% glycerol. The reactions
were electrophoresed on a 12% polyacrylamide gel in Tris/borate/EDTA buffer for 90
min at 120 V. The gel was dried and then exposed on a PhosphorImager. The substrate
DNA and unwound products were detected by autoradiography and quantified by ImageJ.
4.7 Initiation of SV40 DNA Replication Assay
Monopolymerase (Matsumoto et al., 1990) assay mixtures (20 μl) consisted of
250 ng of supercoiled SV40 origin-containing pUC-HS plasmid DNA (2.8 kb), 300 ng of
RPA, 300 ng of topoisomerase I, 125-500 ng of pol/prim, and 300 ng of full-length LTag
in initiation buffer (40 mM HEPES-KOH pH 7.9, 10 mM magnesium acetate, 1 mM
DTT, 4 mM ATP, 0.2 mM each GTP, UTP, and CTP, 0.1 mM each dGTP, dATP, and
dTTP, 0.02 mM dCTP, 40 mM creatine phosphate, 40 μg/ml of creatine kinase)
supplemented with 3 μCi of [α-
32
Huang et al., 2010b
P] dCTP (3,000 Ci/mmol; Perkin Elmer). Reactions
were carried out and results evaluated as described ( ).
4.8 SV40 DNA Replication in Monkey Cells
4.8.1 Cloning of Mutations into Genomic SV40
The pMini plasmid was first constructed as a minimal vector for cloning
mutations into genomic SV40 DNA. The region of pBluescript-KS (Stratagene)
containing the pMB1 origin and the β-lactamase resistance gene was amplified by PCR
using pBS-KS-EcoRI-Forward
(GCGGCGAATTCACGCAGGAAAGAACATGTGAGC) and pBS-KS-EcoRI-Reverse
(GCGGCGAATTCGGGAAATGTGCGCGGAAC). The PCR product was digested with
EcoRI and ligated. Then standard site-directed mutagenesis was performed to remove the
73

remaining EarI site, generating pMini. WT SV40 genomic DNA was digested with
EcoRI and cloned into pMini to generate pMini-SV40. Mutant LTag coding sequences
were isolated from pFastBac1 clones (as EarI/BamHI fragments) and used to replace the
WT LTag coding sequence in pMini-SV40. All clones were verified by DNA sequencing.
BSC40 monkey kidney cells were grown as described (Zhao 2008 82:5316). The pMini-
SV40 DNAs were digested with EcoRI, purified by PCR purification kit (Fermentas), and
2 µg of each linearized DNA was transfected per 60-mm dish of BSC40 cells using
FuGENE HD (Roche) according to the manufacturer’s protocol.
4.8.2 Western Blot
Protein extracts were prepared at 24 h post-transfection by resuspending 5 x 10^3
cells in lysis buffer (10 mM HEPES-KOH, 7.5; 250 mM NaCl; 5 mM EDTA, 8; 1% NP-
40; 200 µM PMSF; 1 µg/ml aprotinin; 1 µM leupeptin), incubated on ice for 30 min, and
clarified by centrifugation for 15 min at 4 °C and 17,500 x g. Samples of 4 µg of total
protein were analyzed by SDS-PAGE and western blot using anti-LTag Pab101(Gurney
et al., 1986) or anti-actin (Santa Cruz, I-19) and chemiluminescence.
4.8.3 Southern Blot Analysis
DNA was extracted from 5 x 10^3 cells at 48 h post-transfection as described
(Hirt 1967 26:365), digested with DpnI, separated in an agarose gel, and transferred to
ZetaProbe membrane (BioRad). Radiolabeled DNA probes were generated by random
priming. The template for the SV40 probe was prepared from purified SV40 genomic
DNA that was excised from pSVWT (Fanning 1982 1:1023) with BamHI. To verify
equal loading of the DNA samples from transfected cells, a mitochondrial DNA probe
74

was prepared by PCR of BSC40 DNA extracts using the oligos Mito-Forward
(GGAGCTCTCCATGCATTTGGTATC) and Mito-Reverse
(GGTGTGGATGTAAGTGGTGTCTTTG). Hybridized blots were visualized and
quantified using a PhosphorImager (Amersham Biosciences). SV40 signals were
normalized to mitochondrial DNA and expressed as a percentage of the signal from cells
transfected with the WT SV40-pMini DNA digest.
75

Bibliography

Agarkar, V.B., Babayeva, N.D., Pavlov, Y.I., and Tahirov, T.H. (2011). Crystal structure
of the C-terminal domain of human DNA primase large subunit: implications for the
mechanism of the primase-polymerase alpha switch. Cell Cycle 10, 926-931.
Ahuja, D., Rathi, A.V., Greer, A.E., Chen, X.S., and Pipas, J.M. (2009). A structure-
guided mutational analysis of simian virus 40 large T antigen: identification of surface
residues required for viral replication and transformation. J Virol 83, 8781-8788.
Arunkumar, A.I., Klimovich, V., Jiang, X., Ott, R.D., Mizoue, L., Fanning, E., and
Chazin, W.J. (2005). Insights into hRPA32 C-terminal domain--mediated assembly of the
simian virus 40 replisome. Nat Struct Mol Biol 12, 332-339.
Ataide, S.F., Schmitz, N., Shen, K., Ke, A., Shan, S.O., Doudna, J.A., and Ban, N.
(2011). The crystal structure of the signal recognition particle in complex with its
receptor. Science 331, 881-886.
Bailey, S., Eliason, W.K., and Steitz, T.A. (2007). Structure of hexameric DnaB helicase
and its complex with a domain of DnaG primase. Science 318, 459-463.
Bargonetti, J., Reynisdottir, I., Friedman, P.N., and Prives, C. (1992). Site-specific
binding of wild-type p53 to cellular DNA is inhibited by SV40 T antigen and mutant p53.
Genes Dev 6, 1886-1898.
Bill, R.M., Henderson, P.J., Iwata, S., Kunji, E.R., Michel, H., Neutze, R., Newstead, S.,
Poolman, B., Tate, C.G., and Vogel, H. (2011). Overcoming barriers to membrane
protein structure determination. Nat Biotechnol 29, 335-340.
Bochkareva, E., Martynowski, D., Seitova, A., and Bochkarev, A. (2006). Structure of
the origin-binding domain of simian virus 40 large T antigen bound to DNA. Embo J 25,
5961-5969.
Bochman, M.L., and Schwacha, A. (2008). The Mcm2-7 complex has in vitro helicase
activity. Mol Cell 31, 287-293.
Bonner, J., Dahmus, M.E., Fambrough, D., Huang, R.C., Marushige, K., and Tuan, D.Y.
(1968). The Biology of Isolated Chromatin: Chromosomes, biologically active in the test
tube, provide a powerful tool for the study of gene action. Science 159, 47-56.
Borowiec, J.A., Dean, F.B., Bullock, P.A., and Hurwitz, J. (1990). Binding and
unwinding--how T antigen engages the SV40 origin of DNA replication. Cell 60, 181-
184.
76

