University of Southern California Dissertations and Theses

Expansion of deoxynucleotide analog probes for studying DNA polymerase mechanism: synthesis of novel beta, gamma-CXY deoxycytidine series

(USC Thesis Other)

Expansion of deoxynucleotide analog probes for studying DNA polymerase mechanism: synthesis of novel beta, gamma-CXY deoxycytidine series

PDF

Download

Open document

Flip pages

Download a page range

Download transcript

Copy asset link

Request this asset

Transcript (if available)

Content EXPANSION OF DEOXYNUCLEOTIDE ANALOG PROBES
FOR STUDYING DNA POLYMERASE MECHANISM:
SYNTHESIS OF NOVEL BETA, GAMMA-CXY
DEOXYCYTIDINE SERIES

by

BEATRIZ GARCIA-BARBOZA (RENNER)

A Dissertation Presented to the
FACULTY OF THE USC GRADUATE SCHOOL
UNIVERSITY OF SOUTHERN CALIFORNIA
In Partial Fulfillment of the
Requirements for the Degree
MASTER OF SCIENCE
(CHEMISTRY)

May 2018

Copyright 2018 Beatriz Garcia-Barboza
(Renner)

ii
DEDICATION

The work presented here is first and foremost dedicated to my loving family. To
my dad, who always encouraged me to learn and move forward no matter the challenge.
To my mom, who has always encouraged and supported my academic endeavors. To my
brother, who taught me to never give up even after falling down. They are my inspiration.

El trabajo presentado aquí está dedicado principalmente a mi amorosa familia.
Para mi papá, que siempre me animó a aprender y avanzar sin importar el desafío. Para
mi madre, que siempre me alentó y apoyó en mis esfuerzos académicos. Para mi
hermano, quien me enseñó a nunca rendirme incluso después de caerme. Ellos son mi
inspiración.

iii
ACKNOWLEDGEMENTS

I would like to thank Professor Charles E. McKenna for giving me the
opportunity to study medicinal chemistry within the McKenna research group. I would
also like to thank Professor McKenna for encouraging me to apply for the National
Science Foundation Graduate Research Fellowship Program (NSF GRFP), and providing
me with the resources to produce a successful application.
I would like to thank the NSF, specifically the GRFP who provided me with
funding for three years during my research and thesis writing process.
I would like to thank Dr. Boris A. Kashemirov for his guidance throughout my
time in the McKenna research group. I believe I became a better chemist due to his
imparted knowledge and training. He is an invaluable asset to the McKenna lab, and the
work presented here could not have been possible without his guidance. I really
appreciate the way he taught and made me think about the research being done.
I would like to thank Professor Myron Goodman and Dr. Samuel Wilson for
having organized the NIH-funded program project of which this research was a part (NIH
grant U19CA105010). I would also like to particularly thank Professor Myron F.
Goodman for serving in my screening and qualifying committee. Thank you to the
Goodman research group, principally Keriann Oertell, who performed the kinetic studies
and who has been essential in the interdisciplinary study of DNA polymerase β by the
Goodman and McKenna research groups.
Thank you to Professor Joann B. Sweasy from Yale University, and her research
group, predominantly Khadijeh S. Alnajjar who performed the pol β K289 mutator
variant single-turn over kinetic experiments and is the corresponding author in the

iv
Biochemistry publication, for which chapter two is adapted with permission from A
Change in the Rate-Determining Step of Polymerization by the K289M DNA
Polymerase β Cancer-Associated Variant. Khadijeh S. Alnajjar, Beatriz Garcia-
Barboza, Amirsoheil Negahbani, Maryam Nakhjiri, Boris Kashemirov, Charles
McKenna, Myron F. Goodman, and Joann B. Sweasy. Biochemistry 2017 56 (15), 2096-
2105. Copyright 2018 American Chemical Society.
Thank you to Professor Chao Zhang and Professor Sarah Feakins for taking the
time in participating in my screening and qualifying committee, as well as my master
thesis committee. Thank you to Professor Surya Prakash and Professor Curt Wittig for
their support in completing my master thesis.
A special thanks to everyone who worked behind the scenes so to speak, and
made it possible for me to be a graduate student at USC. To Allan Kershaw, for
maintaining the USC NMR facility. To Meredith Drake Reitan and Kate Tegmeyer, for
assisting me with the NSF GRFP fellowship, and all of my questions. To Michele Dea
and Magnolia Benitez, for all of the work that they do for the Chemistry Department at
USC.
A huge thanks to my dear friend Anna Batt who provided moral support,
encouragement, hosted many a study/writing sessions, and who without I could not have
survived the challenges of graduate student life.
Finally I would like to thank everyone in the McKenna lab. Thank you Dr. Candy
S. Hwang for your mentorship, friendship, and everything you taught me about writing
and editing. Thank you Amirsoheil Negahbani and Maryam Nakhjiri for all of your
support in lab and mentorship during this project. Thank you Dr. Kim Nguyen for you

v
mentorship, friendship, and encouragement. Thank you Dr. Elena Ferri, Dr. Melissa M
Williams, Dr. Dana Mustafa, and Dr. Anastasia Kadina who in one form or another
taught me valued lessons. Special thanks to Inah Kang for your support, friendship,
encouragement, and being a fountain of information in all administrative and
writing/editing matters.

vi
LIST OF TABLES & SCHEMES

Table 2.1 Summary of WT Kinetic Data from Single-Turnover Activity
a
.................................................... 18
Table 2.2 Summary of K289M Kinetic Data from Single-Turnover Activity
a
............................................. 18
Table 2.3 Fidelity of WT and K289M ........................................................................................................... 23
Table 2.4 Discrimination at K
d
by WT and K289M ...................................................................................... 24
Table 2.5 Discrimination at k
pol
by WT and K289M ..................................................................................... 24
Scheme 2.1 Biochemical Pathway for Nucleotide Incorporation by WT Pol β in the Presence of the Crystal
Structure Primer−Template Substrate T(−8)D:3′OH
a
.................................................................................... 27

