University of Southern California Dissertations and Theses

Axon guidance cues in development of the mammalian auditory circuit

(USC Thesis Other)

Axon guidance cues in development of the mammalian auditory circuit

PDF

Download a page range

Download transcript

Copy asset link

Request this asset

Transcript (if available)

Content Axon Guidance Cues in Development of the Mammalian
Auditory Circuit

Young Joo Kim

A DISSERTATION
PRESENTED TO THE FACULTY
OF THE UNIVERSITY OF SOUTHERN CALIFORNIA
IN CANDIDACY FOR THE DEGREE
OF DOCTOR OF PHILOSOPHY
(NEUROSCIENCE)

MENTORS: LI I ZHANG AND HUIZHONG WHIT TAO

May 2016

© Copyright by Young Joo Kim, 2016.
All rights reserved.

Acknowledgements
First of all, I’d like to thank all my Ph.D. guidance committee, especially Dr. Li Zhang and Dr.
Huizhong Tao for all the support and guidance provided. It was a great privilege for me to be
trained under their supervision. I’ve been always positively challenged by their scientific visions
and reasons.
I was fortunate to work alongside with such dedicated lab members who have supported my
projects in many ways. My special thanks go to Dr. Sheng-zhi Wang and Leena A. Ibrahim.
Without them, I wouldn’t have been where I am at today.
I wish to thank my parents and sister for consistent support with love and encouragement. I want
to also acknowledge my dad who had inspired me greatly in science.
Finally, I owe many thanks to my wife, Ji Ye, and my son, Nathan. Without them, my life
doesn’t mean anything!
2

Table of Contents
Acknowledgements ......................................................................................................................... 2
Table of Contents ............................................................................................................................ 3
List of Figures ................................................................................................................................. 6
List of Tables .................................................................................................................................. 8
Abstract ........................................................................................................................................... 9
Chapter 1: Regulation of spiral ganglion innervation of cochlear hair cells by EphA7 ........... 12
1.1 Overview of the SG innervation patterns ....................................................................... 12
1.1.1 Peripheral target of SGNs ....................................................................................... 12
1.1.2 Central target of SGNs ............................................................................................ 14
1.1.3 Axon guidance molecules ....................................................................................... 16
1.2 Generation of gene expression profiles of moues cochlea ............................................. 19
1.2.1 Transgegic mouse lines to genetically label specific cell populations ................... 19
1.2.2 Comparative analysis of differentially expressed genes ......................................... 21
1.3 Role of EphA7 in afferent innervation pattern of mouse cochlea .................................. 24
1.3.1 Background of ephin/eph signaling in developing cochlea ..................................... 24
1.3.2 Screening for functional guidance molecules of SGNs ........................................... 25
1.3.3 Expression of EphA7 in developing mouse cochlea ............................................... 26
1.3.4 Sparser inner radial bundle fibers in EphA7 mutant ............................................... 29
1.3.5 Loss of synaptic connections with IHCs. ................................................................ 34
1.3.6 Reduction in SGN neurite outgrowth in vitro ......................................................... 35
1.3.7 Decreased synpatic transmission at the IHC afferent synapse ................................ 38
1.3.8 Involvement of downstream ERK activity .............................................................. 39
1.4 Discussions ..................................................................................................................... 44
3

1.4.1 Regulation of axonal outgrowth by EphA7 ............................................................ 44
1.4.2 Potential ligands for EphA7 signaling .................................................................... 45
1.4.3 Other potential effects of EphA7 in cochlear development .................................... 47
1.4.4 Signaling of EphA7................................................................................................. 49
1.4.5 Functional relevance of EphA7 signaling ............................................................... 50
1.5 Experiment procedures and Materials ............................................................................ 51
Mouse strains ......................................................................................................................... 51
Tissue dissections, FACS, RNA amplification, and RNA sequencing ................................. 52
Immunohistochemicstry ........................................................................................................ 52
In situ hybridization ............................................................................................................... 53
Cochlea and SGN explant culture ......................................................................................... 53
TMRD labeling ...................................................................................................................... 54
Western blot ........................................................................................................................... 54
Image analysis and quantification ......................................................................................... 55
Auditory brainstem response (ABR) recording ..................................................................... 56
Chapter 2: Role of Dcc for proper organization of SGNs ........................................................ 57
2.1 Introduction to Dcc in developing nervous system and its clinical relevance ............... 57
2.2 Disorganized SGN fiber and positioning in developing auditory circuit ....................... 59
2.2.1 Expression of Dcc in developing mouse cochlea ................................................... 59
2.2.2 Misrouted SGN fiers in Dcc mutant ....................................................................... 61
2.2.3 Reduction in number of ribbon synapses due to misrouted afferent fibers ............ 66
2.2.4 Loss of spatial restrction of SGNs within the Rosenthal’s canal in Dcc mutant .... 69
2.2.5 Inappropriate SGN exit from the Resenthal’s cana towards the CNS .................... 73
2.2.6 Absence of defective auditory innervation phenotype in Ntn1 mutant ................. 76
2.3 Discussions ..................................................................................................................... 77
4

2.3.1 Simultaneous defects in peripheral and central auditory pathways ......................... 77
2.3.2 Spatial distribution pattern of misrtoued fibers ....................................................... 79
2.3.3 Possible ligands of Dcc............................................................................................ 80
2.4 Experimental procedures and Materials ......................................................................... 81
Mouse strains ......................................................................................................................... 81
Tissue dissec, FACS, RNA amplification, and RNA sequencing ......................................... 81
Immunohistochemitry ............................................................................................................ 81
Imaging ................................................................................................................................ 82
In situ hybridizationtion......................................................................................................... 82
Dye labeling ........................................................................................................................... 83
Image analysis and statistics .................................................................................................. 83
Bibliography ................................................................................................................................. 85

5

List of Figures
Figure 1: Summaryperipheral circuit development prior to syanpse formation ........................... 14
Figure 2: The organization of connections from the ear to the brain. ........................................... 15
Figure 3: Conserved families of guidance molecules. .................................................................. 18
Figure 4: Transgenic mouse lines for HC, GER, & SG purification ............................................ 21
Figure 5: Expression pattern of EphA7 in the wild-type cochlea ................................................. 28
Figure 6: Developmental changes of SGN fiber innervation pattern in EphA7 mutant ............... 29
Figure 7: Regulation of number of inner radial bundles by EphA7 ............................................. 32
Figure 8: SG density change in EphA7 mutant ............................................................................ 33
Figure 9: Reduction in number of synaptic contacts on inner hair cells in EphA7 mutant .......... 35
Figure 10: Regulation of SG neurite outgrowth by EphA7.. ........................................................ 37
Figure 11: Reduction of peak I amplitude of the ABR wave form in EphA7 mutant. ................. 39
Figure 12: Involvement of ERK1/2 activity in EphA7 signaling. ................................................ 40
Figure 13: Possible involvement of Prkg1. ................................................................................... 42
Figure 14: Rescued EphA7 defetive phenotypes by Prkg1 activation .......................................... 43
Figure 15: Schematic model summarizing the downstream signaling of EphA7 activation ........ 50
Figure 16: Fold changes in gene expression levels of selected axon guidance cues from the
microarray analysis……………………………………………………………………………... 60
Figure 17: Dcc expression in embryonic mouse cochlea. ............................................................. 61
Figure 18: Disorganized SG fiber in Dcc mutant ......................................................................... 63
Figure 19: Defective peripheral innervation pattern in Dcc mutant. ............................................ 64
Figure 20: Preserved innervation pattern within the sensory epithelium ..................................... 66
Figure 21: Impairment of afferent fiber innervation in developing mouse cochlea. .................... 68
Figure 22: Mispositioned SGNs in the Dcc mutant cochlea. ........................................................ 70
6

Figure 23: Developmental changes of SGN positions in the Dcc mutant .................................... 72
Figure 24: Mispositioning of SGNs along the central auditory pathway in Dcc mutant .............. 74
Figure 25: Disorganized of central auditory nerves towards the cochlear nucleus ...................... 75
Figure 26: Normal peripheral SG organization in Ntn1 mutant cochlea. ..................................... 77

7

List of Tables
Table 1: Validation of the gene expression profile with established cell markers ....................... 22
Table 2: Screening of all clasical axon guidance cues in developing cochlea .............................. 23
Table 3: Comparative analysis to examine differentially expreseed ephrin type-A receptors ..... 26
Table 4: Comparative analysis of axon guidance molecules, specific to SGNs………...……….60

Abstract
Spiral ganglion neurons (SGNs) are the first cells in the auditory pathway that fire action
potentials to process and supply entire auditory inputs to the brain. These bipolar neurons send
their dendrites to innervate the base of hair cells (HCs) in the cochlea, and their axons centrally
to innervate cochlear nucleus (CN). Precise sets of the connections from spiral ganglion (SG) to
their targets are required for normal hearing function and for proper neural processing as the first
tonotopic map along the auditory pathway is established through SGNs. The importance of SG is
further implicated in clinical settings as sensorineural hearing loss makes up the most common
type of hearing loss. Although much of mouse cochlear anatomical features involving SGNs are
well described, molecular and guidance mechanisms underlying the formation of the SG circuit
assembly remain unclear. The current work aims to contribute to the understanding of molecular
factors underlying auditory circuit development by identifying and examining members of
classical axon guidance cues in SGNs during mouse cochlear development.
To identify genes that play crucial roles in cochlear development, we performed RNA-
sequencing to screen for genes that are differentially expressed in sensory epithelial cells in the
organ of Corti (OC) and non-sensory-epithelial cells in the cochlea. Comparative analysis of the
generated gene expression profiles across different cell populations identified various molecules
as potential candidates, responsible for auditory circuit development. The first part of the thesis
focuses on the role of Ephrin type-A receptor 7 (EphA7) in outgrowth of type I afferent fibers of
SG and its downstream signaling pathway. Analysis of EphA7 mutant embryos showed a
reduction in the number of inner radial bundles originating from SGNs as well as in the number
of ribbon synapses on inner hair cells (IHCs), attributable to fewer type I afferent fibers. The
overall activity of the auditory nerve in EphA7 deletion mice was also reduced in high intensity
9

stimuli, mimicking the symptoms of hidden hearing loss. In vitro analysis further suggested that
the reduced innervation of HCs by SGNs could be attributed to a role of EphA7 in regulating
outgrowth of SGN neurites, as knocking down EphA7 in SGNs resulted in diminished SGN
fibers. In addition, suppressing the activity of ERK1/2, a potential downstream target of EphA7
signaling, either with specific inhibitors in cultured explants or by knocking out cGMP-
dependent protein kinase 1 (Prkg1), resulted in reduced SGN fibers while treatment with 8-Br-
cGMP, activator of Prkg1, rescued the EphA7 defective phenotype. These results suggest that
EphA7 plays an important role in the developmental formation of cochlear innervation pattern
through controlling SGN fiber ontogeny. Such regulation may contribute to the salience level of
auditory signals presented to the central auditory system.
The second part of the thesis focuses on the characterization of functional roles of deleted in
colorectal cancer (Dcc) in developing mouse cochlea. Based on the recent studies demonstrating
Dcc as the causal gene for congenital mirror movement and several clinical links between
congenital mirror movement and sensorineural hearing loss, we hypothesized that Dcc may be
responsible for proper hearing function at the level of regulating spiral ganglion development.
Our gene expression profiles showed the specific expression pattern of Dcc transcript, only in the
SG, complementing the hypothesis. Subsequently, we showed that Dcc contributes to the proper
organization of spiral ganglion neurons (SGNs) within the Rosenthal’s canal and of SGN
projections toward both peripheral and central auditory targets in the developing mouse cochlea.
In Dcc deletion embryos, mispositioning of SGNs occurred along the peripheral auditory
pathway with misrouted afferent fibers and reduced synaptic contacts with hair cells. The central
auditory pathway simultaneously exhibited similar defective phenotypes as in the periphery with
abnormal exit of SGNs from the Rosenthal’s canal. Furthermore, the axons of SGNs ascending
10

into the cochlear nucleus had a disrupted bifurcation pattern. On the other hand, mice with
Netrin-1 (Ntn1) deletion did not show any aberrant features in the cochlea. These results
demonstrate that Dcc, likely interacting with ligands other than Ntn1, is necessary for
establishing the proper spatial organization of SGNs and their fibers in the peripheral and central
auditory pathways.
Together these findings demonstrate that EphA7 and Dcc in SGNs regulate the guidance and
organization of SG innervation patterns during cochlear development. This work extends our
understanding of the neurobiology of auditory circuit development, at molecular level, and will
help pave the way for treatment of congenital hearing loss.

11

Chapter 1: Regulation of spiral ganglion innervation of
cochlear hair cells by EphA7
1.1 Overview of the SG innervation patterns
As external mechanical sound stimuli pass through the inner ear, they are converted into
electrochemical information, which is then conveyed to the brain. Sound in the environment
exists as a complex form of energy as they vary in frequency, intensity, and timing. In order to
accurately process and transmit such complex sound information to the brain, mammalian ear
system has evolved to develop a highly specialized inner ear structure. The inner ear is consisted
of two major types of sensory cells, hair cells and spiral ganglion neurons. SGNs are the first
bipolar afferent neurons along the auditory pathway to process sound information by accurately
capturing and encoding the features of each sound stimulus. Precise organization of SGNs that
gives rise to formation of series of inner radial bundles along the length of cochlea based on
frequency tuning in addition to its intrinsic difference in firing properties has been suggested to
be critical for such processing, leading to normal hearing function. Despite of their key role in
detecting and transmitting the sound stimuli, molecular mechanisms underlying how SGNs
establish highly organized circuit structure, which is the basis of acquiring unique properties of
SGNs for proper auditory processing, remain mystery.

1.1.1 Peripheral target of SGNs
During cochlear development, neuroblasts delaminate from the otocyst and adhere to cochlear
epithelium to become SGNs, which are later restrained within the structure called Rosenthal’s
12

canal (Fig. 1) (Matei et al., 2005, Ruben, 1967, Yang et al., 2011). After the last wave of
delaminating neuroblasts from the otocyst, the cochlear duct undergoes convergent extension
movements and the peripheral processes extend towards their targets, hair cells (Kelley, 2006).
Most developing SGNs begin extending their peripheral processes between E14.5 and E15.5. As
the initial fiber growth occurs, they use growth cones to navigate toward proper targets.
Mesenchymal cells are the first cell types that auditory peripheral fibers encounter, which
eventually travel across the greater epithelial ridge (GER) before entering the organ of Corti
through habenula perforate. Previous studies have demonstrated that these regions participate in
organization of the peripheral wiring of the cochlea (Whitlon et al., 1999; Morris et al., 2006).
By E16.5, fibers of SGNs make spatially distinct connections with their peripheral target, hair
cells. Within the sensory epithelium, type I SGNs synapse onto the inner hair cells while type II
SGNs make synaptic contacts with three rows of the outer hair cell (Fig. 2) that are glutamate-
responsive ribbon-type synapses (Coate and Kelley, 2013). In addition, one of hallmark features
of mammalian peripheral auditory circuit is the inner radial bundles. During the development,
the peripherally projecting fibers of SGNs fasciculate to form multiple fiber bundles along the
entire cochlear length, called inner radial bundles. Each inner radial bundle contains multiple
fibers that process similar sound frequencies. Such spatial segregation of SGN fibers based on
different frequencies represents a tonotopy, which is preserved throughout the entire auditory
pathway. There are hints that suggest the proper restricted spatial positioning of SGNs is an
important basis for the formation of precise innervation patterns on HCs, which is manifested by
a tonotopic organization of inner radial bundles originating from SGNs (Yang et al., 2011).
13

Figure 1. Summary of peripheral circuit development prior to synapse formation.
Schematic representation of the developing spiral ganglion. Yellow cells indicate otocyst-derived cells
within the CVG and SGN. Green cells represent cells originating in the neural tube that contribute to both
the SGN and cochlear epithelium. Each numbered event corresponded to the region marked by the
identical number below the schematics. (Adapted from (Coate and Kelley, 2013))

1.1.2 Central target of SGNs
SGNs send its central projection towards the cochlear nucleus, which is the first relay station
along the auditory ascending pathway. The central cochlea circuit development begins earlier
than the periphery around E11.5 in mouse, suggesting that central and peripheral circuit do not
depend on each other as SGNs have not extended their peripheral processes yet at this time
(Appler and Goodrich, 2011). The central fibers are split into two branches upon entering the
cochlear nucleus: one branch innervates the anterior ventral cochlear nucleus (AVCN) and the
other branch innervates the posterior ventral cochlear nucleus (PVCN) and the dorsal cochlear
nucleus (DCN) (Fig. 2). The branches are thought to process different sound properties in
parallel (Winer and Schreiner, 2005). Compare to the periphery, development of the central
14

projection of the cochlear auditory pathway has been less-well defined. The exact time points
when central fibers of SGNs and cochlear nucleus neurons make synaptic connections are not
known. Further, nothing is known about the cues that guide central projections to cochlear
nucleus although some guidance molecules such as Eph receptors have been shown to be
expressed in cochlear nucleus (Siddiqui and Cramer, 2005).
Once the spiral ganglion central fibers enter into cochlear nucleus, they make, specifically type I
SGN fibers, form large synapses called endbulbs of Held with spherical bushy cells in the
AVCN. Endbulbs of Held are about 10 times larger in size than other synapses and have a highly
complex morphology, consisted of multiple branches and synaptic contacts (Ryugo et al., 2006).
This unusual morphology is thought to be essential for preserving the temporal features of sound
stimuli.

15

Figure 2. The organization of connections from the ear to the brain.
(A) Schematic view of a wedge from a flat mounted cochlea (bottom) and its connections with the
cochlear nucleus complex (top). In the cochlea, peripheral projections are corralled in radial bundles that
pass through the spiral lamina to the hair cells (red). Low SR (dark blue) and high SR (light blue) Type I
neurons contact inner hair cells (IHC). Type II neurons (green) are positioned in the ganglia nearest to the
hair cells, and extend a projection past the inner hair cells and turn towards the base, with each projection
contacting multiple outer hair cells (OHC) along its length. Information is conveyed to the cochlear
nucleus by central axons, which bundle together to form the eighth nerve (double arrowhead). Upon
entering the brainstem, individual axons bifurcate. The ascending projections terminate with bouton
endings in the dorsal cochlear nucleus (DCN), while the descending projections target the ventral
cochlear nucleus (VCN), where they form boutons with a variety of postsynaptic target neurons as well as
unusual endbulb of Held synapses with bushy cells (B’). Within each division of the cochlear nucleus,
auditory axons are tonotopically organized, such that high frequency information from the base of the
cochlea is processed dorsally (dotted lines) and low frequency information from the apex is processed
more ventrally (solid lines). In addition, the central projections from neurons with low spontaneous firing
rates project more laterally than those with high spontaneous firing rates. Type II neurons project to the
small cell cap that surrounds the cochlear nucleus complex (dark gray), as do some arbors from low SR
fibers. (Adapted from (Appler et al., 2011))

1.1.3 Axon guidance molecules
By early 1990s, multiple families of conserved axon guidance molecules have been discovered:
netrins, Slits, semaphorins, and ephrins (Fig. 3) (Dickson, 2002). Although they are not the only
known guidance cues, they are by far the best understood ones. Various genetic and biochemistry
assays demonstrated that they control a wide range of guidance decisions in vivo. In the
developing mammalian and bird inner ears, essentially all of these classical axon guidance
molecules have been demonstrated to be present (Coate and Kelley, 2013) with much of the
detailed characterization focused on the ephrin signaling due to many of its family members
being expressed in developing cochlea. However, considering complex signaling network among
ephrin family and overlapping expression patterns in the cochlea, current knowledge is at the
starting point of understanding detailed mechanisms of ephrin signaling in SGN development. In
addition, there are various cell adhesion molecules (CAM) and morphogens such as Wnt, FGF,
16

Hedgehog, and TGFβ families expressed in cochlea, which have been shown to participate in
axon guidance regulation (Gorves and Fekete, 2012; Kelley, 2003; Simonneau et al., 2003).
Netrins were initially discovered in Caenorhabditis elegans (Hedgecock et al., 1990) as a
chemoattractant of vertebrate commissural axons, which further led to the identification
interacting receptors, unc-40 and unc-5, with UNC-40 belonging to the deleted in colorectal
carcinoma (Dcc) family (Culotti and Merz, 1998). Netrins are multifunctional as they have been
shown to be responsible for guiding many different axons in vivo and for encouraging cell
growth activities (Winberg et al., 1998; Yee et al., 1999). Slits are large secreted proteins in
which the signaling activation is mediated through Roundabout (Robo) family receptors. The
best characterized role of Slit/Robo signaling is in midline guidance in Drosophila and in the
formation of the optic chiasm in vertebrates (Kidd et al., 1998; Battye et al., 1999; Niclou et al.,
2000). Another conserved family among the classical axon guidance molecules is semaphorins.
Semaphorins are large family of cell surface and secreted guidance molecules that are divided
into eight classes based on their structures. They functionally interact with multiple different
receptors such as plexinA, neurophilins, neural cell adhesion molecule L, the receptor tyrpsine
kinase Met, and the catalytically inactive receptor tyrosine kinase OTK (Dickson, 2002).
Previous studies indicate the semaphorins enforce inhibitory effects on surrounding local regions
to deflect axons away from undesired regions (Raper, 2000). Ephrins and their membrane-bound
ligands, Eph family of receptor tyrosine kinases, were first identified in vertebrate retinal axons,
responsible for the formation of topographic mapping. Ephrin signaling mainly affects the
dynamics of cellular movements through regulation of cytoskeletal organization and cell
adhesion (Pasquale, 2005).
17

Although detailed molecular and cellular mechanisms underlying wiring of the cochlea is not
known, it is likely that developmental processes of the auditory peripheral circuit are mediated
by the same classical axon guidance cues that establish neural connections in the rest of the
nervous system. However, it remains to be determined how these multiple factors are being
integrated together to control coordinated developmental process of the mammalian auditory
circuits as only a handful of known guidance mechanisms have emerged. Thus, in our study, we
focus on characterizing specific guidance cues that will eventually help to enrich our
understanding of the auditory neural circuit development.