Borowiec, J.A., and Hurwitz, J. (1988). ATP stimulates the binding of simian virus 40
(SV40) large tumor antigen to the SV40 origin of replication. Proc Natl Acad Sci U S A
85, 64-68.
Braithwaite, A.W., Sturzbecher, H.W., Addison, C., Palmer, C., Rudge, K., and Jenkins,
J.R. (1987). Mouse p53 inhibits SV40 origin-dependent DNA replication. Nature 329,
458-460.
Brewster, A.S., Wang, G., Yu, X., Greenleaf, W.B., Carazo, J.M., Tjajadia, M., Klein,
M.G., and Chen, X.S. (2008). Crystal structure of a near-full-length archaeal MCM:
functional insights for an AAA+ hexameric helicase. Proc Natl Acad Sci U S A 105,
20191-20196.
Brunger, A.T., Das, D., Deacon, A.M., Grant, J., Terwilliger, T.C., Read, R.J., Adams,
P.D., M., L., and Schröder, G.F. (2012). Application of DEN refinement and automated
model building to a difficult case of molecular-replacement phasing: the structure of a
putative succinyl-diaminopimelate desuccinylase from Corynebacterium glutamicum.
Acta Crystallographica Section D In press.
Bullock, P.A. (1997). The initiation of simian virus 40 DNA replication in vitro. Crit Rev
Biochem Mol Biol 32, 503-568.
Campbell, K.S., Mullane, K.P., Aksoy, I.A., Stubdal, H., Zalvide, J., Pipas, J.M., Silver,
P.A., Roberts, T.M., Schaffhausen, B.S., and DeCaprio, J.A. (1997). DnaJ/hsp40
chaperone domain of SV40 large T antigen promotes efficient viral DNA replication.
Genes Dev 11, 1098-1110.
Challberg, M.D., and Kelly, T.J. (1989). Animal virus DNA replication. Annu Rev
Biochem 58, 671-717.
Cole, C.N., Tornow, J., Clark, R., and Tjian, R. (1986). Properties of the simian virus 40
(SV40) large T antigens encoded by SV40 mutants with deletions in gene A. J Virol 57,
539-546.
Collins, K.L., Russo, A.A., Tseng, B.Y., and Kelly, T.J. (1993). The role of the 70 kDa
subunit of human DNA polymerase alpha in DNA replication. Embo J 12, 4555-4566.
Cooper, D.R., Boczek, T., Grelewska, K., Pinkowska, M., Sikorska, M., Zawadzki, M.,
and Derewenda, Z. (2007). Protein crystallization by surface entropy reduction:
optimization of the SER strategy. Acta Crystallogr D Biol Crystallogr 63, 636-645.
Copeland, W.C. (1997). Expression, purification, and characterization of the two human
primase subunits and truncated complexes from Escherichia coli. Protein Expr Purif 9, 1-
9.
77

Copeland, W.C., and Wang, T.S. (1993). Enzymatic characterization of the individual
mammalian primase subunits reveals a biphasic mechanism for initiation of DNA
replication. J Biol Chem 268, 26179-26189.
Corn, J.E., Pease, P.J., Hura, G.L., and Berger, J.M. (2005). Crosstalk between primase
subunits can act to regulate primer synthesis in trans. Mol Cell 20, 391-401.
Costa, A., Ilves, I., Tamberg, N., Petojevic, T., Nogales, E., Botchan, M.R., and Berger,
J.M. (2011). The structural basis for MCM2-7 helicase activation by GINS and Cdc45.
Nat Struct Mol Biol 18, 471-477.
Costa, A., and Onesti, S. (2009). Structural biology of MCM helicases. Crit Rev Biochem
Mol Biol 44, 326-342.
Cuesta, I., Nunez-Ramirez, R., Scheres, S.H., Gai, D., Chen, X.S., Fanning, E., and
Carazo, J.M. (2010). Conformational rearrangements of SV40 large T antigen during
early replication events. J Mol Biol 397, 1276-1286.
Dean, F.B., Borowiec, J.A., Eki, T., and Hurwitz, J. (1992). The simian virus 40 T
antigen double hexamer assembles around the DNA at the replication origin. J Biol Chem
267, 14129-14137.
Dean, F.B., Dodson, M., Echols, H., and Hurwitz, J. (1987). ATP-dependent formation of
a specialized nucleoprotein structure by simian virus 40 (SV40) large tumor antigen at
the SV40 replication origin. Proc Natl Acad Sci U S A 84, 8981-8985.
Dean, F.B., and Hurwitz, J. (1991). Simian virus 40 large T antigen untwists DNA at the
origin of DNA replication. J Biol Chem 266, 5062-5071.
Deb, S.P., and Tegtmeyer, P. (1987). ATP enhances the binding of simian virus 40 large
T antigen to the origin of replication. J Virol 61, 3649-3654.
Dickmanns, A., Zeitvogel, A., Simmersbach, F., Weber, R., Arthur, A.K., Dehde, S.,
Wildeman, A.G., and Fanning, E. (1994). The kinetics of simian virus 40-induced
progression of quiescent cells into S phase depend on four independent functions of large
T antigen. J Virol 68, 5496-5508.
Dobbelstein, M., Arthur, A.K., Dehde, S., van Zee, K., Dickmanns, A., and Fanning, E.
(1992). Intracistronic complementation reveals a new function of SV40 T antigen that co-
operates with Rb and p53 binding to stimulate DNA synthesis in quiescent cells.
Oncogene 7, 837-847.
Dodson, E.J., Winn, M., and Ralph, A. (1997). Collaborative Computational Project,
number 4: providing programs for protein crystallography. Methods Enzymol 277, 620-
633.
78

Dornreiter, I., Copeland, W.C., and Wang, T.S. (1993). Initiation of simian virus 40 DNA
replication requires the interaction of a specific domain of human DNA polymerase alpha
with large T antigen. Mol Cell Biol 13, 809-820.
Dornreiter, I., Hoss, A., Arthur, A.K., and Fanning, E. (1990). SV40 T antigen binds
directly to the large subunit of purified DNA polymerase alpha. Embo J 9, 3329-3336.
Dyson, N. (1998). The regulation of E2F by pRB-family proteins. Genes Dev 12, 2245-
2262.
Eichinger, C.S., Mizuno, T., Mizuno, K., Miyake, Y., Yanagi, K., Imamoto, N., and
Hanaoka, F. (2009). Aberrant DNA polymerase alpha is excluded from the nucleus by
defective import and degradation in the nucleus. J Biol Chem 284, 30604-30614.
Fanning, E., and Zhao, K. (2009). SV40 DNA replication: from the A gene to a
nanomachine. Virology 384, 352-359.
Fletcher, R.J., Bishop, B.E., Leon, R.P., Sclafani, R.A., Ogata, C.M., and Chen, X.S.
(2003). The structure and function of MCM from archaeal M. Thermoautotrophicum. Nat
Struct Biol 10, 160-167.
Foiani, M., Liberi, G., Lucchini, G., and Plevani, P. (1995). Cell cycle-dependent
phosphorylation and dephosphorylation of the yeast DNA polymerase alpha-primase B
subunit. Mol Cell Biol 15, 883-891.
Foiani, M., Marini, F., Gamba, D., Lucchini, G., and Plevani, P. (1994). The B subunit of
the DNA polymerase alpha-primase complex in Saccharomyces cerevisiae executes an
essential function at the initial stage of DNA replication. Mol Cell Biol 14, 923-933.
Gai, D., Roy, R., Wu, C., and Simmons, D.T. (2000). Topoisomerase I associates
specifically with simian virus 40 large-T-antigen double hexamer-origin complexes. J
Virol 74, 5224-5232.
Gai, D., Zhao, R., Li, D., Finkielstein, C.V., and Chen, X.S. (2004). Mechanisms of
conformational change for a replicative hexameric helicase of SV40 large tumor antigen.
Cell 119, 47-60.
Gannon, J.V., and Lane, D.P. (1987). p53 and DNA polymerase alpha compete for
binding to SV40 T antigen. Nature 329, 456-458.
Germond, J.E., Hirt, B., Oudet, P., Gross-Bellark, M., and Chambon, P. (1975). Folding
of the DNA double helix in chromatin-like structures from simian virus 40. Proc Natl
Acad Sci U S A 72, 1843-1847.
79

Giacherio, D., and Hager, L.P. (1979). A poly(dT)-stimulated ATPase activity associated
with simian virus 40 large T antigen. J Biol Chem 254, 8113-8116.
Gomez-Llorente, Y., Fletcher, R.J., Chen, X.S., Carazo, J.M., and San Martin, C. (2005).
Polymorphism and double hexamer structure in the archaeal minichromosome
maintenance (MCM) helicase from Methanobacterium thermoautotrophicum. J Biol
Chem 280, 40909-40915.
Griffith, J.D. (1975). Chromatin structure: deduced from a minichromosome. Science
187, 1202-1203.
Grimes, J.M., Burroughs, J.N., Gouet, P., Diprose, J.M., Malby, R., Zientara, S., Mertens,
P.P., and Stuart, D.I. (1998). The atomic structure of the bluetongue virus core. Nature
395, 470-478.
Grossi, S., Puglisi, A., Dmitriev, P.V., Lopes, M., and Shore, D. (2004). Pol12, the B
subunit of DNA polymerase alpha, functions in both telomere capping and length
regulation. Genes Dev 18, 992-1006.
Guo, S., Tabor, S., and Richardson, C.C. (1999). The linker region between the helicase
and primase domains of the bacteriophage T7 gene 4 protein is critical for hexamer
formation. J Biol Chem 274, 30303-30309.
Gurney, E.G., Tamowski, S., and Deppert, W. (1986). Antigenic binding sites of
monoclonal antibodies specific for simian virus 40 large T antigen. J Virol 57, 1168-
1172.
Hamdan, S.M., and Richardson, C.C. (2009). Motors, switches, and contacts in the
replisome. Annu Rev Biochem 78, 205-243.
Hamdan, S.M., and van Oijen, A.M. (2010). Timing, coordination, and rhythm:
acrobatics at the DNA replication fork. J Biol Chem 285, 18979-18983.
Harbour, J.W., and Dean, D.C. (2000). The Rb/E2F pathway: expanding roles and
emerging paradigms. Genes Dev 14, 2393-2409.
Henricksen, L.A., Umbricht, C.B., and Wold, M.S. (1994). Recombinant replication
protein A: expression, complex formation, and functional characterization. J Biol Chem
269, 11121-11132.
Hinton, D.M., and Nossal, N.G. (1987). Bacteriophage T4 DNA primase-helicase.
Characterization of oligomer synthesis by T4 61 protein alone and in conjunction with T4
41 protein. J Biol Chem 262, 10873-10878.
80