vii
LIST OF FIGURES
Figure 1.1 dNTP analogue “tool-kit” probes for pol β .................................................................................... 2
Figure 2.1 Graphical Abstract
1
......................................................................................................................... 6
Figure 2.2 β,γ-dGTP and β,γ-dCTP analogues .............................................................................................. 16
Figure 2.3 Single-turnover kinetics for the incorporation of the correct β,γ-CH
2
dGTP. .............................. 17
Figure 2.4 Brønsted correlation plots for correct nucleotide insertion. ......................................................... 19
Figure 2.5 Brønsted correlation plots for incorrect nucleotide insertion. ...................................................... 21
Figure 2.6 Active site assembly of WT human DNA pol β and the location of Lys289. .............................. 30
Figure A1.
1
H NMR spectrum (400 MHz, D2O) of 2’-deoxycytidine 5’-triphosphate β,γ CHF, 2a. ........... 45
Figure A2.
19
F NMR spectrum (376 MHz, D2O) of 2’-deoxycytidine 5’-triphosphate β,γ-CHF, 2a. .......... 46
Figure A3.
31
P NMR spectrum (162 MHz, D2O) of 2’-deoxycytidine 5’- triphosphate β,γ-CHF, 2a. ......... 47
Figure A4. LRMS [M-H]- of 2’-deoxycytidine 5’- triphosphate β,γ-CHF, 2a. ............................................. 48
Figure A5.
1
H NMR spectrum (400 MHz, D2O) of 2’-deoxycytidine 5’-triphosphate β,γ-CF
2
, 2b. ............ 49
Figure A6.
19
F NMR spectrum (376 MHz, D2O) of 2’-deoxycytidine 5’-triphosphate β,γ-CF
2
, 2b. ............ 50
Figure A7.
31
P NMR spectrum (162 MHz, D2O) of 2’-deoxycytidine 5’- triphosphate β,γ-CF
2
, 2b. .......... 51
Figure A8. LRMS [M-H]- of 2’-deoxycytidine 5’- triphosphate β,γ-CF
2
, 2b. .............................................. 52
Figure A9.
1
H NMR spectrum (600 MHz, D2O) of 2’-deoxycytidine 5’-triphosphate β,γ-CHCl, 2c. ......... 53
Figure A10.
19
F NMR spectrum (243 MHz, D2O) of 2’-deoxycytidine 5’-triphosphate β,γ- CHCl, 2c. ..... 54
Figure A11. LRMS [M-H]- of 2’-deoxycytidine 5’- triphosphate β,γ-CHCl, 2c. ......................................... 55
Figure A12.
1
H NMR spectrum (500 MHz, D2O) of 2’-deoxycytidine 5’-triphosphate β,γ-CCl
2
, 2d. ......... 56
Figure A13.
31
P NMR spectrum (202 MHz, D2O) of 2’-deoxycytidine 5’- triphosphate β,γ-CCl
2
, 2d. ....... 57
Figure A14. LRMS [M-H]- of 2’-deoxycytidine 5’- triphosphate β,γ-CCl
2
, 2d. ........................................... 58
Figure A15.
1
H NMR spectrum (500 MHz, D2O) of 2’-deoxycytidine 5’-triphosphate β,γ-CClF, 2e. ........ 59
Figure A16.
19
F NMR spectrum (376 MHz, D2O) of 2’-deoxycytidine 5’-triphosphate β,γ-CClF, 2e. ....... 60
Figure A17.
31
P NMR spectrum (162 MHz, D2O) of 2’-deoxycytidine 5’- triphosphate β,γ-CClF, 2e. ...... 61
Figure A18. LRMS [M-H]- of 2’-deoxycytidine 5’- triphosphate β,γ-CClF, 2e. .......................................... 62
Figure A19.
1
H NMR spectrum (500 MHz, D2O) of 2’-deoxycytidine 5’-triphosphate β,γ-CHBr, 2f. ........ 63
Figure A20.
31
P NMR spectrum (162 MHz, D2O) of 2’-deoxycytidine 5’- triphosphate β,γ- CHBr, 2f. ..... 64
Figure A21. LRMS [M-H]- of 2’-deoxycytidine 5’- triphosphate β,γ-CHBr, 2f. .......................................... 65
Figure A22. Single Turnover Kinetics for the Incorporation of the Correct Parent dGTP. ........................... 67

viii

TABLE OF CONTENTS
DEDICATION ................................................................................................................... ii
ACKNOWLEDGEMENTS .............................................................................................. iii
LIST OF TABLES & SCHEMES ...................................................................................... vi
LIST OF FIGURES .......................................................................................................... vii
Chapter 1. DNA Polymerase β ............................................................................................ 1
1.1 Background ............................................................................................................................ 1
1.2 Discussion .............................................................................................................................. 2
1.3 References .............................................................................................................................. 4
Chapter 2. A Change in the Rate-Determining Step of Polymerization by the K289M
DNA Polymerase β Cancer-Associated Variant* ................................................................ 6
2.1 Abstract .................................................................................................................................. 6
2.2 Background ............................................................................................................................ 7
2.3 Materials and Methods ........................................................................................................ 12
2.3.1 Synthesis of dNTP Analogues .............................................................................................. 12
2.3.2 Expression and Purification of DNA Polymerase β ............................................................ 13
2.3.3 DNA Substrates ................................................................................................................... 13
2.3.4 Single-Turnover Kinetics ..................................................................................................... 14
2.4 Results .................................................................................................................................. 15
2.4.1 Synthesis of dNTP Analogues .............................................................................................. 15
2.4.2 Rates for Correct Incorporation by K289M Are Independent of the Leaving Group ......... 16
2.4.3 The Correct LFERs Break at High pK
a4
Values .................................................................. 20
2.4.4 K289M and WT Exhibit a Similar Dependence on the pK
a4
of the Leaving Group for
Incorrect Incorporation ................................................................................................................ 21
2.4.5 K289M Becomes More Accurate in the Presence of the Analogues ................................... 22
2.5 Discussion ............................................................................................................................ 25
2.6 Conclusions .......................................................................................................................... 30
2.7 References ............................................................................................................................ 32
BIBLIOGRAPHY ............................................................................................................. 38
Appendix A. Chapter 2 Supporting Data .......................................................................... 45
NMR Analysis .......................................................................................................................... 66

1
Chapter 1. DNA Polymerase β
1.1 Background
DNA polymerases (DNA pols) are multifunctional enzymes that carry out critical
functions in DNA replication and repair. DNA pols that are involved in genome
replication must maintain a high degree of fidelity; as a result the error rates of said pols
are as low as 10
-3
– 10
-6
.
1
In order to understand how pols achieve such a high degree of
fidelity, it is important to comprehend their catalytic mechanisms. Whether said
mechanism proceeds via a chemical rate-determining step (RDS), or a conformational
change RDS prior to the “chemistry”, can help us determine exactly how a particular
polymerase functions.
2
Pols that belong to the pol family X (e.g. pol λ, pol µ, pol β) are
responsible for mediating DNA base excision and double-strand break repair.
3
DNA pol
β is of particular interest due to its essential function in repairing simple base lesions on
damaged DNA through base excision repair (BER),
4
as well as its role in the
development of anticancer drug resistance.
5

DNA polymerase β is a small 39 kDa protein that possesses two domains, an 8
kDa lyase domain and a 31 kDa polymerase domain.
4
The function of the lyase domain is
to catalyze the β-elimination of the remaining 5’-deoxyribose phosphate group after the
phosphodiesterase reaction during DNA repair.
6
The function of the polymerase domain
is involved in the nucleotidyl transfer mechanism of BER, where it catalyzes the
nucleophilic attack on the P
α
of the incoming deoxynucleotide triphosphate (dNTP) by
the 3
’
-OH of the gapped DNA, which results in the formation of a phosphodiester bond
and the elimination of a pyrophosphate (PP
i
) leaving group.
7-8

2
1.2 Discussion
More than 30% of human tumors show expression of DNA pol β variants,
additionally, over expression of pol β has been found in a variety of tumors.
9
Therefore,
pol β has become a target for possible novel cancer therapies including pol β inhibitors.
For that reason, it is vital to attain a full mechanistic understanding of the achievement of
fidelity by pol β. In order to study fidelity (i.e. discrimination between right (R) and
wrong (W) deoxynucleotide incorporation), it is necessary to ascertain how various
Watson-Crick (W-C) and non-W-C structures are incorporated during DNA replication.
In order to study this phenomenon, the structure and properties of the transition state (TS)
for the RDS in the DNA polymerase active-site must be known.
7-8,10-13

