University of Southern California Dissertations and Theses

TWIST1 functions in both mesoderm and neural crest derived cranial tissues to establish and maintain coronal suture patency

(USC Thesis Other)

TWIST1 functions in both mesoderm and neural crest derived cranial tissues to establish and maintain coronal suture patency

PDF

Download a page range

Download transcript

Copy asset link

Request this asset

Transcript (if available)

Content 1

TWIST1 FUNCTIONS IN BOTH MESODERM AND NEURAL CREST DERIVED CRANIAL TISSUES TO
ESTABLISH AND MAINTAIN CORONAL SUTURE PATENCY

by
Dhvani Sanghani

A Dissertation Presented to the
FACULTY OF THE USC GRADUATE SCHOOL
UNIVERSITY OF SOUTHERN CALIFORNIA
In Partial Fulfillment of the
Requirements for the Degree
MASTER OF SCIENCE
(BIOCHEMISTRY AND MOLECULAR BIOLOGY)

August 2013

Copyright 2013 Dhvani Sanghani
2

Dedication
I dedicate this dissertation to my parents, Preeti Sanghani and Mayank Sanghani, whose
unconditional love and immense belief in my potential gave me the confidence to
achieve my goal.

3

Acknowledgements

I am extremely grateful to my graduate advisor Dr. Robert E. Maxson for giving
me the opportunity to work in his lab for my master's thesis. I would also like to thank
him for helpful guidance and support throughout the course of this project. I appreciate
Dr. Zoltan Tokes and Dr. Amy Merrill for taking the time to give thoughtful suggestions
on this work.
I would like to express my gratitude towards Chris Schafer, Mia Brockop and
Krishnakali Dasgupta for investing their time and efforts in shaping me to become a
more competent researcher and work independently without which this project would
have not been possible. I would also like to thank Mamoru Ishii, Jinging Sun, Nancy Wu
and Youzang Yen, Man- Chun Ting, Hai- Yun Yen and Camilla Teng for their enthusiasm
in sharing their experience and knowledge with me.
Finally, I cordially thank my parents and my family for their endless support and
encouragement for successfully complete my degree at USC.

4

Table of Contents

Acknowledgements……………………………………………………………………………………….……………….3
List of Tables…………………………………………………………………………………………………………………..5
List of Figures…………………………………………………………………………………………………………………6
Abstract………………………………………………………………………………………………………………………….7
Introduction……………………………………………………………………………………………………………………8
Materials and Methods………………………………………………………………………………………………..19
Results………………………………………………………………………………………………………………………….22
Discussion…………………………………………………………………………………………………………………….33
References……………………………………………………………………………………………………………………38

5

List of Table(s)
Table 1: Prevelence of Synostosis 16
Table 2: The genotyping conditions for Wnt1-Cre, Mesp1-Cre, Twist flox 19
and R26R alleles

6

List of Figures
Figure 1: Diagram showing the formation of compartment boundaries between 9
different cell populations
Figure 2: Anatomical Structure of the Mouse Skull showing the various bones 11
of the skull vault and sutures
Figure 3: Diagram representing the classification of Craniosynostosis based on the 16
clinical features of the skull
Figure 4:Synostosis observed in Wnt1-Cre; Mesp1-Cre; Twist
CKO/-
but not in Wnt1- 25
Cre; Twist
CKO/-
and Mesp1-Cre; Twist
CKO/-

Figure 5: Whole mount staining for ALP and LacZ of the developing coronal suture 28
at E14.5
Figure 6: Defective frontal and parietal boundary formation at coronal suture in 30
Wnt1-Cre; Mesp1-Cre; Twist
CKO/-
mutant
Figure 7: Expression of EphrinA2 is altered in the Wnt1-Cre; Mesp1-Cre;Twist
CKO/ -
32
mutant embryo at E14.5.

7

Abstract
The coronal suture is a non-osteogenic tissue boundary located between neural
crest and mesoderm derived skull bones. Failure in the formation of this boundary can
lead to craniosynostosis, a developmental irregularity marked by the premature fusion
of the frontal and parietal bones. Initial studies have linked this phenotype in humans
and mice to the heterozygous loss of the transcription factor TWIST1. Previously we
demonstrated that Twist1
+/-
mutants have defects in cell mixing and differentiation at
the mesoderm-neural crest interface. We revealed that TWIST1 acts upstream of both
EphA4 and Jagged1 to inhibit these processes and allow for the coordinated growth of
the frontal and parietal bones. However, what remains to be addressed is the tissue
specific requirement of Twist1 in the pathophysiology of craniosynostosis. Using Wnt1-
Cre and Mesp1-Cre to conditionally inactivate Twist1 in mesoderm and neural crest
together and independently we show that only the concerted loss of Twist1 in both
tissues populations is sufficient to cause coronal suture fusion.

8

Introduction
The development of a functional multi-cellular organism requires the formation,
maintenance and organization of various tissues and different types of cells within the
tissues. The establishment of the final complex pattern of tissues involves segregation of
cells into non intermingling regions, or compartments, each having a specific identity.
Tissue patterning initially involves the formation of imprecise and fuzzy borders
between different cell populations. As the development progresses, these borders
undergo refinement to finally produce sharp and stable borders at tissue interfaces as
depicted in Figure 1A. The two different cell populations are represented in white and
green tend to intermingle with each other and thus results in a wiggly border initially as
shown in Figure 1A. However, eventually as the development progresses the cells
undergo cell segregation into distinct compartments as shown in Figure 1B. This
generation and maintenance of the precision of tissue organization not only plays a
crucial role in the embryogenesis but also in tissue homeostasis of adult organisms.

9

Figure 1.Diagram showing the formation of compartment
boundaries between different cell populations. (A) The newly
proliferating cells from different cell populations intermingle to
form an imprecise and fuzzy border. (B) The cell segregation
mechanisms at the border results in a sharp and stable
boundary at the interfaces. The black dashed line in Figure 1B
represents the precise compartment boundary between the
different cell populations. The two cell populations having
different origins are represented in white and green. (Dahmann
C, Basler K., 1999)

