University of Southern California Dissertations and Theses

PRAS40 connects microenvironmental stress signaling to exosome-mediated secretion

(USC Thesis Other)

PRAS40 connects microenvironmental stress signaling to exosome-mediated secretion

PDF

Download a page range

Download transcript

Copy asset link

Request this asset

Transcript (if available)

Content PRAS40 Connects Microenvironmental Stress Signaling to
Exosome-Mediated Secretion

By
Jiacong Guo

A Thesis Presented to the
FACULTY OF THE USC GRADUATE SCHOOL
UNIVERSITY OF SOUTHERN CALIFORNIA
In Partial Fulfillment of the
Requirements for the Degree
Doctor of Philosophy
(Genetics, Molecular and Cellular Biology)

December 2017

Copyright 2017 Jiacong Guo

ii

Acknowledgements
First and foremost, I would like to thank my mentor Dr. Wei Li for his
constant support and guidance throughout this journey. I am grateful to him
for his tutoring and day-to-day instruction all along. From him I have learned
attention to detail and critical scientific thinking, as well as extensive
motivation which enlightened me to get my job done to the highest level.

I would also like to take this opportunity to thank my thesis committee
members, Drs. Young-Kwon Hong, Muller Fabbri and Chengyu Liang, who
provided me with numerous scientific advice at every stage of my four years
of doctoral research. I am thankful to Drs. Petra Wise and Gyu-Beom Jang
for their invaluable technical support in this project. I am also grateful for
my former colleagues, Priya Jayaprakash, Ayesha Bhatia, Kathryn O’Brien,
Dan Jian, Mengchen Zou, Hangming Dong for their kind support and
academic suggestions over the past few years.

Last but not the least, I want to convey my sincere gratitude to Dr. Mei Chen
and her lab members, Dr. Yingping Hou and Jon Cogan for kindly providing
us with all the reagents, protocols and countless experimental assistance on

iii

a daily basis without which I can hardly get my project done.

iv

Table of Contents
Acknowledgements ........................................................................................................ ii
List of Figures ................................................................................................................. vii
Abbreviations ................................................................................................................... ix
Abstract .............................................................................................................................. xi
1. Introduction.................................................................................................................. 1
1.1 Intercellular communication .............................................................................. 1
1.2 Extracellular Vesicles ........................................................................................... 1
1.3 Exosome ..................................................................................................................... 4
1.4 Proline Rich Akt Substrate of 40kDa ............................................................. 8
2. Materials and Methods ......................................................................................... 12
2.1 Cell lines ................................................................................................................... 12
2.2 Reagents ................................................................................................................... 12
2.3 Human Phospho-Kinase Array........................................................................ 13
2.4 Stress treatment...................................................................................................... 14

v

2.5 Exosome purification, characterization and analysis ............................. 14
2.6 Site Mutagenesis ................................................................................................... 15
2.7 Lentivirus packaging ........................................................................................... 15
2.8 Confocal Microscopy for Immunostaining ................................................ 16
2.9 Statistics. .................................................................................................................. 17
3. Results ......................................................................................................................... 18
3.1 TGFα, but not EGF, selectively induces secretion of exosome cargo
protein, Hsp90 , in human keratinocytes. ......................................................... 18
3.2 TGF  signaling, but not EGF, phosphorylates PRAS40...................... 22
3.3 Identification of PRAS40 that mediates TGF  signaling to Hsp90 
secretion ........................................................................................................................... 25
3.4 PRAS40 mediates various environmental stresses to Hsp90 
secretion ........................................................................................................................... 29
3.5 PRAS40 regulates exosome-mediated secretion in response to
extracellular signals...............................................................................33
3.6 PRAS40 specifically regulates exosome secretion. ................................ 36

vi

3.7 PRAS40 is a universal regulator of exosome secretion in different
cells under various environmental stresses ........................................................ 38
3.8 Thr-246 phosphorylation of PRAS40 is necessary and sufficient to
trigger exosome secretion. ........................................................................................ 41
3.9 Downregulation of PRAS40 blocks exosome translocation ....... Error!
Bookmark not defined.
3.10 PRAS40 regulates exosome secretion independent of mTORC1 and
14-3-3. ............................................................................... Error! Bookmark not defined.
Discussion .............................................................................................. 50
Bibliography ........................................................................................... 59

vii

List of Figures

Figure 1:TGFα, but not EGF, stimulates Hsp90α secretion via EGFR in
human Keratinocytes. ............................................................................... 23

Figure 2: PRAS40 is the possible downstream effector of TGFα, but not
EGF, signaling by array screening. .......................................................... 25

Figure 3: PRAS40 mediates TGFα signaling to Hsp90α secretion. ........ 28

Figure 4: PRAS40 connects different stress cues to Hsp90α secretion. .. 32

Figure 5: PRAS40 mediates induced exosome secretion. ....................... 35

Figure 6: Pharmacological studies with BFA and DMA.......................... 39

Figure 7: PRAS40 mediates exosome secretion in multiple cell types and
in response to discinct stress cues ............................................................ 41

Figure 8: Threonine-246 phosphorylation of PRAS40 is necessary and

viii

sufficient for triggering exosome secretion. ............................................. 45

Figure 9: PRAS40 regulates exosome translocation inside cells. ............ 47

Figure 10: PRAS40 regulates exosome secretion without mTOR and 14-3-
3 participation. .......................................................................................... 49

Figure 11: A schematic representation of stress-triggered exosome
secretion through PRAS40 ....................................................................... 54

ix

Abbreviations
BSA: Bovine Serum Albumin
ECM: Extracellular Matrix
HDF: Human Dermal Fibroblasts
EGFR: Epidermal growth factor receptor
HKC: Human Keratinocytes
HIF-1α: Hypoxia inducible factor-1α
Hsp90: Heat shock protein 90
LRP-1: Low Density Lipoprotein Related Protein-1
MMP-9: Matrix Metalloproteinases-9
TGFα: Transforming growth factor α
EGF: Epidermal Growth Factor
PRAS40: Proline-Rich Akt Substrate of 40kDa

x

MVB: Multivesicular Body

xi

Abstract
Secreted exosomes carrying lipids, proteins and nucleic acids conduct cell-
cell communications within the microenvironment of both physiological and
pathological conditions. Exosome secretion is triggered by extracellular or
intracellular stress signals. Little is known, however, about the signal
transduction between stress cues and exosome secretion. To identify the
linker protein, we took advantage of a unique finding in human keratinocytes.
In these cells, although TGF  and EGF share the same EGF receptor and
previously indistinguishable intracellular signaling networks, only TGF 
stimulation causes exosome-mediated secretion. However, deduction of
EGF-activated pathways from TGF -activated pathways in the same cells
allowed us to identify the proline-rich Akt substrate of 40 kDa (PRAS40) as
the unique downstream effector of TGF , but not EGF, signaling via
threonine-308 phosphorylated Akt. PRAS40 knockdown (KD) or PRAS40
dominant negative (DN) mutant overexpression blocks not only TGF -, but
also hypoxia- and H
2
O
2
-, induced exosome secretion in a variety of normal
and tumor cells. Site-directed mutagenesis and gene rescue studies show that
Akt-mediated activation of PRAS40 via threonine-246 phosphorylation is
both necessary and sufficient to cause exosome secretion, without affecting
the ER/Golgi pathway. Identification of PRAS40 as a linker protein paves the

xii

way for understanding how stress regulates exosome secretion under
pathophysiological conditions.

1

1. Introduction
1.1 Intercellular Communication
Intercellular communication refers to the communication between cells.
Cells can communicate with each other locally through direct contact either
by gap junction or ligand-receptor recognition. For long distance signaling,
specialized cells release hormones and send them through the circulatory
system for target cells to uptake. This process is known as endocrine
signaling. Neuronal cells make use of neurotransmitter diffusion for synaptic
signaling. Either hormones or neurotransmitters are released as individual
proteins, which contain a signal peptide on their N-terminus and are secreted
through ER/Golgi sorting for exocytosis. Whereas for the past few years,
scientists have gradually realized many proteins with no ER signal sequence
are secreted via cell-derived vesicles named extracellular vesicles.
1.2 Extracellular Vesicles
Within the past decade, extracellular vesicles have emerged as important
mediators of intercellular communication, being involved in the
transmission of biological signals between cells to regulate a diverse range
of biological and physiological processes, for example, stem cell
maintenance, tissue repair, immune surveillance, blood coagulation, etc.

2

Secretion of extracellular vesicles (EVs) by cells under stress is an
evolutionarily conserved phenomenon found in almost all types of cells and
biological fluids. EVs have several synonyms, such as “microvesicles”,
“ectosomes”, “mircoparticles” and “exosomes”, widely used in independent
studies (1, 2). The biologic origin and size differences account for the main
distinctions made among these EVs. Exosomes belong to a subtype of EVs
with loosely defined diameters between 30-150nm and are derived from
intraluminal vesicles (ILVs) within intracellular multivesicular bodies
(MVB) (3, 4, 5).

Extracellular Vesicles are composed of Apoptotic Bodies, Microvesicles and
Exosomes. Picture adapted from Gyorgy et al., Cell. Mol. Life Sci. (2011)
68:2667-2688

3

Nonetheless, due to technical limitations in purifying EV populations, the
currently used term “exosomes” refers to a population of EVs of varying
sizes but with the majority being between 30 and 150 nm in diameter, instead
of a single subtype of EV with a clearly defined population in size and origin
of production (6).

Size ranges of different types of extracellular vesicles. Exosomes share size
distribution with viruses, microvesicles overlap in size with bacteria and
apoptotic bodies are comparable to platelet. Picture adapted from Gyorgy et al.,
Cell. Mol. Life Sci. (2011) 68:2667-2688

4

1.3 Exosome
The initial discovery of exosomes originated from two groundbreaking
publications (3,4), in which scientists used electron microscopy to visualize
the internalization of gold-labeled anti-transferrin receptor antibody in
reticulocytes. In cells that were incubated at 37 ℃ for 15 min after antibody
binding, the label was found in vesicles termed early endosomes, whereas
after one hour of incubation, the internalized antibody was found in multi-
vesicular endosome and localized mostly at the surface of the internal
vesicle. After three hours, the authors observed fusion of these multi-
vesicular compartments with plasma membrane, indicating these
internalized vesicles are released into the extracellular environment.

5

Normal cells secrete exosomes under extracellular environmental stress,
Exosome biogenesis
Lipids, proteins and nucleic acids are transported to MVBs and onto or into the
intraluminal vesicles, which upon fusion of the MVB with the plasma
membrane are released as exosomes. Originally identified as a way to release
transferrin receptor from maturing reticulocytes, after endocytosis, transferrin
receptor complex are targeted to MVBs through various mechanisms and
released on exosomes. RNA and cytoplasmic proteins are also transported to
MVBs, although the mechanisms mediating this transport are less
understood. Adapted from Schorey et. al., EMBO reports (2015) 16,24-43.