Huang, H., Weiner, B.E., Zhang, H., Fuller, B.E., Gao, Y., Wile, B.M., Zhao, K., Arnett,
D.R., Chazin, W.J., and Fanning, E. (2010a). Structure of a DNA polymerase alpha-
primase domain that docks on the SV40 helicase and activates the viral primosome. J
Biol Chem 285, 17112-17122.
Huang, H., Zhao, K., Arnett, D.R., and Fanning, E. (2010b). A specific docking site for
DNA polymerase {alpha}-primase on the SV40 helicase is required for viral primosome
activity, but helicase activity is dispensable. J Biol Chem 285, 33475-33484.
Huang, S.G., Weisshart, K., Gilbert, I., and Fanning, E. (1998). Stoichiometry and
mechanism of assembly of SV40 T antigen complexes with the viral origin of DNA
replication and DNA polymerase alpha-primase. Biochemistry 37, 15345-15352.
Jiang, X., Klimovich, V., Arunkumar, A.I., Hysinger, E.B., Wang, Y., Ott, R.D., Guler,
G.D., Weiner, B., Chazin, W.J., and Fanning, E. (2006). Structural mechanism of RPA
loading on DNA during activation of a simple pre-replication complex. Embo J 25, 5516-
5526.
Johnson, S.K., Bhattacharyya, S., and Griep, M.A. (2000). DnaB helicase stimulates
primer synthesis activity on short oligonucleotide templates. Biochemistry 39, 736-744.
Joo, W.S., Luo, X., Denis, D., Kim, H.Y., Rainey, G.J., Jones, C., Sreekumar, K.R., and
Bullock, P.A. (1997). Purification of the simian virus 40 (SV40) T antigen DNA-binding
domain and characterization of its interactions with the SV40 origin. J Virol 71, 3972-
3985.
Kelly, T.J. (1988). SV40 DNA replication. J Biol Chem 263, 17889-17892.
Khopde, S., and Simmons, D.T. (2008). Simian virus 40 DNA replication is dependent on
an interaction between topoisomerase I and the C-terminal end of T antigen. J Virol 82,
1136-1145.
Kim, H.Y., Ahn, B.Y., and Cho, Y. (2001). Structural basis for the inactivation of
retinoblastoma tumor suppressor by SV40 large T antigen. Embo J 20, 295-304.
Klinge, S., Nunez-Ramirez, R., Llorca, O., and Pellegrini, L. (2009). 3D architecture of
DNA Pol alpha reveals the functional core of multi-subunit replicative polymerases.
Embo J 28, 1978-1987.
Kuchta, R.D., and Stengel, G. (2010). Mechanism and evolution of DNA primases.
Biochim Biophys Acta 1804, 1180-1189.
Kunkel, T.A., and Burgers, P.M. (2008). Dividing the workload at a eukaryotic
replication fork. Trends Cell Biol 18, 521-527.
81

Lai, A., Lee, J.M., Yang, W.M., DeCaprio, J.A., Kaelin, W.G., Jr., Seto, E., and Branton,
P.E. (1999). RBP1 recruits both histone deacetylase-dependent and -independent
repression activities to retinoblastoma family proteins. Mol Cell Biol 19, 6632-6641.
Lanford, R.E. (1988). Expression of simian virus 40 T antigen in insect cells using a
baculovirus expression vector. Virology 167, 72-81.
Lee, J.B., Hite, R.K., Hamdan, S.M., Xie, X.S., Richardson, C.C., and van Oijen, A.M.
(2006). DNA primase acts as a molecular brake in DNA replication. Nature 439, 621-
624.
Li, D., Zhao, R., Lilyestrom, W., Gai, D., Zhang, R., DeCaprio, J.A., Fanning, E.,
Jochimiak, A., Szakonyi, G., and Chen, X.S. (2003). Structure of the replicative helicase
of the oncoprotein SV40 large tumour antigen. Nature 423, 512-518.
Li, J.J., and Kelly, T.J. (1984). Simian virus 40 DNA replication in vitro. Proc Natl Acad
Sci U S A 81, 6973-6977.
Lilyestrom, W., Klein, M.G., Zhang, R., Joachimiak, A., and Chen, X.S. (2006). Crystal
structure of SV40 large T-antigen bound to p53: interplay between a viral oncoprotein
and a cellular tumor suppressor. Genes Dev 20, 2373-2382.
Lipinski, M.M., and Jacks, T. (1999). The retinoblastoma gene family in differentiation
and development. Oncogene 18, 7873-7882.
Liu, X., Schuck, S., and Stenlund, A. (2007). Adjacent residues in the E1 initiator beta-
hairpin define different roles of the beta-hairpin in Ori melting, helicase loading, and
helicase activity. Mol Cell 25, 825-837.
Luo, X., Sanford, D.G., Bullock, P.A., and Bachovchin, W.W. (1996). Solution structure
of the origin DNA-binding domain of SV40 T-antigen. Nat Struct Biol 3, 1034-1039.
Masai, H., Matsumoto, S., You, Z., Yoshizawa-Sugata, N., and Oda, M. (2010).
Eukaryotic chromosome DNA replication: where, when, and how? Annu Rev Biochem
79, 89-130.
Mastrangelo, I.A., Hough, P.V., Wall, J.S., Dodson, M., Dean, F.B., and Hurwitz, J.
(1989). ATP-dependent assembly of double hexamers of SV40 T antigen at the viral
origin of DNA replication. Nature 338, 658-662.
Matsumoto, T., Eki, T., and Hurwitz, J. (1990). Studies on the initiation and elongation
reactions in the simian virus 40 DNA replication system. Proc Natl Acad Sci U S A 87,
9712-9716.
82

McClain, B., Settembre, E., Temple, B.R., Bellamy, A.R., and Harrison, S.C. (2010). X-
ray crystal structure of the rotavirus inner capsid particle at 3.8 A resolution. J Mol Biol
397, 587-599.
Mechali, M. (2010). Eukaryotic DNA replication origins: many choices for appropriate
answers. Nat Rev Mol Cell Biol 11, 728-738.
Meinke, G., Phelan, P., Moine, S., Bochkareva, E., Bochkarev, A., Bullock, P.A., and
Bohm, A. (2007). The crystal structure of the SV40 T-antigen origin binding domain in
complex with DNA. PLoS Biol 5, e23.
Melendy, T., and Stillman, B. (1993). An interaction between replication protein A and
SV40 T antigen appears essential for primosome assembly during SV40 DNA
replication. J Biol Chem 268, 3389-3395.
Miller, S.D., Farmer, G., and Prives, C. (1995). p53 inhibits DNA replication in vitro in a
DNA-binding-dependent manner. Mol Cell Biol 15, 6554-6560.
Mitkova, A.V., Khopde, S.M., and Biswas, S.B. (2003). Mechanism and stoichiometry of
interaction of DnaG primase with DnaB helicase of Escherichia coli in RNA primer
synthesis. J Biol Chem 278, 52253-52261.
Mizuno, T., Ito, N., Yokoi, M., Kobayashi, A., Tamai, K., Miyazawa, H., and Hanaoka,
F. (1998). The second-largest subunit of the mouse DNA polymerase alpha-primase
complex facilitates both production and nuclear translocation of the catalytic subunit of
DNA polymerase alpha. Mol Cell Biol 18, 3552-3562.
Mizuno, T., Yamagishi, K., Miyazawa, H., and Hanaoka, F. (1999). Molecular
architecture of the mouse DNA polymerase alpha-primase complex. Mol Cell Biol 19,
7886-7896.
Morris, P.D., Byrd, A.K., Tackett, A.J., Cameron, C.E., Tanega, P., Ott, R., Fanning, E.,
and Raney, K.D. (2002). Hepatitis C virus NS3 and simian virus 40 T antigen helicases
displace streptavidin from 5'-biotinylated oligonucleotides but not from 3'-biotinylated
oligonucleotides: evidence for directional bias in translocation on single-stranded DNA.
Biochemistry 41, 2372-2378.
Moyer, S.E., Lewis, P.W., and Botchan, M.R. (2006). Isolation of the Cdc45/Mcm2-
7/GINS (CMG) complex, a candidate for the eukaryotic DNA replication fork helicase.
Proc Natl Acad Sci U S A 103, 10236-10241.
Murakami, Y., Eki, T., and Hurwitz, J. (1992). Studies on the initiation of simian virus 40
replication in vitro: RNA primer synthesis and its elongation. Proc Natl Acad Sci U S A
89, 952-956.
83