The spatial patterning of tissues and boundary formation is achieved by the
signaling mechanisms at the border of compartments. Specialized cells at borders act as
signaling centers that are responsible for this spatial pattering of tissues (BatlleE
and WilkinsonDG., 2012). A failure in these signaling mechanisms results in boundary
defect at the interface between the cell populations which eventually lead to abnormal
development of many tissues and organs and finally results in various developmental
disorders.
Researcher have been interested in studying the mechanisms that establish and
maintain tissue organization and the formation of sharp boundaries at the interface of
adjacent tissues. Significant knowledge about the formation of these boundaries
A B
10

between different cell populations has been garnered from the studies on
embryogenesis and development of the wing imaginal disc in Drosophila
(Irvine KD, Rauskolb C.).Furthermore, the studies on the developing nervous system in
vertebrates have explained the formation of compartments in which the intermingling
of cells is restricted across the border of specific subdivisions of the brain.
(Langenberg T, Brand M.;Fraser S, Keynes R, Lumsden A.;Zeltser LM, Larsen CW, LumA.)
The development of the skull vault involves the formation of boundaries
between different cell populations and thus can be used as a model system to study the
mechanisms underlying boundary establishment and apply this insight into skull vault
related developmental disorders like Craniosynostosis. Thus, it would be worthwhile to
discuss the basic anatomy and development of the skull vault and suture biology.
The Skull
The skull of all bony vertebrates is a composite structure made up of two main
parts namely theneurocranium and the viscerocranium. The neurocranium surrounds
and protects the brain from external injuries and the viscerocranium consists of the
facial bones of mammals that support the functions of feeding and breathing. The
neurocranium is further divided anatomically into the base and the calvaria which is
formed by endochondrial ossification and intramembranous ossification respectively
[Morriss-Kay and Wilkie,52005].Unlike endochondrial ossification, intramembranous
ossification involves the poliferation and differentiation of mesenchymal precursor cells
into osteoblast cells without going through the cartilaginous phase.
11

The calvaria, or the mammalian skull vault is primarily composed of five flat
bones of mixed lineage origins as shown in Figure 1. They are namely, two frontal bones,
two parietal bones and a single inter parietal bone. The frontal bones are derived from
the neural crest cells and the parietal bones are derived from the mesoderm. [Jiang et
al, 2002]. In case of the interparietal bone, the central part is derived from the neural
crest and the lateral part is derived from the mesoderm.
The bones of the mammalian skull vault are attached to each other by a fibrous
joint known as sutures. There are typically six cranial sutures in the human skull vault as
shown in Figure 2. The metopic or the interfrontal suture is located between the two
frontal bones, the sagittal suture between the two parietal bones, the paired coronal
suture between the two frontal and two parietal bones, the paired lambdoid suture
between the two supraoccipital and parietal bones and the squamosal suture between
the parietal, temporal and the sphenoid bones. [Opperman,2000]

Figure 2. Basic Structure of the Mouse Skull showing the various bones and sutures of
the skull vault.
12

The cranial vault sutures are major sites of bone growth during embryonic and
postnatal craniofacial growth. The growth of the skull vault bones is achieved through
the bone formation in the osteogenic front at the suture and is necessary for the
expansion of the neurocranium to accommodate the rapidly growing mammalian brain.
In fish, amphibians and reptiles, skull growth continues throughout the life of the
animal, where as in mammals the growth period of the brain ends approximately at the
time of sexual maturity. [Morriss-Kay and Wilkie, 2005]
To function as the intramembranous bone growth sites the suture have to be
maintained in the undifferentiated non osteogenic state and simultaniously allow the
recruitment of new osteogenic cells at the bone fronts of the growing bone. [Opperman,
2000]
The maintenance of the precise boundary between the osteogenic compartment
of expanding bones and non-osteogenic compartment of the sutures, is regulated by the
many genes and signaling pathways involving these genes. The mutation of these genes
and disruption of the signaling mechanism results in boundary defect at the osteogenic-
non osteogenic fronts and may lead to premature fusion of the skull vault bones due to
ossification of the suture resulting in craniosynostosis.

13

Craniosynostosis
Human intelligence depends on the ability of the brain to grow and expand
during development of an individual. This is achieved by the coordinated growth of
brain and the skull vault around it. As the brain grows, it pushes the bones on either
sides of the suture away from each other, and allowing the recruitment of new
osteogenic cells at the growing bone front leading to the overall expansion of the bone.
This in turn provides space for the further development of the underlying brain. Thus,
the growth at the suture is perpendicular to the orientation of the suture. However, this
implies that the normal growth of brain is possible only if the sutures in the skull vault
are maintained in the unossified state.
In normal individual, the metopic suture or the interfrontal suture fuses at 9
months of age after the growth in breath of the brain has taken place. The other cranial
sutures, remain open untill the third or the forth decade of life. The fusion of the suture
marks the end point of growth of the skull vault (Opperman, 2000; Morriss-Kay and
Wilkie, 2005].
The word 'Craniosynostosis' is derived from the Greek word, Kranion meaning
Skull for Cranio- ; sun meaning 'together' for 'syn' ; Osteon meaning 'bone'for osteo- and
osis is a suffix denoting a disease condition. Thus Craniosynostosis refers to a
pathological condition involving the premature fusion of the cranial sutures, occurring in
1 in 2500 live births.

14

Classification of Craniosynostosis
This developmental defect can be classified in several different ways.
Based on number of sutures, craniosynostosis can be classified as simple (or
isolated) and complex. In the simple or isolated form of craniosynostosis, only one out
of four sutures undergo fusion. The complex form involves fusion of more than one
sutures and is more severe form of synostosis when compared to the isolated form
found representing 6% of all the cases.
In the second system of classification, craniosynostosis was classified into
syndromic and non-syndromic forms based on the presence of extracranial
deformations. The non syndromic form of craniosynostosis is usually associated with the
fusion of one suture and has no other extracranial deformations. More than 50% of the
cases are of this type. On the other hand, when craniosynostosis is accompanied with
other deformations in the limbs, heart, central nervous system and respiratory track
then it can be classified under the syndromic form.
The third system of classification is based on the clinical description and the
phenotype of the skull as a result of suture synostosis. They are categorized
asScaphocephaly, Trigonocephaly, Plagiocephaly, Brachycephaly and Oxycephaly. The
specific shape and phenotype attained by the skull can be explained by the concept of
intracranial pressure as a result of fusion of suture.

15

Concept of Intracranial Pressure
As mentioned earlier, the normal development require high coordination
between the growth of the brain and the skull vault surrounding it. The mechanical
force generated by rapidly expanding brain pushes the bones surrounding it away from
each other. This would then widen the gap at the suture and thus create the space for
recruitment of the new osteogenic cells at the osteogenic front and further expansion of
the bone. It can be concluded that the suture patency should be maintained for the
normal development of the brain.
In case of ossification of the suture, the mechanical forces generated by the
brain growth can no longer push the bones away from each other and thus there would
be no more space created for the further expansion of the brain in that direction. These
mechanical forces due to the growth of the brain on the inner walls of the calvaria
results in raised intracranial pressure. This intracranial pressure generated would cause
compensatory growth of the brain at the other open sutures and appositional growth of
the other parts of the skull. As a result the direction of growth of the skull vault will now
be parallel to the fused suture. The different shapes attained by the skull by
compensatory growth mechanisms is illustrated in the Figure 3 and explained below.
For example, Brachycephaly is characterized by synostosis of the coronal suture
that will not allow the free growth of the skull vault in terms of length. Thus the
intracranial pressure generated by the brain will result in compensatory growth at the
sagital suture and lead to the broadening of the skull vault (Figure 3A).
16

Figure 3. Diagram representing the classification of Craniosynostosis based on the clinical
features of the skull. The different shapes are attained by the skull as a result of
compensatory growth due to intracranial pressure. The blue arrows represent the direction
of compensatory growth of the skull vault taking place at the unossified suture.