6

whereas tumor cells constitutively secrete exosomes driven by intracellular
oncogenes (7). In response to environmental or oncogenic stress cues, the
exosome-containing MVB or MVB-derived exosomes themselves directly
fuse with the plasma membrane to release exosomes to the extracellular
environment. The secreted exosomes can transfer their cargo molecules,
including DNAs, mRNAs, miRNAs, lipids and proteins, to other nearby
cells of varying cell types and affect the biological behavior of these target
cells (1, 8, 9, 10).
A schematic representation of exosome composition. Picture adapted from
Meckes at el., 2011;85:12844-12854.

7

This new and increasingly recognized mechanism of intercellular
communication has been demonstrated to play critical roles in host immune
responses (11), tissue repair (1, 12) and tumor invasion and metastasis (7,
13, 14, 15). Despite the importance of secreted exosomes, little is known
about the regulation of exosome secretion by microenvironmental stress.
The Rab27 small GTPases including Rab27a and Rab27b have been
reported to regulate exosome biogenesis and secretion. Studies showed that
Rab27a and Rab27b regulate distinct steps of multi-vesicular endosome
(MVE) docking to the plasma membrane and exosome biogenesis, in which
Rab27a regulates MVE breakdown and Rab27b regulates MVE distribution,
formation and secretion of exosomes in various types of cells (16, 17). On
the other hand, Rab27 proteins do not appear to be strictly specific regulators
of exosomes, since Rab27a also regulates secretion of MMP9 and growth
factors through the conventional ER/Golgi pathway (13, 18). Sinha and
colleagues showed that knockdown or overexpression of cortactin resulted
in a respective decrease or increase in exosome secretion, without
altering exosome cargo content in cancer cells. They proposed that cortactin
promotes exosome secretion via binding to Arp2/3 and stabilizing cortical
actin-rich MVE docking sites (19). Nevertheless, it is not known if Rab 27
or cortactin serve as linker molecules that connect microenvironmental
stress signals to exosome-mediated secretion.

8

1.4 Proline Rich Akt Substrate of 40kDa
The proline-rich Akt substrate of 40 kDa (PRAS40) was initially identified
as a direct substrate of Akt kinase and a binding partner for the 14-3-3
scaffolding molecule (20). Most studies focused on PRAS40’s role in insulin,
as well as NGF and PDGF, signaling to the mTOR (mammalian target of
rapamycin) pathway (specifically mTORC1), which regulates cell
metabolism, protein synthesis and cell growth (21, 22, 23, 24, 25, 26, 27,
28). In growth-arrested cells, PRAS40 was reported to bind, via the raptor
An illustration of possible protein complexes involved in exosome secretion. Picture
adapted from Kowal et. al, Curr Op Cell Biol, 2014 Aug; 29:115-125.

9

subunit, to mTORC1 and inhibits mTOR kinase activity. Insulin stimulation
activates Akt kinase mainly via threonine (Thr)-308 phosphorylation. The
activated Akt kinase in turn phosphorylates PRAS40 on Thr-246. Thr-246
phosphorylated PRAS40 dissociates from mTORC1, resulting in activation
of mTORC1, and (re-) associates with 14-3-3 (23, 25, 26, 29). In addition
to Akt, increased PIM1 kinase activity also correlated with increased
PRAS40 phosphorylation. Activated mTORC1 phosphorylates PRAS40 at
Ser-183, Ser-212 and Ser-221 (30, 31). Despite these reports, other studies
suggest that PRAS40 is not a common regulator of mTOR activation in
response to different extracellular signals (27, 32).

10

Schematic model of PRAS40/mTOR signaling. Stimulation of cellular
growth following caridiac pressure overload or growth factor signaling
activates mTORC1. Full activation of mTORC1 requires the dissociation of
PRAS40 from mTORC1, which requires phosphorylation of PRAS40 by
Akt and mTORC1. Increased mTORC1 activity regulates protein synthesis
and cellular growth through phosphorylation of downstream targets(S6K
and 4EBP1). Overexpression of PRAS40 blocks mTORC1 activation and
reduces cellular growth or proliferation. Picture adapted from Kovacina
et.al., J Biol Chem, 2003 Mar 21; 278(12):10189-10194.

11

In this current study, we seized upon a unique property of human
keratinocytes in culture and found a critical signaling molecule that connects
microenvironmental cues to exosome secretion. While both transforming
growth factor-alpha (TGF ) and epidermal growth factor (EGF) are known
to utilize the same cell surface EGF receptor for transmembrane signaling
and previously indistinguishable intracellular signaling networks, we
surprisingly found that only TGF  triggers secretion of heat shock protein-
90alpha (Hsp90α), a known exosome cargo protein. By comparing and
deducting 43 intracellular signaling molecules/pathways in the same cells in
response to TGF  or EGF stimulation, we identified PRAS40 as a TGF -
specific downstream target. We found that activated PRAS40 acts not only
as a regulator of TGF -, but rather a common regulator of distinct
microenvironmental and oncogenic signal-, triggered exosome secretion in
both normal and tumor cell types. PRAS40 is the first regulator identified
for stress-induced exosome secretion.

12

2. Materials and Methods
2.1 Cell lines
Primary human keratinocytes (HKCs) were cultured in EpiLife medium
with added growth factor supplements (Thermo Scientific, MA, USA). The
third or fourth passages of cells were used throughout this study. Primary
mouse hepatocytes, the mouse lung epithelial cell line, MLE15, and human
triple negative breast cancer cell line, MDA-MB-231, were obtained from
the laboratories of Drs. Bangyan Stiles, Zea Borok, Pinghui Feng and
Michael Press (University of Southern California, Los Angeles),
respectively. All the four types of cells were cultured in DMEM with high
glucose supplemented with 10% FBS (Thermo Scientific, MA, USA).

2.2 Reagents
TGFα and EGF were purchased from Fitzgerald Industries International
(Acton, MA). The human PRAS40 cDNA (wt) was purchased from Addgene
(Plasmid #14950). Anti-PRAS40 (MAB6408), anti-phospho-PRAS40
(T246) (MAB6890) and anti-phospho-RSK S380 antibodies (MAB79671)
were from R&D systems (Minneapolis, MN). Anti-CD63 (EXOAB CD63-
A1), anti-CD9 (13403), anti-flottilin-1 (3253), anti-CD81 (EXOAB

13

CD81A-1), anti-phospho-Akt S473 (4060), anti-phospho-Akt T308 (4087),
and anti-EGFR (4267) antibodies were from System Biosciences (Mountain
View, CA) and Cell Signaling Technology (Danvers, MA), respectively.
Mouse monoclonal antibodies against human Hsp90α (CA1023) and human
Hsp90β (SMC107) were from Calbiochem (Billerica, MA) and Stressmarq
Biosciences (Victoria, BC, Canada), respectively. Anti-cyclin-D1
(GTX61845) and anti-GAPDH (GTX28245) antibodies were from Genetex
(Irvine, CA). LY294002 was from Cell Signaling (Cat. # 9901, Danvers,
MA). Brefeldin A (BFA) and Dimethyl Ameloride (DMA) were purchased
from Sigma Aldrich (St. Louis, MO).

2.3 Human Phospho-Kinase Array
Human Keratinocytes were grown to 80% confluence in 15cm tissue culture
dishes and incubated in serum-free medium overnight. Cells were stimulated
with growth factors for the indicated time. The stimulation was stopped by
addition of ice-cold PBS buffer and the cells on ice lysed. The post-nuclear
extracts were subjected to Proteome Profiler Human Phospho-Kinase Array
(ARY003B, R&D Systems, Minneapolis, MN) according to the
manufacturer’s instruction. In this protocol, the most critical thing is to
“synchronize” all the steps for differentially-treated samples from the time

14

of incubation with the kinase array membranes all the way to ECL
development of the results, in order to compare the relative intensities of the
dots.

2.4 Stress treatment
The OxyCycler C42 from BioSpherix (Parish, NY) was used as the oxygen
content controller. The medium used for hypoxia experiments was pre-
incubated in a hypoxia (1% O2) chamber for 16 hours prior to its use to
replace the normoxia culture medium (Vincent et al. 2007). 1% O2 was used
throughout the study. Hydrogen Peroxide (H2O2) was purchased from
VWR Analytical (Radnor, PA) and 10 M was chosen for the treatment of
the cells.

2.5 Exosome purification, characterization and analysis
Conditioned media were collected (Cheng et al, 2008) and spun at 300g at 4
oC for 10min to remove floating cells. Dead cells and microvesicles were
removed by centrifugation at 2,000g for 10min, followed by 10,000g
centrifugation for 30 min, respectively. Finally, the cleared supernatant was
centrifuged at 100,000g for 70 min to collect the exosomes in the pellets.

15

The exosome fractions were washed in 10ml of PBS and centrifuged again
at 100,000g for 70 min to get rid of any left contaminating particles. The
size distribution and concentration of the exosome fractions were analysed
using the Malvern Nanosight (Nanosight, Malvern instruments) aided by the
Nanoparticle Tracking Analysis (NTA) software. Molecular markers for
exosomes and Hsp90  were verified using Western immunoblotting
analyses.

2.6 Site Mutagenesis
The Quikchange II XL site-directed mutagenesis kit (200521-5) from
Agilent Technologies was used to mutate the T246 site of PRAS40. The
primer sequence GGAAGTCGCTGGCGTTAAGCCGCGGC (sense) was
used to generate the T246A mutation and the primer sequence
GCTTCTGGAAGTCGCTTTCGTTAAGCCGCGGCCGTGG (sense) was
used to generate the T246E mutation.

2.7 Lentivirus packaging
The protocols for using lentiviral systems for gene down-regulation and
gene up-regulation, including virus packaging, isolation, infection and

16

analyses, were as previously described (Cheng et al, 2008; Sahu et al, 2012;
Li et al, 2007). The pRRLsinh-CMV system was used to overexpress
exogenous genes such as the wt and mutant PRAS40 cDNAs. The pHR-
CMV-puro RNAi delivery system was used to deliver shRNA. The shRNA
sequence of PRAS40 was GCTGAGTTCTAAGCTCTAA (sense), for
EGFR was AGAATGTGGAATACCTAAGG (sense) and for 14-3-3 ,
GTGCAGTACTGCTGTAGA (sense).

