University of Southern California Dissertations and Theses

Transcellular calcium transport in amelogenesis

(USC Thesis Other)

Transcellular calcium transport in amelogenesis

PDF

Download

Open document

Flip pages

Download a page range

Download transcript

Copy asset link

Request this asset

Transcript (if available)

Content

Transcellular Calcium Transport in Amelogenesis
By
Sarah Yuriko-Tuggy Robertson

A dissertation presented to the faculty of the Graduate School at
University of Southern California
In partial fulfillment of the requirements for the degree
Doctor of Philosophy
(Craniofacial Biology)
December 2017

2

THESIS ABSTRACT
Calcium transport is a highly controlled process in enamel formation, when ameloblast cells use
calcium not only to incorporate in large quantities into hydroxyapatite crystals, but also to
regulate intracellular signaling and ensure the smooth progression of enamel formation. Our data
focuses on one family of calcium export proteins, the Atp2b (PMCA) family, which is more
highly expressed in the secretory stage of amelogenesis than the maturation stage and is
commonly accepted as a mechanism for fine-tuning calcium homeostasis. Surprisingly, while the
Atp2b1 (PMCA1) and Atp2b4 (PMCA4) are highly expressed on the lateral membranes of
ameloblasts, removal of the catalytic site of the Atp2b1 and Atp2b4 proteins shows some effect
on ameloblast morphology and apoptosis, but produces no noticeable effect on the resulting
enamel mineral. RNA-sequencing of the different stages of amelogenesis identifies the primary
alternatively spliced isoforms of calcium transporters expressed throughout amelogenesis and
sheds some light on the role of calcium transport during secretory stage amelogenesis. This study
aims to add to the understanding of transcellular calcium transport during amelogenesis as not
only valuable for direct incorporation into enamel crystals, but also necessary for the cell
processes that allow the formation of enamel to occur.

3

Dedication
To my husband, Nolan Robertson, my parents, Stephen and Susan Tuggy, and my brother,
Jeremy Tuggy, who have been a constant source of encouragement and remind me to always
have faith in God.

4

Acknowledgements
I would especially like to thank Dr. Michael Paine for his mentorship and guidance
throughout my time as a student and technician in his laboratory. I would also like to thank Dr.
Ruchi Bajpai, Dr. Baruch Frenkel, Dr. Janet Oldak-Moradian, and Dr. Parish Sedgizadeh for
their guidance during their time on my thesis committee. I would like to thank all the friends and
family who have given me encouragement throughout my time as a graduate student, and my
husband for all the ways he has sacrificed to support me.
I would also like to thank Dr. Malcolm Snead, Yaping Lei, Dr. Juni Sarkar, Dr. Kaifeng
Yin, Dr. Xin Wen, Dr. Larry Zhao, Dr. Shuhui Geng, Dr. Rodrigo Lacruz, Dr. Joseph Hacia,
Maria Arciniega, Alec Morse, Chien-Rong Chen, Jian-Bao Xie, Thach-Vu Ho, Dr. Saumya
Prajapati, and Rucha Bapat for their support and help in the lab throughout this project.

5

Statement of Originality
This statement is to certify that to the best of my knowledge, this thesis contains no material
which has been accepted for the award of any degree or diploma at any University. No data
presented in this dissertation has been previously published or reported; other than article
publications, oral presentations, and posters that carry my name as a co-author. Experiments
presented in this dissertation were performed by myself, except in certain instances where due
acknowledgment has been made in the text.

Sarah Yuriko-Tuggy Robertson (nee Tuggy)
October 2017

6
Table of Contents
Chapter 1: A Review of Calcium Transport in Amelogenesis...……………....10
Overview: calcium transport……………………………………………………………………..11
Transcellular calcium transport in amelogenesis………………………………………………...13
Calcium entry: store-operated calcium entry (SOCE)……………………………….…………..14
Calcium extrusion……………………………………………………………………………......16
Slc8a and Slc24a gene products………………………………………………………….17
Atp2b gene products……………………………………………………………………..19
Calcium export pumps and exchangers in health and disease…………………………………...22
Chapter 2: Multiple Calcium Export Exchangers and Pumps are a Prominent
Feature of Enamel Organ Cells…………………………………………………25
Introduction and Materials and Methods..….……………………………………………………26
Results……………………………………………………………………………………………29
Messenger RNA expression profiles…………………………………………………….29
Western blot analysis…………………………………………………………………….31
PMCA1, PMCA4, and NCKX3 localization…………………………………………….33
Discussion………………………………………………………………………………………..35
Chapter 3: An In Vivo Study of the Role of the PMCA Transporters in
Amelogenesis……………………………………………………………………..41
Introduction and Materials and Methods ..………………………………………………………42
Results……………………………………………………………………………………………46
7
Immunofluorescence data confirms no change in PMCA1 localization in the Atp2b4
-/-

knockout or PMCA4 localization in the Atp2b1
+/-
knockout.…………………….……..47
H&E staining identifies morphological abnormalities…………………………………..49
Active-Caspase3 staining suggests increased apoptosis…………………………………50
µCT and SEM analysis show little noticeable defect in enamel density or crystal
organization………………………………………………………………………………52
Real-time PCR data shows significant decrease in an ameloblast-associated protein…...55
Discussion………………………………………………………………………………………..56
Conclusion……………………………………………………………………………………….58
Chapter 4: RNA-sequencing Identifies Key Isoforms of Proteins Involved in
Calcium Transport and Homeostasis in Enamel Organ Cells………………..59
Introduction and Materials and Methods ………………………………………………………..60
Results……………………………………………………………………………………………63
Alternative splicing at splice site C near the C-terminus of PMCA1 and PMCA4 plays a
role in pump activation by calmodulin……………….………….………………………64
Numerous genes related to calcium signaling and handling are differentially expressed
during different stages of amelogenesis………………………………………….………66
CACNA1C (Ca
v
1.2) calcium channel causing Timothy Syndrome is upregulated in
secretory stage amelogenesis…………………………………………………………….74
Discussion………………………………………………………………………………………..76
Conclusion……………………………………………………………………………………….77
Chapter 5: Perspectives on Calcium Transport During Amelogenesis………78
Discussion……………………………………………………………………..……………...….79
8
Conclusion…………………………………………………………………………………….…80
References……………………………………………………………………………………….82
List of Abbreviations Used Throughout This Thesis
AI amelogenesis imperfecta
ALB albumin
Ca
v
L-type voltage-gated calcium channel
CF cystic fibrosis
CRAC Ca
2+
release-activated Ca
2+
channel
EM electron microscope
EMP enamel matrix protein
ER endoplasmic reticulum
FPKM fragments per kilobase of transcript per million mapped reads
Hap hydroxyapatite
HRP horseradish peroxidase
IEE inner enamel epithelium
ITPR IP3 receptor (genes)
NCKX Sodium/calcium-potassium exchanger protein
NCX Sodium/calcium exchanger protein
NFAT nuclear factor of activated T-cells
9
OMIM Online Mendelian Inheritance in Man
PCR polymerase chain reaction
PL papillary layer
PMCA plasma membrane Ca
2+
ATPase
RA ruffle-ended ameloblasts
RIN RNA integrity number
SA smooth-ended ameloblasts
SEM scanning electron microscope
SERCA sarco/endoplasmic reticulum Ca
2+
-ATPase
Si stratum intermedium
SLC solute carrier (genes)
SOCE store-operated Ca
2+
entry
Sr stellate reticulum
STIM stromal interacting molecule

10

CHAPTER 1
A Review of Calcium Transport in
Amelogenesis

11
INTRODUCTION
Enamel is the hardest and most calcified tissue in mammals, and understanding enamel
formation is crucial for developing strategies to repair or regenerate it (Hubbard 2000; Lacruz et
al. 2013; Smith 1998). Amelogenesis, the process of enamel development, is divided into the
secretory and maturation stages with a brief pre-secretory stage before the secretory stage and a
transition stage between the secretory and maturation stages. Epithelial-derived enamel-forming
cells (ameloblasts) differentiate from the inner enamel epithelium (IEE) during the pre-secretory
stage (Orrenius et al. 2015). These amelobasts are highly polarized with an apical end that faces
the enamel area and a basal end that faces circulation. During the secretory stage, ameloblasts
migrate away from the dentin while synthesizing and secreting enamel matrix proteins (EMPs)
such as amelogenin, ameloblastin, and enamelin into the enamel area from Tomes’ processes at
their apical ends. These EMPs serve as a scaffold for the nucleation and elongation of enamel
hydroxyapatite (Hap) crystals (Smith 1998). Each enamel rod follows a single ameloblast’s
Tomes’ process with the interrod following the border of the cell, giving enamel its characteristic
rod-interrod pattern (Hu et al. 2007; Skobe 2006). There is a massive shift in gene expression
during the transition stage, when approximately 25% of ameloblasts undergo apoptosis, after
which another 25% undergo apoptosis throughout the following stages of amelogenesis
(Tsuchiya et al. 2009). During the maturation stage, the ameloblasts undergo cyclical changes
between ruffle-ended (RA) and smooth-ended (SA) morphology (Lacruz et al. 2013; Smith
1998). Maturation-stage ameloblasts become specialized for ion transport and resorptive
activities, and secrete the protease KLK4 to aid in the degradation of EMPs that are subsequently
removed through endocytosis (Lacruz et al. 2012a; Lacruz et al. 2013; Smith 1998). The mouse’s
continuously growing incisor makes it a good model for studying the progression of
12
amelogenesis. While ion transport throughout amelogenesis has been well studied and discussed
elsewhere (Arquitt et al. 2002; Bronckers et al. 2010; Bronckers et al. 2015; Josephsen et al.
2010; Lyaruu et al. 2008; Paine et al. 2007; Yin et al. 2015), and transcellular calcium ion (Ca
2+
)
transport reviewed in Nurbaeva et.al. 2016, I will focus in this thesis primarily on Ca
2+
export
activities in ameloblasts.

OVERVIEW – CALCIUM TRANSPORT
In general high intracellular concentrations of calcium (Ca
2+
) catalyze cell death signaling
cascades, so cells maintain a gradient of ~10
-3
M Ca
2+
concentration outside the cell, in the
mitochondria, and in the endoplasmic reticulum (ER) where Ca
2+
is stored; in the cytoplasm, the
concentration is approximately ~10
-7
M (Brini and Carafoli 2011). The plasma membrane
contains a variety of Ca
2+
channels that transiently open to allow Ca
2+
influx in response to
plasma membrane voltage changes, ligand interaction, or emptying of ER and mitochondria
stores (Brini and Carafoli 2011). Calcium is then removed from the cytoplasm through a number
of mechanisms including the SERCA pump that replenishes ER stores, the mitochondrial
uniporter that replenishes mitochondrial stores, the plasma membrane low-affinity high capacity
Na
+
/Ca
2+
exchanger proteins (NCX), the Na
+
/ Ca
2+
K
+
exchanger proteins (NCKX), and the
high-affinity low-capacity plasma membrane Ca
2+
-ATPase (PMCA) pump proteins (Brini and
Carafoli 2011; Bronckers et al. 2015; Hu et al. 2012).

13
Gene Symbols Protein Products Description
Atp2b1-4 PMCA1-4 Plasma membrane calcium ATPase
Slc8a1-3 NCX1-3 Sodium/calcium exchanger
Slc24a1-6 NCKX1-6 Sodium/calcium and potassium exchanger
Stim1-2 STIM1-2 Stromal interaction molecule
Orai1-2 ORAI1-2 Calcium release-activated calcium channel
Cacna1c Ca v1.2 Calcium voltage-gated channel subunit alpha1C
Mcu MCU Mitochondrial uniporter
Atp2a2 SERCA2 Sarcoplasmic/endoplasmic reticulum calcium ATPase
Atp2c1 SPCA1 Secretory pathway calcium ATPase
Itpr1-3 IP3R1-3 Inositol 1,4,5-triphosphate receptor
Table 1.1: Calcium transporter genes, proteins, and descriptions referenced throughout this thesis

Calcium (Ca
2+
) transport in amelogenesis is crucial to understand because not only is unbound
Ca
2+
a major component of hydroxyapatite (Hap), it is also a major signaling molecule capable
of regulating necessary cell processes in eukaryotic cells such as cellular attachment, motility,
survival, and differentiation (Blair et al. 2011; Hubbard 1996).

TRANSCELLULAR CALCIUM TRANSPORT IN AMELOGENESIS
While historically a number of reports have suggested a passive paracellular passage of Ca
2+
ions
from the basal pole of ameloblasts to the enamel organ is possible (Bawden 1989; Hanawa et al.
1990; Kawamoto and Shimizu 1990; McKee et al. 1987; Moran et al. 1995; Munhoz and
Leblond 1974; Reith and Boyde 1981; Reith et al. 1984; Uchida et al. 1987) (and reviewed in
(Smith 1998)), recent data shows more conclusively that active transcellular Ca
2+
transport
involving ion transporters, channels, exchangers and pumps is employed by ameloblasts during
amelogenesis (Hu et al. 2012; Hubbard 2000; Lacruz et al. 2012a; Lacruz et al. 2013; Nurbaeva
et al. 2015a; Nurbaeva et al. 2015b). A list of calcium transporter genes and protein names can
be found in Table 1.1. Mutations in STIM and ORAI genes, which form a Ca
2+
channel, and
SLC24A4 (NCKX4), which exports Ca
2+
, result in an amelogenesis imperfecta (AI) phenotype,
14
implicating that disturbances to transcellular Ca
2+
transport dramatically impact enamel
mineralization (Herzog et al. 2015; Lacruz and Feske 2015; Wang et al. 2014). All these data
suggest that transcellular Ca
2+
transport is likely the dominant mode for Ca
2+
transport during
amelogenesis, facilitating Ca
2+
movements from the circulation to the enamel matrix.

CALCIUM ENTRY – STORE-OPERATED CALCIUM ENTRY (SOCE)
Calcium can enter the cytoplasm primarily through voltage-gated Ca
2+
channels, ligand-gated
Ca
2+
channels, and store-operated Ca
2+
entry (SOCE) (Giacomello et al. 2013). SOCE is a well-
known mechanism of replenishing ER Ca
2+
stores following stored Ca
2+
depletion, and is
activated by a ligand binding to cell surface receptors (Lacruz and Feske 2015). This ligand
binding causes activation of phospholipase C (PLC) and production of the second messenger
inositol-1,4,5-triphosphate (IP
3
), which binds to the IP
3
receptor (IP
3
R) in the ER membrane and
releases ER Ca
2+
stores into the cytoplasm (Lacruz and Feske 2015). When Ca
2+
is released into
the cytoplasm via inositol 1,4,5-trisphosphate receptor (IP
3
R) from the ER or ryanodine receptor
(RyR) from the sarcoplasmic reticulum (SR) in skeletal muscle, stromal interaction molecules
(STIM1 and STIM2) in the ER membrane interact with ORAI channels in the plasma membrane
to form the Ca
2+
release-activated Ca
2+
(CRAC) channel, which allows for Ca
2+
to flow from the
extracellular space into the cytoplasm and causes an increase in intracellular Ca
2+
(Lacruz and
Feske 2015; Nurbaeva et al. 2015b). The cell is then able to transport and export cytoplasmic
Ca
2+
back into the ER through the sarcoplasmic/endoplasmic reticulum Ca
2+
-ATPase (SERCA)
pumps, into the mitochondria through the mitochondrial uniporter and the Na
+
/Ca
2+
Li
+

exchanger (NCLX) on the mitochondrial membrane, and out of the cell through plasma
membrane Ca
2+
-ATPase (PMCA) pumps, and K
+
-independent (NCX) and K
+
-dependent
15
Na
+
/Ca
2+
exchangers (NCKX) (Borke et al. 1993; Brini and Carafoli 2011; Franklin et al. 2001;
Mornstad 1978; Nurbaeva et al. 2015b; Okumura et al. 2010; Parry et al. 2013; Wang et al.
2014). In ameloblasts, IP
3
R is the primary mediator of Ca
2+
release from the ER, and is
expressed mainly in the maturation-stage ER membrane (Nurbaeva et al. 2015a; Nurbaeva et al.
2015b).

CRAC is likely the main route of maturation-stage Ca
2+
entry, as demonstrated by enamel organ
culture studies where Ca
2+
entry is almost completely eliminated following CRAC blocking with
2-APB (Nurbaeva et al. 2015b). The SERCA2 pump (Franklin et al. 2001), ORAI1, and STIM1
are all highly expressed in maturation-stage ameloblasts (Nurbaeva et al. 2015a; Nurbaeva et al.
2015b). Mutations in, or genetic knockout studies of, ORAI1 and STIM1 all result in severe
enamel defects in humans and rodents (Lacruz and Feske 2015; Wang et al. 2014). All these data
indicate that SOCE through the CRAC channel is the primary method of Ca
2+
entry into
ameloblasts, and that proper CRAC activity is crucial to proper enamel mineralization (Nurbaeva
et al. 2015a; Nurbaeva et al. 2015b; Wang et al. 2014).