In recent years, the McKenna research group has developed a series of modified
dNTP analogues, Figure 1.1. In these DNA polymerase substrate analogues, the β,γ-
phosphate bridging oxygen is replaced by functionalized carbon moieties (CXY). Thus,
the stereoelectronic properties of the bisphosphonate (BP) leaving groups become
altered.
14

Figure 1.1 dNTP analogue “tool-kit” probes for pol β
Where B = G or T; and CXY = CH
2
, CHF, CF
2
, CHCl, CHBr, CBr
2
, CFCl, CHCH
3
, C(CH
3
)
2
,
CHN
3
, CN
3
CH
3

3
The functionalized BP leaving groups mimic the PP
i
leaving group when its
corresponding β,γ-CXY-dNTP analogue is incorporated by pol β.
14
Each BP leaving
group conjugate acid has its own associated pK
a4
value, when X and Y are more
electronegative the pK
a4
will decrease due to an increased stability of the leaving group as
an anion.
14
Consequently, by varying the functional groups (X and Y) these analogues
serve as sensitive chemical probes of the P-O charge stabilization in the TS, and will
reveal the nature of the RDS via linear free energy relationship plots.
7,14-15

The dNTP analogue “tool-kit” synthesized by the McKenna research group
included the functionalized guanosine and thymidine triphosphates.
7-8,12,14-15
The work
presented for the purposes of this thesis that details the synthesis, characterization and
purification of novel deoxycytidine triphosphate series (dCTP), compounds 2a – 2g
(Figure 2.2), is included in the Biochemistry journal publication from which Chapter 2 is
adapted.

4
1.3 References

1. Echols, H.; Goodman, M. F., Fidelity mechanisms in DNA replication. Annu. Rev.
Biochem. 1991, 60, 477-511.
2. Joyce, C. M.; Benkovic, S. J., DNA polymerase fidelity: kinetics, structure, and
checkpoints. Biochemistry 2004, 43 (45), 14317-24.
3. Moon, A. F.; Garcia-Diaz, M.; Batra, V. K.; Beard, W. A.; Bebenek, K.; Kunkel,
T. A.; Wilson, S. H.; Pedersen, L. C., The X family portrait: structural insights
into biological functions of X family polymerases. DNA Repair (Amst) 2007, 6
(12), 1709-25.
4. Beard, W. A.; Wilson, S. H., Structure and mechanism of DNA polymerase Beta.
Chem. Rev. 2006, 106 (2), 361-82.
5. Canitrot, Y.; Frechet, M.; Servant, L.; Cazaux, C.; Hoffmann, J. S.,
Overexpression of DNA polymerase beta: a genomic instability enhancer process.
FASEB J. 1999, 13 (9), 1107-11.
6. Matsumoto, Y.; Kim, K., Excision of deoxyribose phosphate residues by DNA
polymerase beta during DNA repair. Science 1995, 269 (5224), 699-702.
7. Sucato, C. A.; Upton, T. G.; Kashemirov, B. A.; Batra, V. K.; Martinek, V.;
Xiang, Y.; Beard, W. A.; Pedersen, L. C.; Wilson, S. H.; McKenna, C. E.;
Florian, J.; Warshel, A.; Goodman, M. F., Modifying the beta,gamma leaving-
group bridging oxygen alters nucleotide incorporation efficiency, fidelity, and the
catalytic mechanism of DNA polymerase beta. Biochemistry 2007, 46 (2), 461-71.
8. Sucato, C. A.; Upton, T. G.; Kashemirov, B. A.; Osuna, J.; Oertell, K.; Beard, W.
A.; Wilson, S. H.; Florian, J.; Warshel, A.; McKenna, C. E.; Goodman, M. F.,
DNA polymerase beta fidelity: halomethylene-modified leaving groups in pre-
steady-state kinetic analysis reveal differences at the chemical transition state.
Biochemistry 2008, 47 (3), 870-9.
9. Starcevic, D.; Dalal, S.; Sweasy, J. B., Is there a link between DNA polymerase
beta and cancer? Cell cycle (Georgetown, Tex.) 2004, 3 (8), 998-1001.
10. Batra, V. K.; Pedersen, L. C.; Beard, W. A.; Wilson, S. H.; Kashemirov, B. A.;
Upton, T. G.; Goodman, M. F.; McKenna, C. E., Halogenated beta,gamma-
methylene- and ethylidene-dGTP-DNA ternary complexes with DNA polymerase
beta: structural evidence for stereospecific binding of the fluoromethylene
analogues. J. Am. Chem. Soc. 2010, 132 (22), 7617-25.
11. Chamberlain, B. T.; Batra, V. K.; Beard, W. A.; Kadina, A. P.; Shock, D. D.;
Kashemirov, B. A.; McKenna, C. E.; Goodman, M. F.; Wilson, S. H.,
Stereospecific formation of a ternary complex of (S)-alpha,beta-fluoromethylene-
dATP with DNA pol beta. ChemBioChem 2012, 13 (4), 528-30.
12. McKenna, C. E.; Kashemirov, B. A.; Upton, T. G.; Batra, V. K.; Goodman, M. F.;
Pedersen, L. C.; Beard, W. A.; Wilson, S. H., (R)-beta,gamma-fluoromethylene-

5
dGTP-DNA ternary complex with DNA polymerase beta. J. Am. Chem. Soc.
2007, 129 (50), 15412-3.
13. Upton, T. G.; Kashemirov, B. A.; McKenna, C. E.; Goodman, M. F.; Prakash, G.
K.; Kultyshev, R.; Batra, V. K.; Shock, D. D.; Pedersen, L. C.; Beard, W. A.;
Wilson, S. H., Alpha,beta-difluoromethylene deoxynucleoside 5'-triphosphates: a
convenient synthesis of useful probes for DNA polymerase beta structure and
function. Org. Lett. 2009, 11 (9), 1883-6.
14. Oertell, K.; Chamberlain, B. T.; Wu, Y.; Ferri, E.; Kashemirov, B. A.; Beard, W.
A.; Wilson, S. H.; McKenna, C. E.; Goodman, M. F., Transition state in DNA
polymerase beta catalysis: rate-limiting chemistry altered by base-pair
configuration. Biochemistry 2014, 53 (11), 1842-8.
15. Oertell, K.; Wu, Y.; Zakharova, V. M.; Kashemirov, B. A.; Shock, D. D.; Beard,
W. A.; Wilson, S. H.; McKenna, C. E.; Goodman, M. F., Effect of beta,gamma-
CHF- and beta,gamma-CHCl-dGTP halogen atom stereochemistry on the
transition state of DNA polymerase beta. Biochemistry 2012, 51 (43), 8491-501.