2.8 Confocal Microscopy for Immunostaining
For immunostaining with anti-CD63 antibody, approximately 15,000 cells
of passage 2-3 primary human keratinocytes were seeded in 8-well
chambered cell culture slides (Corning, NY) and grown to ~80% confluence.
The cells were serum-starved overnight and either untreated or treated with
human recombinant TGF  (20ng/ml) for 2 hours, the earliest time point
when induced exosome secretion was detectable. Cells were washed twice
with on ice-cold PBS buffer, fixed in acetone for 5 min, washed with PBS
and incubated in blocking reagent (10% normal goat serum, 0.05% Tween
20, 0.05% Triton X-100, and 1% BSA in PBS) for 60 min. The slides were
washed twice with PBS and incubated with anti-CD63 antibody (19281,
Thermo Fisher Scientific, CA) for 2 hours, washed three times with PBS and

17

incubated with FITC-conjugated secondary antibody. Last, the slides were
counter-stained with DAPI solution (2μg/ml DAPI in 40% glycerol),
mounted with coverslips and sealed with nail polish. The images were taken
under confocal microscope (Eclipse C1; Nikon, Japan) with sequential
applications of the following fluorochromes: green (FITC) and blue (DAPI).
The images were taken by Photoshop software (San Jose, CA) as JPEG
format. 60 cells from 10-20 randomly chosen fields (60x) per experimental
condition were evaluated for imaging analysis by Image J software (NIH).
Green fluorescence around membrane peripheral of the cells was localized
by drawing the region of interest. The intensity of the green fluorescence
within the membrane peripheral and of the total cell were measured by
ImageJ software. The translocation percentage (%) was calculated by
dividing the fluorescence intensity in the membrane area by the total cell
fluorescence.

2.9 Statistics.
Data are based on three or more independent experiments and presented as
mean ± standard deviation (s.d.). Statistical significance for comparisons
was evaluated by the Student's two-tailed t-test for comparisons of two
groups, or analysis of variance for comparisons of more than two groups.

18

A p value equal or less than 0.05 was considered statistically significant (*,
**, ***).
3.Results
3.1 TGFα, but not EGF, selectively induces secretion of exosome cargo
protein, Hsp90 , in human keratinocytes.
In wounded skin, the TGFα levels rise from undetectable to ~40ng/ml and
stimulate keratinocytes at the wound edge of epidermis to secrete Hsp90 ,
a known exosome cargo protein, presumably for promoting wound closure
(33, 34, 35). Therefore, understanding how TGFα regulates exosome-
mediated Hsp90  secretion would allow for the identification of the linker
molecule that connects extracellular environmental signals to the exosome
trafficking pathway. Experimentally, we took advantage of a unique
observation that, while both TGFα and EGF share the same cell surface
receptor, EGFR, in primary human keratinocytes, only TGFα stimulation
induces Hsp90α secretion. As shown in Figure 1A, secreted Hsp90  was
detected by Western immunoblotting the conditioned medium only from
TGF -, but not EGF-, stimulated keratinocytes (panel a, lane 3 versus lane
2). Accordingly, we detected a corresponding decrease (~20% as measured
by densitometry scanning) from the cytosolic pool of Hsp90α in the TGFα-

19

stimulated cells (panel b, lane 3 versus lane 1). We confirmed that the TGFα-
stimulated Hsp90α secretion is mediated by EGFR, since down-regulation
of the EGFR (Figure 1B, panel d, lane 2 versus lane 1) completely blocked
TGFα-stimulated Hsp90α secretion (Figure 1C, panel f, lane 5 versus lane
2). The TGFα signaling that leads to Hsp90  secretion is independent of de
novo protein synthesis, since treatment of the cells with cycloheximide (chx)
did not affect the TGFα-induced Hsp90α secretion (Figure 1D, panel g, lane
4 versus lane 3), whereas the chx treatment completely blocked TGFα-
induced cyclin D1 expression (panel h, lane 4 versus lane 3). These findings
provided us with an opportunity to search for the direct downstream effector
of TGFα signaling that regulates Hsp90α secretion.

20

21

Figure 1. TGFα, but not EGF , stimulates Hsp90α secretion via EGFR in human
keratinocytes
(A) Serum-starved primary human keratinocytes were either untreated (-) or treated with
TGFα (20 ng/ml) or EGF (20 ng/ml) for 12 hours. Conditioned media were collected for
secreted molecules and Triton-x-100 soluble extracts for total cytoplasmic proteins. Both
fractions were subjected to immunoblotting analyses with antibodies against the
indicated target molecules. Densitometry scanning was performed on intracellular
Hsp90α against GAPDH as background controls (panels b and c). (B) EGFR down-
regulation by lentiviral vector delivery of a control and anti-EGFR shRNA (panel d, lane
2). (C) Down-regulation of EGFR blocks TGFα-stimulated Hsp90α secretion (panel f,
lane 5 versus lane 2). (D) Cycloheximide (CHX) blocks TGFα-stimulated cyclin D1
induction (panel h), but not Hsp90α secretion (panel g). (E) A schematic interpretation
of the results from A to D. The question mark (?) represents the possible signaling
molecule downstream TGF , but not EGF, signaling. (F) TGF  and EGF induces
indistinguishable patters of total protein tyrosine phosphorylation. (G) Both stocks of
TGF  and EGF are functional for activating ERK1/2 (panel j). These results were
reproducible in at least three repeated experiments (n > 3).

As shown schematically in Figure 1E, our approach was to deduct EGF-
activated pathways from TGFα-activated pathways in the same cells and

22

identify the unique downstream target that is specific for TGFα signaling.
The question mark represents the putative unknown signaling molecule that
mediates TGFα signaling to Hsp90α secretion.

We first compared the global protein tyrosine phosphorylation, since EGFR
is a receptor tyrosine kinase. As shown in Figure 1F, we obtained
indistinguishable patterns between EGF- and TGFα-induced tyrosine
phosphorylation (lanes 2 and 3 versus 1), suggesting that the potential
effector of the TGFα signaling to Hsp90  secretion is not among
phosphotyrosine proteins. In this experiment, both TGF  and EGF were
fully functional, since both growth factors potently stimulated the activation
of ERK1/2 kinases in the same cells (Figure 1G, panel j, lanes 1 to 8 versus
lane 9). We concluded, therefore, that a broader search of the signaling
networks was needed.

3.2 TGF  signaling, but not EGF, phosphorylates PRAS40
Therefore, we subjected the lysates of TGFα- or EGF- stimulated human
keratinocytes to a global pathway screening with the Human Phospho-
Kinase Array (ARY003B, R&D) that allows simultaneous detections of 43
independent signaling pathways, as schematically shown in Figure 2A (see

23

Methods for the details). Our focus was on the early (minutes) and de novo
protein synthesis-independent (TGF  and EGF) signaling events, as
schematically shown in Figure 2B, in which EGF and TGFα stimulation was
restricted to two minutes when the highest level of EGFR activation in
human keratinocytes is detected (36). The results of a representative
experiment are shown in Figure 2C.

24

Figure 2. PRAS40 is the possible downstream effector of TGFα, but not EGF ,
signaling by array screening.
Serum-starved primary human keratinocytes were either untreated (-) or treated with
TGFα (100 ng/ml) or EGF (100 ng/ml) for two minutes (5-10 fold higher concentration
of growth factor for shorter time stimulation to detect signaling molecules.). The cell
extracts were incubated with Human Phospho-Kinase Array membranes rom R&D and
signals detected according to the manufacturer’s instruction (Methods). (A) A schematic
representation of the 43 pathways included in the array. (B) experimental design and
sequential steps. (C) ECL results of the membranes show major pathways activated by

25

TGFα or EGF or both under the stimulation time and conditions.

3.3 Identification of PRAS40 that mediates TGF  signaling to Hsp90 
secretion
Within two-minutes of stimulation, we detected five known molecules that
exhibited increased phosphorylation by TGFα stimulation, including
PRAS40 (circle 1), EGFR (circle 2), ERK1/2 (circle 3), Akt (Thr-308) (circle
4), and RSK (circle 6). One increased protein level, Hsp60 (circle 5), was
ruled out from our search. Phosphorylation of EGFR, ERK1/2 and RSK were
induced by both EGF and TGFα, and, therefore, excluded from further
consideration. We focused on the increased phosphorylation of PRAS40 at
Thr-246 and phosphorylation of Akt at Thr-308, since they were only
detected in TGFα-stimulated (panel b), but not in EGF-stimulated (panel c),
cells. EGF stimulation only induced Ser-473 phosphorylation of Akt in the
same cells (see the following section). We further verified the findings by
Western immunoblotting analysis. The time course of phosphorylation of Akt
(Thr-308), Akt (Ser-473), PRAS40 (Thr-246) and RSK in human
keratinocytes in response to TGFα and EGF stimulation is shown in Figure
3A. TGFα induced a time-dependent phosphorylation of PRAS40 on Thr-
246 (panel a, lanes 2 to 5 versus lane 1), while EGF did not (lanes 6-9 versus

26

lane 1). Both TGFα and EGF stimulated phosphorylation of Akt on Ser-473
(panel c), but interestingly only TGFα stimulated phosphorylation of Akt on
Thr-308 (panel b, lanes 2 to 5 versus lanes 6 to 9). These findings are
important, since a previous report showed that only the Thr-308
phosphorylated Akt is the upstream kinase that phosphorylates Thr-246 in
PRAS40 (39). Under the same conditions, TGFα and EGF equally stimulated
RSK phosphorylation (panel d, lanes 3-5 versus lanes 7-9). Three
corresponding protein loading controls support the above conclusions
(panels e, f, g). As expected, the TGFα-induced phosphorylation of PRAS40
requires EGFR, since down-regulation of EGFR completely blocked TGFα-
stimulated PRAS40 phosphorylation (Figure 3B, panel h, lane 5 versus lane
2).

27

Figure 3. PRAS40 mediates TGF  signaling to Hsp90  secretion.
(A) Serum-starved primary human keratinocytes were either untreated (-) or treated with
TGFα (100 ng/ml) or EGF (100 ng/ml) for the indicated time. Total lysates were
subjected to Western blotting with antibodies against the activated signaling molecules
or controls. (B) TGFα, but not EGF, stimulates phosphorylation of PRAS40 via EGFR.
(C) A schematic representation of a hypothesis that PRAS40 mediates the TGFα
signaling leading to Hsp90α secretion. (D) PI-3K inhibitor blocks TGFα signaling to
Hsp90α secretion. (E) Lentiviral infection (pHR-CMV-puro RNAi delivery system)-

28

mediated down-regulation of endogenous PRAS40. (F) Down-regulation of PRAS40
blocks TGFα-stimulated Hsp90α secretion (lane 5 versus lane 2). (G) Down-regulation
of PRAS40 on cell survival. (H) Down-regulation of PRAS40 on cell motility. These
experiments were repeated 3 times by different lab members on the author list.