CALCIUM TRANSIT
Once Ca
2+
has reached the cytoplasm through the emptying of stores or through Ca
2+
entry, the
cell rapidly removes Ca
2+
that has not been used to affect transcription so it does not catalyze cell
death signaling cascades through the high-affinity proteins in the ER, Golgi, and plasma
membranes and low-affinity proteins such as the mitochondrial uniporter, or NCX or NCKX
proteins of the plasma membrane (Giacomello et al. 2013). While it is not well understood how
Ca
2+
is transported through the cell to be exported into the enamel area, there is evidence from
16
CRAC studies and biochemical data that the ER is important in Ca
2+
transit, especially noted by
the increase in expression of the ER membrane SERCA2 pump in the maturation stage (Franklin
et al. 2001; Nurbaeva et al. 2015a; Nurbaeva et al. 2015b). Evidence suggests that the “calbindin
ferry” model of Ca
2+
transit, where calbindins bind to cytosolic Ca
2+
and facilitate transport, is
not the primary method of calcium transit (Hubbard et al. 2011; Turnbull et al. 2004). The most
abundant calbindin, calbindin-28/CALB1, was downregulated during maturation stage and mice
lacking calbindin-28 had normal teeth (Hubbard et al. 2011; Lacruz et al. 2013); the other two
known calbindins, calbindin-30/CALB2 and calbindin-9/S100, did not contribute enough to
explain the transit of the heavy Ca
2+
load (Hubbard et al. 2011).

CALCIUM EXTRUSION
The SLC8A (sodium/calcium exchangers or NCX), SLC24A (potassium-dependent
sodium/calcium exchangers or NCKX), and ATP2B (ATPase plasma membrane Ca
2+

transporting pumps or PMCA pumps) gene families of Ca
2+
transporters mediate Ca
2+
extrusion
in most cell types (Brini and Carafoli 2011), and proteins from all three of these families have
been reported as functional in enamel organ cells (Borke et al. 1995; Hu et al. 2012; Okumura et
al. 2010; Sasaki and Garant 1986; Wang et al. 2014; Zaki et al. 1996). The SLC8A gene family
has 3 members (NCX1-3) and all have a generally accepted stoichiometry of the extrusion of 1
Ca
2+
in exchange for the intrusion of 3 Na
+
(Brini and Carafoli 2011), while the SLC24A gene
family has 5 members (NCKX1-5) and extrudes 1 Ca
2+
and 1 K
+
while importing 4 Na
+
,
typically up the Ca
2+
gradient; however, the orientation of both NCX and NCKX exchangers can
be reversed depending on the Na
+
and Ca
2+
gradients (Jalloul et al. 2016b; Zhekova et al. 2016).
17
SLC8A and SLC24A gene families are electrogenic because there is a translocation of net charge
across the plasma membrane, have a low Ca
2+
affinity, and are capable of transporting Ca
2+
in
bulk rapidly across the plasma membrane (Brini 2009). They are reversible but in ameloblasts
they primarily operate in transporting Ca
2+
up its gradient facilitated by transport of Na
+
and K
+

down their gradients (Brini and Carafoli 2011; Hu et al. 2012). PMCA pumps/proteins have 4
members (PMCA1-4, coded by genes ATP2B1-4) and are part of a larger family of genes, called
P-type primary ion transport ATPases, that catalyze the auto-phosphorylation of a conserved
aspartyl residue within the pump from ATP (Palmgren and Nissen 2011).

CALCIUM EXTRUSION – SLC8A AND SLC24A GENE PRODUCTS
The SLC8A and SLC24A families are primarily expressed in excitable tissues such as muscle
and heart, as their rapid bulk transport of Ca
2+
is important in, for example, muscle and heart
contraction (Brini and Carafoli 2011). The SLC8A/NCX and SLC24A/NCKX transporters are
Na
+
/Ca
+
exchangers and can be either K
+
-dependent (NCKX) or K
+
-independent (NCX)
(Shumilina et al. 2010). The NCKX and NCX transporters contain a regulatory cytosolic loop in
the middle of their 10 transmembrane segments, which senses intracellular Ca
2+
and Na
+
levels
and regulates protein activation (Sharma and O'Halloran 2014).

NCX1 is expressed in heart, brain, bladder, kidney and cells of the enamel organ; NCX2 is
expressed in brain and skeletal muscle; and NCX3 is expressed in brain, skeletal muscle and
cells of the enamel organ (Lacruz et al. 2012b; Lytton 2007; Okumura et al. 2010; Sharma and
O'Halloran 2014). NCX1 localization is dependent on alternative splicing of its six exons (A-F),
where transcripts that include exon A are localized to excitable cells like muscles and neurons,
18
and transcripts including exon B are in non-excitable tissues such as astrocytes and liver cells
(Sharma and O'Halloran 2014). Okumura et al. demonstrated NCX1 and NCX3 expression at the
apical pole of both secretory and maturation ameloblasts, and expression of NCX1 was also
observed in cells of the stratum intermedium and papillary layer (Okumura et al. 2010). In
addition, protein levels of NCX1 and NCX3 throughout amelogenesis remained relatively
constant (Okumura et al. 2010). Using real-time PCR, Lacruz et al. confirmed that the mRNA
levels of both NCX1 and NCX3 remained relatively constant in both secretory- and maturation-
stage enamel organ cells (Lacruz et al. 2012b).

NCKX1 is expressed primarily in retinal rod photoreceptors and platelets (Lytton 2007;
Schnetkamp 2004). NCKX2 is expressed in cone photoreceptors and is involved in mouse motor
learning and memory (Lee et al. 2009; Lee et al. 2013; Schnetkamp 2004), and NCKX3 is
expressed in the brain and the kidneys (Lee et al. 2009; Schnetkamp 2004) though it is expressed
in the kidneys at higher levels in female mice than in male mice (Lee et al. 2009). NCKX3 is
also highly expressed in the human endometrium during the menstrual cycle, where its
expression is partially regulated by the steroid hormone 17β-estradiol (Yang et al. 2011).
NCKX4 is expressed in olfactory neurons (Stephan et al. 2011), and also in the maturation-stage
ameloblasts (Hu et al. 2012). NCKX5 is expressed in skin melanocytes, retinal epithelium, and
brain (Jalloul et al. 2016a; Jalloul et al. 2016b; Lytton 2007; Schnetkamp 2004; Sharma and
O'Halloran 2014). NCKX6/NCLX was originally considered a member of the NCKX family but
is now considered part of the Ca
2+
cation (CCX) exchanger branch (Cai and Lytton 2004;
Sharma and O'Halloran 2014) as a mitochondrial membrane Ca
2+
,Li
+
/Na
+
exchanger with a wide
tissue distribution (Lytton 2007; Schnetkamp 2004; Sharma and O'Halloran 2014).
19

CALCIUM EXTRUSION – ATP2B GENE PRODUCTS
The ATPase plasma membrane Ca
2+
transporting (or PMCA) gene family is postulated to be
more involved in Ca
2+
homeostasis, as it has a high affinity for Ca
2+
but cannot transport Ca
2+
as
rapidly as either the NCX or NCKX transporters (Brini and Carafoli 2011). The PMCA family is
part of the superfamily of P-type ATPase pumps that form a stable phosphorylated intermediate
as it hydrolyzes one molecule of ATP for each Ca
2+
transported (Cai and Lytton 2004; Strehler
and Zacharias 2001). The phosphorylated enzyme intermediate of the P-type ATPases, which
include the SERCA family of transporters in the ER membrane (Giacomello et al. 2013), occurs
between γ-phosphate of a hydrolyzed ATP with a D-residue in a highly conserved region of the
ATPase pump (Brini and Carafoli 2011).

As stated earlier, the PMCA family has 4 members, coded by genes ATP2B1-4, and over 20
alternatively RNA spliced variants of those members, with many of these variants affecting the
function of the proteins and varying across developmental stages (Krebs 2009; Strehler 2013).
The PMCA pumps have three main alternative splicing sites, termed A, B, and C, located
primarily in the first intracellular loop and the COOH-terminal tail (Strehler and Zacharias
2001). Splice site A is located in the first cytoplasmic loop just upstream of the phospholipid
binding domain, and splice site C is located in the calmodulin binding domain in the C-terminus
(Enyedi et al. 1994; Hilfiker et al. 1994; Krebs 2009; Strehler and Zacharias 2001). Splicing at
site A keeps the open reading frame and does not alter the structure of the pump, while splicing
at site C could cause premature truncation of the pump due to an inserted stop codon
(Giacomello et al. 2013). PMCA1, 2, 3 and 4 are spliced at A and C, except for PMCA1 which is
20
not spliced at site A. Splice site B is only found in human PMCA1 and PMCA4 and may be an
artifact (Brini and Carafoli 2011; Strehler and Zacharias 2001). The precise mechanism of how
such splicing specificity is achieved is unclear, but studies of the differentiation and maturation
process of granular cells in the brain suggest that splicing of PMCA1 at site C in the calmodulin
binding domain, which generates the PMCA1a isoform that has a lower affinity to calmodulin
but has more calmodulin-independent activity, is dependent on intracellular Ca
2+
concentrations
(Enyedi et al. 1994; Hilfiker et al. 1994; Krebs 2009). The PMCA4b isoform interacts with
neuronal nitric oxide synthase (nNOS), which regulates cardiac contraction (Oceandy et al.
2007). The expression of dominant alternative splicing isoforms for all four PMCA proteins
changes during the maturation of granular neurons in the brain, and these alternatively spliced
mRNA/protein isoform profiles are affected by cytosolic Ca
2+
concentrations and correspond to
specific morphological changes in these neurons (Krebs 2009).

The primary location of PMCA activity regulation is at the autoinhibitory 14-3-3 site at its C-
terminus, which interacts with and blocks the catalytic site (Giacomello et al. 2013; Strehler et al.
2007; Strehler and Zacharias 2001). At this autoinhibitory site, Ca
2+
affinity and enzymatic
activity can be increased by interaction with calmodulin or acidic phospholipids, phosphorylation
can occur through protein kinases A and C, and oligomerization is possible with other PMCAs
(Giacomello et al. 2013; Strehler 2013; Strehler and Zacharias 2001). The C-terminus also
interacts with PDZ domains of a variety of proteins, and this interaction may recruit PMCA to
specific membrane regions (Brini et al. 2016). Alternative splicing at the C-terminus can affect
calmodulin and acidic phospholipid interaction, PDZ domain binding, serine/threonine
21
phosphorylation, and the efficacy of autoinhibition (Strehler 2013; Strehler and Zacharias 2001)
(Brini et al. 2016).

PMCA1 is expressed in most tissues throughout development, most highly in the nervous
system, heart, skeletal muscle, and intestine (Zacharias and Kappen 1999), and its expression is
regulated by growth factors such as glucocorticoids and Vitamin D (Giacomello et al. 2013;
Zacharias and Kappen 1999). PMCA2 is expressed mainly in the brain, heart, mammary glands
and ear, and decreased expression of PMCA2 causes increased apoptosis in breast cancer cells
(Curry et al. 2012; Giacomello et al. 2013). PMCA3 has the highest calmodulin affinity and is
detected primarily in the brain and skeletal muscles (Giacomello et al. 2013; Krebs 2009).
PMCA4 is involved in the fertilization process and cardiac function, and has been found to
associate with lipid rafts, which often function to aggregate protein complexes important in
signaling pathways (Giacomello et al. 2013). It has been suggested that PMCA4 is more
involved in cell-specific Ca
2+
signaling than as a pump for bulk Ca
2+
export (Brini et al. 2016;
Strehler 2013). PMCA4 interacts with nitric oxide synthase and with calcineurin, which regulates
NFAT signaling (Brini 2009; Kim et al. 2012; Strehler 2013).

PMCA1 and PMCA4 are important in osteoclast differentiation, maturity, and survival, and
Atp2b1
+/-
and Atp2b4
-/-
mice have decreased bone density (Kim et al. 2012). The PMCA family
members can also influence IP
3
-mediated calcium signaling by binding to phosphatidylinositol-
4,5-bisphosphate (PIP
2
) on the plasma membrane as well as removing Ca
2+
necessary for
phospholipase C (PLC) activity, which prevents cleaving by PLC and thereby prevents Ca
2+

release from the ER (Penniston et al. 2014). Altered PMCA expression is a characteristic of
22
many cancers (Curry et al. 2011) and many other human diseases (Brini et al. 2013), but the
diversity in isoforms and splicing, and lack of specificity of small molecules to target PMCAs,
present challenges in therapeutic agent development (Strehler 2013).

SUMMARY – CALCIUM EXPORT EXCHANGERS AND PUMPS IN AMELOGENESIS
There now are a number of reports that show expression and localization data for NCX1 and
NCX3 (Lacruz et al. 2012b; Okumura et al. 2010), and NCKX4 (Hu et al. 2012; Wang et al.
2014) in the enamel organ. Reports on PMCA expression and activities throughout amelogenesis
are scant (Borke et al. 1995; Sasaki and Garant 1986; Zaki et al. 1996), and to the authors’
knowledge, investigations into the role of PMCA proteins in amelogenesis date back decades.
Data presented here better defines the mRNA profiles of all SLC8A, SLC24A and ATP2B gene
family members, and adds additional insight into the protein and spatiotemporal expression
profiles of NCKX3, PMCA1 and PMCA4.

CALCIUM EXPORT EXCHANGERS AND PUMPS AND DISEASE
A number of the ATP2B, SLC8A and SLC24A gene family members are linked to mammalian
disease, including SLC24A4, which has been linked to amelogenesis imperfecta (Herzog et al.
2015; Parry et al. 2013; Seymen et al. 2014; Wang et al. 2014). A comprehensive list of the
PMCA, NCX, and NCKX pumps and exchangers, their links to human pathologies, and mouse
models of each gene is found in Table 1.2.

23

Gene
symbol
Protein
Name
Predominant
substrates
Link to human
disease Animal models References
ATP2B1 PMCA1 Ca
2+
Embryonic lethal (Okunade et al. 2004)
ATP2B2 PMCA2 Ca
2+

Vestibular/motor
imbalance, Deafness
(Bortolozzi et al.
2010; Street et al.
1998)
ATP2B3 PMCA3 Ca
2+
Spinocerebellar ataxia
(Bertini et al. 2000;
Zanni et al. 2012)
ATP2B4 PMCA4 Ca
2+

Familial spastic
paraplegia
No overt phenotype in
Atp2b4 null mice, Male
mice are infertile
(Ho et al. 2015;
Okunade et al. 2004)
SLC8A1 NCX1 Na
+
, Ca
2+
Embryonic lethal
(Wakimoto et al.
2000)
SLC8A2 NCX2 Na
+
, Ca2
+

SLC8A3 NCX3 Na
+
, Ca
2+

Skeletal muscle fiber
necrosis, Defective
neuromuscular
transmission (Sokolow et al. 2004)
SLC8B1 * NCLX Na
+
, Li
+
, Ca
2+
(Khananshvili 2013)
SLC24A1 NCKX1 Na
+
, Ca
2+
, K
+

Congenital stationary
night blindness Night blindness
(Riazuddin et al. 2010;
Vinberg et al. 2015)
SLC24A2 NCKX2 Na
+
, Ca
2+
, K
+

SLC24A3 NCKX3 Na
+
, Ca
2+
, K
+

SLC24A4 NCKX4 Na
+
, Ca
2+
, K
+

Amelogenesis
imperfecta Amelogenesis imperfecta
(Herzog et al. 2015;
Parry et al. 2013;
Seymen et al. 2014;
Wang et al. 2014)
SLC24A5 NCKX5 Na
+
, Ca
2+
, K
+

Hypopigmentation,
Oculocutaneous
albinism
(Mondal et al. 2012;
Wei et al. 2013)
SLC24A6 NCKX6 Na
+
, Ca
2+
, K
+

Table 1.2: Pathologies associated with genes ATP2B1-4, SLC8A1-3 and SLC24A1-6. Note
that SLC8B1 is found in the mitochondria of mammalian skeletal and heart muscle, neurons and
a few other cell types.

SIGNIFICANCE, OBJECTIVES, AND SCOPE OF THE WORK
This thesis aims to add on to and expand current knowledge of transcellular calcium transport
with three objectives: characterize calcium transport proteins upregulated during secretory stage,
use PMCA1 and PMC4 knockout animals to explain the role of the PMCA transporters in
amelogenesis, and elaborate on expression and alternative splicing of different calcium
24
transporters using next-generation sequencing techniques. The work presented here contains
novel data on calcium transport proteins that are not directly involved in enamel mineralization
but nonetheless likely play an important role in calcium homeostasis and cell signaling. The data
presented in the next-generation sequencing section especially pave the way for future studies to
better understand the overall process of transcellular calcium transport by studying both the
signaling and mineralization roles of each protein involved in calcium transport. While the data
here do not necessarily give definite roles of the calcium transporters described, we use
histological analyses, gene and protein expression data, electron microscopy, and next-
generation sequencing experiments to add to current knowledge of transcellular calcium
transport throughout amelogenesis.

25

CHAPTER 2
Multiple Calcium Export Exchangers and
Pumps are a Prominent Feature of Enamel
Organ Cells

26
INTRODUCTION
Chapter 1 introduced background information and previous knowledge about calcium
transporters involved in amelogenesis. In this chapter, we specifically examine a list of known
calcium exporters, narrowing our focus toward the end of the chapter on a group of calcium
exporters upregulated during the secretory stage of amelogenesis. We believe the
characterization of the expression and localization of these calcium transporters will further lead
into more directed studies involving secretory stage calcium transport.

MATERIALS AND METHODS
Animals
All vertebrate animal manipulation was carried out in accordance with Institutional and Federal
guidelines. The animal protocols were approved by the Institutional Animal Care and Use
Committee at the University of Southern California (Protocol #20461).