As investigated by Cohen, (2000) the prevelence of synostosis detected on the different
sutures is as listed in Table1.
Suture Synostosis Prevalence (%)
Sagittal Synostosis 40-55
Coronal synostosis 20-25
Metopic Synostosis 5-15
Lamboid Synostosis 0-5
Table 1.Prevalence of Synostosis
Advances in molecular genetics in the past decade have identified mutations in
patients having Craniosynostosis which has provided significant understanding about
the etiology, classification and developmental pathology of these disorders. The first
gene mutation was identified in MSX2 gene in humans (Jabs et al.,1993). However, the
Brachycephaly
Posterior
Plagiocephaly

Scaphocephaly Trigonocephaly
Anterior
Plagiocephaly

A
E C D B
17

mutations in the FGFR1-3 and TWIST genes results in the majority of the cases
(Hajihosseini, 2008; Howard TD et al., 1997). Other genes that are seen to be involved in
this disorder include EPHRIN A4 (Merrill et al,2006), EFNB1 (Twigg et al., 2004), RAB23
(Jenkins et al., 2007) , JAGGED1 (Kamath et al., 2002), FRIBRILLIN-1 (Sood et al., 1996),
TGFBR1, TGFBR2 (Lozier et al., 2008). These genes are components of several signaling
pathways. Twist1 gene functions to coordinate the Bmp and RTK pathways.
Saethre-Chotzen syndrome (OMIM 101400) is one of the most common
autosomal dominant forms of Craniosynostosis in human occurring in 1 in 25000 live
births. It is characterized by both craniofacial and limb abnormalities including clinical
features like fusion of the coronal suture, dysmorphic facial features brachydactyly and
cutaneous syndactyly.
Previous work identified various mutations including insertions, deletions,
nonsense mutations and missense mutations in the Twist1 gene that leads to
production of truncated and nonfunctional protein in individuals with Saethre-Chotzen
syndrome. Other reports and earlier work in our lab on mice (Merrill et al., 2006)
suggests that the heterozygous deletion of Twist1 gene (Twist1
+/-
mutant) results in
coronal suture synostosis in addition to abnormalities in several other bones in the
calvarium and preaxialpolydactyly of one or both hind feet (Carver EA, Oram KF, Gridley
T. 2002). These data indicate that Saethre-Chotzen syndrome is caused by the
haploinsufficiency of the Twist1 gene.
18

Although much work has been in understanding the signaling mechanisms that
are affected during development at the coronal suture in the Twist1
+/-
mutant, there is
little or no information on effects of the conditional heterozygous inactivation of Twist1
in specific tissue. Thus this prompted us to inactivate Twist1 gene in neural crest and
mesoderm tissues individually and together which would contribute in better
understanding the mechanisms by which Twist1 functions in maintaining suture
patency.

19

Materials and Methods
Mouse Mutants and Genotyping
All genetically modified mice used in this study were obtained and maintained in
the background C57Bl/6 and are described in the literature: Wnt1-Cre (Danielian et al.,
1998), Mesp1-Cre1 (Saga et al., 1991) and R26R (Soriano, 1999).
The Twist1 floxed mice were a kind of a gift from Dr. Patrick Tam (Children’s
Medical Research Institute, Sydney, Australia) and were also obtained and maintained in
the background C57Bl/6.The Twist flox, Mesp1-Cre, Wnt1-Cre and R26R alleles were
genotyped by PCR according to the conditions described in Table2.
PCR Primers PCR Program
Cre Wnt1- Cre forward-
taa gag gcc tat aagaggcgg (21)
Mesp1- Cre forward-
gccataggtgcctgactt act (21)
Cre Common Reverse-
gttattcaacttgcaccatgc(21)
1. 95⁰C, 5mins
2. 95⁰C, 30sec
3. 55⁰C, 40secs
4. 72⁰C, 40secs
5. Goto#2, 34times
6. 72⁰C, 10mins
7. 4⁰C , forever
R26R R26R Common-
aaagtcgctctgagttgt tat(21)
R26R wildtye:
ggagcgggagaaatg gat atg(21)
R26R knockout:
gcgaagagtttgtcctcaaac(21)

1. 95⁰C, 5mins
2. 95⁰C, 40sec
3. 55⁰C, 40sec
4. 72⁰C, 1min
5. Goto#2, 34times
6. 72⁰C, 10mins
7. 4⁰C , forever
Twist Flox Twist flox forward:
ggtttccgacta gag gtttcc
Twist flox reverse:
aac cat tcaaaaccgacc

1. 95⁰C, 5mins
2. 95⁰C, 1min
3. 62⁰C, 50secs
4. 72⁰C, 1min
5. Goto#2, 34times
6. 72⁰C, 10mins
7. 4⁰C , forever
Table 2. The genotyping conditions for Wnt1-Cre, Mesp1-Cre, Twist flox and R26R alleles.
20

Whole Mount Skull Alizerin Red S Staining
The Skulls of 21 post-natal mice were skinned and stained for bone with 2%
Alizerin Red S in 1%KOH for 1 to 2 days to reveal mineralized bone. The skulls were then
cleared and stored in 100% glycerol.
Whole mount Alkaline Phosphatase (ALP) and β-Galactosidase (LacZ) Staining
The whole mount staining for alkaline phosphatase was performed as previously
described (Ishii et al., 2003) with minor modification. The steps for ALP staining are
briefly explained hereby. The embryonic heads at E14.5 were fixed overnight in 4%
paraformaldehyde(PFA) in PBS and washed thrice with PBS for 10mins each time. The
heads were then stored in 70% Ethanol at 4⁰C for 1 to 2 days. Then the brain and skin
were carefully removed for clear illustration of the coronal suture. The samples were
finally stained for ALP with 0.02% of NBT/BCIP stock solution (Roche Diagnostics).
β-galactosidase whole mount staining embryonic heads of wildtype and
conditional mutants of Twist at E14.5 was carried out as previously described (Ishii et
al.,2003) to test the Cre activity in specific tissue compartments.
Histology, Histochemical Staining and Immunostaining
The heads of embryos at E14.5 were fixed in 4% PFA and embedded in OCT
media (HistoPrepTM, Fisher Scientific) before sectioning. Transverse frozen sections
were cut in a cryostat at 10µm thickness.
21

The ALP staining in tissue sections for detection of osteogenic precursor cells was
carried out as described earlier (Liu et al., 1999). The analysis of β-galactosidase activity
of Wnt1-Cre; R26R and Mesp1-Cre; R26R reporter gene in 10µm tissue sections to
detect Cre activity in neural crest and mesoderm tissue compartments respectively was
performed as described previously (Ishii et al., 2003).
The immunostaining of frozen sections was largely carried out as previously
reported (Ishii et al.,2003). Briefly, the immunohistochemistry was performed using the
primary antibody rabbit anti-EphrinA2 (Zymed, San Francisco,CA; 1:200) diluted in 10%
normal goat serum and incubated overnight at 4ᵒC. The primary antibody was detected
by incubating biotinylated secondary antibody (anti Rabbit Kit, Invitrogen) for 1 hour at
room temperature and then finally visualized with Diaminobenzidintetrahydro-chloride
(DAB) substrate.