The above findings pointed to PRAS40 as the potential linker molecule
between TGFα signaling, via pAkt-T308, and Hsp90α secretion, as
schematically depicted in Figure 3C. To test this possibility, as shown in
Figure 3D, we found that inhibition of Akt upstream kinase, PI-3K, by
LY294002 completely blocked TGF -stimulated Hsp90  secretion (panel j,
lane 4 versus lane 2). Second, we used the lentiviral pHR-CMV-puro RNAi
delivery system (38) to deliver an shRNA against the 3’ UTR of the human
PRAS40 gene and achieved nearly complete down-regulation of the
endogenous PRAS40 protein in human keratinocytes following drug
selection (Figure 3E, panel l, lane 2 versus lane 1). Under these conditions,
TGFα stimulation was no longer able to induce Hsp90α secretion (Figure
3F, panel l, lane 5 versus lane 2).

Down-regulation of PRAS40 affected neither the cell morphology (Figure
3G, panel o versus panel n) nor cell motility in response to serum (Figure
3H, bars 3 and 4 versus bars 1 and 2). Intriguingly, the difference between

29

TGFα and EGF in promoting Hsp90α secretion was also detected in
keratinocyte migration in response to these growth factors. TGFα
promotes extra 10% more of the cell migration than EGF (bar 5 versus bar
7). PRAS40 down-regulation selectively abolished this extra 10%
enhancement of the cell motility by TGFα (bar 6 versus bar 5), but had little
effect over EGF-stimulated cell migration (bars 7 and 8). We found that this
long recognized extra 10% stimulation of cell motility by TGF  was
contributed by secreted Hsp90 , since addition of human recombinant
Hsp90  recovered the extra 10% for TGF  in PRAS40-downregulated cells
(bar 10) and also synergized EGF stimulation to similar level of the TGF 
stimulation (bars 11 and 12).

3.4 PRAS40 mediates various environmental stresses to
Hsp90  secretion
More importantly, this new role for PRAS40 in exosome-mediated Hsp90 
secretion was not restricted to growth factor-induced Hsp90α secretion. As
schematically shown in Figure 4A, we tested two additional common
microenvironmental cues, hypoxia and oxidative stress. Under hypoxia (1%
O2), as shown in Figure 4B, accumulation of the hypoxia-inducible factor-
1alpha (HIF-1 ) protein occurred in a time-dependent fashion, as the proof

30

for hypoxia (panel a). While the overall cellular level of PRAS40 remained
unchanged (panel b), hypoxia induced phosphorylation of PRAS40 on Thr-
246 in a time-dependent manner, which declined after 6 hours (panel c).

Figure 4. PRAS40 connects different stress cues to Hsp90  secretion.
(A) A schematic illustration of a to-be-tested model. (B) Serum-starved primary human
keratinocytes were either untreated (-) or treated with hypoxia (1% O2) for the indicated
time. Total cell lysates were immunoblotted with anti-HIF-1  (panel a), anti-PRAS40
(panel b), anti-phospho-PRAS40 (panel c) and anti-GAPDH (panel d) antibodies. (C)

31

The same duplicate cells were either untreated (-) or treated with H2O2 (30 M). Total
cell lysates were immunoblotted with anti-PRAS40 (panel e), anti-phospho-PRAS40
(panel f) and anti-GAPDH (panel g) antibodies. (D) Conditioned media were collected
from shLacZ- or shPRAS40- infected cells under either normoxia or hypoxia and
subjected to immunoblotting with anti-Hsp90  antibody. (E) Conditioned media were
collected from shLacZ- or sh-PRAS40- infected cells treated with H2O2 (in 3.3 l) or
same volume of H2O and subjected to immunoblotting with anti-Hsp90  antibody. The
results were reproducible by two repetitive experiments.

Oxidative stress, H
2
O
2
, treatment, however, caused a sustained increase in
phosphorylation on Thr-246 (Figure 4C, panels f), which was also followed
by increased PRAS40 protein levels at the later times (panel e). Nonetheless,
down-regulation of PRAS40 blocked both hypoxia- (Figure 4D, panel h,
lane 4 versus lane 3) and H
2
O
2
- (Figure 4E, panel i, lane 4 versus lane 3)
induced Hsp90α secretion. Finally, PRAS40 as regulator of Hsp90α
secretion via exosomes was also confirmed in a variety of cell types (see
Figure 7 later).

32

3.5 PRAS40 regulates exosome-mediated secretion in response to
extracellular signals.
Secreted Hsp90  has been shown to be present with secreted exosomes by
proteomic analysis (39) and electron microscopy (40). We found that the
secreted Hsp90  was associated with the pellet fraction of exosomes and
little in the leftover supernatant following 100,000g centrifugation (Figure
5A, lane 2 versus lane 1), although this finding did not exclude the
possibility that some Hsp90  is associated larger macrovesicles. We,
therefore, postulated that PRAS40 is, in fact, a regulator of stress-induced
exosome secretion, in which Hsp90  is just a cargo molecule. We utilized a
sequential centrifugation technique to isolate the 100,000g pellet fractions
from cell conditioned media, followed by nanoparticle tracking analysis
(NTA), which measures the size and the amount of EVs with the diameter
range set for 10-1000 nanometres (nm) in liquid suspension. As shown in
Figure 5B, the majority of the vesicles in the 100,000g pellets fell into the
range of 30-150 nm in diameter, consistent with the size range for exosomes.
In the control (shLacZ-infected) cells, TGF  stimulated a dramatic increase
in quantity of secreted exosomes (peak #1 versus peak #2). However, the
TGFα-stimulated exosome secretion was completely blocked in the
PRAS40-down-regulated cells (peak #4). PRAS40 down-regulation even

33

eliminated the basal level of exosome secretion from the unstimulated
parental cells (peak #3 versus peak #2) (Note: cell culture itself is a minor
stress to the cells). Quantitation of these data is shown in Figure 5C, which
clearly indicated a critical role for PRAS40 in TGF -induced exosome
secretion (bars 3 and 4 versus bars 1 and 2).

34

Figure 5. PRAS40 mediates induced exosome secretion.
Serum-starved primary human keratinocytes with or without PRAS40 down-
regulation were either untreated (-) or treated with TGFα (20ng/ml). Conditioned
media were collected and subjected to sequential centrifugations (Methods). The
100,000g pellet fraction was analysed by the following methods. (A) Comparison of
secreted Hsp90 in 100,000g exosomes and the exosome-depleted supernatant.
(B) NTA analysis of 100,000g pellet fractions (from conditioned medium of 3 x 106
cells) under the indicated conditions. (C) Quantitation of the NTA data. (D) Effects

35

of PRAS40 down-regulation on the intracellular and secreted EV/exosome markers
as indicated. The results were reproducible in three independent experiments. (E)
NTA analysis of 100,000g pellet fractions from conditioned medium of 3 x 106 cells,
as indicated. ** p <0.05; *** p < 0.005.

To verify the NTA data for the role of PRAS40 in exosome secretion, we
carried out immunoblotting (Western) analysis of 1) total cell lysates, 2)
100,000g pellets and 3) post-100,000g supernatants with antibodies against
both exosome and non-exosome protein markers. As shown in Figure 5D,
as expected, TGFα stimulated PRAS40 phosphorylation in control shLacZ
infected, but not in PRAS40-down-regulated cells (panel a, lane 4 versus
lane 2). Interestingly, PRAS40 was not detected in the exosome fraction
(panel c), supporting our hypothesis that PRAS40 acts as an early signaling
molecule between stress and exosome secretion. Consistent with the NTA
data, PRAS40 down-regulation blocked TGFα-induced secretion of
exosome-associated protein markers and cargo molecules (lanes 4 versus
lanes 2), including Hsp90α (panel d), CD63 (panel e), CD81 (panel f), CD9
(panel g) and flotillin-1 (panel h). In contrast, the ER/Golgi pathway-
secreted matrix metalloproteinase 9 (MMP9) was not detected in the
exosome fractions (panel i). In the exosome-depleted conditioned media,
Hsp90α was no longer detectable (panel j), whereas the presence of MMP9

36

was unaffected by PRAS40 down-regulation (panel k). In consistent with
previous Western blotting data, NTA analysis also confirmed that TGF , but
not EGF, triggers exosome secretion in human keratinocytes (Figure 5E).
The quantity of secreted exosomes (i.e. E6 particles/ml, in 5C and 5E) varies
due to the total number of the cells used for each experiment.

3.6 PRAS40 specifically regulates exosome secretion.

In reverse, if Hsp90  is just one of the cargo molecules in exosomes,
depletion of Hsp90  should not affect exosome secretion. We used
CRISPR/cas9 to knockout both alleles of Hsp90  gene in MDA-MB-231
breast cancer cells (41) that have been shown to constitutively secrete
exosomes and Hsp90  (42, 43). As shown in Figure 6A, Hsp90  knockout
is evident (panel l, lane 2). However, the presence of CD63 (panel n), CD81
(panel o), CD9 (panel p) and flotillin-1 (panel q) in the 100,000g exosome
fraction of the conditioned medium was unaffected by Hsp90  knockout
(lanes 2 versus lanes 1).

The above findings were further supported by a pharmacological approach
using specific chemical inhibitors of the exosome and the ER/Golgi

37

pathways, respectively. DMA (dimethyl amiloride) and BFA (Brefeldin A)
are known specific chemical inhibitors of the exosome-mediated and
ER/Golgi-mediated trafficking pathways, respectively. As shown in Figure
6B, DMA (dimethyl amiloride) showed the same effect as the PRAS40
down-regulation on exosome secretion (panels d to h, lanes 4), whereas BFA
(Brefeldin A) inhibited the ER/Golgi-mediated MMP9 secretion (panel k),
but not exosome secretion (panels d to h, lanes 3).