Quantitative PCR analysis
Secretory-stage and maturation-stage enamel organ cells from mandibular incisors of 4-week old
Wistar Hanover rats were collected as previously described (Lacruz et al., 2012b; Wen et al.,
2014), and RNA extraction was performed using a QIAshredder, an RNeasy Protect Mini Kit,
and DNase I solution from Qiagen (Valencia, CA, USA). Reverse transcription and real-time
PCR were performed using the iScript cDNA Synthesis kit and SYBR Green Supermix from
Takara and BioRad, respectively. Real-time PCR was performed on the CFX96 system (BioRad
Laboratories, Hercules, CA, USA) in 10 µl volumes with a final primer concentration of 100 nm,
for 40 cycles at 95°C for 10 s and 58°C for 45 s. Six independent real-time PCR analyses were
27
conducted using samples from a total of 6 rats, 3 males, and 3 females, for each gene of interest
(primers are listed in Table 2.1), and for both stages of amelogenesis. The male and female data
were analyzed separately and no significant differences were noted between the sexes, so the
data presented in the graph were generated from all 6 animals (n = 6). Rat enamel organ is
preferred to mouse enamel organ for real-time PCR and western blot studies because separating
secretory and maturation stage from adult mouse incisors is technically difficult and yields less
RNA and protein per animal.

Symbol Accession Size Region Forward Reverse Temp
Atp2b1 NM_053311 219 1387-1605 AAAGCAGGTCTGCTGATGTC GACGGAGTAAGCCAGTGAGA 58
Atp2b2 NM_012508 168 4129-4296 GAGACGTCGCTTTAGCTGAG AAAGGGTCTGTGTGTGGAAA 58
Atp2b3 NM_133288 207 4073-4279 GCTCCATGACGTAACCAATC GCGGAATATTGTGGGTGTAG 58
Atp2b4 NM_001005871 184 3698-3881 AATCCAAGAACCAGGTCTCC ACGGCATTGTTATTCGTGTT 58
Slc8a1 NM_019268 150 2430-2579 CCTGCTTCATTGTCTCCATC CAAATGTGTCTGGCACTGAG 58
Slc8a2 NM_078619 166 377-542 AAACGGTGTCCAACCTTACA ACACACACAGCAATGACCAC 58
Slc8a3 NM_078620 206 4310-4515 TGGTGGAAGCCATTCTATGT AATATGGCCCACTCCCTTAG 58
Slc24a1 NM_004727 155 3238-3392 TTCCTGACCTCATCACCAGT TGGAACTGGCTGTAATCCAT 58
Slc24a2 NM_031743 214 1280-1493 GGGAGGTTCAGAGAAAAAGC CGATGCTGTGAGAGAGGTTT 58
Slc24a3 NM_053505 150 2941-3090 TGACATGTGCTCTTGTTGCT AATTGGGACTTCATTGACGA 58
Slc24a4 NM_001108051 235 401-635 AAAGTTGATGGCACCGATAA AGGGATGGGACAAAGAAGTC 58
Slc24a5 NM_001107769 161 371-531 AACATGGTTTCAACGCTCTC CACAGCAGCAGGACATACAG 58
Slc24a6 NM_001017488 160 613-772 TTCTCAGACCCTCGTACTGC ACACGGCCACCATATAGAAA 58
Enam NM_001106001 169 1139-1307 ATGCTGGGAACAATCCTACA GTGGTTTGCCATTGTCTTTC 58
Odam NM_001044274 206 658-863 TTGACAGCTTTGTAGGCACA GACCTTCTGTTCTGGAAGCAG 58
Actb NM_031144 272 559-830 CACACTGTGCCCATCTATGA CCGATAGTGATGACCTGACC 58
Table 2.1: Primers used for real-time PCR.

Western blot analysis
Secretory (S) and maturation (M) enamel organ cells from mandibular incisors of 4-week old
Wistar Hanover rats were collected. Brain (B) and heart (H) tissues were also collected as control
tissues. Total protein extraction was performed with RIPA buffer (1% Nonidet P-40, 0.1% SDS,
0.5% deoxycholic acid, 150 mm NaCl, 50 mm Tris, pH 8.0) and protease inhibitor cocktail,
28
complete mini (Roche Applied Sciences, Indianapolis, IN, USA). Samples were homogenized
manually with a pestle six times, then sonicated with a BRANSON digital sonifier Model 450
(All-Spec Industries, Wilmington, NC, USA; 10% intensity, 10 s on and 10 s off). Samples were
then cleared by centrifugation (15,000 g, 15 min, 4°C). Proteins were quantified using the
bicinchoninic acid (BCA) assay (Pierce, Rockford, IL, USA) and equal quantities were loaded
(15 µg per lane) onto 4–12% SDS–PAGE resolving gels. Protein was transferred to a PVDF
membrane, then blocked with 5% milk in TBST. Antibodies against PMCA1 (AbCam,
Cambridge, MA, USA; catalog #ab190355), PMCA2 (ab3529), PMCA3 (ab3530), PMCA4
(ab2783), NCKX3 (St. John's Laboratory, London, UK, catalog #STJ94358), GAPDH (Santa
Cruz Biotechnology, Santa Cruz, CA, USA, catalog #sc-32233), amelogenin (ThermoFisher
Scientific, catalog #PA5-31286), and cardiac muscle actin (ACTC1) (GeneTex Inc., Irvine, CA,
catalog #GTX101876) were used at dilutions of 1:500, 1:2,000, 1:300, 1:5,000, 1:500, 1:500,
1:3,000, and 1:500, respectively in 5% milk in TBST. Secondary antibody for PMCA1-4 from
Cell Signaling (Danvers, MA, USA; catalog #7074 and #7076) was applied at a dilution of
1:10,000. Secondary antibodies for NCKX3, amelogenin, and ACTC1 from Santa Cruz
Biotechnology (Santa Cruz, CA, USA; catalog #sc-2004 and sc-2418) were applied at a dilution
of 1:7500. Pierce ECL Plus Western Blotting Substrate (Thermo Scientific, Rockford, IL, USA;
catalog #32132) was used as the detection system for all antibodies. TBST (tris-buffered saline
with .1% Tween-20) was used as a wash buffer.

Immunofluorescence
Mandibular incisors were dissected from 9-day-old wild type mice and placed in 4%
paraformaldehyde in PBS overnight. Mouse incisors were preferred to rat incisors in the
29
immunofluorescence studies because mouse incisors decalcify more rapidly and all stages of
amelogenesis are visible in one sagittal section. The incisors were then washed in PBS and
decalcified in 10% EDTA in PBS pH 7.4 for 4 weeks at 4°C. The sample was embedded in
paraffin and 4 µm sections were cut with a microtome. The sections were deparaffinized and
rehydrated. The primary antibodies for PMCA1 and PMCA4 (AbCam, Cambridge, MA, USA;
catalog #ab3528 and #ab2783, respectively) were used at dilutions of 1:40 and 1:200 in 1% BSA
in PBS, respectively. The primary antibody for NCKX3 (Santa Cruz Biotechnology, Santa Cruz,
CA, USA; catalog #sc-50129) was used at a dilution of 1:50. The secondary antibodies (Vector
Laboratories, Burlingame, CA, catalog #DI-1088, DI-2488, DI-2594, DI-3094) were used at a
dilution of 1:300 in 1% BSA in PBST. Sections were mounted with mounting medium with
DAPI (Vector Laboratories, Burlingame, CA, catalog #H-1200) and imaged on a Leica TCS SP8
confocal microscope (Leica Biosystems). PBST (0.1% Tween-20) was used as a wash buffer for
the experiments. Negative control sections, using secondary antibody only, under identical
conditions, were included and showed negligible auto fluorescence (data not shown).

RESULTS
Messenger RNA expression profiles
Quantitative PCR (qPCR) comparing mRNA expression levels in secretory and maturation
enamel organ cells for all PMCA (Atp2b), NCX (Slc8) and NCKX (Slc24) gene family members
indicate that: (1) PMCA1 (Atp2b1), 3 (Atp2b3), and 4 (Atp2b4), and NCKX3 (Slc24a3)
expression is highest during secretory-stage amelogenesis; (2) NCX1 (Slc8a1) and 3 (Slc8a3),
and NCKX6 (Slc24a6) were expressed during secretory and maturation stages; and (3) NCKX4
(Slc24a4) is most highly expressed during maturation-stage amelogenesis (Figure 2.1). The
30
expression levels of PMCA2 (Atp2b2), NCX2 (Slc8a2), NCKX1 (Slc24a1), NCKX2 (Slc24a2),
and NCKX5 (Slc24a5) are negligible throughout amelogenesis (Figure 2.1). These data for NCX
(Slc8) and NCKX (Slc24) gene family members are consistent with previously published gene
expression data (Okumura et al., 2010; Hu et al., 2012), and add novel information suggesting
that PMCA1, PMCA4, and to a lesser extent PMCA3 (which is expressed in secretory enamel
organ cells at a level an order of magnitude lower than seen for PMCA1 and PMCA4), play an
important role in secretory-stage amelogenesis.

31
Figure 2.1: Real-time PCR for rat Atp2b, Slc8a, and Slc24a gene family members. Atp2b1, Atp2b3,
Atp2b4, Slc8a3, and Slc24a3 have significantly higher expression in secretory stage than maturation
stage, while Slc8a1, Slc24a2, and Slc24a4 were significantly more highly expressed in maturation stage
compared to secretory stage. b-actin (Actb) served as a normalizing control, and enamelin (Enam) and
Odam as control transcripts that were significantly down-regulated and up-regulated, respectively (as
expected), during maturation-stage amelogenesis. Slc24a4, Enam and Odam (arrows) have all been linked
to non-syndromic cases or amelogenesis imperfecta. The x-axis is placed at the 0.001 expression level
relative to Actb, and below this “cut-off” figure is arbitrarily considered non-significant. The Student’s t-
test (paired two-tail) was used to compare the expression of each gene between the secretory and
maturation stages (* p < 0.05, and ** p < 0.01). Standard deviations are also included. Data collected by
Xin Wen.

Western blot analysis confirms expression of PMCA proteins in enamel organ cells
Western blot data indicate that PMCA1 and PMCA4 are more highly expressed in secretory
stage than in maturation stage, and PMCA2 is not expressed at any appreciable level in
amelogenesis, consistent with the qPCR data (Figures 2.2Ai,Aiv,Aii respectively). Contrary to
the qPCR data, PMCA3 and NCKX3 appear to be expressed at similar levels during both
secretory stage and maturation stage (Figures 2.2Aiii,B respectively). Rat brain and heart protein
samples were used as control tissues and analyzed with the secretory- and maturation-stage
protein samples. The expected molecular weights for PMCA1-4 are ~130, 133, 123, and 129 kDa
respectively, and relate to the single bands seen at approximately the 150 kDa molecular weight
mark (as indicated by an arrow, Figure 2.2A). The expected molecular weight of NCKX3 is ~60
kDa (Figure 2.2B). Gapdh has been included as a loading control for all samples, and additional
32
controls include Western analysis for both amelogenin (Amelx) and cardiac muscle alpha actin
(Actc) (Figure 2.2B)
Figure 2.2: Western blot analyses of PMCA1-4, and NCKX3 in secretory-stage and maturation-
stage rat enamel organs. (A) Western blot analysis for PMCA1 (Ai), PMCA2 (Aii), PMCA3 (Aiii) and
PMCA4 (Aiv). Samples are secretory-stage enamel organ cells (S), maturation- stage enamel organ cells
(M), brain tissue (B) and heart tissue (H). Brain and heart samples are shown for comparison, as all
PMCAs are highly expressed in brain and at lower levels in the heart (Brini and Carafoli 2011; Brini et al.
2017). Molecular weight markers are indicated at left. The expected molecular weights for PMCA1,
PMCA2, PMCA3, and PMCA4 are ~130kDa, 133kDa, 123kDa, and 129kDa, respectively. The bands are
seen for PMCA1, PMCA3 and PMCA4 (boxed and arrow). No expression of PMCA2 is evident. GAPDH
is used here as a loading control. Panel B: Western blot analysis of NCKX3. The expected molecular
weight for NCKX3 is ~ 60 kDa. NCKX3 is expressed in all 4 tissue samples tested, with similar
expression noted in both secretory-stage and maturation-stage enamel organ cells, and brain tissue.
Relatively higher levels of NCKX3 expression can be appreciated in heart tissue. Amelx and Actc are
used as controls as they are most highly expressed in secretory-stage ameloblasts (Lacruz et al. 2012a;
Lacruz et al. 2012b) and heart tissue (Hamada et al. 1982) respectively. GAPDH is used here as a loading
33
control. PMCA1-4 data collected by Xin Wen.

PMCA1 and PMCA4 localization by immunofluorescence
In the enamel organ, PMCA1 expression is seen primarily on the basolateral membrane of both
secretory- and maturation-stage ameloblasts, with stronger signals seen in secretory ameloblasts
(green; Figures 2.3A–C). These data complement both the qPCR (Figure 2.1) and Western blot
data (Figure 2.2) on the spatiotemporal expression of PMCA1 in enamel organ cells. When
compared to ameloblasts, a weaker signal of PMCA1 is seen in the stratum intermedium (Figure
2.3A) and papillary layer cells of the enamel organ (Figure 2.3B); as reflected by the orange
color observed in the merged images (Figures 2.3G–I). In the enamel organ, PMCA4 expression
is also seen on the basolateral membrane of secretory- and maturation-stage ameloblasts, and
cells of the stratum intermedium and papillary layer cells (red; Figures 2.3D–F). Like the
PMCA1 data, these PMCA4 immunolocalization data complement the qPCR and Western blot
data (Figures 2.1, 2.2). The co-localization of both PMCA1 and PMCA4 in polarized
ameloblasts can be appreciated in the merged image (yellow; Figures 2.3G–I), while PMCA4
(but not PMCA1) is also expressed in the stratum intermedium and papillary layer cells of the
enamel organ (red; Figures 2.3G–I).

34
Figure 2.3: Immunofluorescence analysis of PMCA1, PMCA4, and NCKX3 in 9-day-old mouse
mandibular incisors. Columns from left to right show secretory-stage (A,D,G,J,M,P), transition-stage
(B,E,H,K,N,Q) and maturation-stage (C,F,I,L,O,R) ameloblasts; while rows show immunoreactivity for
PMCA1 (green; A – C and J – L), PMCA4 (red; D – F) and NCKX3 (red; M – O). Merged images are
also shown for each column (A and D merged to G; B and E merged to H; C and F merged to I; J and M
merged to P; K and N merged to Q; and L and O merged to R). Ameloblasts (Am), enamel space (ES),
stratum intermedium (Si), Tomes’ processes (TP; secretory ameloblasts only) and papillary layer (PL;
maturation ameloblasts only). The proximal/basal poles (p/b) and distal/apical poles (d/a) of ameloblast
cells are identified, as are the lateral membranes of ameloblasts (broken while line in panel G). Scale for
panels A – I shown in panel I; and scale for panels J – R shown in R.

35
NCKX3 localization by immunofluorescence
NCKX3 expression is highest in the Tomes' processes (Figure 2.3M) and the apical membrane of
transition- and maturation-stage ameloblasts (Figures 2.3N,O), while some minor ameloblast-
specific intracellular granular immune-reaction is also apparent (Figures 2.3M–O). We compared
the expression profile for NCKX3 (red; Figures 2.3M–O) to the expression profile of the control
PMCA1 (green; Figures 2.3J–L). As can be appreciated from the images (Figures 2.3M–R), the
expression profile for NCKX3 in the enamel organ is highest at the distal/apical pole, and this is
distinct from the expression profiles seen for PMCA1 and PMCA4 where expression is seen on
the lateral membranes of polarized ameloblasts (for both PMCA1 and PMCA4) and stratum
intermedium and papillary layer cells (only PMCA4) (Figures 2.3A–L).

DISCUSSION
From data presented here and prior studies, it is possible to make the following generalizations.
First, of the four unique genes coding the PMCAs, PMCA1, and PMCA4 are highly expressed
on the basolateral membranes of polarized ameloblasts; and both are expressed during secretory-
and maturation-stage amelogenesis. These data somewhat contradict previously published data
suggesting PMCA1 and PMCA4 are localized primarily to Tomes' processes of secretory
ameloblasts (Sasaki and Garant, 1986c; Borke et al., 1995). These differences likely result from
the different specificities of antibodies used to carry out these studies, and as noted previously,
protein localization differences may also result from the different chemical and processing
techniques used by the various laboratories (Takano, 1995). While expression of PMCA1 is
primarily in the basolateral membrane of ameloblasts, there are also lower expression levels
noted in the cells of stratum intermedium and papillary layer. Similarly, while expression of
36
PMCA4 is seen in the basolateral membrane of ameloblasts, expression of PMCA4 is also
recognized as a feature of the cells of the stratum intermedium and papillary layer cells. Of the
three unique genes coding for the NCXs, NCX1, and NCX3 are highly expressed at the apical
pole of both secretory- and maturation-stage ameloblasts (Okumura et al., 2010). Finally, of the
six unique genes coding for NCKXs, NCKX3 (data reported here; Figures 2.1–2.3) and NCKX4
(Hu et al., 2012; Wang et al., 2014) are both highly expressed at the apical pole of polarized
ameloblasts. A similar level of expression of NCKX3 is noted in both secretory- and maturation-
stage ameloblasts (Figures 2.2-2.3). While expression of NCKX4 is negligible in secretory-stage
ameloblasts, it is highly expressed in maturation-stage ameloblasts (Hu et al., 2012; Wang et al.,
2014). All six proteins expressed in ameloblasts (PMCA1, PMCA4, NCX1, NCX3, NCKX3, and
NCKX4) export Ca2+ from the cytoplasm to the extracellular space, thus ameloblasts may be
one of the more complicated epithelial cell types when it comes to understanding ion movements
related to Ca2+ transport as they relate to a mineralizing dental enamel.