Figure 3. Conserved families of guidance molecules.
The ligands (A) and their receptors (B). Domain names are from SMART (http://smart.embl-
heidelberg.de). P1 to P3, DB (DCC-binding), CC0 to CC3, and SP1and SP2 indicate conserved regions in
the cytoplasmic domains of DCC, UNC-5, Robo, and Plexinreceptors, respectively. (Adapted from
(Dickson, 2002))
18

1.2 Generation of gene expression profiles of mouse cochlea
Extensive efforts have been made in the past decades to identify genes underlying the functional
development of cochlear auditory circuit. However, the current understanding is mostly
contributed by genetic analysis of existing hereditary human deafness or mouse deafness models
(Hilgert et al., 2009; Brown et al., 2008), which is unlikely to reveal all the essential genes.
Given that the functional development occurs shortly after the differentiation of hair cells and
supporting cells from the same precursors in the cochlea (Kelley, 2006), a comparison of gene
expression profiles between different groups of cells using RNA-sequencing may provide a
genome wide screening for candidate genes that are only unique in functional development of
collected distinct cell populations. Although gene expression profile studies have been carried
out on the whole cochlea or the organ of Corti (Chen and Corey, 2002; Gong et al., 2006; Sajan
et al., 2007; Hertzano et al., 2004), it remains a challenge to apply the technique to purified
distinct cell types within cochlear, in particular, the hair cells. This is due to the tremendous
efforts required for micro-dissection of the tissue and for collection of large enough numbers of
identified hair cells to obtain high quality RNA samples. In this study, we genetically labeled
specific cell types of mouse cochlea at proper developmental stages and collected substantial
numbers of hair cells, supporting cells, and SGNs with fluorescence activated cell sorting
(FACS). Differential gene expression profiling of these two specific cell types with RNA-
sequencing led to identification of candidate genes that are unique during functional
development of cochlear auditory circuit.
1.2.1 Transgenic mouse lines to genetically label specific cell populations
To identify genes that might play a role in cochlear development, we performed RNA-
sequencing to screen for genes that are differentially expressed in sensory epithelial cells in the
19

organ of Corti (OC) and non-sensory-epithelial cells. Non-sensory-epithelial cells we sampled
included cells in the GER and SG, while sensory epithelial cells consisted of both inner and outer
hair cells (IHC and OHC respectively). We took advantage of available transgenic mouse lines
where different cell types were labelled genetically. As we previously reported (Wang et al.,
2013), in the Parvalbumin (PV)-Cre line, Cre activity in the cochlea was limited to HCs and
SGNs, as shown by the green fluorescence pattern in the PV-Cre mouse crossed with a Cre-
dependent reporter line, Ai6 (zsGreen) (Fig. 4A,B). The fluorescence labelled HC layers and SG
were surgically separated. In the Gad1-GFP line, green fluorescence was specifically observed in
cells in the GER region (Fig. 4C,D). From dissociated cell samples at ages between postnatal
day 3 (P3) and P7, we purified HCs, SGNs and GER cells through fluorescence-activated cell
sorting (FACS) as described previously (Fig. 4E) (Wang et al., 2013). RNA sequencing analysis
was then performed.
20

PV-Cre; ZsGreen1 Gad1-EGFP
Before sorting After sorting
A
B
C
D
E

Figure 4. Transgenic mouse lines for HC, GER, & SG purification.
(A) Image of a PV-Cre::Ai6 mouse cochlea at P4. OC, organ of Corti; SG, spiral ganglion. (B) Higher-
magnification image of cochlea in (A) showing HCs in the OC. OHC, outer hair cell; IHC, inner hair
cell.(C) Image of a Gad1-EGFP mouse cochlea at P4. GER, greater epithelial ridge. (D) Merged
differential interference contrast (DIC) and fluorescence image of the same cochlea. (E) Representative
images of cells from positive population before & after sorting. All scale bars: 30 μm.

1.2.2 Comparative analysis of differentially expressed genes
We compared the gene expression levels across different cell populations within the cochlea and
found that various established cell markers for HCs and GER cells were highly enriched in the
correspondingly designated samples (Table 1), verifying the purity of the isolated cell groups.
21

Parvalbumin (“Pvalb”) and Gad1, the restricted expressions of which formed the basis for our
cell sorting, were also confirmed to be highly enriched in the expected cell samples (Table 1).
Upon validating the generated gene expression profile, we screened for all of families of
classical axon guidance molecules to identify potential key candidates involved in regulation of
coordinated developmental processes of cochlear auditory circuitry (Table 2). Comparative
analysis of the guidance cues demonstrated the presence of previously unreported guidance
molecules as well as the molecules with the known patterns of expression in the corresponding
regions (Table 2). As our previous reported expression pattern of Slit2 in GER region, it was also
shown to be highly enriched in GER population from the gene expression profile data (Wang et
al., 2013). Further, expression levels of Nrp2 and Efna5 in SGNs and HCs complemented their
previously established expression patterns (Defourney et al., 2013; Coate et al., 2015).
Gene
name
Cell type (FRKM)
GER HC SG
Hair cell specific genes
Myo6 34.17 503.17 11.85
Chrna10 10.26 372.84 0.37
Pvalb 15.79 311.32 56.53
Tmc1 3.14 179.15 0.25
Gfi1 4.01 176.90 0.00
Otof 3.67 106.74 0.19
Atoh1 2.32 58.35 0.18
Pcdh15 8.72 30.09 0.72
Barhl1 0.61 22.34 0.20
Slc26a5 0.00 7.21 0.00
Espn 0.57 3.53 0.00
GER specific
genes
Crabp1 292.08 1.59 4.85
Crabp2 204.63 3.08 28.26
Jag1 118.86 6.82 7.40
Cdh4 37.51 5.76 1.33
Gad1 36.17 0.71 0.00

Table 1. Validation of the gene expression profile with established cell markers.
A list of selected known HC- and GER-specific genes and their expression levels in GER, HC and SG
cell samples. Numerical values are in Fragments Per Kilobase of exon per Million (FRKM). The full
names of the genes are (from top to bottom): Myo6: myosin VI; Chrna10: cholinergic receptor, nicotinic,
alpha polypeptide 10; Pvalb: parvalbumin; Tmc1: transmembrane channel-like gene family 1; Gfi1:
growth factor independent 1; Otof: otoferlin; Atoh1: atonal homolog 1 (Drosophila); Pcdh15:
protocadherin 15; Barhl1: BarH-like 1 (Drosophila); Slc26a5: solute carrier family 26, member 5; Espn:
22

espin; Crabp1: cellular retinoic acid binding protein I; Crabp2: cellular retinoic acid binding protein II;
Jag1: jagged 1; Cdh4: cadherin 4; Gad1: glutamate decarboxylase 1.
Guidance Molecules Receptors
Gene
Name
Cell Types Gene
Name
Cell Types
SC HC SGN SC HC SGN
Ntn1 0.291987 0.287536 0.313077 Dcc 0 0 1.27416
Ntn3 0.003005 0 0.00449 Neo1 15.752 5.78751 21.8909
Ntn4 0 0 0 Unc5a 0.171611 0.945418 0
Ntn5 0 0 0 Unc5b 1.69626 3.07132 1.51094
Ntng1 4.92166 1.34048 18.3732 Unc5c 5.83176 0.11426 4.60669
Ntng2 0 0 0 Unc5cl 0 1.10823 0.512023
Slit1 0 0 2.13429 Unc5d 1.01709 0.108628 4.90621
Slit2 23.5068 0.29686 6.81978 Robo1 16.9609 4.86413 5.39499
Slit3 1.23503 0.153293 1.33909 Robo2 23.5354 11.6351 2.0519
Efna1 19.7586 4.56922 11.2321 Robo3 0 0 0
Efna2 1.40287 0.88688 3.973 Robo4 0 0 5.48805
Efna3 0.956779 0 0 Epha1 5.30795 3.16009 0.649002
Efna4 10.7291 1.86627 9.02716 Epha2 0.083158 0 0.846352
Efna5 2.53626 34.7123 22.7668 Epha3 0 0.75091 0.46239
Efnb1 1.27314 0 4.87075 Epha4 18.4469 37.0778 26.3534
Efnb2 36.7231 18.0239 33.9682 Epha5 0.074131 0.343676 2.17597
Efnb3 5.76249 1.82149 13.8246 Epha6 0 0 0.06812
Sema3a 16.6265 6.10089 7.14609 Epha7 172.875 5.87868 12.488
Sema3b 6.72012 0.826158 17.4055 Epha8 0 0 0.188284
Sema3c 14.3912 1.07593 10.8667 Epha10 0 0 0
Sema3d 15.7132 0.238447 10.1495 Ephb1 6.91325 3.8911 3.00102
Sema3e 0.313725 2.3356 27.3714 Ephb2 2.53103 0.731591 3.45582
Sema3f 0.672963 0.091166 0.238233 Ephb3 2.18359 2.27847 2.46585
Sema3g 0 0 0 Ephb4 1.2616 0.318164 1.78494
Sema4a 0.391461 0 0.94313 Ephb6 1.78292 0.656599 2.25204
Sema4b 2.38712 0.413705 0.473522 Plxna1 2.8087 3.36966 2.64267
Sema4c 1.23898 1.81503 1.17214 Plxna2 2.63166 4.87033 2.03184
Sema4d 1.38416 1.18624 0.70749 Plxna3 2.84983 0.868645 3.7259
Sema4f 7.9325 1.13515 1.87143 Plxna4 1.88387 0.651583 0.870651
Sema4g 1.95086 0.635703 3.51307 Plxnb1 6.63703 3.58485 4.18291
Sema5a 1.20719 0.254363 15.7109 Plxnb2 11.8443 4.05841 9.5753
Sema5b 2.23085 31.0786 3.46451 Plxnb3 0.363518 0.390343 3.64299
Sema6a 9.57572 3.83104 6.93643 Plxnc1 4.94658 0.27669 1.49693
Sema6b 0.302393 1.10583 0.244681 Plxnd1 0 0 0.609175
Sema6c 0 0.153224 0 Nrp1 8.11035 0.551931 45.2042
Sema6d 11.0265 1.08001 15.8813 Nrp2 3.8243 15.2802 18.4682
Sema7a 0.139595 0.501136 2.21496

23

Table 2. Screening of all classical axon guidance cues in developing cochlea.
A list of expression levels of classical axon guidance molecules and its receptors in GER, HC and SG cell
samples. Numerical values are in Fragments Per Kilobase of exon per Million (FRKM).

1.3 Role of EphA7 in afferent innervation pattern of mouse
cochlea

In this study, we focused on Eph/ephrin signaling pathways, as they have previously been shown
to affect the formation of neural circuitry in the auditory pathway (Coate et al., 2012; Defourny
et al., 2013; Ilona et al., 2007).
EphA7 knockout resulted in a significant reduction in the number of inner radial bundles of
SGNs projecting to hair cells (HCs) and in the number of ribbon synapses on inner hair cells
(IHCs). Functionally, the auditory brainstem response (ABR) in the EphA7 deletion mouse was
also reduced. In vitro assay further revealed that the reduced innervation of HCs by SGNs can
be attributed to a role of EphA7 in promoting neurite outgrowth. In addition, suppression of
Erk1/2 activity, a potential downstream target of EphA7 signaling, either with specific inhibitor
or knocking out Prkg1, also resulted in reduced afferent projections from SGNs. These results
suggest that by controlling the outgrowth of SGN fibers, EphA7 can regulate the cochlear
innervation pattern. This contributes to the salience level of auditory signals presented to the
central auditory system.

1.31 Background of ephrin/eph signaling in developing cochlea
Ephrins and Eph receptors play a variety of roles during the establishment of neural circuitry.
Their varied expressions in a spatially organized manner during development provide specific
24

Eph/ephrin interactions for regulating cell migration, neurite outgrowth, axon guidance,
synaptogenesis, and many more (Pasquale, 2005). Various studies have shown that ephrins and
Eph receptors are expressed in the developing mouse inner ear (Bianchi and Liu, 1999; Bianchi
and Gale, 1998; Pickles et al., 2002; Pickles, 2003; Saeger et al., 2011; Zhou et al., 2011) and
that they are involved in the proper assembly of auditory neural circuits at nearly every stage of
the auditory pathway from peripheral projections to the auditory cortex (for review, see Cramer
and Gabriele, 2014).
Recent studies have shed some light on ephrin signaling mechanisms for regulating peripherally
projecting axons of SGNs that innervate HCs. Eph receptor A4 (EphA4) has been found to be
important for the proper fasciculation of SGN axons, and for their proper pathfinding to
innervate HCs (Coate et al., 2012; Defourny et al., 2013). EphB1-3 are shown to regulate the
growth of SGN axons (Bianchi and Gray, 2002; Zhou et al., 2011). Interestingly, the defect
caused by each specific Eph receptor mutation is relatively subtle. Given the fact that there are
eight EphA and five EphB receptor variants, this raises a possibility that Eph receptors may act
synergistically to control coordinated development of cochlear innervation pattern. Indeed,
previous in situ hybridization studies have shown expression of several Eph members other than
EphA4 and EphB1-3 in the developing mouse inner ear (Bianchi and Gale, 1998; Bianchi and
Liu, 1999; Pickles, 2003).

1.3.2 Screening for functional guidance molecules of SGNs
Based on the RNA-sequencing data, we screen for ephrin type A receptors family as ephrin
signaling have been shown to be playing an important role during development of peripheral
25

auditory circuit. From the expression pattern of ephrin type A receptors, EphA7 and EphA4
stood out as top candidate factors for regulating SGN development (Table 3). Since EphA4
signaling has been shown to be involved in fasciculation of radial fibers and targeting of type I
fibers to the IHC layer (Coate et al., 2012; Defourny et al., 2013), we hypothesized that EphA7
might act as an additional factor for regulating the development of HC innervation pattern.
Gene
name
Cell type (FRKM)
GER HC SG
EphA1 5.31 3.16 0.65
EphA2 0.08 0.00 0.85
EphA3 0.00 0.75 0.46
EphA4 18.45 37.08 26.35
EphA5 0.07 0.34 2.18
EphA6 0.00 0.00 0.07
EphA7 172.88 5.88 12.49
EphA8 0.00 0.00 0.19
EphA10 0.00 0.00 0.00

Table 3. Comparative analysis to examine differentially expressed ephrin type-A receptors.
A list of differentially expressed ephrin type-A receptor genes and their expression levels.

1.3.3 Expression of EphA7 in developing mouse cochlea
To verify the expression of EphA7 gene in the mouse cochlea, we performed in situ
hybridization in the whole-mount cochlea (Fig. 5A,B) and cochlear cross-sections (Fig. 5C-E).
At P3, relatively strong EphA7 signals were found in the SG and GER regions (Fig. 5A-E).
Within the SG, there were patches of cells that appeared to lack or have very weak EphA7
expression (Fig. 5B,D), suggesting that not all SGNs expressed EphA7. The cross-sectional view
26

also revealed a strong expression of EphA7 transcripts in the OC and the lesser epithelial ridge
(LER) (Fig. 5E). Immunostaining of the cochlea at the same age with an anti-EphA7 antibody
showed an expression pattern of EphA7 proteins similar to EphA7 transcripts: EphA7 proteins
were strongly expressed in the SG, GER and OC regions (Fig. 5H-K).Weaker signals were also
observed in the otic mesenchyme (OM), indicating that EphA7 proteins were also expressed in at
least some mesenchymal cells (Fig. 5H-K). The overall expression pattern of EphA7 transcripts
at E14.5 was largely consistent with that at P3: the expression was strong in the SG and GER
regions, and was also observed in the OC (Fig. 5F-G). Finally, high magnification images of
immunostaining confirmed that some SGNs lacked expression of EphA7 (Fig. 5L-N). Together,
our data suggest that EphA7 is not only differentially expressed in the population of SGNs, but
also is expressed in many other cell populations in the surrounding regions such as the OM, GER
and OC. These in situ and immunostaining data are largely in agreement with our RNA-
sequencing data at postnatal stages and with a previous study of EphA7 expression in the mouse
cochlea (see Shared Harvard Inner-Ear Laboratory Database, http://shield.hms.harvard.edu/).
27

GER
OC
SG
SL
GER
OC
SG
OM
K
H
EphA7
I
Tuj1
J
SG
GER
OC
SL
SL
OM
SG
GER
OC
LER
SL
SG
OM SG
SG
SG
A B
C D
E
F G
P3 P3 P3
P3
E14.5 E14.5
PV EphA7
L M N
E14.5
SG
GER

Figure 5. Expression pattern of EphA7 in the wild-type cochlea.
(A) In situ hybridization of EphA7 in a whole-mount cochlea at P3. SL, spiral limbus. (B) Higher-
magnification image of the cochlea in (A). Different regions are labeled. (C)In situ hybridization of
EphA7 in a cross-sectioned P3 cochlea. (D) Higher-magnification image of the SG region from (C). OM,
otic mesenchyme. (E) Higher-magnification image of the sensory epithelial region from (C). LER, lesser
epithelial ridge. (F) In situ hybridization of EphA7 in a whole-mount cochlea at E14.5. (G) Higher-
magnification image of (F). Note that the SL is nearly absent at this embryonic stage. (H-J) Fluorescence
images of a cross-sectioned P3 cochlea, immunostained with anti-EphA7 (green) and anti-Tuj1 (red)
antibodies. (K) Merged fluorescence (H&I) and DIC image. (L-N) High magnification images of
immunostaining of SGNs with anti-EphA7 (green) and anti-PV (red) and the merged image. White
arrows in (N) mark SGNs negative for EphA7 proteins. Scale bar: 100 μm in (C), 30 μm in all other
panels.
28

EphA7
-/-
EphA7
+/-
Tuj1 E18.5
E16.5
E16.5
E16.5
WT
apex
mid
base
A
I
M
B C
F L
G J
H K N
EphA7
-/-
EphA7
+/-
P8
P4
P1
E18.5
D E
R
S
T
O
P
Q

Figure 6. Developmental changes of SGN fiber innervation pattern in EphA7 mutant.
Developmental changes of SGN fiber innervation pattern in EphA7 mutant cochleae. (A-C) Images of
representative whole-mount cochleae from E18.5 wild-type, EphA7+/−, and EphA7−/− mice,
immunostained with anti-Tuj1. (D-E) Higher-magnification images of the mid-base part of the
EphA7+/− and EphA7−/− cochleae shown in (B-C). (F-N) Higher-magnification images of the apex, mid
and base part of representative cochleae from E16.5 wild-type, EphA7+/−, and EphA7−/− mice,
respectively. (O-T) Higher-magnification images of the mid-base part of EphA7+/− and EphA7−/−
cochleae at P1, P4 and P8, respectively. All scale bars: 30 μm.