38

Figure 6. Pharmacological studies with BFA and DMA.
(A) Hsp90 -knockout (panel l) did not affect exosome secretion (panels n to q) in
MDA-MB-231 cells that constitutively secrete exosomes. (B) TGFα-stimulated
phosphorylation of PRAS40 inside the cells could not be blocked by either ER/Golgi
pathway inhibitor, BFA (10 μg/mL) or exosomal pathway inhibitor, DMA (25 µg/ml)
(panel a). PRAS40 was not found in isolated exosome fractions (panel c). In contrast,
TGFα-stimulated secretion of Hsp90α, exosome-enriched tetraspanins, CD63, CD81
and CD9, and more general EV-enriched marker, flotillin-1, was blocked by DMA, but
unaffected by BFA (lanes 3) (Panels d to h, lanes 2 and 4). The ER/Golgi

39

pathwaysecreted MMP9 was not detected in the exosome fractions (panel i), but
present in EV-depleted supernatants and sensitive to BFA (panel k).
3.7 PRAS40 is a universal regulator of exosome secretion in
different cells under various environmental stresses
Finally, we found that the role for PRAS40 in stress-induced exosome
secretion is conserved in various normal and tumor cell lines. As shown in
Figure 7, PRAS40 down-regulation in primary mouse hepatocytes (Figure
7A, panel a) and MLE15 (mouse lung epithelial) cells (Figure 7B, panel i)
blocked exosome secretion in response to hypoxia and oxidative stress
(panels c to h and panels k to p, respectively). Many cancer cells show
constitutively activated PRAS40 (44). We tested the role of PRAS40 in
MDA-MB-231 breast cancer cells, BJAB Burkitt lymphoma cells and
SKNBE2 neuroblastoma cells, which all show constitutive PRAS40
phosphorylation at Thr-246 and constitutive expression of the HIF-1α
oncogene. In these cells, as shown in Figure 7 C, D and E, PRAS40 down-
regulation dramatically decreased the constitutive exosome-mediated
secretion even under normoxia (panels s to x for MDA-MB-231, panels y to
c’ for BJAB and panels d’ to h’ for SKNBE2)

40

.

41

Figure 7. PRAS40 mediates exosome secretion in multiple cell types and in
response to distinct stress cues.
Downregulation of endogenous PRAS40 in primary mouse hepatocytes (A, panel a),
MLE (mouse lung epithelial) cells (B, panel i), MDA-MB-231 breast cancer cells (C,
panel q), B cell lymphoma cells, BJAB (D, pane y) and neuroblastoma cells, SKNBE2
(E. panel d’). As shown in the middle row of panels, hypoxia strongly induced secretion
of Hsp90α (panels c, k), CD9 (panels d, l) and CD63 (panels e, m) in shLacZ-infected
non-cancer cells cells (lanes 3 versus lanes 1). In contrast, secretion of these markers was
constitutive (lanes 3 vs. lanes 1) in three cancer cell line, MDA-MB-231 (panels s, t, u),
BJAB (panels a’ b’ c’) and SKNBE2 (panels f’, g’ h’). All the secretion was blocked by
down-regulation of PRAS40 (lanes 2 and Lanes 4). Similarly, the H2O2 treatment greatly
induced secretion of Hsp90α (panels f, n and v,), CD9 (panels g, o and w) and CD63
(panels h, p and x) in the control cells (lanes 3 versus lanes 1). Down-regulation of
PRAS40 blocked H2O2-induced secretion of all the markers (lanes 2 versus lanes 4).
3.8 Thr-246 phosphorylation of PRAS40 is necessary and sufficient to
trigger exosome secretion.
The Thr-246 phosphorylation of PRAS40 by Thr-308-phosphorylated Akt1,
as schematically shown in Figure 8A, is a known extracellular signal-
induced post-translational modification (45). Since stress signals including
TGFα, hypoxia and H
2
O
2
have all been shown to activate Akt (46, 47, 48),

42

we tested whether the Thr-246 phosphorylation of PRAS40 is the
mechanism by which PRAS40 receives the extracellular stress signals for
regulating exosome secretion. Specifically, we asked the important question
of whether Thr-246 phosphorylation is necessary, sufficient or both for
PRAS40 to transmit microenvironmental signals to exosome-mediated
secretion. We took a gene rescue approach by re-introducing PRAS40-wt,
dominant negative PRAS40-T246A and constitutively active PRAS40-
T246E mutants into endogenous PRAS40-depleted cells. As shown in
Figure 8B, down-regulation of the endogenous PRAS40 was nearly
complete (panel a, lane 2 versus lane 1). In these cells, each of the three
PRAS40 constructs, as listed in Figure 8A, was expressed at a level similar
to that of the endogenous PRAS40 in the parental cells (lanes 3, 4, 5 versus
lane 1). These cells were untreated or treated with the indicated stress, their
serum-free conditioned media collected and the 100,000 g pellet fractions of
the conditioned media subjected to immunoblotting analysis for cargo and
exosome markers. As shown in Figure 8C, down-regulation of PRAS40
blocked TGFα-stimulated secretion of Hsp90α (panel c, lane 4 versus lane
2), CD9 (panel d, lane 4 versus lane 2) and CD63 (panel e, lane 4 versus
lane 2), in comparison with the control cells (lanes 2). Re-introduced
PRAS40-wt (lanes 6), but not the dominant negative PRAS40-T/A mutant
(lanes 8), rescued the TGFα-induced secretion. Intriguingly, the

43

constitutively active PRAS40-T/E mutant rescued Hsp90α and exosome
marker secretion not only in the presence (lanes 10), but also in the absence
(lanes 9), of TGFα stimulation. Similar results were obtained in the same
cells in response to H
2
O
2
and hypoxia stress. Down-regulation of PRAS40
blocked H
2
O
2
- (Figure 8D, lanes 4 versus lanes 2) and hypoxia- (Figure 8E,
lane 4s versus lanes 2) triggered secretion of Hsp90  and exosome markers.
Re-expression of PRAS40-wt (lanes 6), but not PRAS40-T/A mutant (lanes
8), rescued the secretion in the cells in response to both stress signals (lanes
6). Again, the PRAS40-T/E mutant not only rescued stress-triggered
secretion (lanes 10), but also caused exosome secretion even in the absence
of stress (lanes 9). These findings suggest that activation of PRAS40 by Thr-
246 phosphorylation is both necessary and sufficient to mediate stress
signaling to exosome secretion.

44

45

Figure 8. Threonine-246 phosphorylation of PRAS40 is necessary and
sufficient for triggering exosome secretion. (A) List of the wt and two mutant
constructs of PRAS40 cDNAs in a lentiviral vector, pRRLsinh-CMV , for overexpression.
(B) Re-introduction of the PRAS40-wt, PRAS40-T/A and PRAS40-T/E mutants in
endogenous PRAS40 downregulated human keratinocytes. The lysates of the cells were
subjected to Western blotting with antibodies against the indicated targets. (C, D and E)
Serum-free conditioned media of the cells treated with TGF (C), H2O2 (D) or hypoxia
(E) were subjected to sequential centrifugations. The 100,000g pellet fractions were
analysed by Western blotting with antibodies against the indicated targets. This
experiment was repeated three times with similar outcomes.
3.9 Downregulation of PRAS40 blocks exosome translocation
To directly demonstrate that PRAS40 regulates exosome secretion, we
followed CD63 translocation inside the parental and PRAS40
downregulated human keratinocytes by anti-CD63 immunostaining and
confocal microscopy. As shown in Figure 9A, in the parental cells, CD63
was found to cluster around the nuclei (panel b and c). TGF stimulation
caused a clear spreading and translocation of CD63 to the periphery of the
cells (panels e and f versus panels b and c). In the PRAS40-downregulated
cells, as shown in Figure 9B, TGFα failed to cause CD63 translocation
(panels k and l versus panels h and i). Quantitation of 80-120 randomly
selected cells under each condition is presented underneath the images.

46

47

Figure 9. PRAS40 regulates exosome translocation inside cells. In 8-well chambered
cell culture slides, serum-starved primary human keratinocytes without (A) or with (B)
PRAS40 down-regulation were either untreated (-) or treated with TGFα (20ng/ml) for 2
hours. Cells were stained with DAPI for nucleus and CD63 for exosome locations and
subjected to confocal microscopy analysis (see details in Methods). (C) An example of
CD63’s peripheral (yellow dotted lines) and total (red line) staining for computer-assisted
quantitation. (D) The translocation percentage of CD63 was averaged from confocal
readings of 60 cells per condition. Statistical analysis is described in methods.
3.10 PRAS40 regulates exosome secretion independent of mTORC1
and 14-3-3.
Prior to the current study, the only reported function for PRAS40 was its
binding to the Raptor (regulatory-associated protein of mTOR) subunit and
inhibiting mTORC1 activation (20, 23, 28, 29, 49). Therefore, we tested 1)
whether down-regulation of PRAS40 alone leads to mTORC1 activation and,
more importantly, whether Raptor, mTOR and 14-3-3 have any roles in
stress-triggered exosome secretion. First, we surprisingly found that down
regulation of PRAS4, as shown in Figure 10A (panel a), neither resulted in
activation of mTOR in the absence of stimulation (Figure 10B, panel c, lane
3 versus lane 1) nor affected stress-induced phosphorylation of mTOR (lane
4 versus lane 2) in human keratinocytes.

48

49

Figure 10. PRAS40 regulates exosome secretion without mTOR and 14-3-3
participation. (A) Human keratinocytes with downregulation of PRAS40 (panel a,
lane 2). (B) The absence of PRAS40 alone did neither cause augmented mTORC1
phosphorylation (panel c, lane 3 versus lane 1). (C) Individual downregulation of Raptor
(C, panel e, lane 3) and mTORC1 (panel f, lane 2). (D) Neither Raptor nor mTORC1
downregulation affects TGFα-stimulated secretion of 100,000g fraction containing CD63
(panel h), Hsp90α (panel i) and CD9 (panel j). (E) Downregulation of 14-3-3 (panel k)
and its effect on PRAS40 levels (panel l). (F) TGFα-induced phosphorylation of PRAS40
was unaffected in the presence (lanes 1, 2) or absence (lanes 3, 4) of endogenous 14-3-3.
(G) 14-3-3 is not required for TGFα-induced secretion of 100,000g fraction containing
CD63 (panel p), Hsp90α (panel q) and CD9 (panel r) (lanes 4 vs. lanes 2). This
experiment was repeated twice with similar outcomes.
Second, as shown in Figure 10C, we individually silenced Raptor (panel e,
lane 3) and mTOR (panel f, lane 2) expression in the cells. Under these
conditions, as shown in Figure 10D, stress-stimulated secretion of CD63,
the most agreed upon exosome marker (50), remained unaffected in the
absence of either mTOR (panel h, lane 4) or Raptor (lane 6), in comparison
to the control cells (lanes 2). Similar results were obtained for secretion of
Hsp90α (panel i) and CD9 (panel j).

Finally, down-regulation of another reported PRAS40-binding partner, 14-
3-3 (14-3-3θ) (Figure 10E, panel k) did not affect: i) PRAS40 expression

50

(panel l), ii) TGFα-stimulated PRAS40 phosphorylation (Figure 10F, panel
n, lane 4 versus lane 2) and iii) TGFα-induced secretion of CD63 (Figure
10G, panel p), Hsp90α (panel q) and CD9 (panel r). Taken together, we
concluded that PRAS40 plays a positive role in mediating stress-triggered
exosome secretion via a to-be-identified new pathway.