6
Chapter 2. A Change in the Rate-Determining Step of
Polymerization by the K289M DNA Polymerase β Cancer-
Associated Variant*
* adapted with permission from A Change in the Rate-Determining Step of Polymerization by the
K289M DNA Polymerase β Cancer-Associated Variant Khadijeh S. Alnajjar, Beatriz Garcia-Barboza,
Amirsoheil Negahbani, Maryam Nakhjiri, Boris Kashemirov, Charles McKenna, Myron F. Goodman, and
Joann B. Sweasy. Biochemistry 2017 56 (15), 2096-2105. Copyright 2018 American Chemical Society
2.1 Abstract

Figure 2.1 Graphical Abstract
1

K289M is a variant of DNA polymerase β (pol β) that has previously been
identified in colorectal cancer. The expression of this variant leads to a 16-fold increase
in mutation frequency at a specific site in vivo and a reduction in fidelity in vitro in a
sequence context-specific manner. Previous work shows that this reduction in fidelity
results from a decreased level of discrimination against incorrect nucleotide incorporation
at the level of polymerization. To probe the transition state of the K289M mutator variant
of pol β, single-turnover kinetic experiments were performed using β,γ-CXY dGTP
analogues with a wide range of leaving group monoacid dissociation constants (pK
a4
),
including a corresponding set of novel β,γ-CXY dCTP analogues. Surprisingly, we found
that the values of the log of the catalytic rate constant (k
pol
) for correct insertion by
K289M, in contrast to those of wild-type pol β, do not decrease with increased leaving
group pK
a4

for analogues with pK
a4

values of <11. This suggests that one of the relative

7
rate constants differs for the K289M reaction in comparison to that of the wild type
(WT). However, a plot of log(k
pol
) values for incorrect insertion by K289M versus pK
a4

reveals a linear correlation with a negative slope, in this respect resembling k
pol

values for
misincorporation by the WT enzyme. We also show that some of these analogues
improve the fidelity of K289M. Taken together, our data show that Lys289 critically
influences the catalytic pathway of pol β.
2.2 Background
DNA polymerase β (pol β) is essential for the repair of damaged DNA by base
excision repair (BER). BER prevents cells from propagating DNA damage caused by
exposure to endogenous and exogenous sources. Aberrations in this pathway have proven
to be detrimental and are associated with human diseases, saliently including cancer.
2
Pol
β has been shown to be mutated in a variety of human tumors.
3-4
Several of the cancer-
associated pol β variants possess aberrant function in vitro, including slowed or more
error-prone DNA polymerase activity.
5-9
Importantly, expression of these pol β variants
in cells induces genomic instability and cellular transformation.
3,7-8,10-11
Thus,
understanding the basic mechanisms of catalysis by pol β, including the fidelity of DNA
synthesis, will provide important insights into carcinogenesis.
12

Pol β is a member of the X-family of DNA polymerases. It is a small protein with
a molecular weight of 39 kDa and has two functional domains, the 8 kDa lyase and 31
kDa polymerase domains. The 8 kDa lyase domain catalyzes the β-elimination of the
remaining 5′-deoxyribose phosphate (dRP) group from the preceding phosphodiesterase
reaction.
13
The polymerase domain catalyzes a three-metal ion-dependent mechanism
involving nucleophilic attack by the 3′-OH of the gapped DNA on P
α
of the incoming

8
dNTP to form a phosphodiester bond.
14-15
This reaction results in the formation of an
extended DNA product with the release of inorganic pyrophosphate (PP
i
). The
polymerase domain of pol β is organized into three subdomains resembling a right-
handed structure: the thumb subdomain (residues 88−147) binds to DNA, the palm
subdomain (residues 148−261) contains components of the active site, and the fingers
subdomain (residues 262−335) binds the incoming dNTP.
16-17

We have previously shown that amino acid residues distant from the active site of
pol β influence fidelity in the ground state.
18
Using two different genetic screens,
19-20
we
identified several mutator variants of pol β, each with single-amino acid alterations in
residues distant from the active site of the protein. Subsequent biochemical
characterization of these variants demonstrated that they exhibited fidelity lower than that
of the WT enzyme, mostly because of a lack of substrate discrimination during ground
state binding.
21-30
We have also shown that variants of pol β with low fidelity found in
human tumors result from single-amino acid alterations located at positions far from the
active site.
3,5,11,18,31-32
Together, these studies suggest that the fidelity of pol β is affected
by amino acids distant from the active site of the protein that may not participate directly
in catalysis but may influence substrate choice by affecting the conformation of the
enzyme. In support of this, we have recently used fluorescence resonance energy transfer
(FRET) to monitor precatalytic conformational movements of pol β and to show that the
fingers domain of pol β does not close in a stable manner in the presence of the incorrect
dNTP substrate.
33
In addition, recent NMR spectroscopic characterization of pol β
suggests that this enzyme closes stably in the presence of correct dNTP, but not in the
presence of a mismatch.
34
It has also been suggested that prechemistry conformational

9
changes govern fidelity in other polymerases such as HIV-RT and T7 polymerase.
35-39
Taken together, these studies suggest that specific amino acid residues distant from the
active site of pol β promote stable precatalytic conformational changes that influence
fidelity, supporting an induced-fit mechanism.
Pol β does not contain a proofreading function, which reduces its overall fidelity.
It is estimated that pol β misinserts nucleotides at a frequency of 1 in ∼5000.
40
To
increase specificity and fidelity, pol β utilizes multiple kinetic steps to govern substrate
selection.
33,41-43
Previous evidence indicates that, for pol β, chemistry is normally rate-
determining for both correct and incorrect nucleotides, though the activation energy
barrier for the forward reaction of the incorrect dNTP is much higher.
41,43-47
It has been
suggested that the difference in energy results from a distorted active site in the presence
of a mismatch.
34,45
Reverse fingers closing has also been shown to be an important
determinant of fidelity for HIV-RT as the enzyme prepares for chemistry.
35-36

It has been proposed that pol β employs a number of mechanisms to select the
correct dNTP substrate, including ground state binding, prechemistry conformational
change(s), and transition state (TS) chemistry.
33,41,43
Conformational changes occur upon
binding of the correct dNTP, which result in closing of the fingers subdomain and other
smaller movements that align the active site for an inline nucleophilic attack with the
incoming dNTP, as shown by structural and FRET studies.
14-16,33-34
This then commits the
enzyme to chemistry particularly if the reverse fingers opening is a slow reaction
compared to the rate of chemistry.
35-36
The chemical reaction requires deprotonation of
the 3′-OH to assist with the nucleophilic attack of the 3′-oxygen on P
α
of the bound

10
dNTP. Ultimately, the latter bond is broken, and PP
i
is eliminated as the leaving group.
14-
15,48

In accordance with TS theory, the TS is defined as the highest free energy state
along the reaction coordinate, which constitutes the rate-determining step (RDS).
49-50
A
tool kit consisting of dGTP analogues modified by installation of β,γ-CXY bridging
groups was introduced to study leaving group effects on the TS of pol β during the
incorporation of correct and incorrect nucleotides.
47,51-52
Via variation of the X and Y
substituents, the pK
a4

of the corresponding pCXYp methylene(bisphosphonate) leaving
group can be modulated to probe the dependence of k
pol

on the basicity of the leaving
group. Thus, more electronegative substituents on the bridging β-methylene decrease
pK
a4
, corresponding to a more stable leaving group anion, producing a leaving group
effect and increasing k
pol
.
51-52
This effect can be quantitated by fitting the experimental
k
pol

and pK
a4

data to the Brønsted equation,
47,51-53
which postulates a linear free energy
relationship (LFER)
49
between the logarithm of the rate constant (log k) and the
logarithm of the last acid dissociation constant (pK
a
) for the leaving group, in accordance
with Eq 1.
49-50