1.3.4 Sparser inner radial bundle fibers in EphA7 mutant
Since EphA7 has previously been shown to promote neurite outgrowth and growth cone
spreading in chick spinal motor neurons (Marquardt et al., 2005), we hypothesized that SGNs
29

might require EphA7 for the proper growth and maintenance of their axons. To test this
possibility, we examined the HC innervation pattern of SGN fibers in the whole-mount cochlea,
by immunostaining with an anti-Tuj1 antibody. At E18.5, SGN fibers appeared densely packed
and formed well-organized inner radial bundles along the length of the cochlea in both the wild-
type and EphA7 mutant animals (Fig. 6A-C). Higher-magnification images however revealed
that inner radial bundles were noticeably sparser in EphA7 homozygous than heterozygous
mutants (Fig. 6D-E) and wild-type animals (images not shown). We then examined SGN fibers
at different time points during development. At E16.5, inner radial bundles in the EphA7−/−
cochlea already appeared sparser as compared with heterozygous and wild-type animals,
especially in the base and mid part of the cochlea (Fig. 6F-N).Such differences were observed
throughout the developmental periods as late as P8 (Fig. 6O-T), when all HCs are innervated by
SGN fibers and become synaptically matured (Lu et al., 2011).
To quantify the sparseness of inner radial bundles, we measured the total area of space between
the SG and sensory epithelium that was not occupied by SGN fibers. As shown by the black-
and-white binary images (Fig. 7A,B), the unoccupied/vacant space was evidently larger in
EphA7 homozygous than heterozygous mutants. The quantification confirmed that inner radial
bundles in EphA7−/− mutants consumed less space compared with wild-type and heterozygous
animals, and these differences were evident throughout the developmental periods from E16.5 to
P8 (Fig. 7C). Wild-type and EphA7+/− animals did not have significant differences from each
other (Fig. 7C).
The increase in the vacant space in EphA7−/− mutants could not be simply attributed to a
fasciculation effect as there was no significant difference in average radial bundle thickness
between genotypes (mean bundle width: 26.1 ± 0.95 µm for homozygous and 25.3 ± 0.83 µm for
30

heterozygous at E16-E18, p = 0.55, t test; see Methods). Neither could the increase be attributed
to a difference in cochlear size (see Fig. 6A-C). On the other hand, the number of inner radial
bundles was significantly reduced throughout the developmental periods when EphA7 was
absent (Fig. 7F,G,I). In addition, the average number of small fascicles in the inner spiral plexus
(ISP, medial to the IHC layer) per inner radial bundle (trunk) was significantly reduced in
EphA7−/− mutants after birth (Fig. 7D,E,H), indicating that the total number of small fascicles
of SGN fiber entering the OC was reduced across the developmental stages examined. Together,
our data suggest that the loss of EphA7 causes a reduced number of SGN fibers.
31

A B
EphA7
+/-
EphA7
-/-
**
***
E16 E18 P1 P4 P8
0
2
4
6
8
10
No. inner radial bundle
(trunk) / 315 μm
2
EphA7
+/-
EphA7
-/-
***
***
***
EphA7
-/-
EphA7
+/-
E16 E18 P1 P4 P8
0
2
4
6
8
No. fascicles in ISP /
inner radial bundle
**
***
***
H I
EphA7
+/-
EphA7
-/-
E16 E18 P1 P4 P8
0
10
20
30
% area unoccupied by
inner radial bundles
EphA7-/-
EphA7+/-
WT
***
n.s.
**
n.s.
n.s.
**
n.s.
n.s.
**
**
A B
C
Tuj1
D E
F G
ISP

32

Figure 7. Regulation of number of inner radial bundles by EphA7.
(A-B) Example binary images for Tuj1-stained SGN fibers (black) in E16.5 EphA7+/− and EphA7−/−
whole-mount cochleae. Scale bar: 30 μm. (C) Percentage area of space unoccupied by inner radial
bundles at different stages. Data are shown as mean ± SEM. *p < 0.05; **p < 0.01; ***p < 0.001, one-
way ANOVA and post hoc test. N = 10 cochleae for all genotype groups. (D-E) Images of Tuj1 stained
whole-mount cochleae from EphA7+/− and EphA7−/− mice, focused on the inner spiral plexus (ISP)area
for counting small fascicles entering the OC.(F-G) Tuj1 stained whole-mount cochleae from EphA7+/−
and EphA7−/− mice, focused on inner radial bundles. Scale bar: 30 μm.(H) Average number of small
fascicles per inner radial bundle (trunk). (I) Average number of inner radial bundles (trunks) for every
315 μm
2
image area. Data are shown as mean ± SEM. **p < 0.01; ***p < 0.001, t-test. N = 10 cochleae
for all genotype groups.

Previously it has been shown that EphA7 regulates apoptosis of forebrain neural progenitors
(Depaepe et al., 2005). The apparent reduction in the number of radial bundles led us to suspect
that EphA7 deletion might cause a loss of SGNs. To test this possibility, we counted SGNs,
immunostained with anti-Tuj1 and DAPI (Fig. 8A,B). We did not however find a difference in
the total number of SGNs between EphA7−/− and EphA7+/− littermates (Fig. 8C), indicating
that the observed reduction of HC-innervating fibers was not due to reduced SGN cell number.

C
EphA7
+/-
EphA7
-/-
0
10
20
No. SGN cell bodies
/ 100 μm
2
EphA7
+/-
EphA7
-/-
Tuj1/DAPI
A B

Figure 8. SG density change in EphA7 mutant.
(A-B) Representative cross-sectional images of cochleae from EphA7+/− and EphA7−/− mice at P8,
immunostained with anti-Tuj (green) and DAPI (blue). Scale bar: 100 μm. (C) Average number of SGN
cell bodies per 100 μm
2
area. Data are shown as mean ± SEM. N = 3 cochleae for all genotype groups.

33

1.3.5 Loss of synaptic connections with IHCs
We next examined whether the reduction in fiber density led to a change in synapse number on
HCs. Using an anti-RIBEYE/Ctbp2 antibody, we quantified the mean number of ribbon synapses
on individual IHCs and OHCs (Fig. 9A-D). For OHCs, cross-sectioned tissues were used for
better resolving synaptic puncta at the base of OHCs (Fig. 9C,D). In P8 tissues, we found fewer
synaptic puncta on IHCs in EphA7−/− than EphA7+/− mutants, whereas no significant
difference in synapse number was observed for OHCs (Fig. 9E).
SGNs are subdivided into two classes: type I (90% of the entire SGN population), whose fibers
form synapses on IHCs, and type II (the remaining 10% of the SGN population), whose fibers
grow past the IHC layer, and then turn before forming synapses on OHCs (Huang et al., 2007;
Koundakjian et al., 2007). The reduction of synapse number on IHCs implied that the number of
type I afferent fibers might be specifically reduced by deletion of EphA7. To confirm this
notion, we specifically labelled type I fibers with tetramethylrhodamine-conjugated dextran
(TMRD) (Huang et al., 2007). Consistent with the result on labelling of all types of fiber, we
found a clear reduction of type I fiber innervation in EphA7−/− mutants, as evidenced by a lower
number of small fascicles in the ISP compared with EphA7+/− littermates (Fig. 9F-H). It is
worth noting that the TMRD labelling in the OHC layers at this stage (P4) is consistent with
previous results showing transient innervation of the OHC layers by type I fibers during early
development before they are completely withdrawn from the OHC layers at P6 (Perkins and
Morest, 1975; Huang et al., 2007). The combined anatomical evidence indicates that the loss of
EphA7 leads to a reduction in the number of type I SGN fibers, resulting in diminished synapse
numbers specifically on IHCs.
34

H
EphA7
+/-
EphA7
-/-
0
4
8
No. fascicles in ISP /
inner radial bundle
**
EphA7
+/-
F
EphA7
-/-
G
TMRD
EphA7
+/-
EphA7
-/-
IHC OHC
CtBP2
CtBP2
A B
C D
E
IHC OHC
0
4
8
12
No. ribbon synapses / HC
**
EphA7
+/-
EphA7
-/-
ISP
Figure 9. Reduction in number of synaptic contacts on inner hair cells in EphA7 mutant.
(A-B) Representative images of whole-mount cochleae from EphA7+/− and EphA7−/− mice at P8,
magnified to show the IHC layer, immunostained with anti-CtBP2. Scale bar: 10 μm. (C-D)
Representative images of the cross-sectional view of cochleae from EphA7+/− and EphA7−/− mice at P8,
magnified to show the OHC layer, immunostained with anti-CtBP2. Green arrow marks the base of an
OHC where ribbon synapses are formed. Scale bar: 10 μm. (E) Average number of ribbon synapses per
HC. Data are shown as mean ± SEM. **p < 0.01, t test. N = 8 cochleae for all genotype groups. (F-G)
Representative images of whole-mount cochleae from EphA7+/− and EphA7−/− mice at P4, labelled with
TMRD. Scale bar: 30 μm. (H)Average of number of small fascicles per inner radial bundle. Data are
shown as mean ± SEM. **p < 0.01, t test. N = 8 cochleae for each group.

1.3.6 Reduction in SGN neurite outgrowth in vitro
Previous studies have implicated Eph/ephrin signalling in regulating the branching and growth
dynamics of neuronal processes (Benson et al., 2005; Brownlee et al., 2000; Gao et al., 2000;
Wang et al., 1997; Zhou et al., 2001). The in vivo result of less dense SGN fibers suggests that
35

EphA7 may be involved in regulating the outgrowth of SGN neurites. To test this possibility, we
cultured isolated SG explants from E16.5 EphA7−/− and heterozygous littermates in Matrigel for
4 days (Fig. 10A,B). While there was no difference in tissue size between EphA7−/− and
EphA7+/− explants (explant diameter: 177 ± 30 μm and 168 ± 20 μm respectively, p > 0.05, t
test), the homozygous explants extended fewer neurites compared with the heterozygous
explants (Fig. 10C). The mean neurite length was also shorter in homozygous than heterozygous
explants (Fig. 10D). These results suggest that the development of SGN fibers is altered in a cell-
type autonomous (i.e. interactions occur between cells of the same type) manner when the
endogenous EphA7signalling is interrupted.
To further confirm the role of EphA7 in regulating the number of SGN neurites, we applied
another loss-of-function approach by RNA interference. We identified a target-specific siRNA
against EphA7, which effect of reducing EphA7 translation was validated by western blot (Fig.
10I). We electroporated the EphA7 siRNA or a control scrambled siRNA into wild-type SG
explants (see Methods). After 4 days in culture, we found that EphA7 knockdown impeded
neurite outgrowth from SGN somata, as evidenced by the greatly reduced number of neurites as
compared with the control siRNA (Fig. 10E-H). It is noticeable that the procedure of siRNA
electroporation per se had some effect on neurite growth, so that there was a general reduction of
neurite number (compare heterozygous control in Fig. 10C with control siRNA in Fig. 10G, or
homozygous mutant in Fig. 10C with EphA7 siRNA in Fig. 10G). The relative reduction of
neurite number is 38% in the case of EphA7 knockout (Fig 10C), while 25% in the case of
EphA7 knockdown (Fig 10G). Therefore, although any off-target effects could not be excluded,
the EphA7 siRNA essentially produced a similar effect as the EphA7 knockout. For the few
neurites that had projected from SGN somata, their lengths were significantly reduced compared
36

with tissue treated with the control siRNA (Fig. 10H). This difference could not be explained by
differential cell death since there was no significant difference in explant size after
electroporation and culturing between EphA7 siRNA and control siRNA groups (diameter: 253.3
± 50.9 µm and 251.3 ± 61.7 µm, respectively, p = 0.97, t test). Furthermore, we treated SG
explants with an unclustered, soluble form of EphA7-Fc, which can act as a blocker of
endogenous EphA7signalling, since it competes with endogenous EphA7 receptors for ligands
(Davis et al., 1994). Compared with control IgG-Fc, the unclustered EphA7-Fc applied
exogenously reduced the number of neurites extended from SGN somata (Fig. 10J). Together,
these in vitro results further demonstrate that the absence of EphA7 signalling leads to a reduced
number of SGN neurites. In addition, the results suggest that the natural ligands for EphA7
receptors may be expressed by SGNs themselves.
37

0 100 200 300
0
0.5
1.0
Cumulative Probability
Neurite length ( μm)
Cont.
siRNA
EphA7
siRNA
0
5
10
15
No. neurites
**
Cont. EphA7
0
100
Neurite
length ( μm)
0 100 200 300
0
0.5
1.0
Cumulative Probability
Neurite length ( μm)
0
100
Neurite
length ( μm)
EphA7
+/-
EphA7
-/-
0
10
20
30
No. neurites
Cont.
IgG
Unclustered
EphA7
0
20
40
No. neurites
EphA7 siRNA Control siRNA
EphA7
+/-
EphA7
-/-
A
B
E
F G H
C D
EphA7
siRNA
Control
siRNA
EphA7
Tubulin
J
*
**
***
Tuj1
I
***
EphA7
+/-
EphA7
-/-
+/- -/-
siRNA
Cont.
EphA7
Tuj1

Figure 10. Regulation of SG neurite outgrowth by EphA7.
(A-B) Representative images of E16.5 SG explants from EphA7+/− and EphA7−/− mice grown in vitro
for 4 days, immunostained with anti-Tuj1. Scale bar: 100 μm. (C) Average number of outgrown neurites
per explants quantified forEphA7+/− and EphA7−/− SGs. Data are shown as mean (small box) ± SD
(larger box, with the line indicating the median value). *p < 0.05, Wilcoxon rank-sum test. N = 7
explants for each genotype group. (D) Cumulative probability curve for lengths of extended neurites for
explants in (C). Inset, mean neurite length quantified for EphA7+/− (n = 181) and EphA7−/− (n = 134)
SG explants. Error bar = SEM. **p < 0.01, Wilcoxon rank-sum test. (E) Western blot of SG explants
cultured for 4 days after electroporation of control siRNA or EphA7 siRNA. Anti-tubulin, loading
control.(F-G) Images of E16.5 wild-type SG explants grown for 4 days in vitro after electroporation of
control siRNA or EphA7 siRNA, immunostained with anti-Tuj1. Scale bar: 100 μm. (H) Average number
of neurites quantified for SG explants treated with control siRNA (n = 8 explants) or EphA7 siRNA (n =
8). **p < 0.01, Wilcoxon rank-sum test. (I) Cumulative probability curve for lengths of extended neurites
for explants in (H). Inset, mean neurite length quantified for control siRNA (n = 101) and EphA7 siRNA
(n = 74) treated SG explants. Error bar = SEM. ***p < 0.001, Wilcoxon rank-sum test. (J) Average
number of neurites quantified for SG explants treated with either control IgG (n = 8 explants) or
unclustered EphA7-Fc (n = 8). ***p < 0.001, Wilcoxon rank-sum test.

38

1.3.7 Decreased synaptic transmission at the IHC afferent synapse
To examine the effect of reduced synaptic contacts on IHCs at a functional level, we measured
the auditory brainstem response (ABR) evoked by short tone bursts. Although there was no
significant difference in hearing thresholds between genotypes (EphA7+/−: 25 ± 2 dBSPL;
EphA7−/−: 37 ± 4 dBSPL, p > 0.05, t test) (Fig. 11A), analysis of the first peak of the ABR
waveform (i.e. peak I), which reflects the summed activity of SGNs (Melcher et al., 1996),
showed a decrease in its amplitude in EphA7−/− mutants as compared with heterozygous
littermates (Fig. 11B). The decrease in peak I amplitude was significant at high sound intensities
(70-90 dB SPL) (Fig. 11C). The amplitudes of later peaks of the ABR waveform were also
reduced but to a lesser extent (Fig. 11D). These results suggest that the reduction of IHC afferent
synapses in EphA7−/− mutants is significant enough to cause decreased SGN response activity,
but the defect is eventually compensated to some extent along the ascending central auditory
pathway.
39

90 70
0
1
2
Peak 1 amplitude ( μV)
Stimulus level (dB SPL)
**
*
EphA7
-/-
EphA7
+/-
0 2 4 6
-2
-1
0
1
Amplitude ( μV)
Time (ms)
I
II
III
IV
V
EphA7
-/-
EphA7
+/-
-0.6
-0.3
0
Peak I Peak II Peak III Peak IV Peak V
Change in amplitude ( μV)
EphA7+/- EphA7-/-
0
25
50
75
100
dB SPL
A
B
D C

Figure 11. Reduction of peak I amplitude of the ABR wave form in EphA7 mutant.
(A) Hearing thresholds of wild-type and EphA7−/− mouse.(B)Traces of average ABR waveform in
response to a 16kHz tone stimulus presented at 70 dB SPL in a EphA7−/− mouse and its heterozygous
littermate. Double arrow head labels the measured amplitude for peak I in the EphA7+/− mouse. Peaks I
to V are marked. (C) Average peak I amplitudes at high sound intensities (70 and 90 dB SPL) for
EphA7+/− and EphA7−/− mice. Data are shown as mean ± SEM. *p < 0.05; **p < 0.01, t test. N = 11
mice for each genotype. (D)Average change in amplitude for different peaks in the ABR waveform in
EphA7−/− mice compared to their heterozygous littermates. 16 kHz tones at 70 dBSPL were presented.
Data are shown as mean ± SEM.

1.3.8 Involvement of downstream ERK activity
A previous study has reported that EphA7 activation is accompanied by phosphorylation of
extracellular-signal regulated kinase 1/2 (ERK1/2) (Nakanishi et al., 2007). Here, we sought to
inhibit ERK1/2 phosphorylation by applying a known ERK phosphorylation inhibitor, 5-
Iodotubercidin (5-ITU) (Browning et al., 2005;Gambelli et al., 2004; Nakanishi et al., 2007).
40

Treatment of E17.5 whole-mount cochleae with 5-ITU for 2 days resulted in diminished SGN
fibers and a great loss of small fascicles in the ISP region (Fig. 12A,B), as demonstrated by the
significantly larger vacant space as compared with explants treated with the control vehicle (Fig.
12C). In cultured SG explants incubated with 5-ITU, we also observed a reduction in the
number of neurites (Fig. 12D,E,G). Furthermore, incubation of explants with FR180204, a
selective inhibitor of the kinase activity of ERK1/2 (Ohori et al., 2005), resulted in a drastic
reduction in the number of neurites (Fig. 12F,G), further suggesting that ERK1/2 activity is
important for the initial growth of SGN neurites.
DMSO 5-ITU FR180204
0
10
20
30
No. neurites
*
**
DMSO 5-ITU
Tuj1
A B
C
**
DMSO 5-ITU FR 180204
G
Tuj1
D E F
DMSO 5-ITU
0
20
40
60
% area unoccupied by
inner radial bundles

Figure 12. Involvement of ERK1/2 activity in EphA7 signalling.
(A-B) E17.5 wild-type cochleae cultured for 48 hours in the presence of either DMSO (vehicle) or 5-
Iodotubercidin (5-ITU), immunostained with anti-Tuj1. Scale bar: 30 µm. (C) Quantification of
percentage area of space unoccupied by inner radial bundles in cultured cochleae treated with DMSO (n =
7) or 5-ITU (n = 7). Data are shown as mean (small box) ± SD (larger box, with the line indicating the
median value). **p < 0.01, t test. (D-F) E13.5 wild-type SG explants cultured in the presence of DMSO,
5-ITU or FR 180204 for 48 hours, stained with anti-Tuj1. Scale bar: 100 μm. (G) Quantification of
41

average number of neurites per SG explant. Data are shown as mean ± SEM. *p < 0.05; **p < 0.01, t test.
N = 4explants for each group.

Previous studies have reported that cGMP-dependent protein kinase 1 (Prkg1) is expressed in
SGNs and that it can modulate ERK1/2activity (Jaumann et al., 2012; Komalavilas et al., 1999).
We further examined SGN innervation patterns in Prkg1 knockout mice. Since these animals
were embryonic lethal, all the experiments were carried out at embryonic stages. Prkg1–/–
phenotype resembled that of EphA7–/– mutants, with the defect apparently to a more severe
degree (Fig. 13A-F). There was a significant reduction in the number of inner radial bundles and
increase in the area of space unoccupied by SGN fibers in Prkg1–/– mutants as compared with
wild-type animals (Fig. 13G,H). While the average number of small fascicles per inner radial
bundle was not significantly different between Prkg1–/–and wild-type animals (Fig. 13I), the
reduced number of inner radial bundles (Fig. 13H) indicated a reduction in the total number of
small fascicles. The number of SGN somata was not different between the Prkg1 knockout and
its wild-type control at E17.5 (Fig. 13J-L), excluding the possibility of increased cell death. We
further tested the effect of Prkg1 activity in vitro, by applying 8-Br-cGMP, an activator of Prkg1.
Treatment of wild-type SG explants with 8-Br-cGMP resulted in a large increase in the number
of neuritis at 16 hours after treatment as compared with the control vehicle (Fig. 14A-C),
suggesting that enhancing Prkg1 activity can promote neurite growth. Furthermore, in EphA7–/–
explants, 8-Br-cGMP treatment also resulted in enhanced neurite growth (Fig. 14D-F),
suggesting that enhancing Prkg1 activity may overturn the defect of EphA7 deletion. These
results further support a potential involvement of ERK1/2 inEphA7 signalling.
42

WT Prkg1
-/-
Tuj1
***
**
**
WT
Prkg1
-/-
apex mid base
0
20
40
% area unoccupied by
inner radial bundles
apex
base
A
B
C
D
E
G
H
I
E17.5
***
J
F
K
L
0
10
20
30
No. SGN cell bodies
/ 100 μm
2
WT Prkg1
-/-
Tuj1/DAPI
WT Prkg1
-/-
0
3
6
9
No. inner radial bundle
(trunk) / 315 μm
2
WT Prkg1
-/-
0
4
8
12
No. fascicles in ISP /
inner radial bundle

Figure 13. Possible involvement of Prkg1.
(A-F) Representative images of E17.5 whole-mount cochleae, immunostained with anti-Tuj1, from wild-
type and Prkg1−/− mice, as well as higher magnification images focused on the apex and base part. All
scale bars:30 μm.(G) Percentage area of space unoccupied by inner radial bundles in the apex, mid, and
base part of the cochlea. Data are shown as mean ±SEM. **p < 0.01; ***p < 0.001, t test. N = 10
cochleae for each group. (H) Quantification of average number of inner radial bundles per 315 μm
2

image area. ***p < 0.001, t test. (I) Average number of small fascicles per inner radial bundle. (J-K)
Representative cross-sectional images of cochleae from wild-type and Prkg1−/− mice at E17.5,
immunostained with anti-Tuj (green) and DAPI (blue). Scale bar: 100 μm. (L) Quantification of average
43

number of SGN somata per 100 μm
2
area. Data are shown as mean ± SEM. N = 3 cochleae for all
genotype groups.