Discussion
The discovery of exosomes in cell-to-cell communication in the
microenvironment of homeostasis and tumor progression is a recent
breakthrough in biology. For instance, secreted exosomes can transfer
molecules between dendritic cells and B cells to mediate adaptive immune
responses to pathogens. Tumor cells constitutively secrete exosomes to
direct and facilitate metastasis by creating a more favorable environment for
the tumor cells. Under these conditions, secretion of exosomes is driven by
either extracellular stimuli (tissue injury, hypoxia, nutrient depravation, etc.)
or intracellular stimuli (activated oncogenes, inactivated tumor suppressor
genes or stress). However, little was known about the signaling mechanism
that links the stress cues to the exosome secretion pathway. In this study, we
demonstrate that the ubiquitously expressed PRAS40 is a common signaling

51

molecule that connects various kinds of microenvironmental stress cues to
exosome-mediated secretion in normal and tumor cells. Extracellular stress
signals activate Akt via Thr-308 phosphorylation or possibly other kinase(s),
such as PIM1, which in turn phosphorylates PRAS40 on Thr-246. Thr-246-
phosphorylated PRAS40 does not make direct physical contact with the
exosomes. Rather, it triggers, via currently unknown intermediates,
exosome secretion into the extracellular environment. We demonstrated that
Thr-246-phosphorylation is both necessary and sufficient for connecting
extracellular signals to exosome secretion. In addition, this new “positive”
function of PRAS40 is independent from its previously reported inhibitory
role of mTORC1 or its binding to the scaffolding protein, 14-3-3. Numerous
studies reported the roles for PRAS40 to prevent cell death and promote
tumorigenesis, but little was known about the mechanism of action by
PRAS40. We argue that this previously unrecognized function for PRAS40
in regulation of stress-induced exosome secretion is a major part of its
biology. A schematic representation of these findings is depicted in Figure
11. As illustrated, while this study has identified the first linker molecule
between stress and exosome secretion, it remains to be studied how Thr-
246-phosphorylated PRAS40 communicates with the exosome-secreting
machinery.

52

Figure 11. A schematic representation of stress-triggered exosome secretion
through PRAS40.
Extracellular stress cues including growth factors, hypoxia, and H2O2 activate an
intracellular kinase, such as Akt, which in turn phosphorylates PRAS40 at Thr-246. The
activated PRAS40 communicates with a currently unknown intermediate(s), leading to
exosome secretion. Exosomes contain a variety of molecules for efficient cell-to-cell
communication than secretion of a single molecule, such as a hormone. PRAS40 is the
first linker identified between stress and exosome secretion.

One of the most intriguing findings and the basis of this study is the
unprecedented specificity that TGF , but not EGF, triggers Hsp90  secretion

53

only in primary human keratinocytes (the crucial epidermal cell type for skin
wound closure). Neither TGF  nor EGF triggers exosome or Hsp90 secretion
in human dermal fibroblasts or human microvascular endothelial cells from
the dermis (33). However, human dermal fibroblasts and human
microvascular endothelial cells secrete Hsp90  under other
microenvironmental stress signals, such as hypoxia (37, 38). These
observations make biological sense. It is known that TGF  levels are low or
undetectable in intact skin and rise when skin is wounded. In contrast, the
EGF levels remain unchanged before or after skin wounding (35).
Mechanistically, while both TGF  and EGF induce Ser-473 phosphorylation
of Akt in keratinocytes, only TGF  induces Thr-308 phosphorylation (the
main activation phosphorylation) of Akt. It has been shown that Thr-308-
phosphorylated Akt is responsible for phosphorylating PRAS40 at Thr-246
(39), supporting our findings in this study. We have proposed that
keratinocytes are the main source of secreted Hsp90a in wounded skin for
promoting wound closure (35).

While a body of reports showed that PRAS40 is an inhibitor of the mTORC
pathway and inhibitors of mTORC are often known as tumor suppressors, an
equal number of studies showed that PRAS40 has two positive roles in both
normal and tumor cells, including i) preventing stress-triggered normal and

54

tumor cell apoptosis and ii) supporting tumor progression in vitro and in vivo.
An earlier study showed that PRAS40 inhibits cell apoptosis by preventing
caspase 3 cleavage (21). Madhunapantula and colleagues showed that Akt3
phosphorylates PRAS40 and up-regulates the PRAS40 levels in melanoma
cells to prevent the cancer cells from undergoing apoptosis. Down-regulation
of PRAS40 or inhibition of its upstream Akt3 decrease the anchorage-
independent growth of cells in culture and tumor development in mice (51).
Similar findings were reported in breast and lung cancer cells (52). Kazi et al
showed that silencing PRAS40 reduced proliferation of C2C12 cells due to a
cell cycle arrest in the G1 phase (53). Huang et al showed that PRAS40 is a
target gene for Ewing sarcoma protein, a transcription factor, and promotes
development of Ewing sarcoma (Huang et al., 2012). Havel and colleagues
reported a pro-tumorigenic effect of PRAS40 by suppressing p53-mediated
cellular senescence (54). In normal cells, Yu et al reported that elevated
PRAS40 levels protect motor neurons from spinal cord injury-induced cell
death (55). Similarly, Shin et al showed that overexpression of PRAS40
prevents brain ischemic insult and oxidative stress-induced brain cell death
(56). Obviously, these findings cannot be explained by the reported role for
PRAS40 as an inhibitor of the mTOR pathway. The critical question, then, is
how PRAS40 exerts these two “positive” functions. Our current finding that
Thr-246 phosphorylated PRAS40 regulates exosome secretion provides a

55

possible mechanism for how PRAS40 protects cells from apoptosis and
supports tumor progression – via secreted exosomes. A recent study of our
laboratory showed that the exosome-mediated secretion of Hsp90  prevents
tumor cells from hypoxia-induced cell death (38). Moreover, Zou and
colleagues showed that exosome-mediated secretion of Hsp90  plays an
essential role in not only in de novo tumor formation, but also the further
expansion of already formed tumors in mice (41). Besides the cargo of
Hsp90 , one could anticipate that other types of exosome cargo (proteins,
DNA, miRNA, mRNA, lipids) might modulate other specific biological
events in various tissues and cells.

Results of our study also suggests that distinct stress signals activate PRAS40
via Thr-246 phosphorylation by different kinases or distinct mechanisms. For
instance, TGF -stimulated Thr-246 phosphorylation of PRAS40 is inhibited
by LY29200 (Figure 3D), but H2O2-induced Thr-246 phosphorylation of
PRAS40 is not (data not shown). Instead, H2O2 treatment dramatically
increases the cellular PRAS40 protein levels, in addition to thr-246
phosphorylation (Figure 4C). These observations suggest that under oxidative
stress a different upstream kinase or kinases phosphorylates PRA40 at Thr-
246. This phosphorylation or an completely independent mechanism causes
the increased cellular PRA40 protein levels, triggering increased exosome

56

secretion. Consistent with this notion, increased PRAS40 levels were reported
to correlate with the later stages of melanoma progression, due to activated
Akt3 (51).

The critical question of how Thr-246 phosphorylated PRAS40 communicates
with the exosomal trafficking pathway remains to be investigated. Since the
activation of PRAS40 is an early signaling event in response to extracellular
signal stimulation, we believe that there must be additional intermediate
signaling events in between. One possibility is that PRAS40 uses its proline-
rich domains/motifs to connect with Src-homology-3 (SH3) domain-
containing signaling molecules. For instance, it has recently been reported that
the SH3-containing protein, cortactin, promotes exosome secretion by
stabilizing cortical actin-rich MVE docking sites (19). We did not, however,
detect PRAS40 directly binding to cortactin (data not shown). Amzallag et al
reported a role for TSAP6, a p53-inducilbe transmembrane protein, in
exosome-mediated secretion of TCTP (translationally controlled tumor
protein) from its pre-existing pool in the cells (57). Yu and colleagues
extended this finding to show that γ radiation-induced DNA damage activates
p53, resulting in increased expression of TSAP6 and exosome-mediated
secretion of proteins that are not processed by the ER/Golgi classical protein
trafficking pathway (55). Moreover, Lespagnol et al reported that TSAP6-

57

knockout mice, otherwise developmentally normal, showed defects in DNA
damage-induced and p53-dependent exosome secretion (58). As mentioned
previously, the Rab27 small GTPase family is widely reported to play a role
in in exosome biogenesis and secretion. Currently, limited information is
available for what their exact roles are in those two sequential and distinct
processes. Based on exosome-mediate secretion of Hsp90 , normal cells do
not secrete exosomes under physiological conditions. Rather, they only
secrete exosomes under environmental stress cues. In contrast to normal cells,
many tumor cells were reported to constitutively secrete exosomes driven by
their intrinsic oncogenic signals (7, 35). It would be of a great interest to test
whether PRAS40 has any relationship with TSAP6 or Rab27.

In conclusion, tissue microenvironmental stress cues, such as hypoxia,
nutrient paucity, injury-released cytokines, and oxidative stress, can all trigger
cells to vesiculate and secrete EVs. Under physiological conditions, for
instance, secreted exosomes can transfer molecules between dendritic cells
and B cells to mediate adaptive immune responses to pathogens. Under
pathological conditions, such as in a tumor microenvironment, malignant cells,
vascular cells, stromal cells and immune cells surrounded by extracellular
matrices (ECMs) and soluble factors use the cargo within secreted exosomes
to engage in cell-to-cell communication to support tumor progression and

58

metastasis (7). The identification of PRAS40 as a pivotal regulator of
exosome secretion will hopefully lead to new insights about how
microenvironmental and intracellular stress induces cells to secrete exosomes.
In the domain of cancer biology, PRAS40 may also serve as a target for
therapy.

59

Bibliography

1. Yá ñ ez-Mó , M., Siljander, P.R.M., Andreu, Z., Bedina Zavec, A., Borrà s,
F.E., Buzas, E.I., Buzas, K., Casal, E., Cappello, F., Carvalho, J. and Colá s,
E. 2015. Biological properties of extracellular vesicles and their
physiological functions. Journal of extracellular vesicles: 4:27066.

2. Raposo, G. and Stoorvogel, W. 2013. Extracellular vesicles: Exosomes,
microvesicles, and friends. J Cell Biol 200: 373–383.

3.Harding, C., Heuser, J., and Stahl, P. 1983. Receptor-mediated
endocytosis of transferrin and recycling of the transferrin receptor in rat
reticulocytes. J Cell Biol 97:329–339.

4. Pan, BT., Teng, K., Wu, C., Adam, M., and R.M. Johnstone. 1985.
Electron microscopic evidence for externalization of the transferrin receptor
in vesicular form in sheep reticulocytes. J Cell Biol 101: 942–948.

5. Johnstone, RM., Adam, M., Hammond, JR., Orr, L., and Turbide C. 1987.
Vesicle formation during reticulocyte maturation. Association of plasma

60

membrane activities with released vesicles (exosomes). J Biol Chem 262:
9412–9420.