Murakami, Y., and Hurwitz, J. (1993). Functional interactions between SV40 T antigen
and other replication proteins at the replication fork. J Biol Chem 268, 11008-11017.
Murakami, Y., Wobbe, C.R., Weissbach, L., Dean, F.B., and Hurwitz, J. (1986). Role of
DNA polymerase alpha and DNA primase in simian virus 40 DNA replication in vitro.
Proc Natl Acad Sci U S A 83, 2869-2873.
Nevins, J.R. (1998). Toward an understanding of the functional complexity of the E2F
and retinoblastoma families. Cell Growth Differ 9, 585-593.
Nunez-Ramirez, R., Klinge, S., Sauguet, L., Melero, R., Recuero-Checa, M.A., Kilkenny,
M., Perera, R.L., Garcia-Alvarez, B., Hall, R.J., Nogales, E., et al. (2011). Flexible
tethering of primase and DNA Pol alpha in the eukaryotic primosome. Nucleic Acids Res
39, 8187-8199.
Ott, R.D., Rehfuess, C., Podust, V.N., Clark, J.E., and Fanning, E. (2002a). Role of the
p68 subunit of human DNA polymerase alpha-primase in simian virus 40 DNA
replication. Mol Cell Biol 22, 5669-5678.
Ott, R.D., Wang, Y., and Fanning, E. (2002b). Mutational analysis of simian virus 40 T-
antigen primosome activities in viral DNA replication. J Virol 76, 5121-5130.
Otwinowski, Z.a.M., W (1997). Processing of X-ray diffraction data collected in
oscillation mode. Methods Enzymol 276, 307-326.
Patel, S.S., and Picha, K.M. (2000). Structure and function of hexameric helicases. Annu
Rev Biochem 69, 651-697.
Pipas, J.M. (2009). SV40: Cell transformation and tumorigenesis. Virology 384, 294-303.
Qimron, U., Lee, S.J., Hamdan, S.M., and Richardson, C.C. (2006). Primer initiation and
extension by T7 DNA primase. Embo J 25, 2199-2208.
Roy, R., Trowbridge, P., Yang, Z., Champoux, J.J., and Simmons, D.T. (2003). The cap
region of topoisomerase I binds to sites near both ends of simian virus 40 T antigen. J
Virol 77, 9809-9816.
Rundell, K., Collins, J.K., Tegtmeyer, P., Ozer, H.L., Lai, C.J., and Nathans, D. (1977).
Identification of simian virus 40 protein A. J Virol 21, 636-646.
Saikrishnan, K., Powell, B., Cook, N.J., Webb, M.R., and Wigley, D.B. (2009).
Mechanistic basis of 5'-3' translocation in SF1B helicases. Cell 137, 849-859.
Sauguet, L., Klinge, S., Perera, R.L., Maman, J.D., and Pellegrini, L. Shared active site
architecture between the large subunit of eukaryotic primase and DNA photolyase. PLoS
One 5, e10083.
84

Schroder, G.F., Levitt, M., and Brunger, A.T. (2010). Super-resolution biomolecular
crystallography with low-resolution data. Nature 464, 1218-1222.
Shen, J., Gai, D., Patrick, A., Greenleaf, W.B., and Chen, X.S. (2005). The roles of the
residues on the channel beta-hairpin and loop structures of simian virus 40 hexameric
helicase. Proc Natl Acad Sci U S A 102, 11248-11253.
Simmons, D.T., Melendy, T., Usher, D., and Stillman, B. (1996). Simian virus 40 large T
antigen binds to topoisomerase I. Virology 222, 365-374.
Simpson, A.A., Chipman, P.R., Baker, T.S., Tijssen, P., and Rossmann, M.G. (1998).
The structure of an insect parvovirus (Galleria mellonella densovirus) at 3.7 A resolution.
Structure 6, 1355-1367.
Srinivasan, A., McClellan, A.J., Vartikar, J., Marks, I., Cantalupo, P., Li, Y., Whyte, P.,
Rundell, K., Brodsky, J.L., and Pipas, J.M. (1997). The amino-terminal transforming
region of simian virus 40 large T and small t antigens functions as a J domain. Mol Cell
Biol 17, 4761-4773.
Stahl, H., Droge, P., and Knippers, R. (1986). DNA helicase activity of SV40 large tumor
antigen. Embo J 5, 1939-1944.
Stauffer, M.E., and Chazin, W.J. (2004). Structural mechanisms of DNA replication,
repair, and recombination. J Biol Chem 279, 30915-30918.
Stewart, L., and Champoux, J.J. (1999). Purification of baculovirus-expressed human
DNA topoisomerase I. Methods Mol Biol 94, 223-234.
Stillman, B. (1989). Initiation of eukaryotic DNA replication in vitro. Annu Rev Cell
Biol 5, 197-245.
Stillman, B.W., and Gluzman, Y. (1985). Replication and supercoiling of simian virus 40
DNA in cell extracts from human cells. Mol Cell Biol 5, 2051-2060.
Sullivan, C.S., Cantalupo, P., and Pipas, J.M. (2000). The molecular chaperone activity
of simian virus 40 large T antigen is required to disrupt Rb-E2F family complexes by an
ATP-dependent mechanism. Mol Cell Biol 20, 6233-6243.
Sullivan, C.S., Gilbert, S.P., and Pipas, J.M. (2001). ATP-dependent simian virus 40 T-
antigen-Hsc70 complex formation. J Virol 75, 1601-1610.
Sullivan, C.S., and Pipas, J.M. (2002). T antigens of simian virus 40: molecular
chaperones for viral replication and tumorigenesis. Microbiol Mol Biol Rev 66, 179-202.
Tjian, R. (1978). The binding site on SV40 DNA for a T antigen-related protein. Cell 13,
165-179.
85