(Eq 1) log
!"#
= ×
!!
+
Where
!"#
is the experimental reaction rate constant and coefficient β is related to the
sensitivity of
!"#
to a change in leaving group basicity; if a more basic leaving group
increases the TA ΔG, β < 0. The intercept, C, is a constant.
Previous single-turnover kinetic studies using dGTP and dTTP bisphosphonate

11
analogues demonstrated that their polymerase-catalyzed turnover reaction rate constants
for both correct and incorrect base pairing to the DNA template exhibit well-defined
linear Brønsted correlations with negative slopes,
51-52
consistent with a chemical RDS in
both cases. These studies also showed that the absolute value of β for incorrect base pairs
was typically larger than those for the correct base pairs, showing a greater demand for
charge stabilization in the mispair mechanism.
51-52

K289M is a colon cancer-associated variant of pol β, wherein a lysine residue,
located in the fingers subdomain at the end of helix N, is mutated to a methionine.
18
Helix
N is important for closing of the fingers subdomain upon binding of the correct dNTP.
14

The K289M variant exhibits a 16-fold increase in spontaneous mutation frequency in vivo
within a specific sequence context, identical to a frequently mutated site within the
adenomatous polyposis coli (APC) gene.
18
When tested in vitro, this variant exhibits
reduced fidelity by misincorporating dCTP opposite template C in a sequence context-
specific manner, as a result of a reduced level of discrimination at the level of
polymerization.
18

In this study, we investigated the base-dependent kinetic mechanism of DNA
synthesis catalyzed by the cancer-associated K289M variant of pol β, using a set of CXY
dNTP probes that includes novel dCTP as well as dGTP analogues to compare both
pyrimidine substrate and corresponding purine substrate base recognition effects on
catalysis. Surprisingly, in contrast to the results for WT pol β, k
pol
for the K289M mutant
enzyme is not dependent on the CXY dGTP leaving group for correct incorporation
opposite template C (β ∼ 0) but is dependent for the misincorporation of dCTP opposite

12
template C (β < 0). The results provide evidence that even though it is remote from the
active site in the ground state conformation, Lys289 plays a critical role in the catalysis of
the correct nucleotidyl transfer reaction for dGTP, playing an important role in accurate
DNA synthesis.
2.3 Materials and Methods
2.3.1 Synthesis of dNTP Analogues

Cytidine 5 ′-monophos- phate was purchased from Chem Impex International.
The methylene bisphosphonic acids [in the form of their anhydrous
tris(tributylammonium) salts] and cytidine 5 ′ -monophosphate morpholidate were
prepared according to published procedures.
54-56
All other reagents were purchased from
commercial sources and used as obtained. Preparation of the dGTP β,γ-CXY analogues
1a−i was reported previously.
47,51-52,57-58
The corresponding β,γ-CXY analogues of dCTP,
2a−g, were prepared analogously. Thus, to cytidine 5 ′-monophosphate morpholidate [1
equiv in 2 mL of anhydrous dimethyl sulfoxide (DMSO)] was added the appropriate
member of the group of methylenebisphosphonates 3a−i [tris(tribuylammonium) salt, 3
equiv in 3 mL of dry DMSO]. After 48 h, volatiles were removed under reduced pressure.
The residue was dissolved in 0.5 N triethylammonium bicarbonate (TEAB) buffer (pH
7−8) and subjected to dual-pass preparative high-performance liquid chromatography
(HPLC) (Varian ProStar, Shimadzu SPD-10A UV detector/0.5 mm path, 267 nm). For
SAX: Macherey-Nagel 21.4 mm × 250 mm SP15/25 Nucleogel column, eluted with 5%
acetonitrile in water and 0.5 M TEAB (pH 7.5), from 0 to 40% over 10 min, 40% for 6
min, and from 40 to 100% over 9 min, 8 mL/min. For RP: 21.4 mm × 250 mm Microsorb

13
100-5 C18 column, eluted isocratically with 0.1 M TEAB buffer (pH 7.5) and 8.5%
acetonitrile, 8 mL/min. The purified nucleotide analogue product was characterized by
1H, 19F, and 31P NMR (Varian 400), MS (ESI Finnigan LCQ Deca XP Max in negative
ion mode) (FiguresA1−A21) and by analytical HPLC.
2.3.2 Expression and Purification of DNA Polymerase β

WT and K289M pol β with an N-terminal six-histidine tag were expressed in
Escherichia coli BL21(DE3) and purified as previously described.
18
Briefly, cells were
collected and lysed by sonication. The lysate was loaded onto a nickel-charged chelating
column, and protein was eluted with 250 mM imidazole in buffer A [50 mM Tris (pH
8.0) and 100 mM NaCl] after column washes with buffer A using fast protein liquid
chromatography. The eluent was loaded onto an SP column, and pol β was eluted with 1
M NaCl in buffer B [50 mM Tris (pH 8.0), 1 mM EDTA, and 10% glycerol]. The protein
concentration was determined by A280 using 21200 M
−1
cm
−1
as the extinction
coefficient.
2.3.3 DNA Substrates

Oligonucleotides were purchased from the Keck Oligo Synthesis Resource at
Yale University and were purified by polyacrylamide gel electrophoresis. The following
sequences were used in this study: primer (5′ GAACTCCATATGGATTT), downstream
(5′ TTCAGAACGCTCGGTTGC), and template (5′
GCAACCGAGCGTTCTGAACAAATCCATATGGAGTTC, where C is the templating
base in the gap between the primer and downstream oligonucleotides).
18
The duplex was
termed the CL-CP-CG sequence. The primer DNA sequence was phosphorylated at the 5′

14
terminus using [γ-
32
P]ATP for detection, and the downstream oligonucleotide was
phosphorylated with ATP following the manufacturer’s instructions for T4
polynucleotide kinase (New England BioLabs). After phosphorylation, excess ATP was
removed by passing the products through a microspin column. Primer, downstream, and
template oligonucleotides were mixed in a 1:1.6:1.3 ratio and were allowed to anneal in
annealing buffer containing 500 mM Tris-HCl (pH 8.0) and 2.5 M NaCl to generate a
single-base pair gapped DNA as previously described.
18

2.3.4 Single-Turnover Kinetics

Pol β (750 nM) was premixed with 50 nM labeled DNA (final concentration), a
ratio that was empirically determined for single-turnover conditions.
59
Reactions were
initiated by mixing with equal volumes of dNTP and 10 mM Mg
2+
for specified times at
37 °C in 50 mM Tris (pH 8.0), 20 mM NaCl, 2 mM DTT, and 10% glycerol and then
quenched with 0.3 M EDTA using a KinTek rapid quench-flow apparatus. Reactions that
took >120 s were quenched manually. The correct dGTP analogues were titrated in a
concentration range of 0.05−250 µM. Incorrect dCTP analogues were titrated in a
concentration range of 25−2000 µM. Reaction products were separated via 20%
polyacrylamide gel electrophoresis containing 6 M urea. Dehydrated gels were exposed
to a phosphor screen, and the signal was detected by phosphorescence emission. The
intensities of the product and starting material bands were quantified using ImageQuant
(GE Healthcare); the fraction of product formed was plotted as a function of time (t).
Points were fitted to a single-exponential equation (Eq 2) using GraphPad Prism to obtain
an observed rate (k
obs
) for each of the dNTP concentrations.