The data suggest that there are likely redundancies amongst similarly functioning proteins from
these gene families. For example, from this list of six Ca2+ export proteins expressed in
ameloblasts, only mutations to SLC24A4/NCKX4 have been linked to enamel pathologies (Parry
et al., 2013; Seymen et al., 2014; Wang et al., 2014; Herzog et al., 2015). NCKX4 exports Ca2+
from the apical pole of maturation-stage ameloblasts at the developmental stage where enamel
mineralization is at its greatest; thus, NCKX4 may play a greater role in enamel formation than
either NCX1 or NCX3, which have expression localized to the apical pole throughout the entire
process of amelogenesis. It is conceivable that if the function of either NCX1 or NCX3 is less
37
than optimal, the other may compensate such that no overt enamel phenotype results. Future
studies may be able to address whether NCX1 and NCX3 are equivalent in enamel formation.

Similar to NCX1 and NCX3 in ameloblasts, PMCA1 and PMCA4 or other calcium handling
proteins may be able to overcome the effects of Atp2b1 or Atp2b4 mutations, or gene silencing.
No human pathologies have yet been linked to ATP2B1 mutations (as noted in the Online
Mendelian Inheritance in Man; http://omim.org/entry/108731), however Atp2b1-null mice are
embryonic lethal (Okunade et al., 2004). Only recently a case of familial spastic paraplegia has
been linked to an ATP2B4 mutation (Ho et al., 2015; http://omim.org/entry/108732), and while
Atp2b4-null mice have no overt phenotype, the male mice are infertile due to reduced sperm
motility (Okunade et al., 2004; Schuh et al., 2004; Kim et al., 2012). The similar expression
profiles of PMCA1 and PMCA4 in ameloblasts (that being to the basolateral membrane) may
suggest that loss of PMCA4 function in ameloblasts may be compensated by PMCA1, while the
loss of PMCA1 function remains embryonic lethal. If this is correct, studying PMCA1 activities
in in vivo enamel formation would, in the future, be limited to conditional knockout or
heterozygote animal models. The localization of PMCA1 and PMCA4 on the ameloblast
basolateral membrane may suggest that these Ca2+ pumps are unlikely to have a critical role in
enamel mineralization; i.e., Ca2+ removed by the PMCA pumps may not directly be
incorporated into the Hap mineral phase. Instead, the PMCA pumps may be indirectly involved
in amelogenesis by maintaining ameloblast Ca2+ homeostasis; or being a part of ameloblast cell
signaling pathways. As calcium is transported through the stratum intermedium and papillary
layer to the ameloblasts and the enamel organ, the PMCA family may additionally be valuable in
shuttling the calcium from circulation to the ameloblasts. The PMCA family can be involved in
38
IP3-mediated calcium signaling (Penniston et al., 2014), and PMCA1 and PMCA4 are involved
in RANKL signaling and regulate osteoclast differentiation (Kim et al., 2012). In cultured
osteoclasts, the knockdown and/or silencing of both PMCA1 and PMCA4 increased protein
expression of SERCA2 and TRPV5 (Kim et al., 2012). Indeed, the PMCA transporters may have
evolved to fine-tune intracellular calcium concentration as they have higher calcium affinity and
lower capability for bulk Ca2+ transport than the NCX/NCKX exchangers (Brini and Carafoli,
2011), and are therefore more likely to play a housekeeping role by removal of intracelullar
Ca2+ during maturation stage enamel mineralization which may also prevent calcium overload
and possibly ameloblasts apoptosis. The PMCA transporters have multiple known expressed
isoforms in other tissues but this has not yet been studied in the enamel organ.

Our novel data adds to the current understanding of Ca2+ transport in secretory and maturation
stage enamel organ, described in Figure 2.4. Ca2+ import by the CRAC channel, ER Ca2+
export by IP3R, and ER Ca2+ import by the SERCA2 pump have been well-described elsewhere
(Nurbaeva et al., 2015a,b, 2017). In summary, when Ca2+ is released from the ER through IP3R,
STIM1 associates with ORAI1 and forms the CRAC channel that allows Ca2+ to flow into the
cell. Ca2+ is then removed from the cytoplasm through PMCA1 and PMCA4 on the basal and
lateral membranes, NCX1, NCX3, NCKX3, and NCKX4 on the apical membrane, and SERCA2
on the ER membrane. NCX1 and PMCA4 are also involved in Ca2+ export in the stratum
intermedium and papillary layer. This process of Ca2+ cycling occurs more during the
maturation stage, when large amounts of Ca2+ are necessary for enamel mineralization. During
the secretory stage, PMCA1, PMCA4, NCX1, NCX3, and NCKX3 are the known Ca2+
39
exporters expressed, but further studies are necessary to understand Ca2+ import and other
mechanisms of Ca2+ export during enamel secretion.

Figure 2.4: Schematic of what is currently proposed for secretory- and maturation-stage
transcellular calcium transport in amelogenesis. During the secretory-stage (left image), active Ca2+
transport on the lateral membrane is primarily mediated by PMCA1 and PMCA4 and ATP is hydrolyzed
in the process. NCX1, NCX3, and NCKX3 mediate Ca
2+
export in the Tomes’ process. More calcium
transporters are expressed during the maturation stage (right image). The CRAC channel, composed of
the channel ORAI1 and the ER membrane calcium sensor STIM1, mediates the bulk of calcium entry and
is active in response to ER calcium store depletion through IP
3
R. The cell then removes calcium from the
cytoplasm through the SERCA2 pump that replenishes ER stores, and the NCKX and NCX proteins on
the apical border plasma membrane that export calcium into the enamel area and facilitate mineralization
(Nurbaeva et al. 2015a; Nurbaeva et al. 2016; Nurbaeva et al. 2015b). NCX1 and PMCA4 export Ca
2+

from the stratum intermedium (secretory-stage enamel organ) and papillary layer (maturation-stage
40
enamel organ). Desmosomes (Fausser et al. 1998; Jheon et al. 2011; Sasaki et al. 1984) and gap junctions
(Inai et al. 1997; Pinero et al. 1994; Sasaki and Garant 1986) have also been identified bridging or uniting
adjacent epithelial cells in the enamel organ, and are also illustrated.

Conclusion
Based on the available data, we have reviewed and summarized the expression profiles of the
major Ca2+ export pumps and exchangers in enamel organ cells (Okumura et al., 2010; Hu et al.,
2012; Wang et al., 2014), and illustrated these Ca2+ export proteins along with the current model
for Ca2+ import in enamel organ cells as proposed by Nurbaeva et al. (2015a,b, 2017) (Figure
2.4). As future studies continue to better define Ca2+ export (and also Ca2+ import—see
Nurbaeva et al., 2015a,b, 2017) during amelogenesis, the information in Table 1.1 will
undoubtedly expand and become more precisely defined. Ultimately, elucidating the multitude of
mechanisms involved in transcellular Ca2+ movements in the enamel-forming cells will result in
a better understanding of the physiology and formation of enamel, the hardest and most calcified
tissue in mammals.

Publication Information
The data in this chapter was published in (Robertson et al. 2017).

41

CHAPTER 3
An In Vivo Study of the Role of the PMCA
Transporters in Amelogenesis

42
INTRODUCTION
Because previous data from Atp2b1
+/-
and Atp2b4
-/-
mice show a bone phenotype and increased
apoptosis in osteoclasts and vascular smooth muscle cells (Curry et al. 2012) (Kim et al. 2012)
(Prasad et al. 2007), we tested the effects of the ablation of these calcium transporters on
ameloblast morphology, gene and protein expression, and enamel structure. While our results
suggest slight abnormalities in gene expression and ameloblast morphology, the mature enamel
of the Atp2b1
+/-
, Atp2b4
-/-
, and Atp2b1
+/-
Atp2b4
-/-
mice show no significant differences to wild-
type enamel. Our results highlight the ability of the enamel organ to adapt to the loss of the
catalytic effect of the PMCA transporters.

MATERIALS AND METHODS
Animals and genotyping
Atp2b1
+/-
(Strain 129SvJ/Black Swiss) and Atp2b4
+/-
(Strain FVB/N+NJ) mice were purchased
from JAX Laboratories. Atp2b1
-/-
mice are embryonic lethal but Atp2b1
+/-
mice have an
observable phenotype in other organs (Kim et al. 2012) (Okunade et al. 2004; Prasad et al. 2007),
so Atp2b1
+/-
mice and wild-type littermates were generated from crossing Atp2b1
+/-
and wild-
type mice. Atp2b4
+/-
mice were crossed to get Atp2b4
-/-
mice and wild-type littermates as
previously described (Kim et al. 2012; Okunade et al. 2004). The double mutant Atp2b1
+/-
Atp2b4
-/-
mice and wild-type littermates were generated by crossing Atp2b1
+/-
Atp2b4
+/-
mice and
Atp2b4
+/-
mice. All procedures performed were under the guidelines of the National Institutes of
Health (Guide for the Care and Use of Laboratory Animals) and animal experiment protocols
were approved by the Institutional Animal Care and Use Committee at the University of
Southern California (Protocol #20461). Tail DNA was extracted using the Quick Genotyping
TM

43
DNA Preparation Kit (Bioland Scientific, Paramount, California, USA). Separated PCR was
performed to confirm the genotype using the protocol and primers from JAX Laboratories. PCR
buffer, Taq polymerase, and dNTP mixes were purchased from Takara (Takara Bio USA, Inc.).

Hematoxylin & Eosin (H&E) Staining
Atp2b1
+/-
, Atp2b4
-/-
, and Atp2b1
+/-
Atp2b4
-/-
mice and wild-type mice were euthanized and
mandibular incisors dissected at 9 days. The incisors were fixed in 4% paraformaldehyde in PBS
overnight, washed, and decalcified in 10% EDTA in PBS for 4 weeks. The incisors were then
embedded in paraffin wax and sagittal sections prepared at 4 µM. H&E staining was performed
according to the protocol from the VitroView
TM
H&E Stain Kit (GeneCopoeia Inc, Rockville,
MD, USA) and slides mounted using a xylene-based mounting medium. Image analysis was
performed using a Keyence BZX710 microscope (Keyence Corporation of America, Itasca, IL,
USA).

Immunofluorescence analysis
Atp2b1
+/-
, Atp2b4
-/-
, and Atp2b1
+/-
Atp2b4
-/-
mice and wild-type mice were euthanized and
mandibular incisors dissected at 9 days and decalcified and processed as previously described
(Robertson et al. 2017). Sagittal sections were dewaxed, rehydrated, and blocked with 1% bovine
serum albumin (BSA) in PBS, then incubated with primary antibodies against PMCA1 (Abcam
catalogue #3528) diluted 1/40, PMCA4 (Abcam catalogue #2783) diluted 1/100, and active-
Caspase3 (Abcam catalogue #ab2302) diluted 1/1000).

44
Dissection microscopy
Atp2b1
+/-
, Atp2b4
-/-
, and Atp2b1
+/-
Atp2b4
-/-
mice were euthanized at 8 weeks and images of their
enamel were taken using a Leica MC170 stereoscope (Leica Microsystems, Buffalo Grove, IL,
USA).

µCT analysis
The mandibular incisors of 8-week-old Atp2b1
+/-
(n = 5 mice for wild-type, n = 7 mice for
Atp2b1
+/-
), Atp2b4
-/-
(n = 5 wild-type and Atp2b4
-/-
), and Atp2b1
+/-
Atp2b4
-/-
(n = 4 wild-type and
Atp2b1
+/-
Atp2b4
-/-
) mice and their respective wild-type littermates were dissected and air-dried
overnight. µCT analysis was performed using the SkyScan 1174 scanner with the settings to 50
kVp, 800 µA, and 11.8 µm resolution. The reconstruction was performed with Amira 3D
Visualization and Analysis Software 5.4.3 (FEI Visualization Science Group, Burlington, MA,
USA) (Wen et al. 2015). Three images corresponding to the maturation, transition, and secretory
stages were taken from the reconstruction and comparative enamel density analyzed from those
images using ImageJ (Schneider et al. 2012). A two-tailed Student’s t-test was used to evaluate
potential statistical differences in the relative enamel density between the mutant and wild-type
groups, where significance was defined at P < 0.05).

Scanning Electron Microscopy (SEM)
The mandibular incisors used in the µCT analysis were embedded in Epon resin and cut at two
positions along the incisor corresponding to mature enamel and secretory stage enamel. The
sections were then etched with 1% nitric acid for 15 seconds for the mature enamel, 5 seconds
for the transition stage enamel, and 2 seconds for the secretory stage enamel. The sections were
45
sputter coated and imaged using a JEOL-7001 SEM microscope at 1000x and 3000x
magnification.

Quantitative PCR (qPCR)
1
st
molars of Atp2b1
+/-
, Atp2b4
-/-
, and Atp2b1
+/-
Atp2b4
-/-
mice and wild-type littermates were
dissected at 3, 6, and 9 days, then RNA was extracted, cDNA prepared, and qPCR performed
using a method described previously (Robertson et al. 2017). Primers were designed using the
IDTDNA PrimerQuest tool (Integrated DNA Technologies, Inc.) for the calcium transporters
most likely involved in amelogenesis (Robertson et al. 2017) and real-time PCR reactions were
performed on a CFX96 TouchTM Real-Time PCR Detection System (Bio-Rad Life Sciences)
using iQ SYBR® Green Supermix (Bio-Rad Life Sciences). The Ct values were normalized to
Actb (Beta-actin). The DDCt method was used to calculate the fold changes in gene expression
between the mutants and their wild-type littermates. Two-tailed Student’s t-tests were used to
determine the significance (p < 0.05) of potential differences between the mutant and wild-type
groups.

46
Symbol Accession Forward Reverse
Atp2b1 NM_026482.2 GAACAGGATGACGGTTGTTC AATCCAAGAGAAACCCCAAC
Atp2b2 NM_001036684.3 ATCTCGAGGACCATGATGAA CATCATGACGAAGGTGTTGA
Atp2b3 NM_001310537.1 TGTTCGAAAATCAGCAGACA CTTCTCCTCCTCCTCTCCAC
Atp2b4 NM_001167949.2 ACAGCCATTTGCTCCGATAA CATTGACGATGAGCTCCAGAA
Slc8a1 NM_001112798.2 AGTCTCCCACCCAATGTTTC CTCCTGTTTCTGCCTCTGTATC
Slc8a2 NM_001347561.1 CATGTTCCTGGGTGTGTCTATC CCTTGGTGATGGTGATCTCTTT
Slc8a3 NM_001167920.1 GCTGACTGTGGAGGAAGAGG GATGGCTTCCATGAACTGGT
Slc24a1 NM_144813.1 AAGCAGGCCATCTACCTCTT GGTGATGAGGTCAGGAATTG
Slc24a2 NM_001110240.1 GTATCCTGCCTCCCATCATAAC ACTGCTTCCAAGTAGCGTAAA
Slc24a3 NM_001356497.1 GAGGCTGGCCTTCGAATTAT GGTATAGGCCCTGCTGTTTATC
Slc24a4 NM_172152.2 TGTGCAGAGAAGACGACTAAAG AGTAGAGACCTGTGTGGAGAA
Slc24a5 NM_175034.3 GCAGTTAGTGTAGGAGCAGTTT ACACAGCAGCAGAACATAGAG
Slc24a6 NM_001177594.1 CTGGGCCTCTACGTGTTCTA GATCAGGATCTGGACAGTGG
Cacna1c NM_001159533.2 CGGCACCCTCTTACCTTT AACCCATTAGGAACATTGAAAC
STIM1 NM_009287.4 CCTCTCTTGACTCGGCATAATC GTGCTCCTTAGAGTAACGGTTC
Enam NM_017468.3 GTGGCTCCACAGGACATAAA GCCAGAGCCTTTATCAGGAATA
Odam NM_027128.2 GCTTATCTCGCAGCGTCTATT AAAGCAGGCTTCCTTCTACTG
Actb NM_007393.5 CTGGCACCACACCTTCTACAA GATGTCACGCACGATTTCCCT
Table 3.1: Primers used for qPCR

RESULTS
Immunofluorescence data confirms no change in PMCA1 localization in the Atp2b4
-/-

knockout or PMCA4 localization in the Atp2b1
+/-
knockout.
Figure 3.1 shows the immunofluorescence data of PMCA1 (green) and PMCA4 (red) in
Atp2b1
+/-
. Atp2b4
-/-
, and Atp2b1
+/-
Atp2b4
-/-
mice compared to wild-type littermates. In the
Atp2b1
+/-
mutant, PMCA1 expressed is decreased as expected and PMCA4 localization is
unchanged. Similarly, in the Atp2b4
-/-
mutant, we observe no expression of PMCA4 but no
difference in PMCA1 localization. The Atp2b1
+/-
Atp2b4
-/-
double mutant exhibits both a marked
decrease in PMCA1 and total ablation of PMCA4, as expected.
47

Figure 3.1: Immunofluorescence staining of PMCA1 and PMCA4 in the mutant mice compared to
wild-type littermates confirm knockout. 61x magnification images are shown for the secretory,
transition, and maturation stages of amelogenesis in the Atp2b1
+/-
(Panel A), Atp2b4
-/-
(Panel B), and
Atp2b1
+/-
Atp2b4
-/-
double mutant (Panel C) compared to wild-type littermates. The basal end of the
ameloblasts is at the top of the image, while the apical end is at the bottom of the image.