Toth, E.A., Li, Y., Sawaya, M.R., Cheng, Y., and Ellenberger, T. (2003). The crystal
structure of the bifunctional primase-helicase of bacteriophage T7. Mol Cell 12, 1113-
1123.
Trowbridge, P.W., Roy, R., and Simmons, D.T. (1999). Human topoisomerase I
promotes initiation of simian virus 40 DNA replication in vitro. Mol Cell Biol 19, 1686-
1694.
Uhlmann-Schiffler, H., Seinsoth, S., and Stahl, H. (2002). Preformed hexamers of SV40
T antigen are active in RNA and origin-DNA unwinding. Nucleic Acids Res 30, 3192-
3201.
Vaithiyalingam, S., Warren, E.M., Eichman, B.F., and Chazin, W.J. (2010). Insights into
eukaryotic DNA priming from the structure and functional interactions of the 4Fe-4S
cluster domain of human DNA primase. Proc Natl Acad Sci U S A 107, 13684-13689.
Valentine, A.M., Ishmael, F.T., Shier, V.K., and Benkovic, S.J. (2001). A zinc ribbon
protein in DNA replication: primer synthesis and macromolecular interactions by the
bacteriophage T4 primase. Biochemistry 40, 15074-15085.
Voitenleitner, C., Rehfuess, C., Hilmes, M., O'Rear, L., Liao, P.C., Gage, D.A., Ott, R.,
Nasheuer, H.P., and Fanning, E. (1999). Cell cycle-dependent regulation of human DNA
polymerase alpha-primase activity by phosphorylation. Mol Cell Biol 19, 646-656.
Waga, S., and Stillman, B. (1994). Anatomy of a DNA replication fork revealed by
reconstitution of SV40 DNA replication in vitro. Nature 369, 207-212.
Waga, S., and Stillman, B. (1998). The DNA replication fork in eukaryotic cells. Annu
Rev Biochem 67, 721-751.
Wang, G., Klein, M.G., Tokonzaba, E., Zhang, Y., Holden, L.G., and Chen, X.S. (2008).
The structure of a DnaB-family replicative helicase and its interactions with primase. Nat
Struct Mol Biol 15, 94-100.
Webb, M.R. (1992). A continuous spectrophotometric assay for inorganic phosphate and
for measuring phosphate release kinetics in biological systems. Proc Natl Acad Sci U S A
89, 4884-4887.
Weinberg, D.H., Collins, K.L., Simancek, P., Russo, A., Wold, M.S., Virshup, D.M., and
Kelly, T.J. (1990). Reconstitution of simian virus 40 DNA replication with purified
proteins. Proc Natl Acad Sci U S A 87, 8692-8696.

86

Weisshart, K., Forster, H., Kremmer, E., Schlott, B., Grosse, F., and Nasheuer, H.P.
(2000). Protein-protein interactions of the primase subunits p58 and p48 with simian
virus 40 T antigen are required for efficient primer synthesis in a cell-free system. J Biol
Chem 275, 17328-17337.
Wessel, R., Schweizer, J., and Stahl, H. (1992). Simian virus 40 T-antigen DNA helicase
is a hexamer which forms a binary complex during bidirectional unwinding from the viral
origin of DNA replication. J Virol 66, 804-815.
Wobbe, C.R., Dean, F., Weissbach, L., and Hurwitz, J. (1985). In vitro replication of
duplex circular DNA containing the simian virus 40 DNA origin site. Proc Natl Acad Sci
U S A 82, 5710-5714.
Yang, J., Xi, J., Zhuang, Z., and Benkovic, S.J. (2005). The oligomeric T4 primase is the
functional form during replication. J Biol Chem 280, 25416-25423.
Yang, L., Wold, M.S., Li, J.J., Kelly, T.J., and Liu, L.F. (1987). Roles of DNA
topoisomerases in simian virus 40 DNA replication in vitro. Proc Natl Acad Sci U S A
84, 950-954.
Yuzhakov, A., Kelman, Z., Hurwitz, J., and O'Donnell, M. (1999). Multiple competition
reactions for RPA order the assembly of the DNA polymerase delta holoenzyme. Embo J
18, 6189-6199.
Zerbe, L.K., and Kuchta, R.D. (2002). The p58 subunit of human DNA primase is
important for primer initiation, elongation, and counting. Biochemistry 41, 4891-4900.

87

Appendix A Full-length LTag Expression and Purification by
Using Baculovirus Insect Cell Expression System

A.1 Overview
As mentioned in the previous chapters, SV40 Large T antigen is a multi-
functional protein consisting of several structural domains. The structures of individual
domain have been extensively studied. The LTag domain structures available so far
correlate very well with the functional domain of LTag deduced by biochemical and
molecular genetic studies. However, full-length LTag structure of atomic level still
remains elusive. Low resolution EM study reveals that, besides the straight alignment of
domains, full-length LTag shows certain bending flexibility along the longitudinal axis of
the double hexamer in the presence of DNA, which may be important to understand the
structural dynamics of the complex as well as its in vivo function (Cuesta et al., 2010). It
also indicates that the functional full-length LTag structure is not simply the sum of its
domain structures. Therefore, to gain a complete understanding of LTag structure and
function, obtaining of full-length LTag as well as examining of its structural dynamics
and biochemical characteristics will be our next goals.
Till now, there is no successful experience in purifying FL-LTag in E. coli. Even
though several studies have reported successful expression of FL-LTag by using
Baculovirus insect cell expression system (Lanford, 1988), purification of the protein can
only be accomplished by using LTag antibody affinity chromatography, which is very
costly, time-consuming, and low yielding.
88

Studies in this chapter provide a more convenient way to express and purify FL-
LTag by using baculovirus insect cell expression and Ni-NTA affinity chromatography.
FL-LTag purified from insect cells is pure, tends to oligomerize into double hexamer
even in the absence of DNA or nucleotide, and is active in helicase unwinding assays.
A.2 FL-LTag Expression in Insect Cells by Using Baculavirus-Mediated Expression
System
A.2.1 Why Do We Go Insect Cell System
Choosing the protein expression system, specifically in our case, opting from
E.coli expression system or insect cell expression system to produce LTag is constantly a
balance between the advantages and disadvantages of each system. Most of the LTag
fragments crystallized so far are expressed in E.coli because it is easy to manipulate and
fast to mass-produce. However, compare to insect cell system, it lacks most post-
translational modifications, which can be essential for proper protein solubility, stability
and function. Protein expression in insect cells, such as SF9 cells provides a cellular
environment resembling that of higher eukaryotic organisms, and allows more
complicated protein to be produced. But the time and financial investment required for
insect cell expression are significant. Therefore, in our efforts to obtain FL-LTag protein,
we started from E.coli expression. However, it seems not a good host after we
systematically tried different purification tags constructed at either ends of the peptide.
The major issue is that the expressed FL-LTag does not exist in a soluble form possibly
due to the unavailability of post-translational modifications in bacteria. In contrast,
soluble FL-LTag has successfully been produced from Sf9 insect cells (Lanford, 1988;
89

Ott et al., 2002b). By immunoaffinity chromatography, purified FL-LTag is enough to be
characterized in biochemical studies. However, to obtain large quantity of pure FL-LTag
necessary for crystallization, the yield vs. cost by using insect cell expression and
traditional purification is obviously not satisfactory for the needs.
A.2.2 Obtaining of Recombinant Viruses
Since the cost by adopting the insect cell expression system is not avoidable, I
wondered whether we can lower the cost and workload of protein purification by
expressing the protein recombinant with a regular affinity tag. GST tagged FL-LTag
insect cell expression was tried by a previous researcher in our lab with no success. With
the consideration of the size and dimerization properties of GST, I switched the GST tag
by constructing the His
6
-tag recombinant with the WT FL-LTag (residues 1-708) or the
nFL-LTag (residues 1-627) at either its N-terminal or C-terminal end (His
6
-708, His
6
-
627, 708- His
6
and 627- His
6
). After the transferring vectors harboring these different
recombinant fragments were constructed, Sf9 culturing and infection was outsourced to
the University of Colorado Protein Production, Monoclonal Antibody, and Tissue Culture
Core. Over there, recombinant viruses were derived by homologous recombination
between the plasmid and AcNPV viral DNAs that are co-transfected into SF9 cells. For
each construct, 10 plaque-purified recombinant viruses (A-I) were expanded and used to
infect Sf9 cells in T25 flasks. The cell pellets were sent back for protein expression
analyses by immunoblot with either anti-LTag antibodies (pAb419, anti-LTag residue 1-
82 and pAb416, anti-LTag residue 83-121) or anti-HisTag antibody (Figure A.1). Among
the four constructs, 708- His
6
and 627- His
6
showed less degradation compared to their
90

counterparts with His
6
-tag attached at the N-terminal end of the fragment (His
6
-708 and
His
6
-627). Therefore, I decided focusing on the 708- His
6
Figure A.1 FL-LTag expression (708-His
construct for further protein
expression optimization and larger scale protein production.
6