C
A B
Vehicle 8-Br-cGMP
0
8
16
No. neurites
**
Vehicle 8-Br-cGMP
Tuj1
EphA7-/- (Vehicle) EphA7-/- (8-Br-cGMP)
F
D E
EphA7-/-
vehicle
EphA7-/-
8-Br-cGMP
0
8
16
No. neurites
**

Figure 14. Rescued EphA7 defective phenotypes by Prkg1 activation.
(A-B) Tuj1 stained wild-type SG explants cultured for 16 hours starting at E13.5 in the presence of
vehicle or 8-Bromo-cGMP. Scale bar: 100 μm. (C) Average number of neurites per SG explant. Data are
shown as mean ± SEM. **p < 0.01, t test. N = 4 explants. (D-E) Tuj1 stained EphA7-/- SG explants
cultured for 16 hours starting at E13.5 in the presence of vehicle or 8-Br-cGMP. Scale Bar: 100 μm. (F)
Average number of neurites per SG explant. Data are shown as mean ± SEM. **p < 0.01, t test. N = 3
explants.

44

1.4 Discussion
Eph signaling pathways are known to be key modulators in neural development. Their unique
functions in cochlear development however are only beginning to be explored. Our study reveals
a molecular component in these pathways important for cochlear patterning. Based on the
genetic and functional analyses, we conclude that EphA7 plays an important role in regulating
the development of SGN neurites.
In this study, we focused on Eph/ephrin signaling pathways, as they have previously been shown
to affect the formation of neural circuitry in the auditory pathway (Coate et al., 2012; Defourny
et al., 2013; Ilona et al., 2007).

1.4.1 Regulation of axonal outgrowth by EphA7
Multiple roles of EphA7 in the assembly of neural circuitry have been characterized. In mouse
cortical neurons, EphA7 mediates dendritic growth, dendritic spine formation, synaptic
maturation (Clifford et al., 2014), and organization of a topography of corticothalamic
projections (Torrii and Levitt, 2005). During development of retinocollicular projections, EphA7
is invovled as a repellent substrate for directing retinal axon pathfinding (Rashid et al., 2005).
Furthermore, it is implicated in controling apotosis of forebrain neural progenitors (Depaepe et
al., 2005). Having such multiplex functions is not uncommon for Eph and ephrin family
molecules, as other axon guidance molecules, such as netrin, can also act as a chemoattractant or
chemorepellant depending on the type of axons (Serafini et al.,1994; Colamarino and Tessier-
Lavigne, 1995). Here, we demonstrate that EphA7 signaling in the mouse cochlea is important
forthe initial growthof SGN processes. Previous evidence of EphA7 promoting axonal outgrowth
45

through reverse signaling (Chai et al., 2014; Lewcoc et al., 2007) suggests that signaling via
EphA7 in SGNs may also play a unique role in modulating their axonal outgrowth, thereby
controlling the number of type I fibers innervating IHCs. While Eph receptors are generally
thought to have a repulsive/negative effect on neuronal growth or migration, our data suggest
that they canalso have a stimulative/positive effect on neurite growth. This is reminiscent of
severalin vitro studies showing that ephrins can either stimulate or inhibit neurite outgrowth
depending on different developing systems and possibly also different stages of neurons (Gao et
al., 2000; Zhou et al., 2001). Alternatively, EphA7 may play a permissive role, and removing
EphA7 activity therefore impedes the normal neurite outgrowth.

1.4.2 Potential ligands for EphA7 signaling
Previously EphA4 has been shown to exert both a cell-autonomous and non-cell-autonomous
function in the formation of axon tracts (Dottori et al., 1998; Kullander et al., 2001; Marquardt et
al., 2005). For the latter, the kinase activity of EphA4 is not required, suggesting that EphA4
acts as a ligand. In this study, our in vitroexplant experiments demonstrated that EphA7
signaling in SGNs is activated independent of mesenchymal cells surroundingthe SG. In addition,
the number of SGN neurites is reduced in isolated SG explants treated with unclustered EphA7-
Fc, which competitively binds to EphA7-interacting ligands and blocksendogenous EphA7
signaling. These results indicate that EphA7-interacting ephrins are expressed in SGNs
themselves. Previously it has been shown that EphA7 reverse signaling plays a role in
promoting motor neuron axon outgrowth (Chai et al., 2014). There are also studies showingthat
forward signaling can stimulate axon outgrowth (Hansen et al., 2004; Lewcock et al., 2007).
46

Considering that Eph and ephrine molecules are likely spatially segragated from each other on
the membrane of the parent cell (Marquardt et al., 2005), we postulate that both reverse and
forward EphA7 signalling activated by interactions between EphA7 and its ligands on
neighouring SGNs may play a role in regulating SGN neurite growth.
What are possible ligands for EphA7 then? Based on the partially overlapping expression
patterns of EphA7 and ephrin-A5 in type I SGNs (our unpublished data) and the previous
evidence implicating EphA7/ephrin-A5 interactions (Gale et al., 1996; Clifford et al., 2014), it is
possible that EphA7 signaling is achieved through ephrin-A5 binding. Although there are
studies showing that suppression of ERK activity by ephrin-A5 caused a growth cone collapse in
retinal ganglion cells, hippocampal neurons and SGNs (Defourny et al., 2013; Drescher et
al.,1995; Meier et al., 2011), in these experiments ephrin-A5 was applied for only a breif period
of time (15-60 min). Prolonged exposure of ephrin-A5 in fact induces expression of cytoskeletal
genes such as actinin (Meier et al., 2011), suggesting that it can play a role in promoting axonal
growth. The exact time lapse from initial cell-cell contact to a complete morphological change
due to Eph/ephrin interactions is not known in in vivo conditions, but a continuous expression of
EphA7 and ephrin-A5 in developing SGNs during the entire processes of neurite outgrowth and
formation of synaptic connections suggests a long-term interaction of the two molecules under
physiological conditions. Other potential ligands that might be involved in reverse signaling
could be ephrin-A2 and ephrin-B2. The interaction between EphA7 and ephrin-A2 in reverse
signaling has been previously established in the adult mouse brain. This interaction negatively
regulatesthe proliferation of neural progenitor cells, as neurogenesis in the olfactory bulb is
increasedin mice lacking ephrin-A2 (Holmberg et al., 2005). Furthermore, a gradient expression
of ephrin-A2 in the SG (Lee and Warchol, 2005) makes it an interesting EphA7 partner as
47

topographic mapping is established in a concentration-dependent manner (Hansen et al., 2004).
Ephrin-B2 is also highly expressed in SGNs (Coate el al., 2012). Although the binding of ephrin-
B2 to EphA7 needs to be validated with biochemical experiments, a previous study suggeststhat
ephrin-B2 mediated reverse signaling via EphA7 is responsible for the development of nephric
duct (Weiss et al, 2014), raising the possibility of ephrin-B2 being an EphA7-ineracting partner
in the SG as well. More extensive investigations are needed to fully identify the EphA7 ligands.
As multiple ephrin family members are present throughout the cochlear development, it is
possible that there is a functional redunduncy among these members and that the effect of EphA7
knockout can be compensated to some extent by upregulating other Eph/ephrin signaling
mechanisms. Indeed, there are various studies suggesting compensatory mechanisms of
Eph/ephrin signaling during neural development (Feldheim et al., 2000; Lim et al., 2008; Orioli
et al., 1996; Passante et al., 2008). Considering the diversity of the biological processes
influenced by Eph/ephrin signaling, it is interesting to note that most of ephrin type-A receptor
knockout mice are viable, likely due to compensation effects. In the present study, we observed
a more pronounced effect of reducing SGN neruites by blocking downstream signaling
molecules (e.g. with FR180204) than knocking down EphA7, which is consistent with potential
compensatory effectscaused by increased expression of other Eph molecules when EphA7 is
absent.

1.4.3 Other potential effects of EphA7 in cochlear development
Several lines of evidence suggest a stage-dependent role of EphA7 in the morphological
development of cortical and hippocampal neurons (Clifford et al., 2014; Zhou et al., 2001). In
48

the mouse cochlea, the effect of EphA7 in regulating neurite outgrowthalso seems neuronal
stagedependent. Early embryonic SG explants were responsive to unclustered EphA7-Fc, while
postnatal explants did not show a significant change in neurite number under treatment of
unclustered EphA7-Fc (data not shown). Since SGNs, initially derived from the neuroblasts from
the otocyst, become postmitotic around E11.5 to E15.5, it rasies the possibility that postmitotic
neurons may gradually lose the responsiveness to EphA7 activation.
It is well known that several axon guidance molecules are present in non-sensory regions of the
cochlea such as the GER and mesenchyme. They may play a regulatory role in SGN migration
and in the proper organization and guidance of neurite extension, as have been shown previously
(Bianchi and Liu, 1999; Coate et al., 2012; Wang et al., 2013). Our gene expression and
immunohistochemistry studies showed that EphA7 is also expressed in the GER and
mesenchymal cells. The role of EphA7 molecule in these cell populations is unclear, as there is
no obvious defect in axon fasciculation or pathfinding in the EphA7 knockout mouse.
Considering the fact that other ephrin signaling pathways such as those via EphB2 can influence
non-neuronal cell populations in the ear (Cowan et al., 2000), different roles of EphA7 in other
regionsare plausible. In fact,potential influence of EphA7 on non-neuronal populations in the
developing mouse ear has been implicated before. For example, a strong expression of EphA7 in
the invaginating otic cup starting around E8.5 suggests an involvement of EphA7 in the otic
development concerning border distinction around the otic cup or its invagination process
(Saeger et al., 2011).
49

1.4.4 Signaling of EphA7
The challenge in assembling Eph/ephrin signaling pathways is that various cross-talks may occur
with each other and with other signaling cascades to achieve biological goals (Arvanitis and
Davy, 2008; Klein, 2004). Recent data have linked Eph receptor signaling to the Ras and Rho
protein families. EphA7 activation is implicated in regulating Ras, which eventually activates a
casade of kinases such as ERK1 and ERK2 (Nakanishi et al., 2007). Although much of the
investigation into EphA7 signaling pathways has been carried out in cancer cells associated with
leukemia and lymphoma (Nakanishi et al., 2007; Oricchio et al., 2011), it is possible that the
signaling pathwaysin different cell types may share common mediators. Additionally, ephrin-A
mediated reverse signaling has also been shown to activate ERK pathways (Davy et al., 1999).
Our results presented in this study show that inhibition of ERK1/2 phosphrylation and kinase
activity in vitro and ex vivo produces a similar effect of reducing SGN fibers as in EphA7
deletion mutants, suggesting a possible involvement of ERK1/2 activity in EphA7 signaling
during SGN development (Fig. 15).Furthermore,previous studies demonstrating an initiation of
cytoskeletal interactions upon ERK1/2 activation(Forcet et al., 2002; Veeranna et al., 1998;
Wang and Hatton, 2007), which is essential for neurite outgrowth, further complement our
results.
50

EphA7
Ras Ras
GTP
GDP
Raf
MEK1/2
P
MEK1/2
ERK1/2 ERK1/2
P
NF-H / NF-M
KSP rich
P
NF-H / NF-M
KSP rich
cGMP
Prkg1
Neurite growth
5-ITU & FR180204
8-Br-cGMP
P
Type I SGN
Type I or Type II SGNs

Figure 15. Schematic model summarizing the downstream signaling of EphA7 activation.
During the initial growth of peripheral fibers of SGNs, EphA7 and its partner(s) in neighboring SGNs
interact to activate EphA7 forward signaling. This subsequently lead to MAPK/ERK pathway,
subsequently resulting in neurite growth.

1.4.5 Functional relevance of EphA7 signaling
Hearing loss can severely impair an important aspect of everyday life, leading to a dramatic
reduction in quality of life. Our data indicate that EphA7 deletion does not simply cause a
hearing loss. However, a significant decrease in the amplitude of peak I of ABR, which reflects
51

summed activity of SGN fibers, only at high sound intensitiessuggests that the defect may reflect
a form of hidden hearing loss (Schaette and McAlpine, 2011). In hidden hearing loss, the
unresponsiveness to sound in a fraction of auditory nerve fibers, possibly the ones having high
thresholds and lowspontaneous rates and thought to be involved in encoding high-intensity
acoustic information (Young and Barta, 1986), leads to an increased response gain in the
auditory brainstem. This can result in normal or minimally reducedpeak V amplitudes (Schaette
and McAlpine, 2011). Such compensatory increase in response gain may lead to tinnitus due to
enhancement of spontaneous activity of auditory neurons (Schaette and McAlpine, 2011). In our
ABR data, we do observe changesof peak I and peak V amplitudes consistent with hidden heaing
loss. Although caution has to be taken before intepretating our data as an indicationof hidden
hearing loss and tinnitus, it is possible that deafferentation of auditory nerve fibers caused by
mutations of EphA7 can contribute to the hearing disorders.
The function roles of Eph/ephrin family molecules in the cochlea are beginning to be unveiled.
Future studies with spatially and temporally controlled knockouts of Eph and ephrin members
will provide a deeper understanding of Eph/ephrin signaling in the developing cochlea.

1.5 Experimental procedures and Materials

Mouse strains
Mice were handled according to the protocols approved by the Institutional Animal Care and Use
Committees at the University of Southern California (USC). EphA7 and Prkg1 homozygous
mutants were obtained by crossing heterozygous littermates with the plug day defined as E0.5.
Genotyping was performed as previously described (Rashid et al., 2005). Genotyping of Ai6
52

(Rosa-CAG-LSL-ZsGreen1-WPRE), Parvalbumin (PV)-Cre, glutamate decarboxylase 1 (Gad1)-
GFP mice (The Jackson Laboratory) was performed following previous studies (Hippenmeyer et
al., 2005; Madisen et al., 2010; Tamamaki et al., 2003).
Tissue dissection, FACS, RNA amplification, and RNA sequencing
Mouse cochleae were dissected from P3 to P7 pups. Gad1-GFP cochleae were used for GER
cells, and PV-Cre::Ai6 cochleae for HCs and SGNs. Tissues were further treated to achieve
complete dissociation as described previously (Wang et al., 2013). Fluorescence-activated cell
sorting (FACS) was performed at the Flow Cytometry Core Facility of USC. Cell suspensions
were fed into a BDAriaII sorter and purified using 488 nm laser excitation and a 100-μm
cytoNozzle. Distinct cell populations were collected into DMEM plus 10% FBS and pelleted
down through centrifuge. RNA was extracted from the collected cells using PicoPure RNA
isolation kit (Arcturus). Each RNA sample was then amplified using WT-Ovation Pico
amplification kit (Nugen). The quantity and quality of isolated RNAs were determined with
NanoDrop 2000 (NanoDrop Technologies) and confirmed by Bioanalyzer 2100 (Agilent
Technologies). RNA-sequencing was conducted with Illumina HiSeq 2000 (Illumina) at the USC
Genomics Center following the manufacturer’s instructions.
Immunohistochemistry
Mouse cochleae were dissected at desired time points and fixed with 4% PFA for 2-24hours.
Fixed samples were permeabilized with 0.8% TrionX-100 followed by incubation in 10% serum
blocking buffer for at least 1 hour at room temperature. Primary antibody incubation overnight at
4°C was followed by secondary antibody incubation for 2 hours at room temperature. Confocal
z-stack images were obtained using Fluoview1000 (Olympus), projected using National
Institutes of Health (NIH) ImageJ and further processed using Inkscape. Antibodies used in this
53

study and their dilution were as followed: Alexa488-conjugated mouse anti-Tuj1 (1:300;
Covance), rabbit anti-Parvalbumin (PV) (1:300; Swant), rabbit anti-EphA7 (1:500; Abgent), goat
anti-EphA7 (1:300; R&D), mouse anti-CtBP2 (1:300; BD Transduction Laboratories).
In situ hybridization
In situ hybridization was performed as previously described (Wang et al., 2013). Probes were
generated using cDNA probes by RT-PCR. Primer pair for EphA7 follows:forward5
’
-
ATGAGGCTTAAGACTGCAGGAG-3
’
and reverse5
’
- CAGACGAAGCTCAGCCTTTTAT-3
’
.
After subcloning, the identity of the probe was confirmed by DNA sequencing.
Cochlea and SGN explant culture
C57BL/6 mice were euthanized according to the National Institutes of Health Guide for the Care
and Use of Laboratory Animals. Cochlear epithelium with SGNs attached was removed
mechanically from the bone structure in Leibovitz’s L-15 medium (Invitrogen). For whole-
mount explant culture, the dissected cochlea was place on a Cell-Tak Cell and Tissue Adhesive
(BD Biosciences) pre-coated 10 mm culture dish and cultured in DMEM/F12 supplemented with
10% FBS, 1% N2 supplement and 0.3 mg/ml ampicillin. For 5-Iodotubercidinexperiments, 5-
Iodotubercidin (10 μM; Tocris) was added in the explant culture after being cultured for 4 hours,
and then the culture was maintained for 48 hours in a humidified atmosphere with 5% CO2/95%
air. For SGN cultures, the dissected cochlear epithelium was further microdissected to isolate a
piece of SG. For consistency, exactly one turn away from the apex of a cochlea was set as the
starting point of dissection. Once the SG was isolated, pieces were cut in a comparable length
and placed on a layer of solidified Matrigel (BD Biosciences). Then, another layer of Matrigel
was added and the dish was incubated at 37°C. After a complete solidification of the Matrigel,
cochlear medium was added and explants were allowed to grow for 12 hours. Chemical
54

inhibitors/stimulators, either 3μM 5-Iodotubercidin (in DMSO), 0.5μM FR180204 (in DMSO),
1mM 8-Bromo-cGMP (in water) or DMSO alone (as control), were then added and cultured for
24-48 hours. For siRNA experiments, dissected SG was placed in either standard control siRNA
(Santa Cruz Biotechnology) or EphA7-specific siRNA (Santa Cruz Biotechnology) drops diluted
with PBS on a Sylgard-coated dish and then electroporated using a custom-made electroporator.
Sample was further cultured in 3D Matrigel for 4 days.
TMRD labeling
Mouse inner ear bone with intact auditory nerve projecting out from the bone structure, was
dissected out in the artificial cerebrospinal fluid (ACSF). A small piece of TMRD crystal was
applied to the auditory nerve outside of the bone structure and incubated for 30 minutes at room
temperature. The bone structure was washed with ACSF for several times and incubated in
oxygenated ACSF for at least 4 hours at room temperature. Cochlea was then dissected out and
washed extensively with ACSF and fixed with 4% PFA overnight.
Western blot
Proteins of cultured SGs were extracted using Qproteome Mammalian Protein Prep Kit (Qiagen)
and stored at -80°C with 20% glycerol. Boiled protein extracts were separated with NuPAGE
Novex Bis-Tris gel (Invitrogen) and transferred using Trans-Blot Turbo Transfer System (Bio-
Rad). Extracts were probed with anti-EphA7 antibody (1:500; R&D) or anti-β-tubulin (1:1000;
Cell Signaling), followed by secondary antibody incubation with peroxidase-conjugated IgG
(Jackson Immunoresearch).