C
B
A
48
H&E staining identifies morphological abnormalities
Figure 3.2 shows the results of H&E staining of Atp2b1
+/-
, Atp2b4
-/-
, and Atp2b1
+/-
Atp2b4
-/-
mouse sections compared to their respective wild-type littermates. During the pre-secretory and
transition stages, no observable differences exist between the Atp2b1
+/-
mutant and the wild-type,
however the secretory stage ameloblasts consistently exhibit an abnormal detachment from the
forming enamel layer. While we do not believe the ameloblasts have detached from the enamel
itself, the Atp2b1
+/-
mutation likely causes a weakness in the Tomes’ process that causes the
ameloblasts to be more prone to errors in tissue processing. The detachment again appears during
the Atp2b1
+/-
maturation stage between the papillary layer and the ameloblasts. Additionally, the
Atp2b1
+/-
maturation stage papillary layer exhibits enlarged capillaries compared to those in the
wild-type papillary layer.

The Atp2b4
-/-
section also shows a similar detachment during the secretory stage to the Atp2b1
+/-

section, but the wild-type secretory stage also shows the detachment between the ameloblasts
and enamel layer. We believe this is due to differences in the Atp2b1
+/-
and Atp2b4
-/-
mouse
strains. Enlarged capillaries are also observed in the maturation stage Atp2b4
-/-
papillary layer
compared to the wild-type.

Atp2b1
+/-
Atp2b4
-/-
sections show a more severe abnormality in the morphology of the secretory
stage Tomes’ process than either the Atp2b1
+/-
or Atp2b4
-/-
mutant mice; in most Atp2b1
+/-
Atp2b4
-/-
sections, the Tomes’ process has completely detached from the ameloblasts during
tissue processing. The pattern of enlarged capillaries in the mutant maturation stage papillary
layer remains in the maturation stage Atp2b1
+/-
Atp2b4
-/-
papillary layer.
49

Figure 3.2: H&E staining of mutant mice compared to wild-type littermates. 40x magnification
images are shown for presecretory, secretory, transition, and maturation stages. 4x magnification images
are shown for all mutant animals and controls. WT control images are on the top, mutant animal images
on the bottom. Arrows are placed to highlight differences in morphology during various stages of
amelogenesis. The most noticeable differences occur at the junction between the ameloblasts’ Tomes’
S
A
B
C
50
processes and the enamel area (arrows in secretory stage panels) and in the capillaries that run through the
papillary layer (maturation stage panels).

Active-Caspase3 staining suggests increased ameloblast apoptosis
The fact that many ameloblasts undergo apoptosis throughout enamel development, and most of
that apoptosis occurs during the transition stage, has been well-observed(Shibata et al. 1995)
(Kondo et al. 2001) (Tsuchiya et al. 2009). Apoptosis caused by a lack of PMCA transporters has
been studied in other organs (Kim et al. 2012). We performed immunofluorescence using an
antibody specific to active-Caspase3, a marker for apoptosis (Lavrik et al. 2005), to determine
the spatiotemporal localization of active-Caspase3 throughout amelogenesis.
Immunofluorescence data for active-Caspase3 in the mutant animals compared to their wild-type
counterparts is shown in Figure 3.3. As expected, wild-type and mutant sections share similar
levels of active-Caspase3 expression around the 2
nd
molar, when many ameloblasts are likely in
transition. In the mutant sections, active-Caspase3 expression continues into the 1
st
molar, when
most of the ameloblasts are likely in the maturation stage, with the most noticeable increase in
expression in the Atp2b4
-/-
and Atp2b1
+/-
Atp2b4
-/-
sections.

51

Figure 3.3: Active-Caspase3
immunofluorescence shows
prolonged apoptosis
signaling in the mutant
mouse ameloblasts. All
images are 61x
magnification. Many
ameloblasts undergo
apoptosis during the
transition stage, which
typically occurs in the 2
nd

molar of a 9-day-old mouse.
By the first molar, most
ameloblasts are in maturation
stage and apoptosis is
expected to decrease. We
notice increased active-
Caspase3 staining in the
Atp2b4
-/-
mutant and double
mutant compared to their
wild-type controls.

2
nd
molar 1
st
molar
1
st
molar
2
nd
molar
1
st
molar back 1
st
molar front
52
µCT and SEM analysis show little noticeable defect in enamel density or crystal
organization
Atp2b1
+/-
, Atp2b4
-/-
, and Atp2b1
+/-
Atp2b4
-/-
mice show no significant change in enamel
appearance, density, or mineral organization compared to the wild-type at any stage of
amelogenesis according to the µCT and SEM data (Figures 3.4 and 3.5). The Atp2b1
+/-
and wild-
type litters (strain 129SvJ/Black Swiss) had noticeably denser enamel than the Atp2b4
-/-
and
wild-type litters (strain FVB/N+NJ), demonstrating the effect of mouse strain on enamel density
and causing difficulty in accurately comparing Atp2b1
+/-
Atp2b4
-/-
and wild-type enamel due to
the possibilities in genetic variation within each litter. Even within each strain, a high variability
existed in the enamel density of slice 2, corresponding to the transition between secretory and
maturation. The enamel crystals of the mutant animals appear normal in both the secretory and
maturation stages according to the SEM data. The mature enamel crystals in the double mutant
animal appear to be slightly narrower and hollower than the wild-type mouse, but this difference
does not seem to affect the overall thickness or density of the enamel (Figure 3.4 and 3.5).

53

Figure 3.4:
µCT analysis of
mutant mice
compared to wild-
type controls. The
relative enamel
density of 8-week
old Atp2b1
+/-
,
Atp2b4
-/-
, and
Atp2b1
+/-
Atp2b4
-/-

mutant mouse
mandibular incisors
compared to wild-
type littermates was
quantified at three
different positions
along the incisor
corresponding to a
secretory stage,
transition stage, and
maturation stage
reference plane.

54

Figure 3.5: SEM analysis of mutant animals compared to wild-type controls. 1000x and 3000x
magnification images are shown for the secretory and maturation stages of each mouse. The 8-week old
mouse incisors used for µCT analysis were then cut at the secretory and maturation stage reference planes
to examine the developing enamel at those two stages. No difference in the organization of the enamel
crystals was evident in any of our mutants – the mutants exhibit the same characteristic rod-interrod
enamel crystal structure as wild-type mice.

55
Real-time PCR data shows significant decrease in an ameloblast-associated protein
Because the enamel of the Atp2b1
+/-
, Atp2b4
-/-
, and Atp2b1
+/-
Atp2b4
-/-
mice has no noticeable
difference compared to the corresponding wild-type animals, we predicted that other calcium
transporters may be upregulated in these mutants to compensate for the lack of the PMCA
transporters. To test this, quantitative real-time PCR was performed to survey the calcium
transporters known to be expressed during amelogenesis, using odontogenic ameloblast-
associated protein (Odam) as a marker for maturation stage and enamelin (Enam) as a marker for
secretory stage (Figure 3.6). Knowing that most of the calcium transporters are expressed more
highly during the maturation stage, we used cDNA developed from RNA extracted from the 1
st

molars of 9-day-old Atp2b1
+/-
Atp2b4
-/-
mice and their wild-type littermates (n = 3), when most
of the ameloblasts on the 1
st
molar are in the maturation stage. We saw a slight but statistically
insignificant increase in an isoform of Atp2a2 (protein: SERCA2b), which is expressed on the
membrane of the ER and facilitates calcium transport from the cytoplasm back into the ER for
storage. Previous studies have observed that SERCA2 expression is upregulated when the
PMCA transporters are knocked out (Kim et al. 2012). Surprisingly, Odam expression was
significantly decreased in the Atp2b1
+/-
Atp2b4
-/-
mutant compared to the wild-type but Enam
expression remained unchanged, suggesting that the mutations did not cause a delay in
maturation but rather only affected the expression of Odam, and this finding may warrant further
investigation. In the Atp2b1
+/-
mouse, the Odam expression is lower on average than the wild-
type, but this difference is not statistically significant. Additional real-time PCR data using
primers for the enamel matrix proteins amelogenin and ameloblastin showed no change in the
expression of either (data not shown).

56

Figure 3.6: qPCR analysis of 9-day-old double mutant mice compared to wild-type (Panel
A) and Atp2b1
+/-
mice compared to wild-type (Panel B). * = p < 0.01. Panel A: while we
observe no significant change in expressed in the other known calcium transporters expressed
during amelogenesis (Serca2b is slightly upregulated in the mutant mouse compared to the wild-
type, but this difference is not significant), we observe a significant decrease in Odam (a marker
for maturation stage) expression compared wild-type. Enamelin (Enam), a marker for secretory
stage amelogenesis, shows no significant change, suggesting that the decrease in Odam is not
due to a delay in enamel maturation. We see a statistically insignificant downregulation of Odam
compared to Edam in the Atp2b1
+/-
mouse compared to the wild-type (Panel B).

DISCUSSION
Our observations of Atp2b1
+/-
, Atp2b4
-/-
, and Atp2b1
+/-
Atp2b4
-/-
mouse enamel show no ultimate
changes in the structure of fully mature enamel crystals, though some differences exist at the
genetic and tissue level. Our data is understandable given the knowledge that there are very few
diseases linked to PMCA1 and PMCA4, and the PMCA transporters are commonly believed to
*
A B P9 Atp2b1
+/-
Atp2b4
-/-
vs. WT qPCR
57
be more involved in fine-tuning cellular calcium handling. The PMCA1 and PMCA4
immunofluorescence data shows that the expression and localization of the PMCA1 and PMCA4
transporters are independent of each other, and therefore it is likely that they function
independent of each other. The expression and localization of active-Caspase3 shows that even
in the slight increase of apoptosis in the mutant animals, the additional loss of the ameloblasts
does not ultimately affect the forming enamel. Further studies would be needed to determine if
the enamel organ is replacing the lost ameloblasts and how the replacement process occurs.

Our real-time PCR data suggest that the PMCA transporters play a role in signaling that affects
the expression of Odam. Odam is typically expressed in the basal lamina at the junction between
the cell and the enamel area and is believed to be important in the attachment of the ameloblasts
to the enamel (Wazen et al. 2015) (Dos Santos Neves et al. 2012). Therefore, it is likely that
Odam deficiency causes the tendency of the Tomes’ processes to detach during tissue processing
in our mutant animals. The enlarged capillaries in the papillary layer of the mutant animals is
also to be noted, as the PMCA family is expressed in the papillary layer and a role of the
papillary layer is to shuttle calcium from the circulation to the ameloblasts. The PMCA
transporters are likely involved in this process, but it appears that they are not necessary for
transcellular calcium transport to occur. While our data demonstrate a connection between ion
transport and enamel protein expression, further studies would be needed to determine the
precise interplay of these functions. RNA-sequencing of these mutant mice could identify key
players that help the ameloblasts compensate for any lack or defect in the PMCA transporters
and could help determine the role of the PMCA transporters in other functions of ameloblasts
than calcium transport. Overall, our data support the hypothesis that the PMCA family of
58
calcium transporters are more involved in calcium homeostasis and calcium signaling than
mineralization (Brini et al. 2016; Strehler 2013).

CONCLUSION
Using various methods, we characterize the differences between Atp2b1
+/-
, Atp2b4
-/-
, and
Atp2b1
+/-
Atp2b4
-/-
mutant mice and their wild-type counterparts and conclude that knockouts of
PMCA1 and PMCA4, the primary PMCA transporters in amelogenesis, have little overall effect
on the formation of enamel. Any defect in the secretory stage caused by the lack of PMCA
transporters either has little effect on the ultimate structure of enamel or is rescued by the time
the enamel has matured. This study suggests enamel development proceeds as normal even
without the PMCA transporters to fine-tune calcium homeostasis, and demonstrates the
adaptability of the enamel organ.

59

CHAPTER 4
RNA-sequencing Identifies Key Isoforms of
Proteins Involved in Calcium Transport and
Homeostasis in Enamel Organ Cells

60
INTRODUCTION
The PMCA family of calcium transporters has numerous observed and potential spliced
isoforms, many of which differ in expression patterns and functions (Krebs 2009; Strehler 2013;
Strehler and Zacharias 2001). Using RNA-sequencing (RNA-seq) on the cervical loop, secretory
stage, and maturation stage populations of the enamel organ has the potential to not only identify
the PMCA isoforms most highly expressed in enamel, but also catalogue the whole
transcriptome of the enamel organ and identify many other genes and transcripts that have yet to
be studied in the enamel organ. In this study, we focus primarily on the various isoforms of the
known calcium transporters, additionally highlighting CACNA1C as a gene with a known
disease and enamel phenotype (Papineau and Wilson 2014; Splawski et al. 2005) that is
expressed more highly in the secretory stage than the cervical loop and maturation stages.

MATERIALS AND METHODS
RNA-extraction
The cervical loop, secretory stage, and maturation stage were dissected from the enamel organ of
five 100g Wistar Hannover rats as previously described (Chavez et al. 2014; Lacruz et al. 2012b;
Wen et al. 2015). RNA was extracted from each cell population using the miRNeasy Mini
extraction kit (catalogue #217004, Qiagen, Hilden, Germany). Concentrations of extracted RNA
were measured using a NanoDrop machine (Thermo Fisher Scientific, Waltham, MA, USA).
RNA-extraction was performed by Kaifeng Yin.

61
Library Construction and RNA-seq
cDNA libraries were developed from RNA samples with a RNA Integrity Number (RIN) of at
least 7. 25 million single-ended 75 bp reads were generated per sample on an Illumina
NextSeq500 sequencer (Illumina, Inc., San Diego, CA, USA). Library construction and RNA-
seq was performed by the University of Southern California Molecular Genomics Core.

Data Analysis
The rat rn6 genome was used from the HISAT2 page (Kim et al. 2015) and rn6 annotations from
the UCSC Table Browser (Karolchik et al. 2004) were added to the genome. Raw RNA-seq
reads were first uploaded to Partek Flow® (Copyright, Partek Inc. St. Louis, MO, USA). where
bases with poor Phred quality scores were trimmed. The trimmed reads were then added to a
pipeline using the HISAT2 alignment, StringTie transcriptome assembly (Pertea et al. 2015), and
Ballgown differential expression analysis (Frazee et al. 2015) as described (Pertea et al. 2016).
The HISAT2 parameters were tuned as described (Baruzzo et al. 2017)to improve alignment
accuracy, and aligned reads were processed using HOMER (Heinz et al. 2010) to input and
visualize on the UCSC Genome Browser Tracks (Kent et al. 2002). RNA-seq analysis flow is
shown in Figure 4.1. Principal component analysis (PCA) plot was generated using R and is
shown in Figure 4.2. A calcium transporter isoform heatmap was generated using R. The
fragments per kilobase of transcript per million mapped reads (FPKM) was used as a measure of
the relative expression of a transcript in our samples. Cut-offs for statistical significance were set
at a false discovery rate (q-value) < 0.05.
62

Figure 4.1: RNA-seq data analysis workflow.

Real-time PCR
cDNA was prepared from the RNA samples used in the RNA-seq experiment with the
PrimeScript
TM
1
st
strand DNA synthesis kit (Takara catalogue #6110A). Primers were designed
for Cacna1c (Forward primer: CGGCACCCTCTTACCTTT; Reverse primer:
AACCCATTAGGAACATTGAAAC) and beta actin (Actb, and real-time PCR reactions were
performed on a CFX96 TouchTM Real-Time PCR Detection System (Bio-Rad Life Sciences)
using iQ SYBR® Green Supermix (Bio-Rad Life Sciences). The Ct values were normalized to
Actb (Beta-actin). The DDCt method was used to calculate the fold changes in gene expression
between the mutants and their wild-type littermates. Two-tailed Student’s t-tests were used to
determine the significance (p < 0.05) of potential differences between the cervical loop, secretory
stage, and maturation stage cell populations.

63
Western Blot and Immunohistochemistry (IHC) Analysis
Western blots were performed using the method described previously (Robertson et al. 2017)
using enamel secretory stage and maturation stage protein samples from a 100g rat, using brain
as a positive control. Mandibular incisors were dissected from 9-day-old wild-type mice, fixed in
4% paraformaldehyde in PBS, and decalcified in 10% EDTA in PBS for four weeks. The
incisors were then embedded in paraffin wax and sectioned at 4 µm. Anti-Cav1.2 antibody
(Alomone Labs catalogue #ACC-003) was used at a dilution of 1/1000 for Western blot and
1/100 for IHC. Histostain-Plus IHC Kit, HRP, broad spectrum (Thermo Fisher Scientific,
catalogue #859043) was used for IHC.

RESULTS
Figure 4.2: PCA analysis shows
variance within and between all
stages of amelogenesis.
PCA plot was generated using R.
The PCA plot demonstrates the
uniqueness of each stage of
amelogenesis. Cervical loop,
secretory stage, and maturation
stage samples cluster neatly together
(with an exception of one outlier in
the secretory stage population).

-0.2
0.0
0.2
-0.2 0.0 0.2 0.4 0.6
PC1
PC2
cell_population
cervical_loop
maturation
secretory
64
Alternative splicing at splice site C near the C-terminus of PMCA1 and PMCA4 plays a
role in pump activation by calmodulin
Figure 4.3 shows an alignment of the RNA-seq reads to the rat genome in the UCSC Genome
Browser and compares the RNA-seq reads to the isoforms in the Refseq database. Atp2b1 and
Atp2b4 isoforms expressed in all stages of amelogenesis lack an exon just upstream of the C-
terminus, so the isoforms of Atp2b1 and Atp2b4 most likely expressed in amelogenesis
correspond to Refseq XM_006241296.3 for Atp2b1 and XM_008769446.2 and
XM_008769448.2 for Atp2b4. Further investigation reveals the presence or absence of this exon
is caused by alternative splicing at splice site C on the PMCA mRNA, and affects the rate of
calmodulin binding and channel activation. In humans, the isoform of PMCA4 that lacks the
exon (PMCA4b) binds more slowly to calmodulin and therefore more capable of slow activation
by calmodulin and causing delayed removal of intracellular calcium(Caride et al. 2001a; Caride
et al. 2001b).
65

Figure 4.3: Alignment of reads with rn6 genome identifies calcium transporter isoforms most likely
expressed during amelogenesis (red box). Aligned HISAT2 reads were converted using HOMER and
uploaded to a UCSC Genome Browser session. We used Refseq data about each isoform to identify the
isoform most highly expressed during amelogenesis based on the expression of the exons on the track.
Atp2b1
Atp2b1
Atp2b4
Cacna1c
66
Surprisingly, the isoforms of Atp2b1 and Atp2b4 expressed during amelogenesis appear to be missing an
exon at the C-terminal end.