22

Results
Earlier studies have identified the genomic locus for Saethre-Chotzen syndrome
as chromosome 7p21- p22. Several studies have identified mutations in the Twist1 gene
in individuals with Saethre- Chotzen syndrome. Also, the microdeletion of the entire
Twist1 gene has been seen in patients with Saethre-Chotzen syndrome (Carver
EA, Oram KF, Gridley T., 2002). As mentioned earlier, the results from these studies
demonstrate that Saethre-Chotzen syndrome is caused by the haploinsufficiency of the
Twist1 gene.
Furthermore, the significance of the Twist1 gene in development is evident from
studies in which the null mutation of Twist1 gene leads to embryonic lethality at day
E11.5 due to the failure of neural tube closure (Chen ZF and Behringer RR., 1995).
However, several published reports and previous results in our lab have revealed
that the conventional heterozygous inactivation of Twist1 gene in mice leads to
boundary defect at the coronal suture that would subsequently cause coronal suture
fusion (Merrill et al., 2006) and other skull and limb abnormalities (El Ghouzzi V et al.,
1997). From these observation we concluded that the Twist1 gene plays a crucial role in
preventing the cell mixing at the boundary between the osteogenic and non-osteogenic
cells at the coronal suture and regulates the signaling pathway that are involved in
osteogenicdifferentiation at the coronal suture.
Studies by Bildsoe et al., 2009 show that the homozygous conditional
inactivation of the Twist1 gene in the neural crest cells before and soon after they are
23

formed causes craniofacial defects. Also the conditional inactivation of Twist1 inthe post
migratory neural crest cells populating the mandibular pharealgeal arch have displayed
a spectrum of phenotype including craniofacial abnormalities, mandibular hypoplasia,
altered middle ear and palate development.
Although Twist1 was seen to be involved in the maintaining the integrity of the
boundary between the neural crest and mesoderm at the coronal suture, the tissue
specific requirement of Twist1 in the development of the skull vault has not been
investigated. The requirement of Twist in the formation, migration and differentiation of
neural crest cells intrigued us to study the effects of conditional inactivation of Twist1 in
the neural crest and mesoderm compartments, individually and together, thereby
understanding the mechanisms employed by Twist1 in precise boundary formation.
As Twist1 is seen to play a role in the boundary formation and we expected that
the conditional inactivation of Twist1 in either the neural crest or the mesoderm
compartments adjacent to the coronal suture would lead to a synostosis phenotype. To
test this possibility, we used the neural crest and mesoderm driven Cre-recombinase
system and bred the Twist1
CKO/CKO
males with the Wnt1-Cre and Mesp1-Cre female to
obtain mice in which the Twist gene is conditionally inactivated in the neural crest
derived cells and in the mesoderm derived cells respectively.
In order to observe the existence of the synostosis phenotype at the coronal
suture, the skulls of Wnt1-Cre; Twist
CKO/-
and Mesp1-Cre; Twist
CKO/-
mice at P21 were
stained using the Alizerin Red S staining that marked the bone in red. Unlike what we
24

had expected, the results showed that the coronal synostosis was neither observed in
the Wnt1-Cre ; Twist
CKO/-
(n=3) mutant nor the Mesp1-Cre; Twist
CKO/-
(n=4) mutant and
that both these mutant largely resembled the wildtype skulls. (Figure 4).
This result strongly suggested that the heterozygous loss of Twist1 in either the
neural crest compartment or the mesoderm derived compartment was not sufficient to
cause boundary defect and the fusion of coronal suture during the skull vault
development.
However, the analysis of the Alizarin Red S stained skulls of Wnt1-Cre; Mesp1-
Cre; Twist
CKO/-
(n=2) mice at P21 demonstrated the fusion of coronal suture and the
fusion phenotype resembled the Twist1 conventional heterozygous mutants. This result
led us to conclude that the heterozygous loss of Twist in the neural crest compartment
and the mesoderm compartment together is sufficient to cause the suture phenotype
(Figure 4).

25

Figure 4. Synostosis observed in Wnt1-Cre; Mesp1-Cre; Twist
cko/-
but not in Wnt1-
Cre;Twist
cko/-
and Mesp1-Cre; Twist
cko/-
. (B,C). P21 skull ofWnt1-Cre; Twist
CKO/-
and Mesp1-
Cre; Twist
CKO/-
mutants did not show any synostosis at the coronal suture and was similar to
the wildtype embryos. (D). P21 skull of Wnt1-Cre;Mesp1-Cre;Twist
CKO/-
show bilateral fusion
at coronal suture.(A',B',C',D') show magnified images of dotted region, displaying the
phenotype.

The neural crest- mesoderm boundary defect is detectable first at the embryonic
stage E14.5 (Merrill et al., 2006) and so to trace the embryonic origin of the coronal
suture fusion the developmental mechanisms were studied at that stage. The embryonic
heads at E14.5 were stained for alkaline phosphatase (ALP), an early osteogenic marker
in the wild type and double conditionally knockout mutant of the Twist gene. The results
for the whole mount staining for ALP of the embryonic heads at E14.5 were consistent
with the Alizerin Red S stained at P21 stage.
A
D
C B
Wnt1-Cre;Mesp1-
Cre; Twist
CKO/-

Mesp1-Cre;Twist
CKO/-
Wnt1-Cre;Twist
CKO/-
Wildtype
26

In the wild type embryo heads, a layer of non-ALP expressing suture cells was
evident between the ALP positive cells of the prospective frontal and parietal bone.
However, in the Wnt1-Cre; Mesp1-Cre; Twist
CKO/-
mutant embryos, the layer of suture
cells was filled with a disorganized cloud of ALP expressing cells as previously seen in
heterozygous conventional mutant of Twist1 gene (Twist
+/-
) (Figure 5).
This led to draw a hypothesis that the presence of osteogenic cells in the suture
region could be because of three reasons. Firstly, the sutural cells would themselves get
differentiated into osteogenic cells due to disruption of signaling mechanisms that
regulate the suture patency in the double conditional Twist mutant. Another possibility
could be that the osteogenic cells from the neural crest region of the frontal bone would
migrate into the sutural cells leading to loss of boundary integrity at the neural crest-
mesoderm border. Also, it could also be possible that both these processes could be
taking place at the suture. That is, the osteogenic cells from the frontal and parietal
bone could be migrating into the sutural cells and also signaling the neighboring sutural
cells to differentiate into osteoblast.
To test this hypothesis, we used the Cre marking system to observe the
distribution of the neural crest cells and the mesoderm derived cells at E14.5 embryo
heads in mutant and wildtype embryos. This also verified the neural crest and
mesoderm driven Cre activity only in the compartments where we expect the
conditional inactivation of Twist1.
27