15
(Eq 2) = (1−
!!
!"#
!
)
The k
obs
rates were plotted as a function of dNTP concentration and were fit to a
hyperbolic equation to identify k
pol
and K
d
, in accordance with Eq 3.
(Eq 3)
!"#
=
!
!"#
[!"#$]
!
!
![!"!"]

Reactions were performed in triplicate and are reported as means ± the standard
deviation.
2.4 Results
Using the β,γ-CXY dGTP analogue suite, we previously found that the rate
constant for pol β-catalyzed nucleotide insertion into single-nucleotide gapped DNA
decreased with increasing leaving group basicity, suggesting that a charge-altering
chemical process is involved in the RDS.
47,51-52
In the study reported here, our goal was
to determine if the rates of the K289M pol β sequence context-specific mutator variant
also decreased with increasing leaving group basicity.
18

2.4.1 Synthesis of dNTP Analogues

β,γ-CXY dGTP analogues 1a−j (Figure 2.2) have been reported previously.
47,51-
52,57-58
The corresponding β,γ-CXY analogues of dCTP have not been previously
described but were successfully prepared by similar methods. Thus, the morpholidate of
cytidtine 5′-monophosphate 4
54-55
was reacted with the appropriate methylene
bisphosphonate 3 and product dCTP analogue 2 obtained in high purity (>99%) by
preparative HPLC. Compounds 1b−d, 1g, 2a, 2c, 2e, and 2f were prepared and utilized as
∼1:1 CXY (X≠Y) diastereomer mixtures.
56

16

Figure 2.2 β,γ-dGTP and β,γ-dCTP analogues

2.4.2 Rates for Correct Incorporation by K289M Are Independent of the
Leaving Group

We initially measured the k
pol
and K
d
values of WT and K289M for incorporation
of the correct dGTP within the mutator sequence context. Representative kinetic traces
and the saturation binding plot for the parent dGTP are shown in Figure A22. WT pol β
binds tightly to the parent dGTP (K
d
= 2.3 ± 0.3 µM) and has rapid turnover activity (k
pol

= 27.6 ± 1.2 s
−1
). A significant catalytic phenotype of the K289M cancer variant is the
slow rate of polymerization of the correct dGTP nucleotide as compared to that of WT
(k
pol
= 0.9 ± 0.1 s
−1
; ∼30-fold reduction), although it binds tightly to dGTP (K
d
= 1.3 ± 0.3
µM).
Next, we measured k
pol
and K
d
for correct incorporation of a series of dGTP
analogues opposite template C by WT and the K289M variant. Figure 2.3 shows
representative kinetic traces (A and C) and saturation plots (B and D) for the

17
incorporation of a β,γ-CH
2
-dGTP analogue opposite template C by WT and K289M pol
β, respectively.

Figure 2.3 Single-turnover kinetics for the incorporation of the correct β,γ-CH2 dGTP.
Single-turnover kinetics of product formation by (A and B) WT and (C and D) K289M in the
presence of varying concentrations of dGTP β,γ-CH
2
opposite template C (blue, 0.25 µM; red, 0.5
µM; green, 1 µM; purple, 2.5 µM; orange, 5 µM; black, 10 µM; brown, 25 µM). The single-gap
DNA substrate used for these reactions is shown at the top. The templating dC is underlined and
shown in bold. Pol β and the CL-CP-CG DNA template with a single-nucleotide gap (750 and 50
nM, respectively) were premixed, and reactions were initiated upon mixing with dGTP on the
Kin-Tek rapid quench-flow apparatus for various times at 37 °C. Reactions were quenched with
EDTA, and the product was separated by PAGE. Bands were quantified, and product formed was
plotted as a function of time. Points were fitted to a single-exponential equation to obtain rates
(k
obs
) at each dGTP concentration. Rates were plotted as a function of dGTP β,γ-CH
2

concentration and fitted with a hyperbolic equation to obtain k
pol
and K
d
for (B) WT and (D)
K289M. The leaving group pK
a4
of dGTP β,γ-CH
2
is 10.5, which is much higher than that of the
parent dGTP. K
d
values of WT (7.1 ± 1.2 µM) and K289M (1.7 ± 0.1 µM) are unaffected by the
high pK
a4
. The k
pol
of WT is much slower than that of the parent (10.1 ± 0.7 s
−1
), but that of
K289M was unaffected (0.7 ± 0.0 s
−1
).

18

Table 2.1 Summary of WT Kinetic Data from Single-Turnover Activity
a

a
Values are reported as means ± the standard deviation of three or more repeats.
b
M-N is the
template-incoming dNTP, and -X- is the β,γ-bridging group.
c
pK
a4
values from ref 50.
d
Efficiency
is k
pol
/K
d
.

Table 2.2 Summary of K289M Kinetic Data from Single-Turnover Activity
a

a
Values are reported as means ± the standard deviation of three or more repeats.
b
M-N is the
template-incoming dNTP, and -X- is the β,γ-bridging group.
c
pK
a4
values from ref 50.
d
Efficiency
is k
pol
/K
d
.

19

Figure 2.4 Brønsted correlation plots for correct nucleotide insertion.
Brønsted correlation plot of log(k
pol
) vs leaving group pK
a4
for the correct incorporation of dGTP
analogues opposite template C by WT (blue) and K289M (red) Pol β. Points were fitted with the
equation of a line to generate the slopes. (A) Additional methylated and monohalogenated
analogues show similar patterns at pK
a4
< 10.5 (WT, −0.4; K289M, −0.04). A break in the line
occurs at pK
a4
> 10.5, representing a change in the RDS for both WT and K289M (WT, −1.3;
K289M, −0.78). (B) Incorporation of dihalogenated dGTP analogues by K289M is only weakly
dependent on pK
a4
, as shown by the shallow slope of −0.25 compared to that of WT (−0.63).

Tables 2.1 (WT) and 2.2 (K289M) report k
pol
and K
d
values for each of the
analogues. The tested analogues are grouped as previously reported:
26,31-32
analogues that
dihalogenated substituents as one group termed the dihalogenated dNTPs and the
remaining analogues containing methylated, monohalogenated, and parent dNTPs
grouped together and termed “the other analogues”.
Log(k
pol
) and pK
a4
for the other analogues correlate in a linear fashion, as shown in
Figure 2.4.A. WT pol β exhibits a strong dependence of log (k
pol
) on the pK
a4
of the
bisphosphonate leaving groups, with a slope of −0.4 (Figure 2.4.A, blue line), whereas β
is close to zero for the K289M variant [−0.046 (Figure 2.4.A, red line)]. This suggests
that one of the relative rate constants of the reaction mechanism may differ for the
K289M cancer-associated variant compared to that of WT pol β.