Numerous genes related to calcium signaling and handling are differentially expressed
during different stages of amelogenesis
Table 4.1 a-c shows a list of genes involved in calcium transport and signaling up- and down-
regulated during the cervical loop, secretory stage, and maturation stage. Our RNA-seq data
verified previous microarray data that identified Stim and Orai genes, many S100 calcium
binding genes, and Slc24a4 as significantly upregulated in the maturation stage compared to the
secretory stage (Lacruz et al. 2012a). While maturation stage calcium transport has been well-
documented, our data identifies many genes involved in calcium transport that are more highly
expressed in the secretory stage than the maturation stage, including S100a1, a S100 gene
upregulated in the secretory stage compared to the maturation stage almost two-fold. Many
calcium voltage-gated channel subunits (Cacna1c, Cacna1d, Cacnb2, Cacnb3, and Cacna2d1)
are all significantly upregulated in the secretory stage compared to the maturation stage. Itpr1, a
receptor for inositol 1,4,5-triphosphate (IP3) that mediates the release of ER calcium stores, is
upregulated 30-fold in secretory stage (FPKM = 199). Interestingly, Itpr2, another member of the
IP3 receptor family, is upregulated 2.5-fold in maturation stage (FPKM = 15). Itpr3 is the IP3
receptor family member most highly expressed during the maturation stage (FPKM = 73),
though it does not meet our cutoffs for statistical significance between the secretory and
maturation stages or cervical loop and maturation stages. Compared to the different number of
genes involved in cellular calcium handling in the secretory and maturation stage, relatively few
genes are significantly differentially expressed between the maturation stage and the cervical
loop. Cacna1e, another subunit of the calcium voltage-gated channel alpha 1, is significantly
67
differentially expressed in the cervical loop compared to both the secretory and maturation
stages. Atp2c1, a secretory pathway calcium transporter expressed on the Golgi membrane that
pumps calcium from the cytosol to the lumen of the Golgi, is differentially expressed in the
maturation stage compared to the cervical loop but not compared to the secretory stage. Many
genes related to calcium transport appear to be expressed during the cervical loop and maturation
stages but are transiently downregulated during the secretory stage, such as Cdh23, s100a4,
s100a6, s100a11, and Prckb, though some of these genes do not meet our cutoffs for differential
expression between the stages (Figure 4.4). Genes such as Atp2a2, Gja1 and Stim1 show a
gradual increase in expression from the cervical loop to the secretory stage to the maturation
stage. Ramp1, Slc24a3, Atp2b4, Cacna1c, Cacna1d, Cacna2d1, Cav1, Itpr1, Tmem165, and F2r
are uniquely upregulated during the secretory stage. The calcium mitochondrial uniporter (Mcu)
is expressed at relatively the same levels throughout amelogenesis; however, the mitochondrial
uniporter regulator 1 (Mcur) is significantly upregulated in the maturation stage compared to the
secretory stage, and is upregulated in the cervical loop compared to the secretory stage but does
not quite meet our cutoff for significance (Figure 4.4, q = 0.051).
68

69
Table 4.1: Fold changes of genes related to calcium transport between the secretory stage and
maturation stage, maturation stage and cervical loop, and secretory stage and cervical loop. q-value
for all comparisons is < 0.05. Fold changes were identified using Ballgown and the FPKM for each gene
and the tables organized by lowest q-value. As expected, genes such as Slc24a4 and Stim1 are highly
differentially expressed during the maturation stage and Atp2b1 and Apt2b4 are most highly expressed
during the secretory stage.

70

0.01 0.1 1 10 100 1000
F2rl1
F2r
Cxcl12
Coro1a
Cfl1
Cdh23
Ccr5
Ccr1
Cav1
Camk2g
Camk2d
Calm3
Calm2
Calm2
Calm1
Calcrl
Calb1
Cacnb3
Cacnb2
Cacna2d3
Cacna2d1
Cacna1g
Cacna1e
Cacna1d
Cacna1c
Cacna1b
Bcl2
Atp2c1
Atp2b4
Atp2b1
Atp2a2
Atp2a1
Anxa6
Average FPKM Cervical Loop Average FPKM Secretory Average FPKM Maturation
71
0.1 1 10 100 1000 10000
Ramp3
Ramp2
Ramp1
Pthlh
Pth1r
Psen2
Prkcb
Ppp3ca
Plcg1
Plcb3
Pkd2
Pkd1
Panx1
P2rx4
Orai3
Orai2
Orai1
Nfatc1
Micu2
Micu1
Mcur1
Mcu
Letm1
Kcnn4
Itpr3
Itpr2
Itpr1
Igf1
Gja4
Gja1
Average FPKM Cervical Loop Average FPKM Secretory Average FPKM Maturation
72

0.001 0.01 0.1 1 10 100 1000
Ywhae
Vdr
Vdac1
Trpv4
Trpm7
Trpm4
Trpm2
Tmem165
Stoml2
Stim2
Stim1
Sri
Sln
Slc8a3
Slc8a1
Slc25a23
Slc24a4
Slc24a3
Selenok
S100g
S100b
S100a9
S100a8
S100a6
S100a4
S100a16
S100a13
S100a11
S100a10
S100a1
Average FPKM Cervical Loop Average FPKM Secretory Average FPKM Maturation
73
Figure 4.4: Genes involved in calcium transport averaged across the cervical loop (n = 4, gray bars),
secretory stage (n = 5, orange bars), and maturation stage (n = 5, blue bars). Genes involved in
calcium transport were extracted from a list of all genes identified from our Ballgown analysis after
filtering out low-abundance genes. Many of the transporters in this list appear to upregualted in the
maturation stage and/or downregulated specifically during the secretory stage – many calcium transport-
related genes in this list show an average decrease in expression during the secretory stage, but their
expression levels during the cervical loop and maturation stage remain relatively constant.

CACNA1C (Ca
v
1.2) calcium channel causing Timothy Syndrome is upregulated in
secretory stage amelogenesis
Our RNA-seq data identified calcium channel subunit alpha 1 C (Cacna1c), encoding the L-type
voltage-gated calcium channel subunit Ca
v
1.2, as upregulated in secretory stage amelogenesis
(Figure 4.4). A mutation in this gene is known to cause Timothy Syndrome in humans, a rare
disorder that affects many parts of the body including the heart, fingers and toes, and the nervous
system. Additionally, the teeth of these patients are small and the enamel is cavity-prone
(Splawski et al. 2005). While the enamel phenotype has been documented in humans(Papineau
and Wilson 2014), the Cacna1c gene has yet to be studied in rodent enamel, likely because it is
expressed at a low level in the enamel (FPKM < 10 in all samples). Cacna1c is currently the only
known calcium transporter gene differentially expressed in the secretory stage that is related to a
defect in enamel. Cacna1c has numerous isoforms, and our alignment identified the two
isoforms most likely expressed in the enamel (Refseq XM_006237175.3 and XM_017592434.1)
(Figure 4.3). Real-time PCR data support RNA-seq data that Cacna1c is significantly more
highly expressed in the secretory stage than the maturation stage and cervical loop (Figure 4.5).
Western blot data confirm the upregulation of Ca
v
1.2 during the secretory stage compared to the
74
maturation stage. IHC in the developing mouse incisor show Ca
v
1.2 expressed on the apical
membrane of the early secretory, transitioning, and maturation stage ameloblasts, and expressed
primarily in the Tomes’ processes in the secretory stage ameloblasts.

Figure 4.5: qPCR (top left), Western blot (top right), and IHC (bottom) analysis of the
expression of Cacna1c (Ca
v
1.2). ** - p < 0.005, * p < 0.01. qPCR supports the data found in
RNA-seq, where the expression during the secretory stage is significantly upregulated during the
secretory (Sec) stage compared to the cervical loop (Cer) and maturation stage (Mat). The
Western blot data also confirms the upregulation of Ca
v
1.2 during the secretory stage (S)
comapared to maturation stage (M), where brain tissue (B) is used as a positive control. The IHC
0
0.001
0.002
0.003
0.004
0.005
0.006
0.007
0.008
0.009
Cer Sec Mat
Expression relative to Actb
** *
250 -
150 -

100 -

75 -

50 -

37 -

75
analysis suggests Ca
v
1.2 is expressed primarily on the apical membrane and in the Tomes’
processes of ameloblasts.

DISCUSSION
Isoforms of PMCA1 and PMCA4 expressed during amelogenesis are likely activated slowly
by calmodulin but may show prolonged activity
Our RNA-seq data highlight the importance of alternative splicing during amelogenesis, as
ameloblasts exhibit a preference for certain exons and spliced isoforms of many calcium
transporters. While PMCA transporters have increased activity with interaction with calmodulin,
alternative splicing at the C-terminus in PMCA1 and PMCA4 suggests that calmodulin binds
more slowly to the isoforms expressed during amelogenesis and dissociates more quickly (Caride
et al. 2007). Based on other studies done observing PMCA4 kinetics, this may also suggest that
the isoform of PMCA4 expressed during amelogenesis has a delayed activation but prolonged
activity in exporting calcium after an increase in intracellular calcium(Caride et al. 2001a; Caride
et al. 2007; Strehler et al. 2007). While calmodulin (Calm1) expression is downregulated during
the secretory stage, it is expressed throughout amelogenesis, so further studies are needed to
determine the importance of calmodulin during amelogenesis and its effect on the activity of the
PMCA isoforms expressed during amelogenesis.

Genes involved in calcium influx during the immune response are specifically up-regulated
during the maturation stage
We observed that relatively few genes related to calcium handling are more highly expressed
during the maturation stage than during the cervical loop, and the many of the genes identified in
76
our dataset have well-known roles in enamel formation, such as Slc24a4, Stim1, Stim2, and
Orai2 (Nurbaeva et al. 2015a; Nurbaeva et al. 2016; Nurbaeva et al. 2015b). Cacna1e is the one
calcium channel gene statistically significantly upregulated during the cervical loop, and this
subunit has been identified by its role in insulin release in the pancreas (Jing et al. 2005; Matsuda
et al. 2001). S100g, a s100 calcium binding protein, and Kcnn4, a member of a calcium-activated
potassium channel family, appear to be uniquely upregulated during the maturation stage. Many
of the ion channels significantly upregulated during the maturation stage of amelogenesis are
also crucial for the activation of T-cells during the immune response (Cahalan and Chandy 2009)
(Feske et al. 2010). The nonselective transient receptor potential channel Trpm4, Kcnn4, Orai1,
and Stim1 are all involved in the regulation of the plasma membrane potential and causing the
calcium influx characteristic of T-cell activation. Nuclear factor of activated T-cells 1 (Nfatc1), a
transcription factor involved in T-cell activation as the name suggests, is also significantly
upregulated during the maturation stage compared to the secretory stage but not significantly
differentially expressed between the cervical loop and secretory stage or maturation stage. Many
calcium transporters that remove calcium from the cytosol are also upregulated during the
maturation stage. The secretory pathway calcium transporter Atp2c1, which pumps calcium into
the lumen of the Golgi apparatus, is upregulated in the maturation stage and expressed at lower
levels in the cervical loop and secretory stages. While the mitochondrial uniporter Mcu is
expressed at similar levels throughout amelogenesis, Mcur is upregulated during the maturation
stage, likely indicating an increase in calcium import into the mitochondria. Atp2a2, which
encodes the protein Serca2, is the protein most highly involved in importing calcium back into
the ER and is also upregulated during the maturation stage. While further experiments are
77
required to confirm the activity of these proteins in the removal of calcium from the cytosol
during maturation stage, the RNA-seq data gives strong evidence at the level of gene expression.

The L-type voltage-gated calcium channels are expressed at low levels throughout
amelogenesis
RNA-seq is capable of identifying genes and transcripts expressed at low levels, most notably
the subunits of the L-type voltage-gated calcium channels Ca
v
1 and Ca
v
2. Our real-time PCR,
Western blot, and IHC data supports the RNA-seq data identifying Cacna1c as significantly
more highly expressed during the secretory stage than any other stage during amelogenesis,
which our RNA-seq data identified as having an FPKM of around 6. Cacna1c is currently the
only known calcium transporter expressed predominantly in the secretory stage with a tooth
phenotype in humans, and the isoforms most likely expressed in enamel are shown in Figure 4.2.
Various other subunits of these channels were shown as expressed at low levels but nonetheless
differentially expressed, but other experiments will be needed to understand the interplay of all
the subunits during enamel formation. Further studies could elucidate the role of calcium influx
through the Ca
v
1 and Ca
v
2 channels in the development of enamel and understand the cause of
small and cavity-prone teeth in Timothy Syndrome patients.

CONCLUSION
Our RNA-seq data quantifies changes in gene and mRNA expression between the cervical loop,
secretory, and maturation stages of amelogenesis. We focus on the differential expression of
molecules involved in calcium transport and homeostasis, and identify a few of these molecules
whose role has yet to be studied in enamel development.
78

CHAPTER 5
Perspectives on Calcium Transport
During Amelogenesis

79
DISCUSSION
In this thesis, we present data identifying calcium transporters involved primarily in secretory
stage amelogenesis: PMCA1, PMCA4, NCKX3, and Ca
v
1.2. Our data suggest that a select few
transporters highly expressed in the maturation stage directly shuttle calcium to the enamel area
to be incorporated into hydroxyapatite (Hap) crystals. Most calcium transporters and other
proteins involved in calcium transport are differentially expressed during the secretory stage and
likely contribute to calcium signaling and overall ion homeostasis in the cell. Our data highlight
the multiplicity of calcium to not only be a major signaling molecule necessary in the
progression of amelogenesis but also a major component of the rapidly grown and highly
organized enamel mineral. Amelogenesis is a highly fine-tuned and controlled process, and our
Atp2b1 and Atp2b4 mutant mouse data shows that enamel can develop normally despite some
minor structural defects in the papillary layer (and apparent changes in Odam expression) caused
by the absence of the catalytic effects of PMCA1 and PMCA4. The downregulation of Odam
expression and upregulation of apoptosis in the double mutant mouse suggests the catalytic
effects of PMCA1 and PMCA4 play a role in signaling. Because the Atp2b1
+/-
and Atp2b4
-/-
mice
showed no change in Odam expression, it is likely that PMCA1 and PMCA4 have similar
functions, where each transporter can make up for a defect in the other. Future studies would also
be needed to determine the effect of enlarged capillaries on papillary layer function.

Our RNA-seq data give some clues as to which proteins are most likely involved in the
transcellular transport of calcium during each stage of amelogenesis. Regulation of calcium
homeostasis during the cervical loop stage shares many similarities to the maturation, where
most differences in gene expression can be explained by a direct link to maturation stage
80
mineralization. Many low-abundance but significant genes, such as the subunits of Ca
v
1 and
Ca
v
2, were identified by the RNA-seq data. It also identified the primary isoforms of a variety of
genes involved in calcium transport and homeostasis expressed in the enamel organ, which gives
clues into the function of those proteins during amelogenesis.

Secretory stage calcium regulation likely involves Anxa6 (Annexin VI), a calcium-dependent
membrane and phospholipid binding protein involved in exocytotic and endocytotic pathways
(Enrich et al. 2017). Itpr1 exports calcium from the ER to the cytosol. The L-type calcium
channel causes calcium influx from outside the cell, and further studies could explain how
defects in the subunit Cacna1c cause defects in enamel. Slc8a3 exports calcium from the cytosol
out into the extracellular space in exchange for sodium, and Atp2b1 and Atp2b4 also mediate
some calcium export out of the cell. The isoforms of Atp2b1 and Atp2b4 expressed throughout
amelogenesis are likely to bind slowly to calmodulin and are activated slowly, therefore it takes
more time for these isoforms to remove intracellular calcium than other isoforms of Atp2b1 and
Atp2b4 (Caride et al. 2007). This slow removal of intracellular calcium may allow for prolonged
intracellular calcium signaling in the secretory stage enamel organ.

Maturation stage calcium transport shows similarities with calcium transport involved in T-cell
activation during the immune response. Slc24a4 likely mediates the bulk of calcium transport
used in enamel crystal development, as mutations in this gene have been known to cause
amelogenesis imperfecta (Wang et al. 2014) (Herzog et al. 2015). The CRAC channel composed
of Stim and Orai proteins induces calcium influx into the cytosol from the extracellular space.
81
Itpr3 and Itpr2 release calcium from the ER stores out into the cytosol. Mcu, Atp2c1, and Atp2b2
sequester calcium into the mitochondria, Golgi apparatus, and ER, respectively.