) detected by Western blot. (A) Anti-His-
tag antibody; (B) Anti-LTag (pAb419/pAb416) antibody. Insect cells infected by
baculovirus derived from 10 plaques (A-J) were analyzed.
A.2.3 Detection and Optimization of FL-LTag Expression
The optimal MOI and time course of LTag synthesis in Sf9 cells were examined
in order to optimize the LTag expression. Sf9 cells infected with an MOI of 1, 3 or 5
were collected after different duration of infection for 36, 48 and 60 hours. LTag
expression in insect cells infected by different viral MOI or collected at different time
post infection (p.i.) was analyzed in the corresponding cell extract by Western-blotting. It
was shown that the LTag synthesis was low at 36 hours p.i. The maximum protein
expression was observed at 48 hours p.i., and the protein synthesis significantly reduced
91

at 60 hours p.i. With infection time of 48 hour, different MOI of 1, 3, or 5 does not seem
to affect the expression level of LTag significantly (data not shown). Therefore, in the
large-scale expression, we chose to use 708- His
6
A.3 Purification of FL-LTag from Infected Insect Cell Pellet
-virus #I, inducing the protein
expression in insect cells by adopting an MOI of 1 and an infection time of 48 hours.
Expression scale was expanded by infecting a 300ml flask culture by recombinant
virus 708- His
6
100mM Tris-HCl PH7.5, 300mM NaCl, 5mM KCl and 5mM BME, which I maintained
throughout the entire purification. The remainder of the lysis step and His
-#I. With the pellets sending back from the cell culture core, I focused on
optimizing the lysis buffer conditions and purification scheme. Lysis buffer variables
tested were: buffer PH ranging from 6.0 to 9.0 using PIPES, HEPES, and Tris as
appropriate, 250-750mM NaCl, 0-10% glycerol, with or without 1% NP40. After
multiple preps testing these variables, the optimal prep buffer was determined to be
6
-tag affinity
purification followed the purification protocol (Qiagen) of Ni-NTA affinity
chromatography manual. FL-LTag resided on Ni-NTA column after exhaustive washing
steps by a washing buffer containing 100mM Tris-HCl PH7.5, 300mM NaCl, 50mM
Imidazole, 5mM BME was eluted out by the elution buffer (100mM Tris-HCl PH7.5,
300mM NaCl, 150mM Imidazole, 5mM BME). Protein elutes were concentrated and
loaded to Superose6 analytical size exclusion column. Gel filtration profile contains two
asymmetric peaks and indicates that most of the FL-LTag oligomerized as double-
hexamer (peak2) or an even higher oligomerization state (peak1) (Figure A.2). Different
from all of the other LTag fragments we worked on so far (LTag HD, LTag131 or
92

LTag108), which display an constant equilibration majorly between monomer and
hexamer of LTag, we observed that purified full-length LTag only exists as double-
hexamer or higher oligomerization states even in the absence of any Nt or DNA. This
indicates that, besides the monomer-monomer interactions between the C-terminal region
of LTag, as revealed by its helicase domain structure, the N-terminal domain of LTag
also facilitate the oligomerization of the protein. Fractions from Superose6 analytical
column were analyzed by 10% SDS-PAGE. Both peaks contain pure LTag protein of an
expected size.
93

Figure A.2 Purification of FL-LTag from insect cells. (A) SDS-PAGE analysis of
GST-affinity chromatography lane1, whole cell lysis; lane2, supernatant; lane3, cell
pellet; lane4, protein pulled-down by GST resin; (B) All four lanes are showing protein
elution washed off by applying elution buffer containing 150mM imidazole; (C)
Superose6 gel filtration profile of concentrated FL-LTag from elution; (D) SDS-PAGE
analysis of fractions collected from panel C.

94

A.4 Unwinding Activity of Purified FL-LTag
The unwinding activity of insect cell-derived LTag was determined by helicase
assays. DNA substrate (fork DNA) and the assay procedures are described as the
experimental procedures in chapter 4. As expected, protein fractions in both peak1 and
peak2 from the gel filtration displayed helicase activity (Figure A.3, lane 7-10)
comparable to WT Methanothermobacter thermautotrophicus MCM (mtMCM) (positive
control Figure A.3, lane3). The fraction representing the double hexamer sample of full-
length LTag showed even higher helicase activity compared to mtMCM and almost
unwound the dsDNA substrate completely (Figure A.3, lane 10 compare to lane 3).

Figure A.3 Helicase activity of purified FL-LTag. 5’-labbelled fork DNA was used as
substrate. Lane1 and lane2, boiled and unboiled DNA substrate; lane3, WT mtMCM;
lane 4-10 corresponding to the fraction#4-10 collected from the superose6 gel-filtratraion
chromatography.

A.5 Conclusions and Future Direction
This study for the first time provides an approach to conveniently express and
purify WT full-length LTag from insect cell without expensive LTag antibody affinity
chromatography. The protein expressed in insect cell is soluble, well folded and post-
translational modified. The protein can be prepared to decent purity and yield while
95

retaining its biological activity. Based on the initial optimization on infecting MOI and
duration, and by further tuning on different factors in the expression system, such as
trying other high efficient transfer vectors, insect cell lines, combination of infection
temperature, duration and MOI, the purification yield could be further improved. The
convenient accessibility of high quality FL-LTag will for sure remove one of the major
obstacles in LTag structural and functional study. In addition, by docking LTag-binding
partners to limit local flexibility, such pRb for J domain, SV40 origin-containing DNA
for OBD and/or p68N/p53 for helicase domain as describe in chapter 2, this work set a
good basis for understanding the atomic structure of intact LTag per se or in complex
with its binding partners.
96

Appendix B Towards a Co-Crystal of Near Full Length LTag
(nFL-LTag) and Human Retinoblastoma protein (pRb)

B.1 Overview
Besides its function during viral replication as a DNA helicase, LTag can
dedifferentiate and transform its host cell upon infection (Pipas, 2009). When expressed
on its own, LTag is able to transforms several cell types and induces tumors in animals.
In this sense, LTag is thought to overcome cell cycle checkpoints by altering the function
of tumor suppressors and other key cellular proteins. One of the two critical cellular
targets, p53 and retinoblastoma protein (Rb), LTag interacts with in inducing cellular
transformation is the Rb family of proteins, including pRb, p107 and p130. The
retinoblastoma gene product pRb and other members of the Rb family of pocket proteins
have a central role as tumor suppressor through the regulation of cell cycle progression.
The pRb protein represses gene transcription, which is required for transition from G1 to
S phase by directly binding to the transactivation domain of E2F and by binding to the
promoter of these genes as a complex (Dyson, 1998; Harbour and Dean, 2000; Lipinski
and Jacks, 1999; Nevins, 1998). In addition, studies also show that pRb represses
transcription by remodeling chromatin structure through recruitment of proteins such as
hBRM, BRG1, HDAC1 and SUV39H1, which are involved in nucleosome remodeling,
histone acetylation/deacetylation and methylation respectively (Harbour and Dean, 2000;
Lai et al., 1999). Therefore, loss of pRb function induces cell cycle deregulation and
leads to a malignant phenotype. It has been shown that, to bind and inactivate its normal
regulatory function for controlling cell cycle of pRb, the amino-terminal domain
97

(J domain) of LTag is essential. Not only LTag interacts with pRb through its LXCXE
motif within J domain (Kim et al., 2001), but also the J domain of LTag functions as a
DnaJ molecular chaperone, which recruits the cellular hsc70 chaperone protein, so that
energy generated from hsc70-mediated ATP hydrolysis will drive the dissociation of pRb
and E2F transcription factors (Sullivan et al., 2000; Sullivan et al., 2001). By docking the
pocket domain of human pRb at the N-terminal region of nFL-LTag, and aiming to
understand the detailed mechanisms by which LTag targets pRb in the virus-induced
tumor formation, I tried to reveal the crystal structure of pRb-bound nFL-LTag complex.
In the meanwhile, by limiting the N-terminal structural flexibility of nFL-LTag through
its binding to pRb, this study also intends to understand the LTag structural organization
in a more complete perspective.
B.2 nFL-LTag and pRb Pocket Domain Purification
A great deal of time and efforts of my PhD study working with LTag has been
spent in optimizing the purification and crystallization of the nFL-LTag/pRb complex. To
successfully express and purify the LTag containing the complete N-terminal J domain,
nFL-LTag (residue 1-627) with an internal deletion of residues 117-130 was constructed
into the pXA-B/N low copy expression plasmid between the BamHI and XhoI sites. The
internal deletion was removed in order to prevent protein degradation. To eliminate the
interaction with E.coli DnaK, we also designed a point mutation of H to Q at residue 42
of LTag, which is presumably the major binding site of DnaK on LTag. We also cloned
three Glycines at the N-terminus prior to LTag residue 1 to optimize the cleavage of the
GST tag by thrombin (Figure B.1A). nFL-LTag expression was then induced in E. coli.
98

The fusion protein was isolated by glutathione affinity chromatography. After released by
thrombin cleavage, the nFL-LTag further went through an array of purification steps
including ion exchange and Superose 6 gel-filtration chromatography (GE) (Figure
B.1B). Gel filtration fractions were analyzed by SDS-PAGE (Figure B.1C) and LTag
hexamer fractions were pooled.
99

Figure B.1 Purification of nFL-LTag. (A) Schematic construct of nFL-LTag; (B)
Superose6 prep gel filtration profile of nFL-LTag; (C) SDS-PAGE analysis of fractions
of nFL-LTag from Superose6 size exclusion chromatography.