6. Tkach M, and Thé ry C. 2016. Communication by extracellular vesicles:
Where we are and where we need to go. Cell 164: 1226-1232.

7. Kucharzewska P, Belting M. 2013. Emerging roles of extracellular
vesicles in the adaptive response of tumour cells to microenvironmental
stress. J Extracell Vesicles March 5: 2.

8. Thé ry, C., Zitvogel, L., and Amigorena, S. 2002. Exosomes: composition,
biogenesis and function. Nat Rev Immunol 2: 569–579.

9. Witwer KW, Buzá s EI, Bemis LT, Bora A, Lä sser C, Lö tvall J, Nolte-
't Hoen EN, Piper MG, Sivaraman S, Skog J, Thé ry C, Wauben MH,
Hochberg F. 2013. Standardization of sample collection, isolation and
analysis methods in extracellular vesicle research. J Extracell Vesicles May
27: 2.

10. Colombo, M., Raposo, G., & Thé ry, C. 2014. Biogenesis, secretion, and

61

intercellular interactions of exosomes and other extracellular
vesicles. Annual review of cell and developmental biology 30: 255-289.

11. Nolte, E. N., Buermans, H. P., Waasdorp, M., Stoorvogel, W., Wauben,
M. H., & AC’t Hoen, P. 2012. Deep sequencing of RNA from immune cell-
derived vesicles uncovers the selective incorporation of small non-coding
RNA biotypes with potential regulatory functions. Nucleic Acids Research
40:9272-9285.

12. Yuana Y, Sturk A, Nieuwland R. 2013. Extracellular vesicles in
physiological and pathological conditions. Blood Rev 27: 31-39.

13. Peinado, H., Alečković, M., Lavotshkin, S., Matei, I., Costa-Silva, B.,
Moreno-Bueno, G., Hergueta-Redondo, M., Williams, C., Garcí a-Santos, G.,
Ghajar, C.M. and Nitadori-Hoshino, A. 2012. Melanoma exosomes educate
bone marrow progenitor cells toward a pro-metastatic phenotype through
MET. Nature Medicine 18: 883–891.

14. Hoshino, A., Costa-Silva, B., Shen, T.L., Rodrigues, G., Hashimoto,
A., Mark, M.T., Molina, H., Kohsaka, S., Di Giannatale, A., Ceder, S. and

62

Singh, S. 2015. Tumor exosome integrins determine organotropic
metastasis. Nature 527:329-335.

15. Zhang, L., Zhang, S., Yao, J., Lowery, F.J., Zhang, Q., Huang, W.C., Li,
P., Li, M., Wang, X., Zhang, C. and Wang, H. 2015. Microenvironment-
induced PTEN loss by exosomal microRNA primes brain metastasis
outgrowth. Nature 527:100-104.

16. Ostrowski, M., Carmo, N.B., Krumeich, S., Fanget, I., Raposo, G.,
Savina, A., Moita, C.F., Schauer, K., Hume, A.N., Freitas, R.P. and Goud,
B. 2010. Rab27a and Rab27b control different steps of the exosome
secretion pathway. Nat. Cell Biol 12: 19–30.

17. Zheng Y, Campbell EC, Lucocq J, Riches A, Powis SJ. 2013.
Monitoring the Rab27 associated exosome pathway using nanoparticle
tracking analysis. Exp Cell Res 319:1706-1713.

18. Bobrie, A., Krumeich, S., Reyal, F., Recchi, C., Moita, LF., Seabra,
MC., Ostrowski, M., and C. Thé ry. 2012. Rab27a supports exosome-
dependent and -independent mechanisms that modify the tumour

63

microenvironment and can promote tumour progression. Cancer Res 72:
4920–4930.

19. Sinha S., H. Daisuke, N. H. Hong, K. C. Kirkbride, N. E. Grega-
Larson, M. Seiki, M. J. Tyska and A. M. Weaver. 2016. Cortactin promotes
exosome secretion by controlling branched actin dynamics. J Cell Biol. 214:
197–213.

20. Kovacina KS, Park GY, Bae SS, Guzzetta AW, Schaefer E, Birnbaum
MJ, Roth RA. Identification of a proline-rich Akt substrate as a 14-3-3
binding partner. 2003. J Biol Chem 278: 10189 –10194.

21. Saito, A., Narasimhan, P., Hayashi, T., Okuno, S., Ferrand-Drake, M.
and Chan, P.H. 2004. Neuroprotective role of a proline-rich Akt substrate in
apoptotic neuronal cell death after stroke: relationships with nerve growth
factor. Journal of Neuroscience, 24:1584-1593.

22. Shimaya A, Kovacina KS, and Roth RA. 2004. On the mechanism for
neomycin reversal of wortmannin inhibition of insulin stimulation of
glucose uptake. J. Biol. Chem. 279:55277-55282.

64

23. Vander Haar E, Lee SI, Bandhakavi S, Griffin TJ, Kim DH.
2007. Insulin signalling to mTOR mediated by the Akt/PKB
substrate PRAS40. Nat Cell Biol 9: 316–323.

24. Sancak, Y., Bar-Peled, L., Zoncu, R., Markhard, A.L., Nada, S. and
Sabatini, D.M. 2010. Ragulator-Rag complex targets mTORC1 to the
lysosomal surface and is necessary for its activation by amino
acids. Cell 141: 290-303.

25. Fonseca BD, Smith EM, Lee VH, MacKintosh C, Proud CG. 2007.
PRAS40 is a target for mammalian target of rapamycin complex 1 and is
required for signalling downstream of this complex. J Biol Chem 282:
24514-24524.

26. Oshiro N1, Takahashi R, Yoshino K, Tanimura K, Nakashima A,
Eguchi S, Miyamoto T, Hara K, Takehana K, Avruch J, Kikkawa U,
Yonezawa K. 2007. The proline-rich Akt substrate of 40 kDa (PRAS40) is
a physiological substrate of mammalian target of rapamycin complex 1. J
Biol Chem 282: 20329-20339.

65

27. Thedieck K1, Polak P, Kim ML, Molle KD, Cohen A, Jenö P,
Arrieumerlou C, and Hall MN. 2007. PRAS40 and PRR5-like protein are
new mTOR interactors that regulate apoptosis. PLoS One 2: e1217.

28. Wang, L., Harris, T. E., Roth, R. A., & Lawrence, J. C. 2007. PRAS40
regulates mTORC1 kinase activity by functioning as a direct inhibitor of
substrate binding. J Biol Chem 282: 20036-20044.

29. Sancak, Y., Thoreen, C.C., Peterson, T.R., Lindquist, R.A., Kang, S.A.,
Spooner, E., Carr, S.A. and Sabatini, D.M. 2007. PRAS40 is an insulin-
regulated inhibitor of the mTORC1 protein kinase. Molecular cell 25: 903-
915.

30. Wang L, Harris TE, Lawrence JC. 2008. Regulation of proline-rich
Akt substrate of 40 kDa (PRAS40) function by mammalian target of
rapamycin complex 1 (mTORC1)-mediate phosphorylation. J Biol
Chem. 283:15619-15627.

31. Zhang F, Beharry ZM, Harris TE, Lilly MB, Smith CD, Mahajan S,

66

Kraft AS. 2009. PIM1 protein kinase regulates PRAS40 phosphorylation
and mTOR activity in FDCP1 cells. Cancer Biol Ther. 8:846-853.

32. Fonseca BD, Lee VH, Proud CG. 2008. The binding of PRAS40 to
14-3-3 proteins is not required for activation of mTORC1 signalling by
phorbol esters/ERK. Biochem J 411: 141-149.

33 ．Cheng, C. F., J. Fan, M. Fedesco, S. Guan, Y. Li, B. Bandyopadhyay,
A. M. Bright, D. Yerushalmi, M. Liang, M. Chen, Y. P. Han, D. T. Woodley
& W. Li. 2008. Transforming growth factor alpha (TGFalpha)-stimulated
secretion of HSP90alpha: using the receptor LRP-1/CD91 to promote
human skin cell migration against a TGFbeta-rich environment during
wound healing. Mol Cell Biol 28: 3344-3358.

34. Cheng, C. F., D. Sahu, F. Tsen, Z. Zhao, J. Fan, R. Kim, X. Wang,
K. O'Brien, Y. Li, Y. Kuang, M. Chen, D. T. Woodley & W. Li. 2011. A
fragment of secreted Hsp90alpha carries properties that enable it to
accelerate effectively both acute and diabetic wound healing in mice. J Clin
Invest 121: 4348-4361.

67

35. Li, W., Sahu, D., & Tsen, F. 2012. Secreted heat shock protein-90
(Hsp90) in wound healing and cancer. Biochimica et Biophysica Acta
(BBA)-Molecular Cell Research 1823: 730-741.

36. Li Y, Fan J, Chen M, Li W, Woodley DT. 2006. Transforming growth
factor-alpha: a major human serum factor that promotes human keratinocyte
migration. J Invest. Derm. 126:2096-2105.

37. Li W, Li Y, Guan S, Fan J, Cheng CF, Chen, M. and Woodley DT.
2007. Extracellular heat shock protein-90alpha: linking hypoxia to skin cell
motility and wound healing. EMBO J 26:1221-1233.

38. Woodley, D T, Li Y, J. Fan, J. Cheng C-F, Chen M. and Li W. (2009)
Participation of LRP-1 in Hypoxia hsp90  autocrine signaling to promote
cell motility. Journal of Cell Science, 122:1495-1498

39. Vincent, E. E., D. J. E. Elder, E. C. Thomas, L. Phillips, C. Morgan, J.
Pawade, M. Sohail, M. T. May, M. R. Hetzel, and J. M. Tavaré . 2011. Akt
phosphorylation on Thr308 but not on Ser473 correlates with Akt protein
kinase activity in human non-small cell lung cancer. British Journal of

68

Cancer 104: 1755-1761.

38. Dong, H., Zou, M., Bhatia, A., Jayaprakash, P., Hofman, F., Ying, Q.,
Chen, M., Woodley, D.T. and Li, W. 2016. Breast Cancer MDA-MB-231
Cells Use Secreted Heat Shock Protein-90alpha (Hsp90α) to Survive a
Hostile Hypoxic Environment. Scientific Reports 6:20605.

39. Clayton, A., A. Turkes, H. Navabi, M. D. Mason & Z. Tabi. 2005.
Induction of heat shock proteins in B-cell exosomes. J Cell Sci 118: 3631-
3638.

40. Yu X, Harris SL, Levine AJ. 2006. The regulation of exosome secretion:
a novel function of the p53 protein. Cancer Res. 66: 4795-4801.