Future studies could identify the interplay of many of these transporters and their regulators.
STIM1 has been shown to deactivate Ca
v
1.2 and activate ORAI1 (Park et al. 2010; Wang et al.
2001). Ramp1, which is highly expressed during the secretory stage, and Ramp2, differentially
expressed during the maturation stage, are increase cyclic AMP (cAMP) production by their
association with the calcitonin receptor-like receptor (CLR) (Barwell et al. 2012). Our RNA-seq
data identify the presence of the mitochondrial uniporter (Mcu) and many of its regulators
(Mcur1, Slc25a3, Micu1, Micu2) (De Stefani et al. 2016) during amelogenesis, but the activity of
the mitochondrial uniporter and its regulators has yet to be studied in amelogenesis.

CONCLUSION
This thesis provides novel insights into the expression and localization of calcium transporters
involved primarily during the secretory stage of amelogenesis, namely PMCA1, PMCA4,
NCKX3, and Ca
v
1.2. We discuss prior understanding of transcellular calcium transport
throughout amelogenesis, but most of the studies up to this point focus on maturation stage
calcium transport, when the bulk of calcium transported is directly incorporated into the enamel
crystals. We also provide novel data on different genes and isoforms differentially expressed in
all stages of amelogenesis. This thesis aims to broaden the current understanding of transcellular
calcium transport in ameloblasts and allow future studies to continue to build on the knowledge
provided here.

82
References
Arquitt CK, Boyd C, Wright JT. 2002. Cystic fibrosis transmembrane regulator gene (cftr) is
associated with abnormal enamel formation. J Dent Res. 81(7):492-496.
Baruzzo G, Hayer KE, Kim EJ, Di Camillo B, FitzGerald GA, Grant GR. 2017. Simulation-
based comprehensive benchmarking of rna-seq aligners. Nat Methods. 14(2):135-139.
Barwell J, Wootten D, Simms J, Hay DL, Poyner DR. 2012. Ramps and cgrp receptors. Adv Exp
Med Biol. 744:13-24.
Bawden JW. 1989. Calcium transport during mineralization. The Anatomical Record. 224:226-
233.
Bertini E, des Portes V, Zanni G, Santorelli F, Dionisi-Vici C, Vicari S, Fariello G, Chelly J.
2000. X-linked congenital ataxia: A clinical and genetic study. Am J Med Genet.
92(1):53-56.
Blair HC, Robinson LJ, Huang CL, Sun L, Friedman PA, Schlesinger PH, Zaidi M. 2011.
Calcium and bone disease. Biofactors. 37(3):159-167.
Borke JL, Zaki AE, Eisenmann DR, Ashrafi SH, Ashrafi SS, Penniston JT. 1993. Expression of
plasma membrane ca++ pump epitopes parallels the progression of enamel and dentin
mineralization in rat incisor. J Histochem Cytochem. 41(2):175-181.
Borke JL, Zaki AE, Eisenmann DR, Ashrafi SH, Sharawy MM, Rahman SS. 1995. In situ
hybridization and monoclonal antibody analysis of plasma membrane ca-pump mrna and
protein in submandibular glands of rabbit, rat and man. Scanning Microsc. 9(3):817-823;
discussion 723-814.
Bortolozzi M, Brini M, Parkinson N, Crispino G, Scimemi P, De Siati RD, Di Leva F, Parker A,
Ortolano S, Arslan E et al. 2010. The novel pmca2 pump mutation tommy impairs
83
cytosolic calcium clearance in hair cells and links to deafness in mice. J Biol Chem.
285(48):37693-37703.
Brini M. 2009. Plasma membrane ca(2+)-atpase: From a housekeeping function to a versatile
signaling role. Pflugers Arch. 257(3):657-664.
Brini M, Cali T, Ottolini D, Carafoli E. 2013. The plasma membrane calcium pump in health and
disease. FEBS J. 280(21):5385-5397.
Brini M, Carafoli E. 2011. The plasma membrane ca(2)+ atpase and the plasma membrane
sodium calcium exchanger cooperate in the regulation of cell calcium. Cold Spring Harb
Perspect Biol. 3(2).
Brini M, Carafoli E, Cali T. 2016. The plasma membrane calcium pumps: Focus on the role in
(neuro)pathology. Biochem Biophys Res Commun.
Brini M, Carafoli E, Cali T. 2017. The plasma membrane calcium pumps: Focus on the role in
(neuro)pathology. Biochem Biophys Res Commun. 483(4):1116-1124.
Bronckers A, Kalogeraki L, Jorna HJ, Wilke M, Bervoets TJ, Lyaruu DM, Zandieh-Doulabi B,
Denbesten P, de Jonge H. 2010. The cystic fibrosis transmembrane conductance regulator
(cftr) is expressed in maturation stage ameloblasts, odontoblasts and bone cells. Bone.
46(4):1188-1196.
Bronckers AL, Lyaruu D, Jalali R, Medina JF, Zandieh-Doulabi B, DenBesten PK. 2015.
Ameloblast modulation and transport of cl(-), na(+), and k(+) during amelogenesis. J
Dent Res. 94(12):1740-1747.
Cahalan MD, Chandy KG. 2009. The functional network of ion channels in t lymphocytes.
Immunol Rev. 231(1):59-87.
84
Cai X, Lytton J. 2004. Molecular cloning of a sixth member of the k+-dependent na+/ca2+
exchanger gene family, nckx6. J Biol Chem. 279(7):5867-5876.
Caride AJ, Filoteo AG, Penheiter AR, Paszty K, Enyedi A, Penniston JT. 2001a. Delayed
activation of the plasma membrane calcium pump by a sudden increase in ca2+: Fast
pumps reside in fast cells. Cell Calcium. 30(1):49-57.
Caride AJ, Filoteo AG, Penniston JT, Strehler EE. 2007. The plasma membrane ca2+ pump
isoform 4a differs from isoform 4b in the mechanism of calmodulin binding and
activation kinetics: Implications for ca2+ signaling. J Biol Chem. 282(35):25640-25648.
Caride AJ, Penheiter AR, Filoteo AG, Bajzer Z, Enyedi A, Penniston JT. 2001b. The plasma
membrane calcium pump displays memory of past calcium spikes. Differences between
isoforms 2b and 4b. J Biol Chem. 276(43):39797-39804.
Chavez MG, Hu J, Seidel K, Li C, Jheon A, Naveau A, Horst O, Klein OD. 2014. Isolation and
culture of dental epithelial stem cells from the adult mouse incisor. J Vis Exp. (87).
Curry MC, Luk NA, Kenny PA, Roberts-Thomson SJ, Monteith GR. 2012. Distinct regulation of
cytoplasmic calcium signals and cell death pathways by different plasma membrane
calcium atpase isoforms in mda-mb-231 breast cancer cells. J Biol Chem. 287(34):28598-
28608.
Curry MC, Roberts-Thomson SJ, Monteith GR. 2011. Plasma membrane calcium atpases and
cancer. Biofactors. 37(3):132-138.
De Stefani D, Rizzuto R, Pozzan T. 2016. Enjoy the trip: Calcium in mitochondria back and
forth. Annu Rev Biochem. 85:161-192.
85
Dos Santos Neves J, Wazen RM, Kuroda S, Francis Zalzal S, Moffatt P, Nanci A. 2012.
Odontogenic ameloblast-associated and amelotin are novel basal lamina components.
Histochem Cell Biol. 137(3):329-338.
Enrich C, Rentero C, Grewal T. 2017. Annexin a6 in the liver: From the endocytic compartment
to cellular physiology. Biochim Biophys Acta. 1864(6):933-946.
Enyedi A, Verma AK, Heim R, Adamo HP, Filoteo AG, Strehler EE, Penniston JT. 1994. The
ca2+ affinity of the plasma-membrane ca2+ pump is controlled by alternative splicing. J
Biol Chem. 269(1):41-43.
Fausser JL, Schlepp O, Aberdam D, Meneguzzi G, Ruch JV, Lesot H. 1998. Localization of
antigens associated with adherens junctions, desmosomes, and hemidesmosomes during
murine molar morphogenesis. Differentiation. 63(1):1-11.
Feske S, Picard C, Fischer A. 2010. Immunodeficiency due to mutations in orai1 and stim1. Clin
Immunol. 135(2):169-182.
Franklin IK, Winz RA, Hubbard MJ. 2001. Endoplasmic reticulum ca2+-atpase pump is up-
regulated in calcium-transporting dental enamel cells: A non-housekeeping role for
serca2b. Biochem J. 358(Pt 1):217-224.
Frazee AC, Pertea G, Jaffe AE, Langmead B, Salzberg SL, Leek JT. 2015. Ballgown bridges the
gap between transcriptome assembly and expression analysis. Nat Biotechnol. 33(3):243-
246.
Giacomello M, De Mario A, Scarlatti C, Primerano S, Carafoli E. 2013. Plasma membrane
calcium atpases and related disorders. Int J Biochem Cell Biol. 45(3):753-762.
Hamada H, Petrino MG, Kakunaga T. 1982. Molecular structure and evolutionary origin of
human cardiac muscle actin gene. Proc Natl Acad Sci U S A. 79(19):5901-5905.
86
Hanawa M, Takano Y, Wakita M. 1990. An autoradiographic study of calcium movement in the
enamel organ of rat molar tooth germs. Arch Oral Biol. 35(11):899-906.
Heinz S, Benner C, Spann N, Bertolino E, Lin YC, Laslo P, Cheng JX, Murre C, Singh H, Glass
CK. 2010. Simple combinations of lineage-determining transcription factors prime cis-
regulatory elements required for macrophage and b cell identities. Mol Cell. 38(4):576-
589.
Herzog CR, Reid BM, Seymen F, Koruyucu M, Tuna EB, Simmer JP, Hu JC. 2015.
Hypomaturation amelogenesis imperfecta caused by a novel slc24a4 mutation. Oral Surg
Oral Med Oral Pathol Oral Radiol. 119(2):e77-81.
Hilfiker H, Guerini D, Carafoli E. 1994. Cloning and expression of isoform-2 of the human
plasma-membrane ca2+ atpase - functional-properties of the enzyme and its splicing
products. J Biol Chem. 269(42):26178-26183.
Ho PW, Pang SY, Li M, Tse ZH, Kung MH, Sham PC, Ho SL. 2015. Pmca4 (atp2b4) mutation
in familial spastic paraplegia causes delay in intracellular calcium extrusion. Brain
Behav. 5(4):e00321.
Hu JC, Chun YH, Al Hazzazzi T, Simmer JP. 2007. Enamel formation and amelogenesis
imperfecta. Cells Tissues Organs. 186(1):78-85.
Hu P, Lacruz RS, Smith CE, Smith SM, Kurtz I, Paine ML. 2012. Expression of the
sodium/calcium/potassium exchanger, nckx4, in ameloblasts. Cells Tissues Organs.
196(6):501-509.
Hubbard MJ. 1996. Articular debridement versus washout for degeneration of the medial femoral
condyle. A five-year study. J Bone Joint Surg Br. 78(2):217-219.
87
Hubbard MJ. 2000. Calcium transport across the dental enamel epithelium. Crit Rev Oral Biol
Med. 11(4):437-466.
Hubbard MJ, McHugh NJ, Mangum JE. 2011. Exclusion of all three calbindins from a calcium-
ferry role in rat enamel cells. Eur J Oral Sci. 119 Suppl 1:112-119.
Inai T, Nakamura K, Kurisu K, Shibata Y. 1997. Immunohistochemical localization of
connexin43 in the enamel organ of the rat upper incisor during ameloblast development.
Arch Histol Cytol. 60(3):297-306.
Jalloul AH, Rogasevskaia TP, Szerencsei RT, Schnetkamp PP. 2016a. A functional study of
mutations in k+-dependent na+-ca2+ exchangers associated with amelogenesis
imperfecta and non-syndromic oculocutaneous albinism. J Biol Chem. 291(25):13113-
13123.
Jalloul AH, Szerencsei RT, Schnetkamp PP. 2016b. Cation dependencies and turnover rates of
the human k⁺-dependent na⁺-ca²⁺ exchangers nckx1, nckx2, nckx3 and nckx4. Cell
Calcium. 59(1):1-11.
Jheon AH, Mostowfi P, Snead ML, Ihrie RA, Sone E, Pramparo T, Attardi LD, Klein OD. 2011.
Perp regulates enamel formation via effects on cell-cell adhesion and gene expression. J
Cell Sci. 124(Pt 5):745-754.
Jing X, Li DQ, Olofsson CS, Salehi A, Surve VV, Caballero J, Ivarsson R, Lundquist I,
Pereverzev A, Schneider T et al. 2005. Cav2.3 calcium channels control second-phase
insulin release. J Clin Invest. 115(1):146-154.
Josephsen K, Takano Y, Frische S, Praetorius J, Nielsen S, Aoba T, Fejerskov O. 2010. Ion
transporters in secretory and cyclically modulating ameloblasts. A new hypothesis for
cellular control of preeruptive enamel maturation. Am J Physiol Cell Physiol.
88
Karolchik D, Hinrichs AS, Furey TS, Roskin KM, Sugnet CW, Haussler D, Kent WJ. 2004. The
ucsc table browser data retrieval tool. Nucleic Acids Res. 32(Database issue):D493-496.
Kawamoto T, Shimizu M. 1990. Changes in the mode of calcium and phosphate transport during
rat incisal enamel formation. Calcif Tissue Int. 46(6):406-414.
Kent WJ, Sugnet CW, Furey TS, Roskin KM, Pringle TH, Zahler AM, Haussler D. 2002. The
human genome browser at ucsc. Genome Res. 12(6):996-1006.
Khananshvili D. 2013. The slc8 gene family of sodium-calcium exchangers (ncx) - structure,
function, and regulation in health and disease. Mol Aspects Med. 34(2-3):220-235.
Kim D, Langmead B, Salzberg SL. 2015. Hisat: A fast spliced aligner with low memory
requirements. Nat Methods. 12(4):357-360.
Kim HJ, Prasad V, Hyung SW, Lee ZH, Lee SW, Bhargava A, Pearce D, Lee Y, Kim HH. 2012.
Plasma membrane calcium atpase regulates bone mass by fine-tuning osteoclast
differentiation and survival. J Cell Biol. 199(7):1145-1158.
Kondo S, Tamura Y, Bawden JW, Tanase S. 2001. The immunohistochemical localization of bax
and bcl-2 and their relation to apoptosis during amelogenesis in developing rat molars.
Arch Oral Biol. 46(6):557-568.
Krebs J. 2009. The influence of calcium signaling on the regulation of alternative splicing.
Biochim Biophys Acta. 1793(6):979-984.
Lacruz RS, Feske S. 2015. Diseases caused by mutations in orai1 and stim1. Ann N Y Acad Sci.
1356(1):45-79.
Lacruz RS, Smith CE, Bringasjr P, Chen YB, Smith SM, Snead ML, Kurtz I, Hacia JG, Hubbard
MJ, Paine ML. 2012a. Identification of novel candidate genes involved in mineralization
of dental enamel by genome-wide transcript profiling. J Cell Physiol. 227(5):2264-2275.
89
Lacruz RS, Smith CE, Kurtz I, Hubbard MJ, Paine ML. 2013. New paradigms on the transport
functions of maturation-stage ameloblasts. J Dent Res. 92(2):122-129.
Lacruz RS, Smith CE, Moffatt P, Chang EH, Bromage TG, Bringas P, Jr., Nanci A, Baniwal SK,
Zabner J, Welsh MJ et al. 2012b. Requirements for ion and solute transport, and ph
regulation during enamel maturation. J Cell Physiol. 227(4):1776-1785.
Lavrik IN, Golks A, Krammer PH. 2005. Caspases: Pharmacological manipulation of cell death.
J Clin Invest. 115(10):2665-2672.
Lee GS, Choi KC, Jeung EB. 2009. K+-dependent na+/ca2+ exchanger 3 is involved in renal
active calcium transport and is differentially expressed in the mouse kidney. Am J
Physiol Renal Physiol. 297(2):F371-379.
Lee KH, Ho WK, Lee SH. 2013. Endocytosis of somatodendritic nckx2 is regulated by src
family kinase-dependent tyrosine phosphorylation. Front Cell Neurosci. 7:14.
Lyaruu DM, Bronckers AL, Mulder L, Mardones P, Medina JF, Kellokumpu S, Oude Elferink
RP, Everts V. 2008. The anion exchanger ae2 is required for enamel maturation in mouse
teeth. Matrix Biol. 27(2):119-127.
Lytton J. 2007. Na+/ca2+ exchangers: Three mammalian gene families control ca2+ transport.
Biochem J. 406(3):365-382.
Matsuda Y, Saegusa H, Zong S, Noda T, Tanabe T. 2001. Mice lacking ca(v)2.3 (alpha1e)
calcium channel exhibit hyperglycemia. Biochem Biophys Res Commun. 289(4):791-
795.
McKee MD, Warshawsky H, Nanci A. 1987. Use of backscattered electron imaging on
developed radioautographic emulsions, application to viewing rat incisor enamel
maturation following 45calcium injection. J Electron Microsc Tech. 5:357-365.
90
Mondal M, Sengupta M, Samanta S, Sil A, Ray K. 2012. Molecular basis of albinism in india:
Evaluation of seven potential candidate genes and some new findings. Gene. 511(2):470-
474.
Moran RA, Deaton TG, Bawden JW. 1995. Problems associated with estimation of net calcium
uptake during enamel formation using 45ca. J Dent Res. 74(2):698-701.
Mornstad H. 1978. Calcium-stimulated atpase activity in homogenates of the secretory enamel
organ in the rat. Scand J Dent Res. 86(1):1-11.
Munhoz CO, Leblond CP. 1974. Deposition of calcium phosphate into dentin and enamel as
shown by radioautography of sections of incisor teeth following injection of 45ca into
rats. Calcif Tissue Res. 15(3):221-235.
Nurbaeva MK, Eckstein M, Concepcion AR, Smith CE, Srikanth S, Paine ML, Gwack Y,
Hubbard MJ, Feske S, Lacruz RS. 2015a. Dental enamel cells express functional soce
channels. Sci Rep. 5:15803.
Nurbaeva MK, Eckstein M, Feske S, Lacruz RS. 2016. Ca2+ transport and signalling in enamel
cells. J Physiol.
Nurbaeva MK, Eckstein M, Snead ML, Feske S, Lacruz RS. 2015b. Store-operated ca2+ entry
modulates the expression of enamel genes. J Dent Res. 94(10):1471-1477.
Oceandy D, Stanley PJ, Cartwright EJ, Neyses L. 2007. The regulatory function of plasma-
membrane ca(2+)-atpase (pmca) in the heart. Biochem Soc Trans. 35(Pt 5):927-930.
Okumura R, Shibukawa Y, Muramatsu T, Hashimoto S, Nakagawa K, Tazaki M, Shimono M.
2010. Sodium-calcium exchangers in rat ameloblasts. J Pharmacol Sci. 112(2):223-230.
Okunade GW, Miller ML, Pyne GJ, Sutliff RL, O'Connor KT, Neumann JC, Andringa A, Miller
DA, Prasad V, Doetschman T et al. 2004. Targeted ablation of plasma membrane ca2+-
91
atpase (pmca) 1 and 4 indicates a major housekeeping function for pmca1 and a critical
role in hyperactivated sperm motility and male fertility for pmca4. J Biol Chem.
279(32):33742-33750.
Orrenius S, Gogvadze V, Zhivotovsky B. 2015. Calcium and mitochondria in the regulation of
cell death. Biochem Biophys Res Commun. 460(1):72-81.
Paine ML, Wang HJ, Abuladze N, Liu W, Wall S, Kim YH, Kurtz I. 2007. Expression of ae2
and nbc1 in secretory ameloblasts. Experimental Biology annual meeting in Washington,
DC, April 28-May 2, 2007.
Palmgren MG, Nissen P. 2011. P-type atpases. Annu Rev Biophys. 40:243-266.
Papineau SD, Wilson S. 2014. Dentition abnormalities in a timothy syndrome patient with a
novel genetic mutation: A case report. Pediatr Dent. 36(3):245-249.
Park CY, Shcheglovitov A, Dolmetsch R. 2010. The crac channel activator stim1 binds and
inhibits l-type voltage-gated calcium channels. Science. 330(6000):101-105.
Parry DA, Poulter JA, Logan CV, Brookes SJ, Jafri H, Ferguson CH, Anwari BM, Rashid Y,
Zhao H, Johnson CA et al. 2013. Identification of mutations in slc24a4, encoding a
potassium-dependent sodium/calcium exchanger, as a cause of amelogenesis imperfecta.
Am J Hum Genet. 92(2):307-312.
Penniston JT, Padanyi R, Paszty K, Varga K, Hegedus L, Enyedi A. 2014. Apart from its known
function, the plasma membrane ca(2)(+)atpase can regulate ca(2)(+) signaling by
controlling phosphatidylinositol 4,5-bisphosphate levels. J Cell Sci. 127(Pt 1):72-84.
Pertea M, Kim D, Pertea GM, Leek JT, Salzberg SL. 2016. Transcript-level expression analysis
of rna-seq experiments with hisat, stringtie and ballgown. Nat Protoc. 11(9):1650-1667.
92
Pertea M, Pertea GM, Antonescu CM, Chang TC, Mendell JT, Salzberg SL. 2015. Stringtie
enables improved reconstruction of a transcriptome from rna-seq reads. Nat Biotechnol.
33(3):290-295.
Pinero GJ, Parker S, Rundus V, Hertzberg EL, Minkoff R. 1994. Immunolocalization of
connexin 43 in the tooth germ of the neonatal rat. Histochem J. 26(10):765-770.
Prasad V, Okunade G, Liu L, Paul RJ, Shull GE. 2007. Distinct phenotypes among plasma
membrane ca2+-atpase knockout mice. Ann N Y Acad Sci. 1099:276-286.
Reith EJ, Boyde A. 1981. Autoradiographic evidence of cyclical entry of calcium into maturing
enamel of the rat incisor tooth. Arch Oral Biol. 26(12):983-987.
Reith EJ, Schmid MI, Boyde A. 1984. Rapid uptake of calcium in maturing enamel of the rat
incisor. Histochemistry. 80(4):409-410.
Riazuddin SA, Shahzadi A, Zeitz C, Ahmed ZM, Ayyagari R, Chavali VR, Ponferrada VG,
Audo I, Michiels C, Lancelot ME et al. 2010. A mutation in slc24a1 implicated in
autosomal-recessive congenital stationary night blindness. Am J Hum Genet. 87(4):523-
531.
Robertson SYT, Wen X, Yin K, Chen J, Smith CE, Paine ML. 2017. Multiple calcium export
exchangers and pumps are a prominent feature of enamel organ cells. Front Physiol.
8:336.
Sasaki T, Garant PR. 1986. Ultracytochemical demonstration of atp-dependent calcium pump in
ameloblasts of rat incisor enamel organ. Calcif Tissue Int. 39(2):86-96.
Sasaki T, Segawa K, Takiguchi R, Higashi S. 1984. Intercellular junctions in the cells of the
human enamel organ as revealed by freeze-fracture. Arch Oral Biol. 29(4):275-286.
93
Schneider CA, Rasband WS, Eliceiri KW. 2012. Nih image to imagej: 25 years of image
analysis. Nat Methods. 9(7):671-675.
Schnetkamp PP. 2004. The slc24 na+/ca2+-k+ exchanger family: Vision and beyond. Pflugers
Arch. 447(5):683-688.
Seymen F, Lee KE, Tran Le CG, Yildirim M, Gencay K, Lee ZH, Kim JW. 2014. Exonal
deletion of slc24a4 causes hypomaturation amelogenesis imperfecta. J Dent Res.
93(4):366-370.
Sharma V, O'Halloran DM. 2014. Recent structural and functional insights into the family of
sodium calcium exchangers. Genesis. 52(2):93-109.
Shibata S, Suzuki S, Tengan T, Yamashita Y. 1995. A histochemical study of apoptosis in the
reduced ameloblasts of erupting mouse molars. Arch Oral Biol. 40:677-680.
Shumilina E, Xuan NT, Matzner N, Bhandaru M, Zemtsova IM, Lang F. 2010. Regulation of
calcium signaling in dendritic cells by 1,25-dihydroxyvitamin d3. FASEB J. 24(6):1989-
1996.
Skobe Z. 2006. Sem evidence that one ameloblast secretes one keyhole-shaped enamel rod in
monkey teeth. Eur J Oral Sci. 114((Suppl. 1)):338-342.
Smith CE. 1998. Cellular and chemical events during enamel maturation. Crit Rev Oral Biol
Med. 9:128-161.
Sokolow S, Manto M, Gailly P, Molgo J, Vandebrouck C, Vanderwinden JM, Herchuelz A,
Schurmans S. 2004. Impaired neuromuscular transmission and skeletal muscle fiber
necrosis in mice lacking na/ca exchanger 3. J Clin Invest. 113(2):265-273.
94
Splawski I, Timothy KW, Decher N, Kumar P, Sachse FB, Beggs AH, Sanguinetti MC, Keating
MT. 2005. Severe arrhythmia disorder caused by cardiac l-type calcium channel
mutations. Proc Natl Acad Sci U S A. 102(23):8089-8096; discussion 8086-8088.
Stephan AB, Tobochnik S, Dibattista M, Wall CM, Reisert J, Zhao H. 2011. The na(+)/ca(2+)
exchanger nckx4 governs termination and adaptation of the mammalian olfactory
response. Nat Neurosci. 15(1):131-137.
Street VA, McKee-Johnson JW, Fonseca RC, Tempel BL, Noben-Trauth K. 1998. Mutations in
a plasma membrane ca2+-atpase gene cause deafness in deafwaddler mice. Nat Genet.
19(4):390-394.
Strehler EE. 2013. Plasma membrane calcium atpases as novel candidates for therapeutic agent
development. J Pharm Pharm Sci. 16(2):190-206.
Strehler EE, Caride AJ, Filoteo AG, Xiong Y, Penniston JT, Enyedi A. 2007. Plasma membrane
ca2+ atpases as dynamic regulators of cellular calcium handling. Ann N Y Acad Sci.
1099:226-236.
Strehler EE, Zacharias DA. 2001. Role of alternative splicing in generating isoform diversity
among plasma membrane calcium pumps. Physiol Rev. 81(1):21-50.
Tsuchiya M, Sharma R, Tye CE, Sugiyama T, Bartlett JD. 2009. Transforming growth factor-
beta1 expression is up-regulated in maturation-stage enamel organ and may induce
ameloblast apoptosis. Eur J Oral Sci. 117(2):105-112.
Turnbull CI, Looi K, Mangum JE, Meyer M, Sayer RJ, Hubbard MJ. 2004. Calbindin
independence of calcium transport in developing teeth contradicts the calcium ferry
dogma. J Biol Chem. 279(53):55850-55854.
95
Uchida T, McKee MD, Warshawsky H. 1987. A radioautographic study of the effects of
vinblastine on the fate of injected 45calcium and [125i]-insulin in the rat incisor. Arch
Oral Biol. 32(6):433-437.
Vinberg F, Wang T, Molday RS, Chen J, Kefalov VJ. 2015. A new mouse model for stationary
night blindness with mutant slc24a1 explains the pathophysiology of the associated
human disease. Hum Mol Genet. 24(20):5915-5929.
Wakimoto K, Kobayashi K, Kuro OM, Yao A, Iwamoto T, Yanaka N, Kita S, Nishida A, Azuma
S, Toyoda Y et al. 2000. Targeted disruption of na+/ca2+ exchanger gene leads to
cardiomyocyte apoptosis and defects in heartbeat. J Biol Chem. 275(47):36991-36998.
Wang S, Choi M, Richardson AS, Reid BM, Seymen F, Yildirim M, Tuna E, Gencay K, Simmer
JP, Hu JC. 2014. Stim1 and slc24a4 are critical for enamel maturation. J Dent Res. 93(7
Suppl):94S-100S.
Wang SQ, Song LS, Lakatta EG, Cheng H. 2001. Ca2+ signalling between single l-type ca2+
channels and ryanodine receptors in heart cells. Nature. 410(6828):592-596.
Wazen RM, Moffatt P, Ponce KJ, Kuroda S, Nishio C, Nanci A. 2015. Inactivation of the
odontogenic ameloblast-associated gene affects the integrity of the junctional epithelium
and gingival healing. Eur Cell Mater. 30:187-199.
Wei AH, Zang DJ, Zhang Z, Liu XZ, He X, Yang L, Wang Y, Zhou ZY, Zhang MR, Dai LL et
al. 2013. Exome sequencing identifies slc24a5 as a candidate gene for nonsyndromic
oculocutaneous albinism. J Invest Dermatol. 133(7):1834-1840.
Wen X, Lacruz RS, Paine ML. 2015. Dental and cranial pathologies in mice lacking the cl(-)
/h(+) -exchanger clc-7. Anat Rec (Hoboken). 298(8):1502-1508.
96
Yang H, Kim TH, Lee HH, Choi KC, Jeung EB. 2011. Distinct expression of the calcium
exchangers, nckx3 and ncx1, and their regulation by steroid in the human endometrium
during the menstrual cycle. Reprod Sci. 18(6):577-585.
Yin K, Lei Y, Wen X, Lacruz RS, Soleimani M, Kurtz I, Snead ML, White SN, Paine ML. 2015.
Slc26a gene family participate in ph regulation during enamel maturation. PLoS One.
10(12):e0144703.
Zacharias DA, Kappen C. 1999. Developmental expression of the four plasma membrane
calcium atpase (pmca) genes in the mouse. Biochim Biophys Acta. 1428(2-3):397-405.
Zaki AE, Hand AR, Mednieks MI, Eisenmann DR, Borke JL. 1996. Quantitative
immunocytochemistry of ca(2+)-mg2+ atpase in ameloblasts associated with enamel
secretion and maturation in the rat incisor. Adv Dent Res. 10(2):245-251.
Zanni G, Cali T, Kalscheuer VM, Ottolini D, Barresi S, Lebrun N, Montecchi-Palazzi L, Hu H,
Chelly J, Bertini E et al. 2012. Mutation of plasma membrane ca2+ atpase isoform 3 in a
family with x-linked congenital cerebellar ataxia impairs ca2+ homeostasis. Proc Natl
Acad Sci U S A. 109(36):14514-14519.
Zhekova HR, Zhao C, Schnetkamp PP, Noskov SY. 2016. Characterization of the cation binding
sites in the nckx2 na+/ca2+- k+ exchanger. Biochemistry.