100

Human pRb pocket domain (residues 379-772) was constructed into the pGEX-
2TK vector. It was expressed in E. coli as a GST fusion protein and purified by
glutathione affinity chromatography. After on-column cleavage by thrombin, eluted pRb
was further purified by S200 size exclusion chromatography before collection (Figure
B.2).

Figure B.2 Purification of pRb pocket domain. (A) S200 analytical gel filtration
chromatography of pRb; (B) SDS-PAGE analysis of fractions from S200 gel filtration,
indicating purified pRb

101

As already mentioned many times in this dissertation, LTag of SV40 is a highly
streamlined protein in both its structural organization and function. Decades of studying
on LTag reveals that it is not LTag per se, but the manner that it interacts with a
bewildering array of cellular proteins enables the various cellular functions of this viral
protein. However, when it comes to the time of full-length large T antigen purification,
this property makes the purification of longer fragment of LTag more challenging with
regard to removing its binding partners. By designing the nFL-LTag peptide very
carefully and through a combination of diverse protein purification techniques, we were
able to gradually resolve the LTag degradation problem and eliminate the binding of
cellular proteins such as DnaK during protein expression. Resource Q ion exchange
process improved the purity of nFL-LTag by removing tight DnaK-bound LTag even
further (data not shown). The eventual purified LTag was examined for its unwinding
activity by helicase assay as described in chapter4. The helicase assay showed that the
nFL-LTag is active in unwinding dsDNA very well (data not shown).
B.3 Binding between nFL-LTag and pRb
To test the binding between nFL-LTag and pRb, a mixture of purified proteins
was incubated and loaded into Superose6 size exclusion column. We observed three
elution peaks (peak 1, 2 and 3 in Figure B.3A) in the gel filtration profile. Protein size
and fraction analyses of each peak suggested that peak1 corresponded to the hexameric
LTag-pRb complex, peak2 represented the monomeric LTag-pRb complex while peak3
should contain the free monomeric pRb. To further confirm the composition of each
peak, gel filtration profiles showing the same input of LTag alone (red curve), pRb alone
102

(blue curve) or LTag/pRb mixture (yellow curve of Figure B.3A) were aligned. We
observed an obvious drop of the free pRb peak by incubating pRb with nFL-LTag. And
in the meanwhile, the UV absorbance of both hexameric and monomeric LTag peaks
increased within the profile corresponding to protein mixture, compared to that of the
nFL-LTag alone. A slight shift of both complex peaks towards left indicated an increase
of complex molecular weight due to the pRb binding. Fractions corresponding to each
peak were analyzed by SDS-PAGE, which further confirmed that pRb interacts with both
hexameric and monomeric LTag in the testing buffer condition (Figure B.3B).

103

Figure B.3 Binding test of nFL-LTag and pRb. (A) Alignment of gel filtration profiles
of nFL-LTag alone (red), pRb alone (blue) and nFL-LTag/pRb mixture (yellow); (B)
SDS-PAGE analysis of gel-filtration fractions (yellow curve), numbers on the top of the
gel is corresponding to the fraction numbers from gel filtration.

104

B.4 Crystallization and Optimization
With the confirmed nFL-LTag/pRb interaction, I set out trying to crystallize the
protein complex. Each protein was buffer-exchanged and concentrated in crystallization
buffer containing 25 mM Tris-HCl, pH 8.0, 250 mM NaCl, and 10 mM dithiothreitol.
Three LTag concentrations (10mg/ml, 7.5mg/ml and 4mg/ml) were tested. LTag at each
concentration was mixed with pRb at an optimized molar ratio of 1:1 (LTag monomer:
p68N) (A representative purified nFL-LTag/pRb mixture for crystallization is shown in
Figure B.4A). Standard screens (from Hampton Research and Qiagen) were set up at a
1:1 protein to mother liquor buffer ratio using the Hydra II robot at both 18◦ C and 4◦ C
by the hanging-drop vapor diffusion method. Trays were monitored at regular intervals
beginning from the second week of initial setting-up, once a week for the first month,
then every few months for the next year and a half. Among the six sets of setting-up
(three LTag concentrations and two temperatures), over 1000 screening conditions in
each set, promising crystalline particles were observed in multiple conditions, each of
which was used to design an optimized screening around and was monitored in a similar
manner. Most optimization screenings do not provide anything better than those
promising microcrystals has ever been found, with exception of two conditions in which
promising crystals were grown and improved.
Condition1: 25mM Tris PH 8.0, 250mM NaCl, 5mM TCEP
Condition2: 75mM Bis-Tris 6.0, 250mM NaCl
Both conditions were optimized systematically, aiming to decrease the nucleation
numbers in crystallization drops and increase the size of single crystal. By carefully
105

tuning the PH, salt and TCEP concentration in condition1, together with the screening of
Hampton additives, the crystal size could reach to around 70-80mM. The other condition
(condition2) was the one I spent most of my time and efforts optimizing with. Very
detailed optimization and additive screens have been done and the best crystal could
reach up to 200mM in size (Figure B.4B). Unfortunately, the diffraction of these crystals
are still weak despite of the various cryo-conditions and techniques I have tried. The
diffraction I was able to get with my best crystal was about 17 angstrom from an ALS
synchrotron trip.

Figure B.4 Crystallization of nFL-LTag/pRb. (A) Final purified nFL-LTag and pRb
mixture used for crystallization; (B) Optimized co-crystals of nFL-LTag and pRb.

106

B.5 Elimination of nFL-LTag231 Degradation
SDS-PAGE analysis of purified nFL-LTag displayed a smaller molecular weight
protein migrating faster than the targeting LTag band (FigB.5A Left). N-terminal
sequencing result indicated this smaller protein to be a degradation fragment of LTag231-
627 (Figure B.5B). Concerning this degradation would influence the quality of obtained
crystals, I managed to eliminate this heterogeneity by designing a series of site mutations
within the near-full length LT fragment.

Figure B.5 Elimination of nFL-LTag231 degradation. (A) SDS-PAGE and
coommassie blue staining of purified nFL-LTag (Left) and nFL-LTag P417D mutants
(Right); (B) N-terminal sequencing result showing the identity of nFL-LTag degradation
band.
107

A list of mutants based on nFL-LTag aiming to get rid of the LTag 231
degradation is shown in Table B.1.
Table B.1 List of mutants aiming to reduce the nFL-LTag231 degradation
Single mutation L231A, L231S and L231D
Double mutation Y230A/L231S, Y230S/L231S and Y230D/L231S
Monomeric mutation V350E and P417D