Whole mount X-gal staining of Wnt1-Cre; R26R and Mesp1; R26R embryo heads
at E14.5 were stained for LacZ in the neural crest derived and mesoderm derived
compartments respectively. As we would expect the Wnt1-Cre; Twis
CKO/-
; R26R and
Mesp1-Cre; Twist
CKO/-
; R26R staining was similar to the wild type and LacZ positive cells
were not seen to migrate into the suture and thus the boundary integrity was
maintained. However, as in the double conditional mutant of Twist the Cre would be
active in both the neural crest and mesoderm derived compartments, the embryonic
heads were stained completely and the neural crest derived cells could not be
distinguished from the mesoderm derived cells. Due to this limitation, we could not look
at the distribution and migration of the neural crest or mesoderm derived cells in the
suture region. However the activity of the Cre in both these compartments was
confirmed (Figure 5).
28

29

To closely observe the phenomenon taking place at the boundary between the
osteogenic and non osteogenic compartments at the embryonic stage E14.5, the heads
of wildtype and mutant embryos were sectioned and stained for early osteogenic
marker, alkaline phosphatase. The results obtained from the staining of tissue sections
were consistent with the data from whole mount ALP staining of E14.5 embryo heads
and Alizerin Red S staining of the P21 skulls.
In the wild type, the osteoblast cells, that is the prospective frontal and parietal
bones were marked by ALP stain in blue with a distinct region of non-ALP expressing
cells in between that represents the future coronal suture. In the Wnt1-Cre; Twist
CKO/-

(n=11) and Mesp1-Cre; Twist
CKO/-
(n=10) mutant embryos, in which the Twist1 gene was
inactivated either in neural crest or mesoderm separately, the phenotype resembled the
wildtype with the presence of discrete layer of non-ALP expressing cells representing of
coronal suture. However, double conditional mutant, Wnt1-Cre; Mesp1- Cre; Twist
CKO/-

(75%; n=6/8) where the Twist1 was inactivated in the neural crest as well as the
mesoderm, the phenotype was largely similar to the conventional heterozygous mutant,
Twist1
+/-
(Merrill et al., 2006). The layer of non-ALP expressing cells was lost and was
filled with osteogenic cells. This result was in coherence with the observations in Alizerin
Red S staining and whole mount ALP staining showing the synostosis phenotype in the
double conditional mutants (Figure 6).

CS
CS
FB
PB
PB
FB
30

Figure 6. Defective frontal and parietal boundary formation at coronal suture in Wnt1-Cre; Mesp1-Cre;
Twist
CKO/-
mutant. Transverse section tissue sections of wildtype and mutant embryo heads were stained for
ALP and LacZ. (A, D, G) The R26R allele served as an indicator for Wnt1-Cre and Mesp1-Cre activation in the
E14.5 embryos. The staining of LacZ is apparent in the frontal bone in the Wnt1-Cre; R26R embryos and in
the suture and parietal bone in the Mesp1-Cre;R26R. In the double conditional mutant the suture, frontal
bone and parietal bones are stained and the neural crest derived cells are not differentiated from the
mesoderm derived cells. (B, C, E, F, H, I) The adjacent tissue sections were stained for ALP, a marker for early
osteogenic cells, that revealed the presence of the bones and the suture (arrow). CS – Coronal Suture; FB –
Frontal Bone; PB – Parietal Bone.

31

The disorganized appearance and cell mixing of osteogenic cells at the coronal
suture signifies a boundary defect between the neural crest and mesoderm
compartments. To further investigate the signaling mechanisms involved we studied the
expression of EphrinA2 in the double conditional mutant of Twist1 gene.
Reduced expression of EphrinA2 in the coronal suture in Wnt1-Cre; Mesp1-
Cre;Twist
CKO/-
Studies on hindbrain and somite segregation have demonstrated that Ephrin-Eph
signaling mechanism plays an important role in the boundary formation in vertebrates.
(Cooke et al., 2005; Durbin et al., 1998). The distribution of the EphrinA2 proteins was
detected as a single layer of cells on the ectocranial side of the prospective coronal
suture immediately anterior to the coronal suture. This region corresponds to the
surface where the parietal bone overlaps the frontal bone in the later stages of
development. Furthermore, previous studies in our lab (Merrill et al.,2006) shows that
the expression of EphrinA2 is transient and is detectable at the time when the neural
crest- mesoderm boundary defect is prominent. These factors hints that EphrinA2 would
have a significant function in the formation if the neural crest-mesoderm boundary and
craniosynostosis.
As the next obvious step we sought to determine the expression of EphrinA2 in
the double conditional mutant of Twist gene. An antibody against EphrinA2 was used to
stain frozen sections of E14.5 wildtype and mutant embryo heads. Previous work in our
lab showed that the expression of EphrinA2 restricted anteriorly in conventional
32

heterozygous Twist1 mutants. As the coronal suture fusion phenotype in the double
conditional Twist mutant resembled the conventional mutant of Twist from the Alizerin
Red S stain, we anticipated a similarity in the alteration of EphrinA2 expression.

Figure 7.Expression of EphrinA2 is altered in the Wnt1-Cre; Mesp1-Cre; Twist
cko/+
mutant embryo at E14.5. The transverse fronzen sections of wildtype and double
conditional mutant embryos heads at E14.5 were immunostained for Ephrin-A2 to
analyze the effect of Wnt1-Cre; Mesp1-Cre; Twist
CKO/-
mutants on Ephrin-A2 protein.
Adjacent sections were stained for ALP to mark the osteogenic cells and locate the
position of the suture. (A,B)In the wildtype embryo sections, EphrinA2 visualized in
dark brown (purple arrows) was expressed in the layer above the prospective frontal
bone and extended till the coronal suture(arrow). (C,D) Note that in the Wnt1-
Cre;Mesp1-Cre; Twist
CKO/-
double conditional mutant, the EphrinA2 expression is
reduced and dispersed. Also, the expression tends to restrict to the anteriorly and is
no londer seen to extend till the coronal suture region. CS- Coronal Suture; PB –
Parietal Bone; FB – Frontal Bone.