20
The β,γ-CHF bisphosphonate leaving group has a pK
a4
close to that of
pyrophosphate from the natural parent dGTP,
56
and although the binding affinity
decreases 3-fold, k
pol
is similar to that of the parent dGTP. The β,γ-CHCl bisphosphonate
has a pK
a4
of 9.5; in addition to a 3-fold decrease in binding affinity, k
pol
decreases 1.5-
fold. The β,γ-CH
2
bisphosphonate has a high pK
a4
of 10.5, compared to a value of 8.9 for
pyrophosphate. This is reflected in the corresponding k
pol
of 10.1 s
−1
, which is 3-fold
lower than that of the parent dGTP.
Similar results were obtained with the dihalogenated compounds, which is shown
in Figure 2.4.B (blue line, WT; red line, K289M). This relationship shows that the WT
activity follows a strong negative dependence on pK
a4
(β is −0.63). The catalytic rate
decreases from 44 s
−1
for the β,γ-CF
2
dGTP, which has a pK
a4
of 7.8, to 3.7 s
−1
for the
β,γ-CBr
2
, which has a pK
a4
of 9.3 (Table 2.1). Strikingly, for K289M, the dependence of
k
pol
on pK
a4
is less prominent: the rate decreases from 0.8 s
−1
for the β,γ-CF
2
dGTP to 0.3
s
−1
for the β,γ-CBr
2
(Table 2.2), and the slope of the Brønsted correlation for K289M is
−0.25 for the dihalogenated analogues (Figure 2.4.B, red line). In combination, our
results suggest that the K289M variant has a TS that is less dependent on charge
stabilization than WT pol β is. We speculate that for K289M there may be a change in the
equilibrium constant for one or more of the conformational changes that precede
chemistry.
33

2.4.3 The Correct LFERs Break at High pK
a4
Values

The WT enzyme is strongly dependent on pK
a4
, and the mutant is independent of
pK
a4
up to values of 10.5. However, the Brønsted relationship for both WT and K289M

21
pol β displays a break at high pK
a4
(Figure 2.4.A). This is likely to represent a change in
the TS structure for the WT. The rate of polymerization by WT becomes more dependent
on the pK
a4
, indicating that the TS is less stable at high pK
a4
. For the K289M variant, this
break indicates a change in the RDS at pK
a4
> 10.5 from a prechemistry step where a
leaving group effect is not observed to a chemistry step where the basicity of the leaving
group moiety influences the rate. A break of this nature, for WT or K289M, has not been
reported previously.
2.4.4 K289M and WT Exhibit a Similar Dependence on the pK
a4
of the
Leaving Group for Incorrect Incorporation

Figure 2.5 Brønsted correlation plots for incorrect nucleotide insertion.
Brønsted correlation plots for the incorporation of the incorrect dCTP analogues opposite
template C for WT (blue) and K289M (red) pol β. The relationship for the K289M variant mimics
that of the WT. The relationship is linear, and both have increased sensitivity to pK
a4
compared to
that for correct insertion (WTother, −0.6; WTdihalogenated, −1.7; K289Mother, −0.6;
K289Mdihalogenated, −1.0).

The LFER for incorrect dCTP incorporation for each of the enzymes is linear and
is shown in Figure 2.5. The WT and K289M enzymes are similarly sensitive to pK
a4
,
although the reaction rates of K289M are slower than what is observed for WT. For the

22
dihalogenated analogues, β,γ-CF2 dCTP binds to WT and K289M with similar affinities
but K289M has a 10-fold lower k
pol
(Tables 2.1 and 2.2). The β,γ-CFCl dCTP binds more
tightly to both the WT and K289M pol β than the parent dCTP does, and the k
pol
is 10-
fold lower for K289M (Tables 2.1 and 2.2). The β,γ-CCl
2
dCTP analogue is intriguing
because it exhibits similar k
pol
values and weak binding for both WT and K289M; the
Brønsted correlation lines for WT and K289M converge at this point (Figure 2.5). The
sensitivity to leaving group pK
a4
of the incorrect dihalogenated analogues results in steep
slopes of −1.7 for WT and −1.0 for K289M, consistent with a RDS dependent on
chemistry sensitive to leaving group charge, though with different degrees of charge
buildup at the TS.
The reaction rates of WT and K289M display a similar dependence on the pK
a4

for the other analogues. The slope from the Brønsted correlation is −0.6 for both the WT
and K289M. The polymerization rates catalyzed by K289M are consistently 10-fold
slower than those of WT, resulting in similar LFER slopes. Additionally, the binding
affinity of WT for the analogues is similar to that of K289M, with the exception of β,γ-
CHBr, which binds with better affinity to WT. The dependency of the reaction rates on
the pK
a4
for K289M suggests that the charge buildup at the TS for this variant is similar
to that of WT pol β for incorrect incorporation.
2.4.5 K289M Becomes More Accurate in the Presence of the Analogues

As this mutant is a fidelity mutant, we compared the fidelity of the WT and
K289M enzymes for the analogue substrates and also for the analogues versus the parent
dNTP (Table 2.3). In comparison to those of the parent compounds, the fidelity of both
WT and K289M is increased with each of the analogues (Table 2.3, column 4). The

23
increase in fidelity observed between the analogues and the parent compound is greatest
for K289M (Table 2.3, column 4, F analogue/parent). For WT, fidelity is increased
∼1.5−2.5-fold with the analogs compared to that with the parent compound, the exception

Table 2.3 Fidelity of WT and K289M

a
Fidelity, F, is calculated from [efficiency
(correct)
+ efficiency
(correct)
]/efficiency
(incorrect)
.
b
F analogue/F parent.
c
[F K289M
(analogue)
]/[F WT
(analogue)
].
d
[F K289M
(analogue/parent)
]/[F WT
(analogue/parent)
].

being CCl
2
for which the increase is ∼37-fold. However, the fidelity of K289M is
increased 12−22-fold versus that of the parent compound (Table 2.3, column 4, F
analogue/parent) in most cases, the exceptions being CFCl and CHF, for which the
observed increase in fidelity is only ∼3−6-fold. For the majority of the analogues, the
mechanistic basis for the increased fidelity of K289M is discrimination predominantly at
the level of substrate binding (Table 2.4). When compared to K289M, WT exhibits an
increased level of discrimination for the analogues themselves at the level of k
pol
.
However, K289M exhibits an increased level of discrimination over what is observed for
WT (analogue/parent) at the level of k
pol
(Table 2.5). Therefore, in most cases, the fidelity
of K289M is greatly increased when the analogues, rather than the parent compound, are
substrates for polymerization.

24

Table 2.4 Discrimination at K
d
by WT and K289M
a
Discrimination, D, at K
d
c
is calculated from K
d(incorrect)
/K
d(correct)
.
b
D K
d
analogue/D K
d
parent. D K
d
K289M analogue/D K
d
WT analogue.

Table 2.5 Discrimination at k
pol
by WT and K289M
a
Discrimination, D, at k
pol
is calculated from k
pol(correct)
/k
pol(incorrect)
.
b
D k
pol
analogue/D k
pol
parent.
c
D
k
pol
WT analogue/D k
pol
K289M analogue.