55

Image analysis and quantification
All the confocal image stacks were processed in Fiji (ImageJ) software. For calculating area
occupancy by inner radial bundles, whole-mount immunostained z-stacked images were
converted to binary images. Pixels of outlined objects in binary images were then counted and
subtracted from the pixel number of the total area. The measured total area extended from the SG
boundary to the inner hair cell layer. Significance was tested using two-tailed Student’s t-test for
two group comparisons, or one-way ANOVA followed by Tamhane’s T2 post hoc test for
multiple group comparisons.
To quantify the number of inner radial bundle trunks, an image layer from the z-stacked image
acquired at 40X magnification, representing the most medial part of the inner radial bundle
growing out from SGN somas, was chosen for counting the number of bundles. Branches
emerging from the middle of inner radial bundles or branches crossing to other bundles were not
counted. The average bundle thickness (i.e. mean bundle width) was calculated by dividing the
total length of space occupied by inner radial bundles (at the same plane as described above) by
the number of bundles (Wang et al., 2013). To quantify the number of small fascicles per inner
radial bundle, the total number of fascicles at 10μm distance medially from the inner hair cell
layer was counted, and the number was then divided by the number of inner radial bundles in the
chosen area. Significance was tested using two-tailed Student’s t-test.
Tuj-1 and DAPI immunostained whole-mount and 20μm cross-sectional P8 cochlear imageswere
used to manually count SGN somas in a chosen area. To quantify ribbon synapses of inner hair
cells, whole-mount cochleae stained with anti-CtBP2 were used. For counting ribbon synapses
on outer hair cells, confocal z-stacked cross-sectional images at 5μm intervals were used. The
56

total number of ribbon synapses was divided by the total number of HC nuclei to obtain the
average number of synapses per HC. Significance was tested using two-tailed Student’s t-test.
For measuring neurite length in in vitro explants, distance from the somata boundary to the distal
end of the neurite was measured. The number of outgrowing neurites, i.e. neurites that directly
projected out from SGN somas, were manually counted. Staining procedures and image setting
were identical for all samples in the same experiments for comparison. Significance was tested
using Wilcoxon rank-sum test.
Auditory brainstem response (ABR) recording
5-week old mice were anesthetized with ketamine (80mg/kg) and xylazine (10mg/kg) mixture.
The body temperature was maintained at 37°C with a heating pad and a rectal probe. ABRs were
evoked by tone bursts (5-ms duration, with 0.5-ms rise-fall time) at frequencies of 8, 12, 16, 24,
32 kHz. The tone intensity was increased in 5 dB steps from 10 dB to 100 dB sound pressure
level (SPL). Responses at each frequency and intensity level, averaged across 1000 repetitions,
were acquired using EPL Cochlear Function Test Suite (Massachusetts Eye and Ear) (Niu et al.,
2006). Threshold was identified by visual inspection of waveforms.

57

Chapter 2: Role of Dcc in functional assembly of
peripheral & central auditory circuits
2.1 Introduction to Dcc in developing nervous system
Dcc is a gene encoding the receptor for Netrin 1 (Barallobre et al., 2005). Dcc, originally
identified in humans as a tumor suppressor gene, has been well characterized in the developing
nervous system of various model organisms. Its wide variety of functions include neuronal
precursor cell migration (Alcantara et al., 2000), axon guidance, (Deiner et al., 1997), axon
branching (Hao et al., 2010), axon innervation (Xu et al., 2010), and oligodendroglial
development (Rajasekharan et al., 2009). A significant amount of what is known about Dcc
comes from detailed studies of commissural axons in the developing spinal cord (Izzi and
Charron, 2011), which indicate that Dcc serves as a guidance cue for commissural axons to cross
the midline. Expression studies have demonstrated that all of the “classical” families of axon
guidance cuesare expressed in the developing ear, suggesting that a complex network of these
signaling mechanisms controls cochlear development and innervation pattern (Coate & Kelley,
2013). Recently, several of these signaling pathways in the developing mouse cochlea have been
characterized. For example, Slit/Robo signaling regulates the spatial restriction of SGNs (Wang
et al., 2013), while various Eph/ephrin signaling molecules affect SGN neurite outgrowth and
HC innervation patterns (Coate et al., 2013; Defourny et al., 2013; Kim et al., 2015). The
apparently prominent developmental roles of the conserved families of axon guidance molecules
in the cochlea and the number of clinical cases inferring a connection between Dcc and
sensorineural hearing loss thus prompted us to examine the role of Dcc in mouse cochlear
development.
58

Mirror movements are intentional movements of one side of the body that is accompanied by
mirroring involuntary movements on the other side. Mild cases of mirror movements are found
in normally developing young children but its persistency through adulthood is rare and found
only in certain neurological disorders such as Klippel-Feil syndrome (KFS) (Srour et al, 2010).
Eight independent mutations in Dcc, leading to Dcc protein lacking most of its functional
domains, have recently been identified in different families with congenital mirror movements,
which is likely to be a result of defective midline crossing of axonal fibers (Srour et al., 2010;
Depienne et al., 2011, Meneret et al., 2014). Mirror movement behaviors caused by mutations in
Dcc are not only limited to humans but also have been observed in mice and zebrafish (Finger et
al., 2002; Jain et al., 2014). Interestingly, clinical characterizations of CMM individuals imply a
possible link between Dcc and sensorineural hearing loss, as mirror movements is the most
common abnormalities associated with the KFS (Royal et al., 2002; Van der Linden &
Bruggeman, 1991; Rasmussen, 1993; Forget et al., 1986; Notermans et al., 1970) and 80% of
individuals with KFS have been reported to have sensorineural hearing loss (McGaughran et al.,
1998). In addition, one of hallmark phenotypic CNS features of Dcc mutant mice is an absence
of corpus callosum as well as hippocampal and anterior commissures (Fazeli et al., 1997). In
humans, a complete or partial absence of corpus callosum is a rare congenital abnormality called
agenesis of the corpus callosum (ACC). Sensorineural hearing loss has been observed in many
syndromes exhibiting ACC, e.g. Chudley-Mccullough and Acrocallosal syndrome (Nadkarni et
al., 2008; Cataltepe&Tuncbilek, 1992). Together these clinical reports strongly suggest that Dcc
mutations may be involved in sensorineural hearing loss.

59

2.2 Disorganized SGN fiber and positioning in developing auditory
circuit
We first observed two defects in the cochlea of Dcc deletion mice: disrupted SGN assembly in
the Rosenthal’s canal, and misrouted afferent fibers of SGNs. By tracing the changes
developmentally, we found that E16.5 was the earliest time point when the disruption of SG
assembly could be observed, excluding any possible origin of SGN delamination defects. Similar
disruption of SGN positioning and misrouting of fibers was also observed in the central auditory
pathway towards the cochlear nucleus. In addition, the bifurcation pattern of auditory nerve
fibers was disrupted in Dcc mutants. Our results revealed a previously unrecognized role of Dcc
in regulating the proper organization of not only SGN cell bodies but also their neurites in the
developing auditory system. Such disrupted spatial patterning of SGNs could be a causal factor
that gives rise to hearing impairments seen in clinical cases involving Dcc mutations.

2.2.1 Expression of Dcc in developing mouse cochlea
From the gene expression analysis of all families of classical axon guidance molecules, we found
six genes, displaying high spatial specificity, exclusive to SGNs. These genes included Dcc,
Robo4, Slit1, EphA6, EphA8, and Plxnd1 (Table 4). Comparison of expression levels of the six
genes from the RNA-sequencing data to the previously generated microarray-based profile data
demonstrated the highest fold change in Dcc expression level between the sensory and non-
sensory cell populations, suggesting its potential involvement in cochlear auditory circuit
development (Fig. 16).

60

Gene Name
Cell Types
SC HC SGN
Dcc 0 0 1.27416
Robo4 0 0 5.48805
Epha6 0 0 0.06812
Epha8 0 0 0.18828
Plxnd1 0 0 0.60918
Slit1 0 0 2.13429

Table 4. Comparative analysis of axon guidance molecules, specific to SGNs.
A list of selected genes that have been shown to be specifically expressed by SGNs.

Dcc Robo4 Slit1 EphA6 EphA8 Plxnd1
0
5
10
15
Fold of Difference
(Non-sensory/Sensory)

Figure 16. Fold changes in gene expression levels of selected axon guidance cues from the
microarray analysis.
Fold of difference between the non-sensory and sensory cell populations purified from ~P6 mouse
cochleae for selected axon guidance molecules based on the RNA-sequencing data in the microarray
analysis. N = 3. Bar = SD.

Previously, the expression pattern of Dcc within the auditory circuitry has been characterized in
the early embryonic and adult vestibulocochlear ganglion and in the ventral cochlear nucleus
(Howell et al., 2007; Lee and Warchol, 2008; Seaman et al., 2001). However, its presence during
the peripheral auditory circuit development has not been characterized. To verify the expression
of Dcc in the cochlea within the crucial developmental time window when the peripheral
innervations take place, we performed in situ hybridizations in the cochlear whole-mount and
61

cross-sections at E17.5. Strong Dcc signals were found in the SG, but not in the organ of Corti
(oc) or greater epithelial ridge (ger) (Fig. 17A). Cross-sectional views of E17.5 cochlea revealed
that Dcc was also expressed in the Reissner’s membrane (rm) and spiral ligament (sl) lateral to
the stria vascularis (sva) (Fig. 17B). The overall expression patterns of Dcc transcripts were
consistent with our cochlear gene profiling results. The strong expression of Dcc in spiral
ganglion neurons suggests that it may play a role in regulating the development of SGNs and
their fibers.

ger
oc
sg
rm
sl
sva
sg
ger
oc
A B
E17.5 E17.5

Figure 17. Dcc expression in embryonic mouse cochlea.
(A) In situ hybridization of Dcc in the whole-mount cochlea at E17.5. “oc”, organ of corti; “ger”, greater
epithelial ridge; “sg”, spiral ganglion. (B) In situ hybridization of Dcc in the transverse section of E17.5
cochlea. “rm”, reissner’s membrane; “sl”, spiral ligament; “sva”, stria vascularis. All scale bars represent
50 μm.

2.2.2 Misrouted SGN fibers in Dcc mutant
Based on the known functional roles of Dcc in the developing nervous system and its highly
enriched expression pattern in SGNs, we hypothesized that proper axon guidance may be
provided by Dcc signaling during cochlear development. To test this hypothesis, we compared
62

the innervation pattern of SGN fibers in cochlear cross-sections between wild-type and Dcc
-/-
mice. At E14.5, peripheral fibers of SGNs, which would innervate hair cells (HCs), have not
been fully extended out yet in either wild-type or Dcc
-/-
cochleae (Fig. 18A,D). However, cross-
sectional views of Dcc
-/-
cochleae at E16.5 and E18.5 revealed that ectopic fibers were routed
towards the peripheral side of the cochlea, whereas central auditory nerves did not show any
signs of aberrant fiber trajectories (Fig. 18B,C,E,F). High-magnification views of cochlear cross-
sections showed exact locations of misrouted SG fibers in ectopic places such as the modiolus
(mo) near the Rosenthal’s canal (rc) (Fig. 1H,I), spiral ligament (sl), and mesothelial cells of the
scala vestibule (sv)and scala tympani (st), whereas wild-type tissues showed no traces of Tuj1
signals in any of these regions (Fig. 18G-I).
63

I
E18.5
Dcc-/- #3
rc
HC
A
D
B
E
C
F
G H
rc
sv
sm
st
mo
rc
sv sm
st
mo
ce
rc
sv
sm
st
Dcc-/-
WT
Dcc-/- #1 Dcc-/- #2
E14.5 E16.5 E18.5
E14.5 E16.5 E18.5
E18.5 E18.5
Tuj1
PV/Tuj1
rc
sva
HC
sl
rc
rc
rc
rc
ce
rc
st
sm
sv
sm
mo
rc
rc
rc
sv
st
rc
rc
rc
sv
sm
st
mo
mo
sm
sm
sl
sl
sl
sl
sl
sl
sv
st
st
sv
sm

Figure 18. Disorganized SG fiber in Dcc mutant.
(A-C) Representative images of cross-sections of wild-type cochleae at E14.5, E16.5, and E18.5,
immunostained with anti-Tuj1 (green) antibody and merged with differential interference contrast (DIC)
images. “ce”, cochlear epithelium; “sl”, spiral ligament; “sv”, scala vestibule; “sm”, scala media; “st”,
scala timpani; “mo”, modiolus; “rc”, Rosenthal’s canal. (D-F) Cross-sectional images of Dcc
-/-
cochleae,
treated similarly as in (A-C). White arrows mark misrouted fibers in “sl”. Blue arrows mark misrouted
fibers in mesothelial cells of “sv”or“st”. Yellow arrows indicate fibers in “mo”. Green arrow marks fibers
in “sm”. (G-I) High-magnification cross-sectional views of E18.5 mouse cochlea from three Dcc
-/-

animals, immunostained with anti-PV (red) and anti-Tuj1 (green) antibodies. Misrouted fibers are marked
in similar manners as in (E,F). All scale bars represent 50 μm.
64

Misrouted fibers in the peripheral side of the cochlea prompted us to closely examine the pattern
of SGN innervation of HCs. At E14.5, when inner radial bundles (i.e. fasciculated
afferent/efferent fibers) were not yet visible in a whole-mount preparation, there was no apparent
difference in the overall morphology between Dcc
-/-
and wild-type cochleae (Fig. 19A,D,G). At
E16.5 and E18.5, misrouted fibers originating from the SG region were observed in Dcc
-/-
but not
in wild-type cochleae, with some of them apparently overshooting past the sensory epithelium
(Fig. 19B,C,E,F). High-magnification images showed that the misrouted fibers were usually in
bundles (Fig. 19H,I). Despite the randomly misrouted fiber bundles, the overall organizational
pattern of inner radial bundles was preserved to some degree throughout the whole cochlear
length (Fig. 19E,F).
E16.5 E14.5
E14.5 E16.5
E18.5
E18.5
Dcc-/- WT
A
D
G
B
E
H
C
F
I
Dcc-/-
E14.5 E16.5 E18.5
Myo6/Tuj1
HC
sg

65

Figure 19. Defective peripheral innervation pattern in Dcc mutant.
(A-C) Representative images of whole-mount wild-type cochleae at E14.5, E16.5, and E18.5,
immunostained with anti-Myo6 (red) and anti-Tuj1 (green) antibodies. (D-F) Images of whole-mount
Dcc
-/-
cochleae, stained in similar manners as in (A-C).(G-I) Higher magnification images of cochleae
shown in (D-F). Arrows point to misrouted fiber bundles originating from SG. “HC”, hair cells; “sg”,
spiral ganglion. All scale bars represent 50 μm.

Next, we examined the SGN innervation pattern in the sensory epithelium. The entire z-stack
images of whole-mount cochlea at E18.5 (Fig. 20A,D) were partitioned into two sets, with one
consisted of planes from the apex to base of HCs (Fig. 20B,E) and the other from the base of
HCs to SGN cell bodies in the Rosenthal’s canal (Fig. 20C,F). These images revealed largely
normal organization of type I and type II fiber innervation of HCs in Dcc mutants, as no aberrant
fibers were observed around the HC rows (Fig. 20B,E). However, fibers innervating HCs were
less densely packed in Dcc
-/-
mutants (Fig. 20B,E; percentage area occupied by fibers in HC
regions= 4.05% ± 0.78 for WT and 2.76% ± 0.45 for Dcc
-/-
, p ˂ 0.01, t test, N = 8embryosfor
both genotypes). All the misrouted fibers in Dcc
-/-
mutants were observed in the z-stack image
representing the space below the HC layers (Fig. 20C,F), indicating diminished target
innervation within the sensory epithelium.
66

D
B
E
C
F
WT Dcc-/-
E18.5 E18.5
A
Myo6/Tuj1
HC

Figure 20. Preserved innervation pattern within the sensory epithelium.
(A-F) Representative z-stack projections images of the base region of wild-type and Dcc
-/-
cochleae at
E18.5, immunostained with anti-Myo6 (red) and anti-Tuj1 (green) antibodies. Images in (B,E) are the
projection of a subset of z-stack images from (A,D), showing only the HC layers, while images in (C,F)
exclude stacks for HC layers. All scale bars represent 50 μm.

2.2.3 Reduction in number of ribbon synapses due to misrouted afferent
fibers
Anatomical studies in the ear have shown that efferent fibers, originating from the superior
olivary complex (SOC), descend via the inferior vestibular nerve and eventually travel through
the Rosenthal’s canal into the organ of Corti (Ciuman et al., 2010). In order to test the possibility
67

of efferent projections contributing to the disorganization of cochlear fibers observed in Dcc
mutants, the pattern of efferent fibers was revealed by depositing a lipophilic dye, DiI, in the
path of olivocochlear bundles (Guinan et al., 2006). No apparent misrouting of efferent fibers
was observed in Dcc
-/-
cochleae (Fig. 21A-F), indicating that the misrouted fibers revealed by
Tuj1 staining (Fig. 21A,D) were all afferent fibers originating from SGN somas. Together, these
data suggest that Dcc is important for the proper projection of afferent fibers.
We next asked whether the diminished fiber density in cochlear epithelial region (Fig. 20B,E)
and ectopic afferent fibers (Fig. 20C,F) could result in reduction of synapse numbers between
SGNs and hair cells in Dcc
-/-
cochlea. We first closely examined SGN peripheral fibers that
entered the organ of Corti. Past the habenula perforate (hp), a tiny opening in the spiral lamina
that allowed fibers to pass to enter the organ of Corti, disorganization of fibers could still be
observed in the terminal region near HCs (Fig. 21G-J).We then quantified the number of ribbon
synapses in wild-type and Dcc
-/-
cochleae, by staining with CtBP2 (Uthaiah et al., 2010) (Fig.
21K,L). Comparison of sensory epitheliums at E18.5 revealed reduced number of ribbon
synapses in the Dcc
-/-
mutant (Fig. 21M). These data further support the notion that the
disruption of Dcc function impairs correct targeting of SGN fibers to form afferent synapses on
HCs.
68

A
Tuj1
HC
Dcc-/- WT
E18.5
B
J
K
L
M
CtBP2
HC
IHC
E18.5
G
bm
hp
C
hp
bm
E16.5
B
D
E
DiI
C
F
E16.5
Myo6/Tuj1
H
I
Dcc-/-
WT
WT
Dcc-/-
0
8
16
24
# of ribbon synapses / IHC
*
(18.8)
(13)
E18.5
E18.5

Figure 21. Impairment of afferent fiber innervation in developing mouse cochlea.
(A-F) Representative images of whole-mount wild-type and Dcc
-/-
cochleae at E16.5, immunostained with
anti-Tuj1 (green) antibody and labelled with DiI for efferent fiber projection patterns and their
superimposed images. (G-J) Representative images of cross-sections of the mid region of E18.5 wild-type
69

and Dcc
-/-
cochleae, immunostained with anti-Myo6 (red) and anti-Tuj1 (green) antibodies, showing SG
fibers innervating HCs. Images of SG fibers (green) and HCs (red) are superimposed in (H,J). “bm”,
basilar membrane; “hp”, habenula perforate. (K,L) Whole-mount images from the mid-base region of
wild-type and Dcc
-/-
cochleae at E18.5, immunostained with anti-CtBP2 antibody. Each white spot labels
one ribbon synapse. Dotted ovals indicate individual inner hair cell (IHC) nuclei. (M) Average number of
ribbon synapses per IHC at E18.5. Data are shown as mean ±SEM. *p < 0.05, t test. N = 4 cochleae for
both genotypes. Scale bar represents 50 μm in (A), 20 μm in (H), and 5 μm in (K).

2.2.4 Loss of spatial restriction of SGNs within the Rosenthal’s canal in Dcc
mutant
Since Dcc has been implicated in regulating neuronal migration in various systems such as the
spinal cord, forebrain, midbrain, bowel and pancreas (Liu et al., 1990; Schwarting et al., 2001;
Cotrufo et al., 2012; Jiang et al., 2003), we further examined its possible role in regulating SGN
migration. In E14.5 Dcc
-/-
cochlea, SGNs remained within the Rosenthal’s canal without any
noticeable abnormalities as compared with wild-type cochleae (Fig. 22A,D). However, starting
from E16.5 and continuing into E18.5, a number of ectopically located SGNs were distributed
throughout the cochlea along both medial-lateral and basal-apical axis, although the majority of
SGNs were still correctly located within the Rosenthal’s canal (Fig. 22B,C,E,F). We quantified
the number of mispositioned SGN cell bodies by staining SGNs with parvalbumin (PV) (Wang
et al., 2013)(Fig. 22G,H).E16.5 and E18.5 mutant cochleae exhibited a comparable number of
mispositioned SGNs (Fig. 22I). To determine whether the mispositioned SGNs were possibly
dying neurons being separated from the intact SG, we compared the density of apoptotic neurons
between wild-type and Dcc
-/-
cochleae, using anti-Cleaved Caspase3 antibody (Di cunto et al.,
2000). There were no enhanced apoptotic signals within or around the SG region (Fig. 22J-O).
However, signs of enhanced apoptosis were visible in the already misplaced SGN cell bodies and
70

fibers in the Dcc
-/-
mutant (Fig. 22K,N).These data suggest that the partial disassembly of SG in
the absence of Dcc is not caused by apoptosis.
E14.5 E16.5 E18.5
Dcc-/- WT
A
D
B
E
C
F
Myo6/Tuj1
HC
E16.5
E16.5
Dcc-/-
WT
CC3/Tuj1
sg
HC
J K L
M N O
sg
sg
G
E16.5
Myo6/PV
HC
H
E14 E16 E18 E14 E16 E18
0
20
40
60
80
# of mSGN
I
***
***
WT Dcc-/-
(58) (64)
(0) (0) (0) (0)

71

Figure 22. Mispositioned SGNs in the Dcc mutant cochlea.
(A-F)Representative images of whole-mount wild-type and Dcc
-/-
cochleae at E14.5, E16.5, and E18.5,
immunostained with anti-Myo6 (red) and anti-Tuj1 (green) antibodies. White arrows point to
mispositioned SGN cell bodies. (G,H) Whole-mount E16.5 wild-type and Dcc
-/-
cochleae,
immunostained with anti-Myo6 (red) and anti-PV (white) antibodies. White dotted curve labels the lateral
boundary of SG. (I) Average number of mispositioned SGN cell bodies per cochlea between in wild-type
and Dcc mutant animals at different developmental time points. Data are shown as mean ±SEM. ***p <
0.001, t test. N = 8embryosper group for both genotypes. (J-O) Representative images of whole-mount
wild-type and Dcc
-/-
cochleae at E16.5, immunostained with anti-CC3 (red) and anti-Tuj1 (green)
antibodies. Superimposed images of SG fibers and CC3 positive signals are shown in (L,O). Arrows
point to selected mispositioned SGN cell bodies showing CC3 labeling. Arrowhead points to selective
misrouted SG fibers showing CC3 labeling. White dotted curve labels the lateral boundary of SG. All
scale bars represent 50 μm.