Among them, it was surprising to see Y230A/L231S double mutation does not
reduce the heterogeneity much compared to the purified WT nFL-LTag. However,
interestingly, another monomeric mutation of of LTag, P417D, for an unknown reason,
could get rid of almost all of the degradation contamination (Figure B.5A Right).
However sadly, this purer nFL-LTag-P417D protein was not able to crystallize under our
known crystallization conditions as well as in new crystallization screens. Since this
mutation could almost completely disrupt the hexamerization of LTag, we reasoned that
successful hexamer formation should be critical for the crystallization of this protein
complex.
B.6 Conclusion and Future Direction
In the first half year after I entered the lab, I had already obtained both pure LTag
and pRb proteins in high protein concentration (30mg/ml for near-full length LTag and
over 50mg/ml for pRb) for crystallization attempts, which already produced some very
promising crystals. But this direction proceeded with no luck in the following years. It is
not surprising that this is a very challenging direction, given the facts that the complex
structure contains near full length LTag fragment which hardly to be prepared into a high
homogeneity, as well as that the hexameric nFL-LTag/pRb complex is expected to be a
108

huge structure, which usually requires bigger and higher quality of crystals to obtain good
diffraction data to solve the structure. Therefore, obtaining crystals and diffraction data
sets of better quality is the bottleneck limiting the development of this direction.
Progressions in my studies of other directions in previous chapters may provide
breakthrough to conquer the difficulties in this project.
To improve the quality of co-crystal or its diffraction, further efforts through the
following directions will potentially help to accomplish our goals of pursuing this
direction.
1) Based on the experiences we obtained in crystallizing p68N/LTag HD as
described in chapter 2 (31 conditions gave crystals in initial robot screening), it seems
p68N might be utilized as a useful crystallization agent to help the complex
crystallization of nFL-LTag and pRb. Therefore, further crystallization can include this
small peptide to assist in improving the co-crystal quality of nFL-LTag/pRb.
2) One issue that the nFL-LTag/pRb co-crystal is not of sufficient quality to
diffract well is the heterogeneity of nFL-LTag as discussed in part B.5. The degradation
contamination can be effectively removed from target nFL-LTag by purifying monomeric
mutants of the nFL-LTag. However, this purer version of nFL-LTag does not co-
crystalize with pRb anymore, possibly because this mutation altered the oligomerization
ability of the peptide substantially. In this regard, FL-LTag obtained from studies of
Appendix A is free of this degradation, therefore can be a good candidate, rather than
nFL-LTag, to be co-crystallized with pRb, with the help of p68N in the future.
109

3) Surface Entropy Reduction (SER) could be another useful method to try with
(Cooper et al., 2007). SER relies on replacing small clusters of surface residues
characterized by high conformational entropy with alanines. It has proven to be an
effective salvage pathway for proteins that are difficult to be crystallized.
4) Expecting a large unit cell, dehydration techniques is worth to be tried in order
to improve the diffraction quality of the crystals. Also, with the super beam available in
APS (Chicago, IL), it is also worthwhile to bring some crystal and shoot with the super
beam, which is extremely intensive and fine in size now, the diffraction can be greatly
improved.

Abstract (if available)

Abstract Simian Virus 40 (SV40) replication has long been regarded as a useful model system in circumventing the complexity of studying the eukaryotic DNA replication process. SV40 large T antigen (LTag), as the only virus-encoding protein required for viral genome replication, extensively uses cellular proteins to function as a replication initiator at replication origins and as a helicase during nascent DNA elongation. ❧ During replication initiation, DNA polymerase alpha-primase (pol-prim) plays an essential role in eukaryotic DNA replication, initiating synthesis of the leading strand and of each Okazaki fragment on the lagging strand. At least three subunits of pol-prim interact physically with the hexameric SV40 LTag to carry out its functions. However, structural understanding of these interactions and their role in viral chromatin replication in vivo remains incomplete. ❧ Further DNA elongation substantially depends on the helicase function of LTag. In the presence of DNA, LTag forms an efficient molecular motor fueled by ATP binding and hydrolysis. Significant progress has been made in gaining insight into the mechanism of LTag helicase function by structural and biochemical studies. However, the detailed mechanism by which LTag couple the ATP hydrolysis to translocation and DNA separation is not yet clear. ❧ This dissertation is organized to further the understanding of these areas via a literature review and presentation of findings I discovered through my PhD research: ❧ In Chapter 1, I will give a thorough review about the current understanding of LTag mediated SV40 replication. ❧ In Chapter 2, I will present a co-crystal structure of SV40 hexameric helicase and the regulatory subunit (p68) of eukaryotic DNA polymerase ɑ/primase (pol/prim). The structure reveals the detailed LTag-p68 interface, which is validated by site-directed mutagenesis, and demonstrated to be critical in activating the SV40 primosome in cell-free reactions with purified pol-prim, as well as in monkey cells in vivo. ❧ In Chapter 3, I will demonstrate the roles of the residues along the LTag central channel structure elements in DNA unwinding. By substituting these residues with a series of amino acids carrying diverse side chain properties and systematically examining the DNA stimulated ATPase activity and helicase function of these mutants, my study reveals the significant roles of these central channel residues in DNA unwinding. More intriguingly, careful data analysis suggests that even though these residues are spatially proximal to each other, they might affect DNA unwinding through different mechanisms. ❧ Chapter 4 describes the detailed experimental procedures. ❧ Last but not the least, efforts and preliminary results are included in the appendices towards understanding of structure and function of the complete LTag protein, as well as its tumorigenesis through interacting with human retinoblastoma protein. ❧ Altogether, the information presented here advances the understanding of the mechanism of SV40 LTag in DNA replication and provides a solid base for future studies with this incredible molecule. We anticipate results accumulated in this model system will eventually facilitate the understanding of the replication process as well as tumorigenesis in eukaryotic cells.

Linked assets

University of Southern California Dissertations and Theses

Conceptually similar

PDF

Mechanism study of SV40 large tumor antigen atpase and helicase functions in viral DNA replication

PDF

Simulating the helicase motor of SV40 large tumor antigen

PDF

Biochemical characterization and structural analysis of two hexameric helicases for eukaryotic DNA replication

PDF

Structure and function of archaeal McM helicase

PDF

Structural and biochemical studies of DNA helicase complexes: conformational diversity of archaeal MCM

PDF

Essential and non-essential helicases maintain genome stability in Schizosaccharomyces pombe

PDF

Structural and biochemical studies of two DNA transaction enzymes

PDF

Structural studies of two key factors for DNA replication in eukaryotic cells

PDF

Structural and biochemical determinants of APOBEC1 substrate recognition and enzymatic function

PDF

X-ray structural studies on DNA-dependent protein kinase catalytic subunit:DNA co-crystals

PDF

Biochemical studies of APOBEC protein family

PDF

Forkhead transcription factors regulate replication origin firing through dimerization and cell cycle-dependent chromatin binding in S. cerevisiae

PDF

Investigating the E. Coli DNA polymerase V mutasome

PDF

Structure and regulation of lymphoid tyrosine phosphatase (LYP) in autoimmune response

PDF

The role of Cdc7 in replication fork progression in response to DNA damage

PDF

The function of Rpd3 in balancing the replicaton initiation of different genomic regions

PDF

Biochemical mechanism of TopBP1 recruitment to sites of DNA damage

PDF

Structural and biochemical analyses on substrate specificity and HIV-1 Vif mediated inhibition of human APOBEC3 cytidine deaminases

PDF

Nucleotide analogs and molecular probes for LFER, time-resolved crystallography, FRET, and EPR studies of human DNA polymerase: probing mechanism, conformation and structure

PDF

Forkhead transcription factors control genome wide dynamics of the S. cerevisiae replication timing program

Asset Metadata

Creator Zhou, Bo (author)

Core Title Structural and biochemical studies of large T antigen: the SV40 replicative helicase

School College of Letters, Arts and Sciences

Degree Doctor of Philosophy

Degree Program Molecular Biology

Publication Date 04/26/2012

Defense Date 03/14/2012

Publisher University of Southern California (original), University of Southern California. Libraries (digital)

Tag crystallography,DNA polymerase,DNA replication,helicase,large T antigen,OAI-PMH Harvest,Primase

Language English

Contributor Electronically uploaded by the author (provenance)

Advisor Chen, Xiaojiang S. (committee chair), Chen, Lin (committee member), Haworth, Ian S. (committee member)

Creator Email bozhou@usc.edu,bzhou.usc@gmail.com

Permanent Link (DOI) https://doi.org/10.25549/usctheses-c3-13912

Unique identifier UC11290345

Identifier usctheses-c3-13912 (legacy record id)

Legacy Identifier etd-ZhouBo-647.pdf

Dmrecord 13912

Document Type Dissertation

Rights Zhou, Bo

Type texts

Source University of Southern California (contributing entity), University of Southern California Dissertations and Theses (collection)

Access Conditions The author retains rights to his/her dissertation, thesis or other graduate work according to U.S. copyright law. Electronic access is being provided by the USC Libraries in agreement with the a...

Repository Name University of Southern California Digital Library

Repository Location USC Digital Library, University of Southern California, University Park Campus MC 2810, 3434 South Grand Avenue, 2nd Floor, Los Angeles, California 90089-2810, USA