Abstract (if available)

Abstract Calcium transport is a highly controlled process in enamel formation, when ameloblast cells use calcium not only to incorporate in large quantities into hydroxyapatite crystals, but also to regulate intracellular signaling and ensure the smooth progression of enamel formation. Our data focuses on one family of calcium export proteins, the Atp2b (PMCA) family, which is more highly expressed in the secretory stage of amelogenesis than the maturation stage and is commonly accepted as a mechanism for fine-tuning calcium homeostasis. Surprisingly, while the Atp2b1 (PMCA1) and Atp2b4 (PMCA4) are highly expressed on the lateral membranes of ameloblasts, removal of the catalytic site of the Atp2b1 and Atp2b4 proteins shows some effect on ameloblast morphology and apoptosis, but produces no noticeable effect on the resulting enamel mineral. RNA-sequencing of the different stages of amelogenesis identifies the primary alternatively spliced isoforms of calcium transporters expressed throughout amelogenesis and sheds some light on the role of calcium transport during secretory stage amelogenesis. This study aims to add to the understanding of transcellular calcium transport during amelogenesis as not only valuable for direct incorporation into enamel crystals, but also necessary for the cell processes that allow the formation of enamel to occur.

Linked assets

University of Southern California Dissertations and Theses

Conceptually similar

PDF

Amelogenin-ameloblastin protein interaction and function in dental enamel formation

PDF

Global analysis of the molecular activities defining maturation-stage amelogenesis

PDF

Ameloblastin-protein interactions pattern enamel matrix

PDF

Role of MMP-20 in preventing protein occlusion in enamel apatite crystals: relevance in enamel biomineralization and biomimetics

PDF

Cytomegalovirus induced amelogenesis imperfecta

PDF

Integrative analysis of gene expression and phenotype data

PDF

Leucine-rich amelogenin peptide induces osteogenesis in mouse embryonic stem cells

PDF

Amelogenin peptides for biomimetic remineralization of enamel and dentin

PDF

Integrin expression and signaling during palatal fusion

PDF

The role of Hic-5 in glucocorticoid receptor binding to chromatin

PDF

Inhibitory effects of estradiol and SERMs on RUNX2-driven osteoblast differentiation and gene expression

PDF

Antibody mediated osseous regeneration

PDF

Genetics and the environment: evaluating the role of noncoding RNA in autism spectrum disorder

PDF

Identifying and characterizing a unique enhancer for Y537S mutant estrogen receptor (ER) in breast cancer cells

PDF

Aggregatibacter actinomycetemcomitans oral infection: in vivo T cell immune responses and a novel bone-targeting conjugate to treat biofilm-mediated osteolytic infection

PDF

Cultured neuronal cells derived from the olfactory neuroepithelium growing in three dimensions as a model system for schizophrenia

PDF

Characterizing the protein expression of S1P receptors in T-cell acute lymphoblastic leukemia (T-ALL) cell lines

PDF

Opposing function of chd7 and phf6 in zebrafish craniofacial development

PDF

The role of neuregulin receptors in cell differentiation and the response to inflammatory cytokines in the intestinal epithelium

PDF

Investigating the role of ion channel activity of coronaviruses envelope protein in CD1d regulation

Asset Metadata

Creator Robertson, Sarah Yuriko-Tuggy (author)

Core Title Transcellular calcium transport in amelogenesis

School School of Dentistry

Degree Doctor of Philosophy

Degree Program Craniofacial Biology

Publisher University of Southern California (original), University of Southern California. Libraries (digital)

Tag amelogenesis,calcium homeostasis,Craniofacial Biology,developmental biology,enamel,hydroxyapatite,mineralization,next-generation sequencing,OAI-PMH Harvest,plasma membrane calcium transport,PMCA

Language English

Contributor Electronically uploaded by the author (provenance)

Advisor Paine, Michael (committee chair), Bajpai, Ruchi (committee member), Frenkel, Baruch (committee member), Oldak, Janet (committee member), Sedghizadeh, Parish (committee member)

Creator Email smilesinthepool@yahoo.com,stuggy@usc.edu

Permanent Link (DOI) https://doi.org/10.25549/usctheses-c40-453806

Unique identifier UC11265554

Identifier etd-RobertsonS-5890.pdf (filename),usctheses-c40-453806 (legacy record id)

Legacy Identifier etd-RobertsonS-5890.pdf

Dmrecord 453806

Document Type Dissertation

Rights Robertson, Sarah Yuriko-Tuggy

Type texts

Source University of Southern California (contributing entity), University of Southern California Dissertations and Theses (collection)

Access Conditions The author retains rights to his/her dissertation, thesis or other graduate work according to U.S. copyright law. Electronic access is being provided by the USC Libraries in agreement with the a...

Repository Name University of Southern California Digital Library

Repository Location USC Digital Library, University of Southern California, University Park Campus MC 2810, 3434 South Grand Avenue, 2nd Floor, Los Angeles, California 90089-2810, USA