In the wildtype, the EphrinA2 expression was seen to be evident as a single layer
of cells on the ectocranial side of the prospective coronal suture extended until the
coronal suture region. In coherence with our expectation, the expression of EphrinA2 in
the double conditional mutant of Twist1 (62%; n=5/8) was dispersed and not precise as
on the wildtype. Also the expression does not extend till the region of the coronal
suture and retracted anteriorly before that point (Figure 7).
ALP Ephrin-A2
CS
CS
Wildtype Wnt1-Cre; Mesp1-Cre; Twist
CKO/-
33

Discussion
Molecular and cellular basis of the synostosis observed in double conditional mutants
The development of the complex multi-cellular organism starts from a single cell
that undergoes progressive subdivision to form millions of cells each having a specific
identity. Formation of organs and patterning of complex tissue structures involves the
segregation of different cell populations at tissues interfaces, or boundaries, into
distinct non intermingling compartments. The specialized cells at the borders
communicate with the adjacent cells by signaling mechanism to define these precise
interfaces between tissues. A mutation in the genes, that are involved in these signaling
mechanisms leads to the failure of accurate communication at interfaces and eventually
results in developmental defects.
The skull vault is a composite structure of flat bones and sutures derived from
neural crest and mesoderm cell populations. The sutures are site of growth of the bones
necessary for accommodation of the expanding neurocranium. The loss of boundary
integrity between the neural crest and mesoderm derived cell populations at the suture
results in premature fusion of the skull vault bones and restricts the normal
development. The study on the development of the skull vault would thus contribute in
understanding the mechanisms that underlie boundary formation and giving insight into
disorders like craniosynostosis.
Previous works have provided strong evidence that the heterozygous
conventional mutant of Twist1 is associated with a unilateral or bilateral synostosis
phenotype at the coronal suture as a result of boundary defect between the neural crest
34

and the mesoderm derived populations. They also showed that the neural crest cells
invade into the suture region in the mutants by neural crest marker system.
These results conclude that heterozygous deletion of Twist1 modulates the cell
adhesion molecules that allow cell mixing at the neural crest-mesoderm boundary and
explains the intrusion of neural crest cells into the suture mesenchyme eventually
leading to synostosis. These results suggest that coronal suture fusion may result from
Twist1 mutations in either the mesoderm derived suture mesenchyme or the neural
crest derived osteogenic mesenchyme. More elaborately, as Twist1 might control the
cell affinity, the heterozygous deletion of Twist1 in the mesoderm compartment would
allow the intrusion of the neural crest cells into the suture across the boundary probably
due to the reduced expression of cell adhesion molecules in the mesoderm. In the
similar way, in the conditional inactivation of Twist1 in the neural crest might reduce the
cell affinity among cells and the mesoderm cells population would be expected to be
able to invade the neural crest region. Unlike the expectation according to this
conclusion, our result show that inactivation of Twist1 in either compartments is not
sufficient to cause synostosis. This implies that although when Twist1 reduced in the
compartment would modulate the cell affinity in that specific region, there was no
synostosis observed. This would hint that the Twist1 probably maintains the coronal
suture patency by yet another mechanism in addition to controlling cell adhesion.
However, the results from the Alizerin Red S staining experiments at P21 clearly
demonstrated that the Twist1 heterozygous double conditional mutant in which the
35

gene is deleted in the neural crest and mesoderm compartments together is associated
with bilateral synostosis of the coronal suture. In addition, the results from ALP staining
experiments at E14.5 revealed the presence of osteogenic cells in the suture region
which would eventually lead to synostosis phenotype. These observations led us to
consider the possible events that are responsible for this phenotype. As discussed
before, the suture cells could themselves differentiate into osteogenic cells or the
osteogenic cells from the neural crest derived prospective frontal bone could invade
into the suture region. Also both these events could be taking place where the
osteogeinc cells from the frontal bone could invade into the suture and then signal the
adjacent suture cells to differentiate into osteoblasts.
To test this hypothesis, we performed the LacZ staining experiments using the
Cre marking system by which we could observe distribution of the neural crest and
mesoderm derived cells. In the Wnt1-Cre; Twist
CKO/-
and Mesp1-Cre; Twist
CKO/-
mutants
the distribution of the neural crest cells and the mesoderm derived cells was observed
as in the wildtype mutants and there was cell mixing observed at the neural crest-
mesoderm boundary. However, in case of double conditional mutants the neural crest
cells as well as the mesoderm cells were stained. As a result the migration and
distribution of the neural crest cells could not be distinctly observed at the tissue
interface. Due to this limitation it was not possible to draw any conclusion on the events
that might have taken place to cause the boundary defect in the double conditional
mutant that led to the synostosis phenotype.
36

Involvement of signaling mechanisms from the dura mater to maintain coronal suture
patency
Several theories have been proposed to explain the mechanisms that regulate
the suture patency during the development of the skull vault. The involvement of
instructive signals from the dura mater beneath the developing bone for suture patency
has remained a dominant concept in cranial morphogenesis. Many transplantation
experiments of the dura mater have attempted to high lighten the critical role of dura
mater in the development and positioning of the suture (Moss., 1960; Smith and
Tondury., 1978) and maintenance of the coronal suture (Oppermann et al., 1993).
Also Yu et al., (1997) has proved that the dura mater is strictly derived from the
neural crest cells. Thus the heterozygous conditional inactivation of Twist1 in the neural
crest also results in the deletion of the gene from the dura mater. However, our result
demonstrates that the Wnt1-Cre; Twist
CKO/-
mutants does not show synostosis at P21.
This observation implies that the dura mater does not seem to influence the suture
patency, at least with respect to the signaling pathway involving Twist1 gene.
Next Steps
In this study we have shown that the conditional inactivation of Twist1 from the
neural crest and mesoderm derived cell population together, but not separately, is
sufficient to cause coronal suture patency. We have been able to demonstrate the
presence of osteogenic cells in the suture region that would lead to the synostosis later
by ALP staining techniques. However, due to the limitations of the LacZ staining of
37

double conditional mutant we were not able to observe the migration of the neural
crest cells in the Wnt1-Cre; Mesp1-Cre; Twist
CKO/-
mutant. Thus the next step would
probably be to perform dye injection technique on double conditional mutant to
observe the migration of the cells distinctly from each other. The analysis of the
alteration of expression of proteins like EphA4 and Jagged1 when compared to the
wildtype would give a better insight into the early events of synostosis.

38

References
Batlle E., Wilkinson D.G., 2012. Molecular mechanisms of cell segregation and
boundary formation in development and tumorigenesis. Cold Spring Harbor Perspect
Biol. 4(1):a008227. doi: 10.1101/cshperspect.a008227.
Bildsoe, H., Loebel, D.A., Jones, V.J., Chen, Y.T., Behringer, R.R., Tam, P.P., 2009.
Requirement for Twist1 in frontonasal and skull vault development in the mouse
embryo. Dev. Biol. 331, 176–188.
Bourgeois P., Bolcato-Bellemin, A.L., Danse, J.M., Bloch-Zupan, A., Yoshiba, K.,
Stoetzel, C., Perrin-Schmitt, F., 1998. The variable expressivity and incomplete
penetrance of the twist-null heterozygous mouse phenotype resemble those of
human Saethre-Chotzen syndrome. Hum Mol Genet 7:945–957.
Carver, E.A., Oram, K.F., Gridley, T., 2002. Craniosynostosis in Twist heterozygous mice:
A model for Saethre-Chotzen syndrome. Anat Rec. 2002 Oct 1;268(2):90-2.
Chen, Z.F., Behringer, R.R., 1995. Twist is required in head mesenchyme for cranial
neural tube morphogenesis. Genes Dev 9:686–699.
Cooke, J.E., Kemp, H.A., Moens, C.B., 2005. EphA4 is required for cell adhesion and
rhombomere-boundary formation in the zebrafish. Curr. Biol., 15,536–542.