The spatial distribution pattern of mis-migrated SGNs appeared to change developmentally. For
example, there were significantly fewer mispositioned SGN cell bodies in the lesser epithelial
ridge (LER), but more mispositioned SGNs in the greater epithelial ridge (GER) at E18.5 than
E16.5 (Fig. 23A-C). For a systematic analysis of the location of ectopic SGNs, we reconstructed
three dimensional (3D) images from confocal z-stacks. The 3D reconstructed images revealed
that every single mispositioned SGN cell body ended up in the space dorsal to HC layers
regardless of their lateral-medial positions (Fig. 23D-G). The mispositioned SGNs medial to HC
rows were located within the spiral lamina canal (slc) where inner radial bundles (irb) passed
through (Fig. 23F,G, white and red arrows). The SGN cell bodies in the LER (which is lateral to
HC rows) were located on the same dorsal-ventral plane as the inner radial bundles (Fig. 23G,
yellow arrow). Therefore, none of the mispositioned SGNs occupied the space within the organ
of Corti per se.

72

E16.5 Dcc-/- E18.5 Dcc-/-
E16.5 Dcc-/-
A B
Myo6/Tuj1
HC
LER
HC
LER
D
sg
V
D
L
M
A
P
HC
irb
E
F
C
E14 E16 E18
0
20
40
60
# of mSGNs
**
LER
GER
**
(24.6)
(33.4)
(8.8)
(55.2)
(0)
HC
irb
slc
G
HC
irb
slc
GER GER

Figure 23. Developmental changes of SGN positions in the Dcc mutant.
(A-B) Representative images of whole-mount Dcc
-/-
cochlea at E16.5 and E18.5, immunostained with anti-
Myo6 (red) and anti-Tuj1 (green) antibodies. Arrows mark SGN cell bodies located in the lesser epithelial
ridge (LER). (C) Average number of mispositioned SGN cell bodies in LER and GER regions per cochlea
in Dcc mutants at different time points. Data are shown as mean ±SEM. **p < 0.01, t test. N = 8embryos
per group. (D) Representative z-stack projection image of whole-mount wild-type cochleae at E16.5,
immunostained with anti-Myo6 (red) and anti-Tuj1 (green) antibodies. (E) 3D reconstructed 30° angled
transverse z-stacked image of (D). “HC”, hair cells; “sg”, spiral ganglion; “irb”, inner radial bundle; “slc”,
spiral laminal canal; V, ventral; D, dorsal; A, anterior; P, posterior; M, medial; L, lateral. (F,G)
Transverse views from the 3D image in (E) at horizontal planes of the indicated mispositioned SGNs by
arrows in (D,E). Arrows of the same color indicate same mispositioned SGN cell bodies shown in (D-G).
All scale bars represent 50 μm.

73

2.2.5 Inappropriate SGN exit from the Rosenthal’s canal towards the CNS

As a previous report has demonstrated the importance of Dcc in confining spinal interneuron cell
bodies and their axons within the central nervous system (CNS) (Laumonnerie et al., 2014), we
hypothesized that the proper organization of the central auditory pathway may also require Dcc.
To test this hypothesis, we examined the SG assembly in the Rosenthal’s canal in cross-sections
of Dcc mutant cochleae. In E18.5 wild-type cochleae, there was no single SGN cell body
observed outside the Rosenthal’s canal (Fig. 24A-C,G). However, in the absence of Dcc, some
SGN cell bodies drifted away from the Rosenthal’s canal along the pathway of the central
auditory nerve (can) (Fig. 24D-F,H). The onset of ectopic SGNs in the central auditory nerve
pathway (E16.5) was comparable to that in the periphery (Fig. 24I). At E14.5, SGNs were
properly confined within the Rosenthal’s canal without mispositioned SGNs observed in the
central auditory nerve pathway across the cochlea (Fig. 24I).
74

(15.8)
(14.7)
WT Dcc-/-
E18.5
E18.5
PV
WT Dcc-/-
E18.5
E14 E16 E18 E14 E16 E18
0
5
10
15
20
# of mSGN / RC
WT Dcc-/-
A B C
D E F
G H I
E18.5
PV/Tuj1
oc
rc
rc
can
***
***
(0) (0) (0) (0)
can
can

Figure 24. Mispositioning of SGNs along the central auditory pathway in Dcc mutant.
(A-F) Cross-sectional images of E18.5 wild-type and Dcc
-/-
cochleae, immunostained with anti-PV (red)
antibody. Images in middle and right panels are high-magnification views of the regions marked with
white dotted squares. Arrows point to some of mispositioned SGN cell bodies. “oc”, organ of corti; “rc”,
Rosenthal’s canal; “can”, central auditory nerve. (G,H) Cross-sectional views of the Rosenthal’s canal
region of a wild-type and Dcc
-/-
cochlea at E18.5, immunostained with anti-PV (red) and anti-Tuj1 (green)
antibodies. (I) Average number of mispositioned SGN cell bodies within 200 μm distance from the
Rosenthal’s canal along the central auditory nerve. Data are shown as mean ±SEM. ***p < 0.001, t test.
N = 6embryosper group for both genotypes. All scale bars represent 30 μm.

Mispositioning of SGNs was also evident at the terminal region of central auditory nerve axons
in the cochlear nucleus (Fig. 25A-D). This abnormality was significant at as early as E16.5 (Fig.
25E-G), similar to the developmental defect in the periphery (Fig. 22I). In addition, there were
aberrant fiber bundles deviating from the main trajectory of the central axons, whereas the
75

controlcentral axons exhibited a compact trajectory (Fig. 25A,C, arrowheads). In the wild-type
cochlea, the central axons bifurcated, with the ascending and descending branches projecting
towards the anterior and posterior parts of the ventral cochlear nucleus respectively (Nayagam et
al., 2011)(Fig. 25B). The bifurcation pattern appeared different in the Dcc mutant, with relatively
fewer ascending axons into the anterior ventral cochlear nucleus (Fig. 25B,D,E,F). These results
demonstrate that the phenotypic defect in the periphery of Dcc mutants was also duplicated to
some extent in the central auditory pathway, with a similar developmental onset. In addition,
Dcc may also play a role in regulating bifurcation of the central axons.
E14 E16 E18 E14 E16 E18
0
10
20
# of scattered SGN
WT
AVCN
DCN
PVCN
AVCN
DCN
PVCN
WT
Dcc-/-
WT
A B
C D
E F G
Dcc-/-
E16.5
E16.5
E16.5 E16.5
DiI
Dcc-/-
**
**
(3.3)
(4.3)
(6)
(5)
(15.3)
(12.4)

Figure 25. Disorganized of central auditory nerves towards the cochlear nucleus.
(A-D) DiI-labeled auditory nerve fibers(red) extending from the cochlea to cochlear nucleus in sagittal
sections of hindbrains of wild-type and Dcc
-/-
animals at E16.5, merged with the corresponding DIC
image. Images in (B,D) are high-magnification views of bifurcated nerve fibers shown in (A,C). Arrows
76

point to scattered SGN cell bodies. Arrowhead points to aberrant axon bundles drifting away from the
body of central nerve. “DCN”, dorsal cochlear nucleus; “PVCN”, posteroventral cochlear nucleus;
“AVCN”, anteroventral cochlear nucleus. (E,F) Sagittally sectioned E16.5 cochlear nucleus from another
wild-type and Dcc-/- animal, with auditory nerve fibers labeled with DiI. Arrows point to scattered SGN
cell bodies. (G) Average number of scattered SGN cell bodies in the proximity of auditory axon terminals
within the cochlear nucleus from E14.5 to E18.5 for wild-type and Dcc
-/-
animals. **p < 0.01, t test. N =
5embryosper group for both genotypes. All scale bars represent 100 μm.

2.2.6 Absence of defective auditory innervation phenotype in Ntn1 mutant
Based on the broad characterization of functional interactions of Ntn1 and Dcc in the central
nervous system (CNS) as axon guidance cues (Yu and Bargmann, 2001; Arakawa, 2004) and
resemblance of nervous system defects in Dcc and Ntn1 knockout mice (Serafini et al., 1996;
Fazeli et al., 1997), we reasoned that Ntn1 would be expressed by the SGNs or within the
pathway of peripheral SG innervating fibers. Thus we examined expression pattern of Ntn1 in
E17.5 mouse cochlea when Dcc was strongly expressed by the SGNs. Surprisingly, Ntn1 was not
detected at appreciable level in cochlea (Fig. 26A). The most strongly expressed Ntn1 transcript
was in fact found at the small end portions of Reissner’s member near the SG boundary, which
remained on the tissue after dissection (Fig. 26A). This expression pattern was consistent with a
previous report demonstrating an absence of Ntn1 in the SG, but its presence only in the
Reissner’s membrane (Salminen et al., 2000). Further examination of possible involvement of
Ntn1 via Dcc in peripheral auditory circuit development with Ntn1 KO cochleae showed no
obvious defects of innervations patterns or SG assembly as shown in Dcc mutants (Fig. 26B,C).
The lack of Ntn1 transcript led to a survey of another known Dcc interacting ligand, Draxin.
Transcript of Draxin was distributed specifically in the SGNs and hair cell region (Fig. 26D).
These results demonstrate that Dcc may not mediate functional signaling cascades with Ntn1 in
77

cochlear circuit development but may be involved with Draxin according to its complementary
expression pattern with Dcc.
B C
E16.5
A
sg
ger
oc
Ntn1 Draxin
E17.5
D
sg
oc
ger
E17.5 Myo6/Tuj1
rm

Figure 26. Normal peripheral SG organization in Ntn1 mutant cochlea.
(A)In situ hybridization of Ntn1 in the whole-mount cochlea at E17.5. “oc”, organ of corti; “ger”, greater
epithelial ridge; “sg”, spiral ganglion; “rm”, reissner’s membrane. (B)Representative images of whole-
mount Ntn1cochlea at E16.5, immunostained with anti-Myo6 (red) and anti-Tuj1 (green) antibodies. (C)
Higher magnification images of cochleae shown in (B). (D)In situ hybridization of Draxin in the whole-
mount cochlea at E17.5. All scale bars represent 50 μm.

2.3 Discussions
Our study suggests that Dcc mediates the proper organization of SG assembly and its innervation
pattern in the developing auditory circuitry. Dcc
-/-
mice exhibited spatial disorganization of SG
cell bodies and fibers in both peripheral and central auditory pathways beginning from E16.5.

2.3.1 Simultaneous defects in peripheral and central auditory pathways
The distinct developmental time point when the mispositioning of SGN cell bodies occurs,
indicates that the observed phenotypic defects are not due to any abnormality in the initial
delamination of neuroblasts from the otocyst when forming a SG aggregate, which occurs at
around E10 (Kelley, 2006). Although the development of the central projections occurs earlier
78

than the peripheral, with the central projections reaching the hindbrain at around E11.5 (Appler
and Goodrich, 2011), in Dcc mutants the central and peripheral auditory projections developed
defective phenotypes simultaneously. This suggests that Dcc deletion affects a developmental
process common for the central and peripheral auditory projections.
Previously we reported defects in SGN positioning in Slit2 (and Robo) mutant mice (Wang et al.,
2013). Although the overall defective phenotype appears similar between Slit2 and Dcc mutants,
the developmental contexts that trigger these defects may be different in the two mutants, as the
onsets of initial mis-migration of SGNs are not the same. In Slit2 mutants, mispositioned SGNs
were seen starting from E14.5 when SGNs start to extend their peripheral axons towards the
organ of Corti, while in Dcc mutants mispositioning of SGNs was only observable starting from
E16.5. Based on the currently known developmental processes during mouse cochlear
development, there is a possibility that the defect in Dcc mutants may be linked to convergent
extension, which also begins at around E16 (McKenzie et al., 2004). During the convergent
extension process, the cochlear duct extends, resulting in significant changes in cochlear length
and width (McKenzie et al., 2004; Yamamoto et al., 2009). SGNs are inevitably engaged in this
process as they elongate and migrate along with the growing cochlear duct, undergoing cellular
interactions such as rearrangements of the cytoskeleton via certain surface molecules (Yang et al,
2011). The whole process would most likely bring a physical tension upon the assembly of
SGNs. Possibly, in Dcc mutants the SG interneuronal interactions become less effective to
overcome this tension, resulting in disassembly of SG. Our results are reminiscent of a previous
report that Dcc can mediate the adhesion of spinal commissural neurons to substrate-bound
netrin-1 proteins (Shekarabi et al., 2005). We thus postulate that Dcc is involved in maintaining
79

strong SGN interactions for a proper confinement of their cell bodies within the Rosenthal’s
canal.

2.3.2 Spatial distribution pattern of misrouted fibers
Although the neurites extended from the mispositioned SGNs contributed to the overall pattern
of disorganized SG fibers in the periphery, a significant portion of defective fibers seemed to
originate directly from the SG (Fig. 19H,I). Whether the disorganized fibers are a secondary
effect to the mispositioning of SGNs within and out of the Rosenthal’s canal or a direct effect of
absence of Dcc signaling for axon guidance remains unclear. Misrouted fibers may just be
consequences of loss of the correct positional organization in SG. It is also possible that absence
of Dcc disrupted the navigation of the pioneer SGNs that first extend neurites to pioneer the
route for subsequent follower neurites, which led to the misrouting (Raper and Mason, 2010).
Further investigations will provide mechanisms behind Dcc signaling in organization of SGN
fibers.
All the ectopic SGNs in the periphery and CNS were mis-migrated along the auditory nerves and
were largely confined to the nerve pathway. The misrouted SG fibers, on the other hand, were
less spatially restricted compared with SGN cell bodies, as they were scattered throughout the
cochlea. This difference in distribution pattern between cell bodies and fibers may be due to
limited routes by which SGN cell bodies can travel through. Previous studies have revealed that
the cochlea is consisted of a web of connective tissue fibers interwoven into a porous meshwork,
which is suitable for the exchange of fluids and molecular substances (Rask-Anderson et al.,
80

2006; Zhang et al., 2012). SGN fibers could have travelled through these connective tissues,
whereas SGN cell bodies could not.

2.3.3 Possible ligands of Dcc
Overall, our results suggest that Dcc regulates the proper spatial patterning of SGNs during
cochlear development. Future work is required to identify the molecular partner of Dcc
underlying its regulation in organization of SGNs and their fibers. Based on the normal cochlear
innervation pattern in Ntn1 mutants, weak expression of Ntn1 in the cochlea, and previous
studies demonstrating non-synergistic interaction of Dcc and Ntn1 (Meyerhardt et al., 1999;
Corset et al., 2000; Guijarro et al., 2006), it is likely that molecules other than Ntn1 serve as Dcc
ligands in developing mouse cochlea. In fact, Draxin has recently been reported to bind to Dcc
and function in proper neural connections in the central nervous system (Islam et al., 2009;
Ahmed et al., 2011). Whether Draxin can serve as Dcc-interacting partners in SG awaits to be
tested in the future. The synaptic loss on hair cells in Dcc mutants raises the possibility that Dcc
can be directly involved in sensorineural hearing loss, although this needs to be further validated.
Besides the reduced afferent inputs, hearing impairments due to Dcc mutations may involve
several other defects along the entire auditory pathway as there has been a study demonstrating
inability of axons of ventral cochlear neurons (VCN) to cross midline in the absence of Dcc
(Howell et al., 2007). Dcc
Kanga
strain can be utilized to test the direct connection between hearing
loss and Dcc, since the homozygous survives into the adulthood and shows the similar brain
defects as those reported for the targeted allele of Dcc (Finger et al., 2002). In addition, it will be
of particular interest to examine human patients with mirror movements for hearing deficits.
81

2.4 Experimental procedures and Materials
Mouse strains
Mice were handled according to the protocols approved by the Institutional Animal Care and Use
Committees at the University of Southern California (USC). The Dcc (Dcc
tm1Wbg
) (Fazeli et al.,
1997) mouse line was maintained on C57BL/6 background. Dcc homozygous mutants were
obtained by crossing heterozygous littermates with the plug day designated as E0.5. Dcc
+/-
and Dcc
-/-
embryos were genotyped by genomic PCR (gPCR) using wild-type forward
(5′ggccattgaggttccttt3′), wild-type reverse (5′aagacgaccacacgcgag3′) and mutant reverse
(5′tcctcgtgctttacggtatc3′) primers.Ntn1 mutant embryos were obtained from Dr. Le Ma.
Tissue dissection, FACS, RNA amplification, and RNA sequencing
Preparation of RNA sequencing samples and sequencing were performed as described previously
(Kim et al., 2015). In short, RNA was extracted from the distinct populations of fluorescently
labeled HCs, GER cells and SGNs, purified from Gad-GFP and PV-Cre::Ai6 cochleae. Each
RNA sample was then amplified using WT-Ovation Pico amplification kit (Nugen) and
sequenced with Illumina HiSeq 2000 (Illumina) at the USC Genomics Center following the
manufacturer’s instructions.
Immunohistochemistry
For whole-mount beta-III Tubulin (Tuj-1), Myosin6 (Myo6), C-terminal binding protein 2
(CtBP2), Cleaved Caspase-3 (CC3), and Parvalbumin (PV) staining, mouse heads at desired time
points were fixed with 4% PFA for 2-24hours. Fixed cochleae were dissected out and
permeabilized with 0.5% TrionX-100 followed by incubation in 10% serum blocking buffer for
at least 1 hour at room temperature. Incubation of primary antibody was carried out for overnight
82

at 4°C, followed by Alexa-conjugated secondary antibodies (1:1000, Invitrogen). For cross-
section staining, mouse heads were fixed with 4% PFA for overnight. Fixed inner ear bone
structure was dissected out and cryoprotected with sucrose. Tissue was then embedded in OCT
(Tissue-Tek) and cut into 35-µm sections using a vibrotome (Leica). Sections were later stained
using Tuj-1, Myo6, and PV as the whole-mount staining procedure. Antibodies used in this study
and their dilution were as followed: Alexa488-conjugated mouse anti-Tuj1 (1:300; Covance),
rabbit anti-PV (1:300; Swant Inc.), rabbit anti-Myo6 (1:500, Millipore), mouse anti-CtBP2
(1:250, BD Biosciences), rabbit anti-CC3 (1:300, Cell Signaling Technology).
Imaging
Confocal z-stack images were obtained using Fluoview1000 (Olympus), projected using
National Institutes of Health (NIH) ImageJ and further processed using Inkscape.

In situ hybridization
In situ hybridization was performed as previously described (Wang et al., 2013). Probes were
generated using cDNA probes by RT-PCR. Primer pair for Dcc follows: forward 5
’
-
ATGGTGACCAAGAACAGAAGGT-3
’
and reverse 5
’
-AATCACTGCTACAATCACCACG-3
’
.
Primer pair for Netrin-1 follows: forward 5
’
-CTTCCTCACCGACCTCAATAAC-3
’
and reverse
5
’
-TAGAGCTCCATGTTGAATCTGC-3
’
. Primer pair for Draxin follows: forward 5
’
-
CAGGGAGGTTTAGGACAAACAG-3
’
and reverse 5
’
- TGTAGGAGCTGAGGGAAAGAAG-
3
’
. After subcloning, the identity of the probe was confirmed by DNA sequencing.