41. Zou, M., Bhatia, A., Dong, H., Jayaprakash, P., Guo, J., Sahu, D., Hou,
Y., Tsen, F., Tong, C., O'Brien, K., Situ, A., Schimidt, T., Chen, M., Ying,
Q., Ulmer, T., Woodley, D., Li, W. 2016. Evolutionarily Conserved Dual
Lysine Motif Determines the Non-Chaperone Function of Secreted
Hsp90alpha in Tumour Progression. Oncogene, in press.

69

42. Sahu, D., Zhao, Z., Tsen, F., Cheng, C.F., Park, R., Situ, A.J., Dai, J.,
Eginli, A., Shams, S., Chen, M. and Ulmer, T.S. 2012. A potentially
common peptide target in secreted heat shock protein-90α for hypoxia-
inducible factor-1α–positive tumors. Molecular Biology of the Cell 23: 602-
613.

43. Melo SA, Sugimoto H, O’Connell JT, Kato N, Villanueva A, Vidal A,
Qiu L, Vitkin E, Perelman LT, Melo CA, Lucci A. 2014. Cancer exosomes
perform cell-independent microRNA biogenesis and promote tumorigenesis.
Cancer cell 26:707-721.

44. Huang, B. and Porter, G. 2005. Expression of proline‐rich Akt‐
substrate PRAS40 in cell survival pathway and carcinogenesis1. Acta
Pharmacologica Sinica 26(10): 1253-1258.

45. Nascimento, E.B., Snel, M., Guigas, B., van der Zon, G.C., Kriek, J.,
Maassen, J.A., Jazet, I.M., Diamant, M. and Ouwens, D.M. 2010.
Phosphorylation of PRAS40 on Thr246 by PKB/AKT facilitates efficient
phosphorylation of Ser183 by mTORC1. Cell signal 22:961-967.

70

46. Pino, M. S., Shrader, M., Baker, C. H., Cognetti, F., Xiong, H. Q.,
Abbruzzese, J. L., & McConkey, D. J. 2006. Transforming growth factor α
expression drives constitutive epidermal growth factor receptor pathway
activation and sensitivity to gefitinib (Iressa) in human pancreatic cancer
cell lines. Cancer research 66: 3802-3812.

47. Garcia-Maceira P and Mateo J. 2009. Silibinin inhibits hypoxia-
inducible factor-1α and mTOR/p70S6K/4E-BP1 signalling pathway in
human cervical and hepatoma cancer cells: implications for anticancer
therapy. Oncogene 28: 313-324.

48. Jia CH, Li M, Liu J, Zhao L, Lin J, Lai PL, Zhou X, Zhang Y, Chen
ZG, Li HY, Liu AL, Yang CL, Gao TM, Jiang Y, Can XC. 2013. IKK-β
mediates hydrogen peroxide induced cell death through p85 S6K1. Cell
Death & Differentiation 20:248-258.

49. Wiza, C., Nascimento, E.B. and Ouwens, D.M. 2012. Role of PRAS40
in Akt and mTOR signalling in health and disease. American Journal of
Physiology-Endocrinology and Metabolism 302: E1453-E1460.

71

50. Kowal, J., Arras, G., Colombo, M., Jouve, M., Morath, J.P., Primdal-
Bengtson, B., Dingli, F., Loew, D., Tkach, M. and C. Thé ry. 2016.
Proteomic comparison defines novel markers to characterize heterogeneous
populations of extracellular vesicle subtypes. Proc. Nat. Aca. Sci. 113:
E968-E977.

51. Madhunapantula, S.V., Sharma, A. and Robertson, G.P. 2007. PRAS40
deregulates apoptosis in malignant melanoma. Cancer research 67(8): 3626-
3636.

52. Huang, L., Nakai, Y., Kuwahara, I. and Matsumoto, K. 2012. PRAS40
is a functionally critical target for EWS repression in Ewing
sarcoma. Cancer research 72(5): 1260-1269.
53. Kazi, A.A. and Lang, C.H. 2010. PRAS40 regulates protein synthesis
and cell cycle in C2C12 myoblasts. Molecular Medicine 16(9): 359.

54. Havel, J.J., Li, Z., Cheng, D., Peng, J. and Fu, H. 2015. Nuclear
PRAS40 couples the Akt/mTORC1 signaling axis to the RPL11-HDM2-p53
nucleolar stress response pathway. Oncogene 34(12): 1487-1498.

72

55. Yu, F., Narasimhan, P., Saito, A., Liu, J. and Chan, P.H. 2008. Increased
expression of a proline-rich Akt substrate (PRAS40) in human copper/zinc-
superoxide dismutase transgenic rats protects motor neurons from death
after spinal cord injury. Journal of Cerebral Blood Flow &
Metabolism 28(1): 44-52.

56. Shin, M.J., Kim, D.W., Jo, H.S., Cho, S.B., Park, J.H., Lee, C.H., Yeo,
E.J., Choi, Y.J., Kim, J.A., Hwang, J.S. and Sohn, E.J. 2016. Tat-PRAS40
prevent hippocampal HT-22 cell death and oxidative stress induced animal
brain ischemic insults. Free Radical Biology and Medicine 97: 250-262.

57 ．Amzallag N, Passer BJ, Allanic D, Segura E, Thé ry C, Goud B, Amson
R, Telerman A. 2004. TSAP6 facilitates the secretion of translationally
controlled tumour protein/histamine-releasing factor via a nonclassical
pathway. J Biol Chem 279: 46104-12.

58. Lespagnol, A., Duflaut, D., Beekman, C., Blanc, L., Fiucci, G., Marine,
J.C., Vidal, M., Amson, R. and Telerman, A. 2008. Exosome secretion,
including the DNA damage-induced p53-dependent secretory pathway, is
severely compromised in TSAP6/Steap3-null mice. Cell Death &

73

Differentiation 15: 1723-1733.

Abstract (if available)

Abstract Secreted exosomes carrying lipids, proteins and nucleic acids conduct cell-cell communications within the microenvironment of both physiological and pathological conditions. Exosome secretion is triggered by extracellular or intracellular stress signals. Little is known, however, about the signal transduction between stress cues and exosome secretion. To identify the linker protein, we took advantage of a unique finding in human keratinocytes. In these cells, although TGFα and EGF share the same EGF receptor and previously indistinguishable intracellular signaling networks, only TGFα stimulation causes exosome-mediated secretion. However, deduction of EGF-activated pathways from TGFα-activated pathways in the same cells allowed us to identify the proline-rich Akt substrate of 40 kDa (PRAS40) as the unique downstream effector of TGFα, but not EGF, signaling via threonine-308 phosphorylated Akt. PRAS40 knockdown (KD) or PRAS40 dominant negative (DN) mutant overexpression blocks not only TGFα-, but also hypoxia- and H₂O₂-induced exosome secretion in a variety of normal and tumor cells. Site-directed mutagenesis and gene rescue studies show that Akt-mediated activation of PRAS40 via threonine-246 phosphorylation is both necessary and sufficient to cause exosome secretion, without affecting the ER/Golgi pathway. Identification of PRAS40 as a linker protein paves the way for understanding how stress regulates exosome secretion under pathophysiological conditions.

Linked assets

University of Southern California Dissertations and Theses

Conceptually similar

PDF

Mechanism of secretion and function of heat shock protein-90 (Hsp90) family genes

PDF

To investigate whether Hsp90α is present on the surface of exosome

PDF

The mechanism by which extracellular Hsp90α promotes cell migration: implications in wound healing and cancer

PDF

Molecular mechanism of transforming growth factor-beta signaling in skin wound healing

PDF

Cell surface translocation mechanism of stress-inducible GRP78 in human cancer

PDF

Disrupted ER-to-Golgi trafficking underlies anti-HIV drugs and alcohol induced cellular stress and hepatic injury

PDF

Role of endoplasmic reticulum chaperones GRP78 and GRP94 in regulating unfolded protein response and cell survival

PDF

Characterization of three novel variants of the MAVS adaptor

PDF

Study of the mechanism by which hypoxia-inducible-factor-1 alpha (HIF-1α) regulates heat shock protein-90 alpha (Hsp90α) secretion in breast cancer

PDF

Kaposi's sarcoma associated herpes-virus induces cellular proxi expression to modulate host gene expression that benefits viral infection and oncogenesis

PDF

The role of endoplasmic reticulum protein GRP78 in normal hematopoeises and PTEN-null leukemogenesis

PDF

Drug discovery for highly pathogenic hemorrhagic fever viruses

PDF

Using engineered exosomes and gene-editing to target latent HIV

PDF

The role of adipocytes in acute lymphoblastic leukemia cell migration and survival against daunorubicin

PDF

Antibody discovery and structural studies of the viral oncogene ORF74

PDF

Nuclear respiratory factor-1 regulation by PTEN signaling

PDF

Lymphatic cell environment promotes sustained KSHV lytic replication and viral maintenance

PDF

The role of α-catlulin during tumor progression and early mouse development

PDF

LINC00261 induces a G2/M cell cycle arrest and activation of the DNA damage response in lung adenocarcinoma

PDF

Targeting glioma cancer stem cells for the treatment of glioblastoma multiforme

Asset Metadata

Creator Guo, Jiacong (author)

Core Title PRAS40 connects microenvironmental stress signaling to exosome-mediated secretion

School Keck School of Medicine

Degree Doctor of Philosophy

Degree Program Genetic, Molecular and Cellular Biology

Publication Date 09/19/2017

Defense Date 07/25/2017

Publisher University of Southern California (original), University of Southern California. Libraries (digital)

Tag environmental stress,exosome,OAI-PMH Harvest,PRAS40

Language English

Contributor Electronically uploaded by the author (provenance)

Advisor Hong, Young-Kwon (committee chair), Fabbri, Muller (committee member), Li, Wei (committee member), Liang, Chengyu (committee member)

Creator Email batista.guo@gmail.com,jiacongg@usc.edu

Permanent Link (DOI) https://doi.org/10.25549/usctheses-c40-429083

Unique identifier UC11264274

Identifier etd-GuoJiacong-5732.pdf (filename),usctheses-c40-429083 (legacy record id)

Legacy Identifier etd-GuoJiacong-5732.pdf

Dmrecord 429083

Document Type Dissertation

Rights Guo, Jiacong

Type texts

Source University of Southern California (contributing entity), University of Southern California Dissertations and Theses (collection)

Access Conditions The author retains rights to his/her dissertation, thesis or other graduate work according to U.S. copyright law. Electronic access is being provided by the USC Libraries in agreement with the a...

Repository Name University of Southern California Digital Library

Repository Location USC Digital Library, University of Southern California, University Park Campus MC 2810, 3434 South Grand Avenue, 2nd Floor, Los Angeles, California 90089-2810, USA