Dahmann, C., Basler, K., 1999. Compartment boundaries: at the edge of development.
Trends Genet. Aug;15(8):320-6.

Durbin, L., Brennan, C., Shiomi, K., Cooke, J., Barrios, A., Shanmugalingam, S.,
Guthrie, B., Lindberg, R., Holder, N., 1998. Eph signaling is required for segmentation
and differentiation of the somites. Genes Dev., 12, 3096–3109.
El Ghouzzi, V., Le Merrer, M., Perrin-Schmitt, F., Lajeunie, E., Benit, P., Renier, D.,
Bourgeois, P., Bolcato-Bellemin, A.L., Munnich, A., Bonaventure, J., 1997. Mutations
of the TWIST gene in the Saethre-Chotzen syndrome. Nat Genet 15:42–46.
Fraser, S., Keynes, R., Lumsden, A., 1990. Segmentation in the chick embryo hindbrain
is defined by cell lineage restrictions. Nature 344: 431–435.
Hajihosseini, 2008. Fibroblast growth factor signaling in cranial suture development and
pathogenesis Front. Oral Biol., 12, pp. 160–177.
Howard, T.D., Paznekas, W.A., Green, E.D., Chiang, L.C., Ma, N., De Luna, R.I., Delgado
C.G., Gonzalez-Ramos, M., Kline, A.D., Jabs, E.W., 1997. Mutations in TWIST, a basic
39

helix-loop-helix transcription factor, in Saethre-Chotzen syndrome. Nat Genet 15:36–
41.
Irvine, K.D., Rauskolb, C., 2001. Boundaries in development: Formation and
function. Annu Rev Cell Dev Biol 17: 189–214.
Ishii, M., Merrill, A.E., Chan, Y.S., Gitelman, I., Rice, D.P., Sucov, H.M., Maxson, R.E. Jr.,
2003. Msx2 and Twist cooperatively control the development of the neural crest-derived
skeletogenic mesenchyme of the murine skull vault Development, 130, pp. 6131–6142.
Jabs, E.W., Müller, U., Li X., Ma, L., Luo, W., Haworth, I.S., Klisak, I., Sparkes R,
Warman, M.L., Mulliken, J.B., et al., 1993. A mutation in the homeodomain of the
human MSX2 gene in a family affected with autosomal dominant craniosynostosis Cell,
75, pp. 443–450.
Jenkins, D., Seelow, D., Jehee, F.S., Perlyn C.A., Alonso, L.G., Bueno, D.F., D. Donnai,
D., Josifova, D., Mathijssen I.M., Morton, J.E., Orstavik, K.H., Sweeney, E., Wall, S.A.,
Marsh, J.L., Nurnberg, P., Passos-Bueno, M.R., Wilkie, A.O., 2007. RAB23 mutations
in Carpenter syndrome imply an unexpected role for hedgehog signaling in cranial-
suture development and obesity. Am. J. Hum. Genet., 80, pp. 1162–1170.

Jiang, S. Iseki, Maxson, R.E., Sucov, H.M., Morriss-Kay, G.M., 2002. Tissue origins and
interactions in the mammalian skull vault Dev. Biol., 241 , pp. 106–116.

Kamath B.M., Stolle,C., Bason, L., Colliton, R.P., Piccoli D.A., Spinner N.B., Krantz I.D.,
2002. Craniosynostosis in Alagille syndrome. Am. J. Med. Genet., 112, pp. 176–18.

Langenberg, T., Brand, M., 2005. Lineage restriction maintains a stable organizer cell
population at the zebrafish midbrain-hindbrain boundary. Development132: 3209–
3216.
Lewanda, A.F., Cohen, Jr. M.M., Jackson, C.E., Taylor, E.W., Li, X., Beloff, M., Day, D.,
Clarren, S.K., Ortiz, R., Garcia, C., Hauselman, E., Figueroa, A., Wulfsberg, E., Wilson,
M., Warman, M.L., Padwa, B.L., Whiteman, D.A., Mulliken, J.B., Jabs, E.W. 1994.
Genetic heterogeneity among craniosynostosis syndromes: mapping the Saethre-
Chotzen syndrome locus between D7S513 and D7S516 and exclusion of Jackson-
Weissand Crouzon syndrome loci from 7p. Genomics 19:115–119.
Liu, Y.H., Tang, Z., Kundu, R.K., Wu, L., Luo, W., Zhu, D., Sangiorgi, F., Snead, M.L.,
Maxson, R.E., 1999. Msx2 gene dosage influences the number of proliferative
osteogenic cells in growth centers of the developing murine skull: a possible
mechanism for MSX2-mediated craniosynostosis in humans. Dev. Biol.,205, 260–274.

40

Lozier, J., McCright, B., Gridley, T., 2008. Notch signaling regulates bile duct
morphogenesis in mice. PLoS ONE, 3, p. e1851

Merrill, A.E. , Bochukova E.G., Brugger, S.M., Ishii, M., Pilz, D.T., Wall, S.A., Lyons,
K.M., Wilkie, A.O., Maxson R.E. Jr., 2006. Cell mixing at a neural crest-mesoderm
boundary and deficient ephrin-Eph signaling in the pathogenesis of craniosynostosis
Hum. Mol. Genet., 15, pp. 1319–1328

Morriss-Kay, Wilkie, 2005. Growth of the normal skull vault and its alteration in
craniosynostosis: insights from human genetics and experimental studies J. Anat., 207,
pp. 637–653

Moss, M.L., 1960. Inhibition and stimulation of sutural fusion in the rat calvaria. Anat.
Rec. 136:457-467.

Opperman, L.A., Sweeney, T.M., Redmon, J., Persing, J.A., Ogle, R.C., 1993. Tissue
interactions with underlying dura mater inhibit osseous obliteration of developing
cranial sutures. Dev Dyn.(4):312-22.
Opperman, L.A., 2000. Cranial sutures as intramembranous bone growth sites Dev.
Dyn., 219, pp. 472–485.
Reid, C.S., McMorrow, L.E., McDonald-McGinn, D.M., Grace, K.J., Ramos, F.J., Zackai,
E.H., Cohen, Jr. M.M., Jabs, E.W., 1993. Saethre-Chotzen syndrome with familial
translocation at chromosome 7p22. Am J Med Genet 47637–639.
Rose, C.S., Patel, P., Reardon, W., Malcolm, S., Winter, R.M., 1997. The TWIST gene,
although not disrupted in Saethre-Chotzen patients with apparently balanced
translocations of 7p21, is mutated in familial and sporadic cases. Hum Mol Genet
6:1369–1373.
Roybal, P.G., Wu, N.L., Sun, J., Ting, M.C., Schafer, C.A., Maxson, R.E., 2010. Inactivation
of Msx1 and Msx2 in neural crest reveals an unexpected role in suppressing
heterotopic bone formation in the head.Dev Biol. 343(1-2):28-39. doi:
10.1016/j.ydbio.2010.04.007.