83

Dye labeling
Embryonic mouse head was fixed in 4% PFA for at least overnight. Cochlea was exposed by
removing the inner ear bones and a small crystal of lipophilic carbocyanin dye 1,1’-dioctadecyl-
3,3,3’,3’-tetramethylindocarbocyanine perchlorate (DiI, Molecular Probes
TM
) was placed in the
mid turn of the cochlea and incubated at 37°C in PBS for 4 days. Cochlear nuclei were then
sectioned with a sagittal plane cut of the fixed head at 300 μm thickness to include the entire
cochlea nucleus in one section. Dissected pieces of cochlear nucleus were then cleared with
Clear
T
(Kuwajima et al., 2013) and imaged with confocal microscopy. For DiI labeling of
efferent fibers, small piece of DiI crystal was inserted into the olivocochlear fiber pathway and
incubated at 37°C in PBS for 3 weeks. Cochlea was dissected out and imaged whole-mount with
confocal microscopy.

Image analysis and statistics
All the confocal image stacks were processed in Fiji (ImageJ) software and 3D reconstructions
were performed using Olympus FV10-ASW 3.1 software. The hair cell layers and boundaries of
SG were identified based on the immunostaining of Myo6 and Tuj1, respectively, from the
image series of the confocal Z-stack. For calculating area occupancy by fibers, whole-mount
immunostained z-stacks from the apex to base of HCs were converted to binary images. Pixels of
outlined objects in binary images were then counted and subtracted from the pixel number of the
total area. Significance was tested using two-tailed Student’s t-test.
Mispositioned SG cell bodies were identified and quantified based on SGN cell body
morphology by DiI labeling or PV/Tuj-1 immunostaining. For quantification of number of
mispositioned SGNs along the central auditory pathway, a circular boundary with 200 μm radius
84

was set, with the center positioned at the most medial edge of the Rosenthal’s canal, and any
SGNs within this range were counted. For counting ribbon synapses on inner hair cells, whole-
mount cochleae stained with anti-CtBP2were used to acquire confocal z-stacks with 0.3 µm
intervals. The total number of ribbon synapses was divided by the total number of IHC nuclei
(stained with anti-CtBP2) to obtain the average number of synapses per IHC. Significance was
tested using two tailed Student’s t-test.

85

Bibliography
Ahmed G, Shinmyo Y, Ohta K, Islam SM, Hossain M, Naser IB, Riyadh MA, Su Y, Zhang S,
Tessier-Lavigne M, Tanaka H (2011) Draxin inhibits axonal outgrowth through the netrin
receptor DCC. The Journal of neuroscience: the official journal of the Society for
Neuroscience 31:14018-14023.
Alcantara S, Ruiz M, De Castro F, Soriano E, Sotelo C (2000) Netrin 1 acts as an attractive or as
a repulsive cue for distinct migrating neurons during the development of the cerebellar
system. Development 127:1359-1372.
Appler JM, Goodrich LV (2011) Connecting the ear to the brain: Molecular mechanisms of
auditory circuit assembly. Progress in neurobiology 93:488-508.
Arakawa H (2004) Netrin-1 and its receptors in tumorigenesis. Nature reviews Cancer 4:978-
987.
Arvanitis D, Davy A (2008) Eph/ephrin signaling: networks. Genes & development 22:416-429.
Barallobre MJ, Pascual M, Del Rio JA, Soriano E (2005) The Netrin family of guidance factors:
emphasis on Netrin-1 signalling. Brain research Brain research reviews 49:22-47.
Battye R, Stevens A, Jacobs JR (1999) Axon repulsion from the midline of the Drosophila CNS
requires slit function. Development 126:2475-2481.
Benson MD, Romero MI, Lush ME, Lu QR, Henkemeyer M, Parada LF (2005) Ephrin-B3 is a
myelin-based inhibitor of neurite outgrowth. Proceedings of the National Academy of
Sciences of the United States of America 102:10694-10699.
Bianchi LM, Gale NW (1998) Distribution of Eph-related molecules in the developing and
mature cochlea. Hearing research 117:161-172.
Bianchi LM, Liu H (1999) Comparison of ephrin-A ligand and EphA receptor distribution in the
developing inner ear. The Anatomical record 254:127-134.
Bianchi LM, Gray NA (2002) EphB receptors influence growth of ephrin-B1-positive
statoacoustic nerve fibers. The European journal of neuroscience 16:1499-1506.
Brown SD, Hardisty-Hughes RE, Mburu P (2008) Quiet as a mouse: dissecting the molecular
and genetic basis of hearing. Nature reviews Genetics 9:277-290.
Brownlee H, Gao PP, Frisen J, Dreyfus C, Zhou R, Black IB (2000) Multiple ephrins regulate
hippocampal neurite outgrowth. The Journal of comparative neurology 425:315-322.
Cataltepe S, Tuncbilek E (1992) A family with one child with acrocallosal syndrome, one child
with anencephaly-polydactyly, and parental consanguinity. European journal of pediatrics
151:288-290.
Chai G, Zhou L, Manto M, Helmbacher F, Clotman F, Goffinet AM, Tissir F (2014) Celsr3 is
required in motor neurons to steer their axons in the hindlimb. Nature neuroscience
17:1171-1179.
Chen ZY, Corey DP (2002) An inner ear gene expression database. Journal of the Association
for Research in Otolaryngology : JARO 3:140-148.
Ciuman RR (2010) The efferent system or olivocochlear function bundle - fine regulator and
protector of hearing perception. International journal of biomedical science : IJBS 6:276-
288.
Clifford MA, Athar W, Leonard CE, Russo A, Sampognaro PJ, Van der Goes MS, Burton DA,
Zhao X, Lalchandani RR, Sahin M, Vicini S, Donoghue MJ (2014) EphA7 signaling
guides cortical dendritic development and spine maturation. Proceedings of the National
Academy of Sciences of the United States of America 111:4994-4999.
86

Coate TM, Kelley MW (2013) Making connections in the inner ear: recent insights into the
development of spiral ganglion neurons and their connectivity with sensory hair cells.
Seminars in cell & developmental biology 24:460-469.
Coate TM, Raft S, Zhao X, Ryan AK, Crenshaw EB, 3rd, Kelley MW (2012) Otic mesenchyme
cells regulate spiral ganglion axon fasciculation through a Pou3f4/EphA4 signaling
pathway. Neuron 73:49-63.
Coate TM, Spita NA, Zhang KD, Isgrig KT, Kelley MW (2015) Neuropilin-2/Semaphorin-3F-
mediated repulsion promotes inner hair cell innervation by spiral ganglion neurons. Elife
4.
Colamarino SA, Tessier-Lavigne M (1995) The axonal chemoattractant netrin-1 is also a
chemorepellent for trochlear motor axons. Cell 81:621-629.
Corset V, Nguyen-Ba-Charvet KT, Forcet C, Moyse E, Chedotal A, Mehlen P (2000) Netrin-1-
mediated axon outgrowth and cAMP production requires interaction with adenosine A2b
receptor. Nature 407:747-750.
Cotrufo T, Andres RM, Ros O, Perez-Branguli F, Muhaisen A, Fuschini G, Martinez R, Pascual
M, Comella JX, Soriano E (2012) Syntaxin 1 is required for DCC/Netrin-1-dependent
chemoattraction of migrating neurons from the lower rhombic lip. The European journal
of neuroscience 36:3152-3164.
Cowan CA, Yokoyama N, Bianchi LM, Henkemeyer M, Fritzsch B (2000) EphB2 guides axons
at the midline and is necessary for normal vestibular function. Neuron 26:417-430.
Cramer KS, Gabriele ML (2014) Axon guidance in the auditory system: multiple functions of
Eph receptors. Neuroscience 277:152-162.
Culotti JG, Merz DC (1998) DCC and netrins. Current opinion in cell biology 10:609-613.
Davy A, Gale NW, Murray EW, Klinghoffer RA, Soriano P, Feuerstein C, Robbins SM (1999)
Compartmentalized signaling by GPI-anchored ephrin-A5 requires the Fyn tyrosine
kinase to regulate cellular adhesion. Genes & development 13:3125-3135.
Defourny J, Poirrier AL, Lallemend F, Mateo Sanchez S, Neef J, Vanderhaeghen P, Soriano E,
Peuckert C, Kullander K, Fritzsch B, Nguyen L, Moonen G, Moser T, Malgrange B
(2013) Ephrin-A5/EphA4 signalling controls specific afferent targeting to cochlear hair
cells. Nature communications 4:1438.
Defourny J, Poirrier AL, Lallemend F, Mateo Sanchez S, Neef J, Vanderhaeghen P, Soriano E,
Peuckert C, Kullander K, Fritzsch B, Nguyen L, Moonen G, Moser T, Malgrange B
(2013) Ephrin-A5/EphA4 signalling controls specific afferent targeting to cochlear hair
cells. Nature communications 4:1438.
Deiner MS, Kennedy TE, Fazeli A, Serafini T, Tessier-Lavigne M, Sretavan DW (1997) Netrin-
1 and DCC mediate axon guidance locally at the optic disc: loss of function leads to optic
nerve hypoplasia. Neuron 19:575-589.
Depaepe V, Suarez-Gonzalez N, Dufour A, Passante L, Gorski JA, Jones KR, Ledent C,
Vanderhaeghen P (2005) Ephrin signalling controls brain size by regulating apoptosis of
neural progenitors. Nature 435:1244-1250.
Depienne C, Cincotta M, Billot S, Bouteiller D, Groppa S, Brochard V, Flamand C, Hubsch C,
Meunier S, Giovannelli F, Klebe S, Corvol JC, Vidailhet M, Brice A, Roze E (2011) A
novel DCC mutation and genetic heterogeneity in congenital mirror movements.
Neurology 76:260-264.
Di Cunto F, Imarisio S, Hirsch E, Broccoli V, Bulfone A, Migheli A, Atzori C, Turco E, Triolo
R, Dotto GP, Silengo L, Altruda F (2000) Defective neurogenesis in citron kinase
87

knockout mice by altered cytokinesis and massive apoptosis. Neuron 28:115-127.
Dickson BJ (2002) Molecular mechanisms of axon guidance. Science 298:1959-1964.
Dottori M, Hartley L, Galea M, Paxinos G, Polizzotto M, Kilpatrick T, Bartlett PF, Murphy M,
Kontgen F, Boyd AW (1998) EphA4 (Sek1) receptor tyrosine kinase is required for the
development of the corticospinal tract. Proceedings of the National Academy of Sciences
of the United States of America 95:13248-13253.
Drescher U, Kremoser C, Handwerker C, Loschinger J, Noda M, Bonhoeffer F (1995) In vitro
guidance of retinal ganglion cell axons by RAGS, a 25 kDa tectal protein related to
ligands for Eph receptor tyrosine kinases. Cell 82:359-370.
Fazeli A, Dickinson SL, Hermiston ML, Tighe RV, Steen RG, Small CG, Stoeckli ET, Keino-
Masu K, Masu M, Rayburn H, Simons J, Bronson RT, Gordon JI, Tessier-Lavigne M,
Weinberg RA (1997) Phenotype of mice lacking functional Deleted in colorectal cancer
(Dcc) gene. Nature 386:796-804.
Feldheim DA, Kim YI, Bergemann AD, Frisen J, Barbacid M, Flanagan JG (2000) Genetic
analysis of ephrin-A2 and ephrin-A5 shows their requirement in multiple aspects of
retinocollicular mapping. Neuron 25:563-574.
Finger JH, Bronson RT, Harris B, Johnson K, Przyborski SA, Ackerman SL (2002) The netrin 1
receptors Unc5h3 and Dcc are necessary at multiple choice points for the guidance of
corticospinal tract axons. The Journal of neuroscience : the official journal of the Society
for Neuroscience 22:10346-10356.
Forcet C, Stein E, Pays L, Corset V, Llambi F, Tessier-Lavigne M, Mehlen P (2002) Netrin-1-
mediated axon outgrowth requires deleted in colorectal cancer-dependent MAPK
activation. Nature 417:443-447.
Forget R, Boghen D, Attig E, Lamarre Y (1986) Electromyographic studies of congenital mirror
movements. Neurology 36:1316-1322.
Gale NW, Holland SJ, Valenzuela DM, Flenniken A, Pan L, Ryan TE, Henkemeyer M,
Strebhardt K, Hirai H, Wilkinson DG, Pawson T, Davis S, Yancopoulos GD (1996) Eph
receptors and ligands comprise two major specificity subclasses and are reciprocally
compartmentalized during embryogenesis. Neuron 17:9-19.
Gao PP, Sun CH, Zhou XF, DiCicco-Bloom E, Zhou R (2000) Ephrins stimulate or inhibit
neurite outgrowth and survival as a function of neuronal cell type. Journal of
neuroscience research 60:427-436.
Gong TW, Karolyi IJ, Macdonald J, Beyer L, Raphael Y, Kohrman DC, Camper SA, Lomax MI
(2006) Age-related changes in cochlear gene expression in normal and shaker 2 mice.
Journal of the Association for Research in Otolaryngology : JARO 7:317-328.
Groves AK, Fekete DM (2012) Shaping sound in space: the regulation of inner ear patterning.
Development 139:245-257.
Guijarro P, Simo S, Pascual M, Abasolo I, Del Rio JA, Soriano E (2006) Netrin1 exerts a
chemorepulsive effect on migrating cerebellar interneurons in a Dcc-independent way.
Molecular and cellular neurosciences 33:389-400.
Guinan JJ, Jr. (2006) Olivocochlear efferents: anatomy, physiology, function, and the
measurement of efferent effects in humans. Ear and hearing 27:589-607.
Hansen MJ, Dallal GE, Flanagan JG (2004) Retinal axon response to ephrin-as shows a graded,
concentration-dependent transition from growth promotion to inhibition. Neuron 42:717-
730.
Hao JC, Adler CE, Mebane L, Gertler FB, Bargmann CI, Tessier-Lavigne M (2010) The
88

tripartite motif protein MADD-2 functions with the receptor UNC-40 (DCC) in Netrin-
mediated axon attraction and branching. Developmental cell 18:950-960.
Hedgecock EM, Culotti JG, Hall DH (1990) The unc-5, unc-6, and unc-40 genes guide
circumferential migrations of pioneer axons and mesodermal cells on the epidermis in C.
elegans. Neuron 4:61-85.
Hertzano R, Montcouquiol M, Rashi-Elkeles S, Elkon R, Yucel R, Frankel WN, Rechavi G,
Moroy T, Friedman TB, Kelley MW, Avraham KB (2004) Transcription profiling of
inner ears from Pou4f3(ddl/ddl) identifies Gfi1 as a target of the Pou4f3 deafness gene.
Human molecular genetics 13:2143-2153.
Hilgert N, Smith RJ, Van Camp G (2009) Function and expression pattern of nonsyndromic
deafness genes. Current molecular medicine 9:546-564.
Hippenmeyer S, Vrieseling E, Sigrist M, Portmann T, Laengle C, Ladle DR, Arber S (2005) A
developmental switch in the response of DRG neurons to ETS transcription factor
signaling. PLoS biology 3:e159.
Holmberg J, Clarke DL, Frisen J (2000) Regulation of repulsion versus adhesion by different
splice forms of an Eph receptor. Nature 408:203-206.
Holmberg J, Armulik A, Senti KA, Edoff K, Spalding K, Momma S, Cassidy R, Flanagan JG,
Frisen J (2005) Ephrin-A2 reverse signaling negatively regulates neural progenitor
proliferation and neurogenesis. Genes & development 19:462-471.
Howell DM, Morgan WJ, Jarjour AA, Spirou GA, Berrebi AS, Kennedy TE, Mathers PH (2007)
Molecular guidance cues necessary for axon pathfinding from the ventral cochlear
nucleus. The Journal of comparative neurology 504:533-549.
Huang LC, Thorne PR, Housley GD, Montgomery JM (2007) Spatiotemporal definition of
neurite outgrowth, refinement and retraction in the developing mouse cochlea.
Development 134:2925-2933.
Islam SM, Shinmyo Y, Okafuji T, Su Y, Naser IB, Ahmed G, Zhang S, Chen S, Ohta K,
Kiyonari H, Abe T, Tanaka S, Nishinakamura R, Terashima T, Kitamura T, Tanaka H
(2009) Draxin, a repulsive guidance protein for spinal cord and forebrain commissures.
Science 323:388-393.
Izzi L, Charron F (2011) Midline axon guidance and human genetic disorders. Clinical genetics
80:226-234.
Jain RA, Bell H, Lim A, Chien CB, Granato M (2014) Mirror movement-like defects in startle
behavior of zebrafish dcc mutants are caused by aberrant midline guidance of identified
descending hindbrain neurons. The Journal of neuroscience : the official journal of the
Society for Neuroscience 34:2898-2909.
Jiang Y, Liu MT, Gershon MD (2003) Netrins and DCC in the guidance of migrating neural
crest-derived cells in the developing bowel and pancreas. Developmental biology
258:364-384.
Kelley MW (2003) Cell adhesion molecules during inner ear and hair cell development,
including notch and its ligands. Current topics in developmental biology 57:321-356.
Kelley MW (2006) Regulation of cell fate in the sensory epithelia of the inner ear. Nature
reviews Neuroscience 7:837-849.
Kidd T, Brose K, Mitchell KJ, Fetter RD, Tessier-Lavigne M, Goodman CS, Tear G (1998)
Roundabout controls axon crossing of the CNS midline and defines a novel subfamily of
evolutionarily conserved guidance receptors. Cell 92:205-215.
Kim YJ, Ibrahim LA, Wang SZ, Yuan W, Evgrafov OV, Knowles JA, Wang K, Tao HW, Zhang
89

LI (2015) EphA7 regulates spiral ganglion innervation of cochlear hair cells.
Developmental neurobiology.
Klein R (2004) Eph/ephrin signaling in morphogenesis, neural development and plasticity.
Current opinion in cell biology 16:580-589.
Komalavilas P, Shah PK, Jo H, Lincoln TM (1999) Activation of mitogen-activated protein
kinase pathways by cyclic GMP and cyclic GMP-dependent protein kinase in contractile
vascular smooth muscle cells. The Journal of biological chemistry 274:34301-34309.
Koundakjian EJ, Appler JL, Goodrich LV (2007) Auditory neurons make stereotyped wiring
decisions before maturation of their targets. The Journal of neuroscience : the official
journal of the Society for Neuroscience 27:14078-14088.
Kullander K, Mather NK, Diella F, Dottori M, Boyd AW, Klein R (2001) Kinase-dependent and
kinase-independent functions of EphA4 receptors in major axon tract formation in vivo.
Neuron 29:73-84.
Kuwajima T, Sitko AA, Bhansali P, Jurgens C, Guido W, Mason C (2013) ClearT: a detergent-
and solvent-free clearing method for neuronal and non-neuronal tissue. Development
140:1364-1368.
Laumonnerie C, Da Silva RV, Kania A, Wilson SI (2014) Netrin 1 and Dcc signalling are
required for confinement of central axons within the central nervous system.
Development 141:594-603.
Lee KH, Warchol ME (2005) Ephrin A2 may play a role in axon guidance during hair cell
regeneration. The Laryngoscope 115:1021-1025.
Lee KH, Warchol ME (2008) Promotion of neurite outgrowth and axon guidance in spiral
ganglion cells by netrin-1. Arch Otolaryngol Head Neck Surg 134: 146-151.
Lewcock JW, Genoud N, Lettieri K, Pfaff SL (2007) The ubiquitin ligase Phr1 regulates axon
outgrowth through modulation of microtubule dynamics. Neuron 56:604-620.
Lim BK, Matsuda N, Poo MM (2008) Ephrin-B reverse signaling promotes structural and
functional synaptic maturation in vivo. Nature neuroscience 11:160-169.
Liu GC, Ferris EJ, Boyd CM (1990) Diagnostic value of Tc-99m MAA radionuclide venography
of lower extremity: as a simultaneous procedure of ventilation-perfusion scan for
pulmonary embolism. Gaoxiong yi xue ke xue za zhi = The Kaohsiung journal of medical
sciences 6:581-586.
Lu CC, Appler JM, Houseman EA, Goodrich LV (2011) Developmental profiling of spiral
ganglion neurons reveals insights into auditory circuit assembly. The Journal of
neuroscience : the official journal of the Society for Neuroscience 31:10903-10918.
Madisen L, Zwingman TA, Sunkin SM, Oh SW, Zariwala HA, Gu H, Ng LL, Palmiter RD,
Hawrylycz MJ, Jones AR, Lein ES, Zeng H (2010) A robust and high-throughput Cre
reporting and characterization system for the whole mouse brain. Nature neuroscience
13:133-140.
Maison SF, Usubuchi H, Liberman MC (2013) Efferent feedback minimizes cochlear neuropathy
from moderate noise exposure. The Journal of neuroscience : the official journal of the
Society for Neuroscience 33:5542-5552.
Mao Y, Reiprich S, Wegner M, Fritzsch B (2014) Targeted deletion of Sox10 by Wnt1-cre
defects neuronal migration and projection in the mouse inner ear. PloS one 9:e94580.
Marquardt T, Shirasaki R, Ghosh S, Andrews SE, Carter N, Hunter T, Pfaff SL (2005)
Coexpressed EphA receptors and ephrin-A ligands mediate opposing actions on growth
cone navigation from distinct membrane domains. Cell 121:127-139.
90

McGaughran JM, Kuna P, Das V (1998) Audiological abnormalities in the Klippel-Feil
syndrome. Archives of disease in childhood 79:352-355.
McKenzie E, Krupin A, Kelley MW (2004) Cellular growth and rearrangement during the
development of the mammalian organ of Corti. Developmental dynamics : an official
publication of the American Association of Anatomists 229:802-812.
Meier C, Anastasiadou S, Knoll B (2011) Ephrin-A5 suppresses neurotrophin evoked neuronal
motility, ERK activation and gene expression. PloS one 6:e26089.
Melcher JR, Kiang NY (1996) Generators of the brainstem auditory evoked potential in cat. III:
Identified cell populations. Hearing research 93:52-71.
Meneret A et al. (2014) Congenital mirror movements: mutational analysis of RAD51 and DCC
in 26 cases. Neurology 82:1999-2002.
Meyerhardt JA, Caca K, Eckstrand BC, Hu G, Lengauer C, Banavali S, Look AT, Fearon ER
(1999) Netrin-1: interaction with deleted in colorectal cancer (DCC) and alterations in
brain tumors and neuroblastomas. Cell growth & differentiation : the molecular biology
journal of the American Association for Cancer Research 10:35-42.
Miko IJ, Nakamura PA, Henkemeyer M, Cramer KS (2007) Auditory brainstem neural
activation patterns are altered in EphA4- and ephrin-B2-deficient mice. The Journal of
comparative neurology 505:669-681.
Morris JK, Maklad A, Hansen LA, Feng F, Sorensen C, Lee KF, Macklin WB, Fritzsch B (2006)
A disorganized innervation of the inner ear persists in the absence of ErbB2. Brain
research 1091:186-199.
Nadkarni TD, Menon RK, Shah AH, Goel A (2008) Chudley McCullough syndrome. Child's
nervous system : ChNS : official journal of the International Society for Pediatric
Neurosurgery 24:541-544.
Nakanishi H, Nakamura T, Canaani E, Croce CM (2007) ALL1 fusion proteins induce
deregulation of EphA7 and ERK phosphorylation in human acute leukemias. Proceedings
of the National Academy of Sciences of the United States of America 104:14442-14447.
Nayagam BA, Muniak MA, Ryugo DK (2011) The spiral ganglion: connecting the peripheral
and central auditory systems. Hearing research 278:2-20.
Niclou SP, Jia L, Raper JA (2000) Slit2 is a repellent for retinal ganglion cell axons. The Journal
of neuroscience : the official journal of the Society for Neuroscience 20:4962-4974.
Niu H, Makmura L, Shen T, Sheth SS, Blair K, Friedman RA (2006) Identification of two major
loci that suppress hearing loss and cochlear dysmorphogenesis in Eya1bor/bor mice.
Genomics 88:302-308.
Notermans SL, Go KG, Boonstra S (1970) EMG studies of associated movements in a patient
with Klippel-Feil syndrome. Psychiatria, neurologia, neurochirurgia 73:257-266.
Ohori M, Kinoshita T, Okubo M, Sato K, Yamazaki A, Arakawa H, Nishimura S, Inamura N,
Nakajima H, Neya M, Miyake H, Fujii T (2005) Identification of a selective ERK
inhibitor and structural determination of the inhibitor-ERK2 complex. Biochemical and
biophysical research communications 336:357-363.
Oricchio E, Nanjangud G, Wolfe AL, Schatz JH, Mavrakis KJ, Jiang M, Liu X, Bruno J, Heguy
A, Olshen AB, Socci ND, Teruya-Feldstein J, Weis-Garcia F, Tam W, Shaknovich R,
Melnick A, Himanen JP, Chaganti RS, Wendel HG (2011) The Eph-receptor A7 is a
soluble tumor suppressor for follicular lymphoma. Cell 147:554-564.
Orioli D, Henkemeyer M, Lemke G, Klein R, Pawson T (1996) Sek4 and Nuk receptors
cooperate in guidance of commissural axons and in palate formation. The EMBO journal
91

15:6035-6049.
Pasquale EB (2005) Eph receptor signalling casts a wide net on cell behaviour. Nature reviews
Molecular cell biology 6:462-475.
Passante L, Gaspard N, Degraeve M, Frisen J, Kullander K, De Maertelaer V, Vanderhaeghen P
(2008) Temporal regulation of ephrin/Eph signalling is required for the spatial patterning
of the mammalian striatum. Development 135:3281-3290.
Perkins RE, Morest DK (1975) A study of cochlear innervation patterns in cats and rats with the
Golgi method and Nomarkski Optics. The Journal of comparative neurology 163:129-
158.
Pickles JO (2003) Expression of Ephs and ephrins in developing mouse inner ear. Hearing
research 178:44-51.
Pickles JO, Claxton C, Van Heumen WR (2002) Complementary and layered expression of Ephs
and ephrins in developing mouse inner ear. The Journal of comparative neurology
449:207-216.
Rajasekharan S, Baker KA, Horn KE, Jarjour AA, Antel JP, Kennedy TE (2009) Netrin 1 and
Dcc regulate oligodendrocyte process branching and membrane extension via Fyn and
RhoA. Development 136:415-426.
Raper JA (2000) Semaphorins and their receptors in vertebrates and invertebrates. Current
opinion in neurobiology 10:88-94.
Raper J, Mason C (2010) Cellular strategies of axonal pathfinding. Cold Spring Harbor
perspectives in biology 2:a001933.
Rashid T, Upton AL, Blentic A, Ciossek T, Knoll B, Thompson ID, Drescher U (2005)
Opposing gradients of ephrin-As and EphA7 in the superior colliculus are essential for
topographic mapping in the mammalian visual system. Neuron 47:57-69.
Rask-Andersen H, Schrott-Fischer A, Pfaller K, Glueckert R (2006) Perilymph/modiolar
communication routes in the human cochlea. Ear and hearing 27:457-465.
Rasmussen P (1993) Persistent mirror movements: a clinical study of 17 children, adolescents
and young adults. Developmental medicine and child neurology 35:699-707.
Royal SA, Tubbs RS, D'Antonio MG, Rauzzino MJ, Oakes WJ (2002) Investigations into the
association between cervicomedullary neuroschisis and mirror movements in patients
with Klippel-Feil syndrome. AJNR American journal of neuroradiology 23:724-729.
Ryugo DK, Montey KL, Wright AL, Bennett ML, Pongstaporn T (2006) Postnatal development
of a large auditory nerve terminal: the endbulb of Held in cats. Hearing research 216-
217:100-115.
Saeger BM, Suhm M, Neubuser A (2011) Ephrin/ephrin receptor expression during early stages
of mouse inner ear development. Developmental dynamics : an official publication of the
American Association of Anatomists 240:1578-1585.
Sajan SA, Warchol ME, Lovett M (2007) Toward a systems biology of mouse inner ear
organogenesis: gene expression pathways, patterns and network analysis. Genetics
177:631-653.
Salminen M, Meyer BI, Bober E, Gruss P (2000) Netrin 1 is required for semicircular canal
formation in the mouse inner ear. Development 127:13-22.
Schaette R, McAlpine D (2011) Tinnitus with a normal audiogram: physiological evidence for
hidden hearing loss and computational model. The Journal of neuroscience : the official
journal of the Society for Neuroscience 31:13452-13457.
Schwarting GA, Kostek C, Bless EP, Ahmad N, Tobet SA (2001) Deleted in colorectal cancer
92

(DCC) regulates the migration of luteinizing hormone-releasing hormone neurons to the
basal forebrain. The Journal of neuroscience : the official journal of the Society for
Neuroscience 21:911-919.
Seaman C, Anderson R, Emery B, Cooper HM (2001) Localization of the netrin guidance
receptor, DCC, in the developing peripheral and enteric nervous systems. Mechanisms of
development 103:173-175.
Serafini T, Kennedy TE, Galko MJ, Mirzayan C, Jessell TM, Tessier-Lavigne M (1994) The
netrins define a family of axon outgrowth-promoting proteins homologous to C. elegans
UNC-6. Cell 78:409-424.
Serafini T, Colamarino SA, Leonardo ED, Wang H, Beddington R, Skarnes WC, Tessier-
Lavigne M (1996) Netrin-1 is required for commissural axon guidance in the developing
vertebrate nervous system. Cell 87:1001-1014.
Shekarabi M, Moore SW, Tritsch NX, Morris SJ, Bouchard JF, Kennedy TE (2005) Deleted in
colorectal cancer binding netrin-1 mediates cell substrate adhesion and recruits Cdc42,
Rac1, Pak1, and N-WASP into an intracellular signaling complex that promotes growth
cone expansion. The Journal of neuroscience : the official journal of the Society for
Neuroscience 25:3132-3141.
Shi M, Zheng MH, Liu ZR, Hu ZL, Huang Y, Chen JY, Zhao G, Han H, Ding YQ (2010) DCC
is specifically required for the survival of retinal ganglion and displaced amacrine cells in
the developing mouse retina. Developmental biology 348:87-96.
Siddiqui SA, Cramer KS (2005) Differential expression of Eph receptors and ephrins in the
cochlear ganglion and eighth cranial nerve of the chick embryo. The Journal of
comparative neurology 482:309-319.
Simonneau L, Gallego M, Pujol R (2003) Comparative expression patterns of T-, N-, E-
cadherins, beta-catenin, and polysialic acid neural cell adhesion molecule in rat cochlea
during development: implications for the nature of Kolliker's organ. The Journal of
comparative neurology 459:113-126.
Srour M, Riviere JB, Pham JM, Dube MP, Girard S, Morin S, Dion PA, Asselin G, Rochefort D,
Hince P, Diab S, Sharafaddinzadeh N, Chouinard S, Theoret H, Charron F, Rouleau GA
(2010) Mutations in DCC cause congenital mirror movements. Science 328:592.
Tamamaki N, Yanagawa Y, Tomioka R, Miyazaki J, Obata K, Kaneko T (2003) Green
fluorescent protein expression and colocalization with calretinin, parvalbumin, and
somatostatin in the GAD67-GFP knock-in mouse. The Journal of comparative neurology
467:60-79.
Torii M, Levitt P (2005) Dissociation of corticothalamic and thalamocortical axon targeting by
an EphA7-mediated mechanism. Neuron 48:563-575.
Uthaiah RC, Hudspeth AJ (2010) Molecular anatomy of the hair cell's ribbon synapse. The
Journal of neuroscience : the official journal of the Society for Neuroscience 30:12387-
12399.
van der Linden C, Bruggeman R (1991) Bilateral small-hand-muscle motor evoked responses in
a patient with congenital mirror movements. Electromyography and clinical
neurophysiology 31:361-364.
Veeranna, Amin ND, Ahn NG, Jaffe H, Winters CA, Grant P, Pant HC (1998) Mitogen-activated
protein kinases (Erk1,2) phosphorylate Lys-Ser-Pro (KSP) repeats in neurofilament
proteins NF-H and NF-M. The Journal of neuroscience : the official journal of the
Society for Neuroscience 18:4008-4021.
93

Wang HU, Anderson DJ (1997) Eph family transmembrane ligands can mediate repulsive
guidance of trunk neural crest migration and motor axon outgrowth. Neuron 18:383-396.
Wang YF, Hatton GI (2007) Interaction of extracellular signal-regulated protein kinase 1/2 with
actin cytoskeleton in supraoptic oxytocin neurons and astrocytes: role in burst firing. The
Journal of neuroscience : the official journal of the Society for Neuroscience 27:13822-
13834.
Wang SZ, Ibrahim LA, Kim YJ, Gibson DA, Leung HC, Yuan W, Zhang KK, Tao HW, Ma L,
Zhang LI (2013) Slit/Robo signaling mediates spatial positioning of spiral ganglion
neurons during development of cochlear innervation. The Journal of neuroscience : the
official journal of the Society for Neuroscience 33:12242-12254.
Wegener JW, Nawrath H, Wolfsgruber W, Kuhbandner S, Werner C, Hofmann F, Feil R (2002)
cGMP-dependent protein kinase I mediates the negative inotropic effect of cGMP in the
murine myocardium. Circulation research 90:18-20.
Weiss AC, Airik R, Bohnenpoll T, Greulich F, Foik A, Trowe MO, Rudat C, Costantini F,
Adams RH, Kispert A (2014) Nephric duct insertion requires EphA4/EphA7 signaling
from the pericloacal mesenchyme. Development 141:3420-3430.
Whitlon DS, Zhang X, Kusakabe M (1999) Tenascin-C in the cochlea of the developing mouse.
The Journal of comparative neurology 406:361-374.
Winberg ML, Mitchell KJ, Goodman CS (1998) Genetic analysis of the mechanisms controlling
target selection: complementary and combinatorial functions of netrins, semaphorins, and
IgCAMs. Cell 93:581-591.
Xu B, Goldman JS, Rymar VV, Forget C, Lo PS, Bull SJ, Vereker E, Barker PA, Trudeau LE,
Sadikot AF, Kennedy TE (2010) Critical roles for the netrin receptor deleted in colorectal
cancer in dopaminergic neuronal precursor migration, axon guidance, and axon
arborization. Neuroscience 169:932-949.
Yamamoto N, Okano T, Ma X, Adelstein RS, Kelley MW (2009) Myosin II regulates extension,
growth and patterning in the mammalian cochlear duct. Development 136:1977-1986.
Yang T, Kersigo J, Jahan I, Pan N, Fritzsch B (2011) The molecular basis of making spiral
ganglion neurons and connecting them to hair cells of the organ of Corti. Hearing
research 278:21-33.
Yee KT, Simon HH, Tessier-Lavigne M, O'Leary DM (1999) Extension of long leading
processes and neuronal migration in the mammalian brain directed by the
chemoattractant netrin-1. Neuron 24:607-622.
Young ED, Barta PE (1986) Rate responses of auditory nerve fibers to tones in noise near
masked threshold. The Journal of the Acoustical Society of America 79:426-442.
Yu TW, Bargmann CI (2001) Dynamic regulation of axon guidance. Nature neuroscience 4
Suppl:1169-1176.
Zhang Y, Zhang W, Johnston AH, Newman TA, Pyykko I, Zou J (2012) Targeted delivery of
Tet1 peptide functionalized polymersomes to the rat cochlear nerve. International journal
of nanomedicine 7:1015-1022.

94

Abstract (if available)

Abstract Spiral ganglion neurons (SGNs) are the first cells in the auditory pathway that fire action potentials to process and supply entre auditory inputs to the brain. These bipolar neurons send their dendrites to innervate the base of hair cells (HCs) in the cochlea, and their axons centrally to innervate cochlear nucleus (CN). Precise sets of the connections from spiral ganglion (SG) to their targets are required for normal hearing function and for proper neural processing as the first tonotopic map along the auditory pathway is established through SGNs. The importance of SG is further implicated in clinical settings as sensorineural hearing loss makes up the most common type of hearing loss. Although much of mouse cochlear anatomical features involving SGNs are well described, molecular and guidance mechanisms underlying the formation of the SG circuit assembly remain unclear. The current work aims to contribute to the understanding of molecular factors underlying auditory circuit development by identifying and examining members of classical axon guidance cues in SGNs during mouse cochlear development. ❧ To identify genes that play crucial roles in cochlear development, we performed RNA-sequencing to screen for genes that are differentially expressed in sensory epithelial cells in the organ of Corti (OC) and non-sensory-epithelial cells in the cochlea. Comparative analysis of the generated gene expression profiles across different cell populations identified various molecules as potential candidates, responsible for auditory circuit development. The first part of the thesis focuses on the role of Ephrin type-A receptor 7 (EphA7) in outgrowth of type I afferent fibers of SG and its downstream signaling pathway. Analysis of EphA7 mutant embryos showed a reduction in the number of inner radial bundles originating from SGNs as well as in the number of ribbon synapses on inner hair cells (IHCs), attributable to fewer type I afferent fibers. The overall activity of the auditory nerve in EphA7 deletion mice was also reduced in high intensity stimuli, mimicking the symptoms of hidden hearing loss. In vitro analysis further suggested that the reduced innervation of HCs by SGNs could be attributed to a role of EphA7 in regulating outgrowth of SGN neurites, as knocking down EphA7 in SGNs resulted in diminished SGN fibers. In addition, suppressing the activity of ERK1/2, a potential downstream target of EphA7 signaling, either with specific inhibitors in cultured explants or by knocking out cGMP-dependent protein kinase 1 (Prkg1), resulted in reduced SGN fibers while treatment with 8-Br-cGMP, activator of Prkg1, rescued the EphA7 defective phenotype. These results suggest that EphA7 plays an important role in the developmental formation of cochlear innervation pattern through controlling SGN fiber ontogeny. Such regulation may contribute to the salience level of auditory signals presented to the central auditory system. ❧ The second part of the thesis focuses on the characterization of functional roles of deleted in colorectal cancer (Dcc) in developing mouse cochlea. Based on the recent studies demonstrating Dcc as the causal gene for congenital mirror movement and several clinical links between congenital mirror movement and sensorineural hearing loss, we hypothesized that Dcc may be responsible for proper hearing function at the level of regulating spiral ganglion development. Our gene expression profiles showed the specific expression pattern of Dcc transcript, only in the SG, complementing the hypothesis. Subsequently, we showed that Dcc contributes to the proper organization of spiral ganglion neurons (SGNs) within the Rosenthal’s canal and of SGN projections toward both peripheral and central auditory targets in the developing mouse cochlea. In Dcc deletion embryos, mispositioning of SGNs occurred along the peripheral auditory pathway with misrouted afferent fibers and reduced synaptic contacts with hair cells. The central auditory pathway simultaneously exhibited similar defective phenotypes as in the periphery with abnormal exit of SGNs from the Rosenthal’s canal. Furthermore, the axons of SGNs ascending into the cochlear nucleus had a disrupted bifurcation pattern. On the other hand, mice with Netrin-1 (Ntn1) deletion did not show any aberrant features in the cochlea. These results demonstrate that Dcc, likely interacting with ligands other than Ntn1, is necessary for establishing the proper spatial organization of SGNs and their fibers in the peripheral and central auditory pathways. ❧ Together these findings demonstrate that EphA7 and Dcc in SGNs regulate the guidance and organization of SG innervation patterns during cochlear development. This work extends our understanding of the neurobiology of auditory circuit development, at molecular level, and will help pave the way for treatment of congenital hearing loss.

Linked assets

University of Southern California Dissertations and Theses

Conceptually similar

PDF

Slit/Robo signaling underlies the spatial patterning of spiral ganglion neurons to shape the peripheral auditory circuitry assembly

PDF

Neural circuits underlying the modulation and impact of defensive behaviors

PDF

Synaptic circuits for information processing along the central auditory pathway

PDF

Functional circuitry underlying cross-modality integration and the development of a novel sparse labeling technique

PDF

Physiology of the inner ear: the role of the biophysical properties of spiral ganglion neurons in encoding sound intensity information at the auditory nerve

PDF

Exploiting novel transport properties of adeno-associated virus for circuit mapping and manipulation

PDF

Synaptic mechanism underlying development and function of neural circuits in rat primary auditory cortex

PDF

Contextual modulation of sensory processing via the pulvinar nucleus

PDF

From sensory processing to behavior control: functions of the inferior colliculus

Asset Metadata

Creator Kim, Young Joo (author)

Core Title Axon guidance cues in development of the mammalian auditory circuit

School College of Letters, Arts and Sciences

Degree Doctor of Philosophy

Degree Program Neuroscience

Publication Date 03/31/2016

Defense Date 12/03/2015

Publisher University of Southern California (original), University of Southern California. Libraries (digital)

Tag cochlea,mammalian auditory circuit,OAI-PMH Harvest,spiral ganglion

Format application/pdf (imt)

Language English

Contributor Electronically uploaded by the author (provenance)

Advisor Bonnin, Alexandre (committee chair), Tao, Huizhong (committee member), Ying, Qilong (committee member), Zhang, Li I. (committee member)

Creator Email kim31@usc.edu,youngjk9@hotmail.com

Permanent Link (DOI) https://doi.org/10.25549/usctheses-c40-223311

Unique identifier UC11276531

Identifier etd-KimYoungJo-4220.pdf (filename),usctheses-c40-223311 (legacy record id)

Legacy Identifier etd-KimYoungJo-4220.pdf

Dmrecord 223311

Document Type Dissertation

Format application/pdf (imt)

Rights Kim, Young Joo

Type texts

Source University of Southern California (contributing entity), University of Southern California Dissertations and Theses (collection)

Access Conditions The author retains rights to his/her dissertation, thesis or other graduate work according to U.S. copyright law. Electronic access is being provided by the USC Libraries in agreement with the a...

Repository Name University of Southern California Digital Library

Repository Location USC Digital Library, University of Southern California, University Park Campus MC 2810, 3434 South Grand Avenue, 2nd Floor, Los Angeles, California 90089-2810, USA