Smith, D.W., and Tondury, G., 1978. Origin of the calvaria and its sutures. Am. J. Dis.
Child. 132:662-666.

Sood, S., Eldadah, Z.A., Krause, W.L., McIntosh, I., Dietz, H.C., 1996. Mutation in
fibrillin-1 and the Marfanoid-craniosynostosis (Shprintzen-Goldberg) syndrome
Nat. Genet., 12, pp. 209–211.
41

Twigg, S.R., Kan, R., Babbs, C., Bochukova, E.G., Robertson, S.P., Wall, S.A., Morriss-
Kay, G.M., Wilkie, A.O., 2004. Mutations of ephrin-B1 (EFNB1), a marker of tissue
boundary formation, cause craniofrontonasal syndrome. Proc. Natl. Acad. Sci. U.S.A.,
101, pp. 8652–8657.
van Herwerden, L., Rose, C.S., Reardn, W., Brueton, L.A., Weissenbach, J., Malcolm, S.,
Winter, R.M., 1994. Evidence for locus heterogeneity in acrocephalo syndactyly: a
refined localization for the Saethre-Chotzen syndrome locus on distal chromosome
7p—and exclusion of Jackson-Weiss syndrome from craniosynostosis loci on 7p and
5q.Am J Hum Genet 54:669–674.
Yen, H.Y., Ting, M.C., Maxson, R.E., 2010. Jagged1 functions downstream of Twist1 in
the specification of the coronal suture and the formation of a boundary between
osteogenic and non-osteogenic cells.Dev Biol.347(2):258-70. doi:
10.1016/j.ydbio.2010.08.010.

Zeltser, L.M., Larsen, C.W., Lumsden, A., 2001. A new developmental compartment in
the forebrain regulated by lunatic fringe. Nat Neurosci 4: 683–684.

Abstract (if available)

Abstract The coronal suture is a non-osteogenic tissue boundary located between neural crest and mesoderm derived skull bones. Failure in the formation of this boundary can lead to craniosynostosis, a developmental irregularity marked by the premature fusion of the frontal and parietal bones. Initial studies have linked this phenotype in humans and mice to the heterozygous loss of the transcription factor TWIST1. Previously we demonstrated that Twist1+/- mutants have defects in cell mixing and differentiation at the mesoderm-neural crest interface. We revealed that TWIST1 acts upstream of both EphA4 and Jagged1 to inhibit these processes and allow for the coordinated growth of the frontal and parietal bones. However, what remains to be addressed is the tissue specific requirement of Twist1 in the pathophysiology of craniosynostosis. Using Wnt1-Cre and Mesp1-Cre to conditionally inactivate Twist1 in mesoderm and neural crest together and independently we show that only the concerted loss of Twist1 in both tissues populations is sufficient to cause coronal suture fusion.

Linked assets

University of Southern California Dissertations and Theses

Conceptually similar

PDF

Lineage boundaries and cell migration in the patterning of the mammalian skull

PDF

Jagged1 functions downstream of Twist1 in the specification of the coronal suture and the formation of a boundary between osteogenic and non-osteogenic cells

PDF

Elucidating the role of neural crest specific Stat3 signaling in maintaining coronal suture patency during embryonic development

PDF

Utilizing zebrafish and mouse models to uncover the underlying genetics of human craniofacial anomalies

PDF

Functions of Msx2 and Msx1 during mouse skull and hair follicle development

PDF

Tissue-specific action of Msx genes in the regulation of skull vault development

PDF

Tissue interactions & molecular pathways in specification of the ectomesenchyme from cranial neural crest

PDF

Opposing function of chd7 and phf6 in zebrafish craniofacial development

PDF

FGFR2 Regulates Connective Tissue Development in the Skull

PDF

Neurogenic placodes provide migratory enteric sensory neural progenitors in response to endothelin signaling pathway

PDF

Targeting Ryk-signaling to attenuate multiple sclerosis by promoting oligodendrocyte differentiation and myelination

PDF

Cultured neuronal cells derived from the olfactory neuroepithelium growing in three dimensions as a model system for schizophrenia

PDF

Characterization of the STARS (STochastic gene Activation with Regulated Sparseness) mouse line

PDF

Characterization of transgenic zebrafish lines for studying role of platelet derived growth factor (PDGF) signaling on coronary vessel formation in regenerating zebrafish heart after cryoinjury

PDF

Preosteoblast-specific RUNX2 promotes RANKL membrane association: antagonism by sex steroids through a non-genomic mechanism

PDF

Pten deletion in adult pancreatic beta-cells induces cell proliferation and G1/S cell cycle progression

PDF

Topical adipose-derived stem cell therapy ameliorates radiation-induced delayed wound healing

PDF

Craniofacial skull joint and temporomandibular joint (TMJ) in homeostasis and disease

PDF

In vitro generation of chondrocyte-osteoblast hybrid cells through differentiation of ATDC5 cells

PDF

Connexins in feather morphogenesis

Asset Metadata

Creator Sanghani, Dhvani (author)

Core Title TWIST1 functions in both mesoderm and neural crest derived cranial tissues to establish and maintain coronal suture patency

School Keck School of Medicine

Degree Master of Science

Degree Program Biochemistry and Molecular Biology

Publication Date 08/04/2013

Defense Date 06/19/2013

Publisher University of Southern California (original), University of Southern California. Libraries (digital)

Tag coronal suture,craniosynostosis,OAI-PMH Harvest,TWIST1

Format application/pdf (imt)

Language English

Contributor Electronically uploaded by the author (provenance)

Advisor Maxson, Robert E., Jr. (committee chair), Merrill, Amy (committee member), Tokes, Zoltan A. (committee member)

Creator Email dhvani04.india@gmail.com,dsanghan@usc.edu

Permanent Link (DOI) https://doi.org/10.25549/usctheses-c3-313936

Unique identifier UC11293315

Identifier etd-SanghaniDh-1943.pdf (filename),usctheses-c3-313936 (legacy record id)

Legacy Identifier etd-SanghaniDh-1943-0.pdf

Dmrecord 313936

Document Type Thesis

Format application/pdf (imt)

Rights Sanghani, Dhvani

Type texts

Source University of Southern California (contributing entity), University of Southern California Dissertations and Theses (collection)

Access Conditions The author retains rights to his/her dissertation, thesis or other graduate work according to U.S. copyright law. Electronic access is being provided by the USC Libraries in agreement with the a...

Repository Name University of Southern California Digital Library

Repository Location USC Digital Library, University of Southern California, University Park Campus MC 2810, 3434 South Grand Avenue, 2nd Floor, Los Angeles, California 90089-2810, USA