25
2.5 Discussion
In this study, we show that the rate of nucleotidyl transfer of the K289M colon
cancer-associated mutator variant of pol β is significantly less dependent upon the pK
a4
of
the leaving group than that of WT pol β for incorporation of the correct dNTP analogue.
In addition, K289M exhibits a stronger dependence on the pK
a4
of the leaving group for
incorporation of the incorrect dCTP analogues versus the correct dGTP analogues.
However, K289M is less dependent on the pK
a4
of the leaving groups of the incorrect
dihalogenated dCTP analogues than WT pol β is. In combination, our results suggest that
one of the relative rate constants differs for a step along the reaction coordinate of
K289M compared to that of WT pol β in a manner different than for the incorporation of
the correct dGTP analogue at pK
a4
< 10.5, which like dCTP analogue incorporation by
K289M is more similar to that of WT pol β.
We also show that the fidelity of K289M increases in the presence of several
dNTP analogues, and that the discrimination at the level of dNTP binding is also
increased (Table 2.4). This suggests that alteration of Lys289 to Met results in an enzyme
with a significantly altered dNTP binding pocket that facilitates selection of correct
dNTPs carrying specific modifications of β,γ-CXY bridging groups.
A Change at Lys289 Leads to a Change in One or More of the Relative Rates of the
Mechanism for Correct Incorporation. Results from our work demonstrate a negative
dependence of the TS for correct incorporation by WT on the leaving group pK
a4
of the
dNTP analogue substrate, as indicated by the LFER slopes (β is −0.6 for dihalogenated
and −0.4 for other substituted analogues) (Figure 2.4), consistent with a TS in which

26
leaving group departure is implicated, as previously proposed.
14,43,51,56,60

Our work focusing on the K289M cancer-associated variant shows that the mutant
enzyme has a significantly decreased dependence on the leaving group pK
a4
for the
correct dGTP analogues, as shown by the LFER slopes (−0.25 for dihalogenated and
−0.04 for other substituted analogues) (Figure 2.4). This suggests that K289M catalyzes
polymerization of correct dNTPs via the formation of a TS that is less dependent on
charge differences in the leaving group. Although Lys289 is located at a distal location
from the active site, removing the positively charged lysine and replacing it with a neutral
methionine alters the kinetic phenotype, i.e., reaction pathway, of the enzyme
predominantly for correct incorporation. More specifically, Lys289 is located in the
fingers subdomain on helix N (residues 275−289). This particular helix has been shown
by time-resolved X-ray crystallography to move closer to the minor groove of the DNA
upon binding of the correct dNTP. Our previous FRET studies using WT pol β also
provide evidence that one or more conformational changes occur during correct dNTP
incorporation of dGTP opposite template C in the primer−template substrate
T(−8)D:3′OH. This is the DNA sequence utilized in the majority of crystal structures of
pol β, with the exception of a Dabcyl label at position −8 in the template and not the
DNA primer−template used in this study (Scheme 2.1).
33

Knowing that the alteration of Lys289 to Met does not significantly change K
d

(Table 2.2) and that the alteration of Lys to Met results in product formation independent
of charge differences in the leaving group, we speculate that there is a change in the
equilibrium constant for one of these conformational changes that precedes chemistry.

27

Scheme 2.1 Biochemical Pathway for Nucleotide Incorporation by WT Pol β in the Presence
of the Crystal Structure Primer−Template Substrate T(−8)D:3′OH
a

a
The binary complex, β-DNA , binds dNTP with a specific Kn d(dNTP) (step 2). Binding of dNTP
leads to conformational changes (steps 3 and 3.1), which align the active site for nucleophilic
attack. The rate of DNA polymerization is designated as step 3.2. Finally, product DNA (DNA
n+1
)
is released in step 4. This reaction pathway was adapted from ref 32.

Lys289 is located at the distal end of the helix, away from the active site (Figure
2.6). Molecular dynamics simulations show that the ε-amino group of Lys289 forms a
salt bridge with Glu288 in the binary structure and with Gln324 in the ternary complex,
which makes it important for the formation of the ternary complex and the alignment of
the active site for activity
61
(Figure 2.6). The crystal structure also shows that Lys289
moves 12 Å closer to the terminal phosphate of the downstream strand of the double-
stranded DNA. This long-distance DNA interaction with the positively charged Lys289
may be important for the closing of the fingers subdomain to prepare the active site for
chemistry. The loss of the positively charged Lys289 may destabilize the closing of the
fingers subdomain upon dNTP binding, making the reaction independent of the β,γ-
bridging substitution for pK
a4
< 10.5, and reducing activity.

28
WT and K289M Exhibit Similar Relative Rates along the Reaction Coordinate for
Misincorporation. Both WT and K289M enzymes have a large negative LFER slope for
misincorporation (WT
other
, −0.6; WT
dihalogenated
, −1.7; K289M
other
, −0.6; K289M
dihalogenated
,
−1.0) (Figure 2.5). The slope suggests that chemistry is rate-limiting for both WT and
K289M and that the TS has a highly charged characteristic that is very sensitive to
leaving group pK
a4
. The RDS for WT and K289M during the incorrect incorporation of C
opposite templating C has not been previously investigated, and we provide evidence
consistent with it being a chemical step. Previous work from our lab and others indicates
that one or more conformational changes preceding chemistry may be very slow for
incorporation of the incorrect dNTP and may approach reaction rates measured in this
study.
33,45,62-63

Our previous FRET studies, in addition to recent NMR work, suggest that the
closing of the fingers subdomain is most stable during correct incorporation and is
destabilized during misincorporation.
33-34
Closing of the fingers subdomain is proposed to
align the active site for the inline attack, which makes it important for the formation of
the TS. The rate of reverse closing is in fact significantly slower than the rate of
chemistry during correct nucleotide incorporation, which commits the enzyme to
chemistry.
33
This is consistent with previous reports about HIV RT and T7
polymerase.
33,36,39
Our recent work suggests that misincorporation may occur in the
absence of one or more stable conformational changes.
33
Thus, if the K289M mutation
destabilizes the formation of the closed ternary complex, the mutation will not be limiting
for misincorporation and will limit only correct dNTP incorporation.
The Analogues Improve the Fidelity of K289M. We show that most of the

29
analogues rescue the low-fidelity phenotype of K289M (Table 2.3). Although the K289M
cancer variant exhibits less discrimination than WT does at the k
pol
level (Table 2.5), the
analogues improve discrimination at the level of ground state binding for K289M (Table
2.4). This results predominantly from the improved affinity of K289M versus that of WT
for the correct analogues as WT and K289M exhibit similar affinities for the incorrect
analogues. Although the activity is low, the higher binding affinity for the correct
analogues commits the enzyme to catalyze the correct incorporation.
One of the hallmarks of fingers closing is the repositioning of Arg183 to form a
hydrogen bond with P
β
of the incoming correct nucleotide.
64-65
If the fingers subdomain
in K289M does not close in a stable manner, the Arg183 residue is proposed to be distant
from the bound dNTP. Therefore, if the bridging groups potentially cause steric clashes
with Arg183, this will not occur with K289M if it is unable to form a stable closed
structure. This could explain why there is increased discrimination for the correct
analogues at the level of dNTP binding in the presence of Met289. Alternatively, the
dNTP binding pocket of K289M may be altered in some other manner that promotes
tighter binding of the correct dNTP analogues.
Mutator variants have the ability to drive carcinogenesis, and we have previously
shown that expression of K289M in immortal but nontransformed cells induces cellular
transformation.
18
Increased levels of mutagenesis induced by a mutator polymerase also
have the ability to promote resistance to chemotherapeutic drugs that affect DNA.
Specific dNTP analogues targeting enzymes that drive a mutator phenotype in tumors
may be useful in limiting mutagenesis that leads to drug resistance, a hypothesis that will
be tested in future experiments.

30

Figure 2.6 Active site assembly of WT human DNA pol β and the location of Lys289.
α-Helix N closes over the incoming nucleotide, in this case (R)-β,γ-fluoromethylene-dGTP. The
ternary complex (gold) positions the nascent base pair (templating base and the incoming
nucleotide), so that it is sandwiched between the primer terminus and α-helix N side chains. In
the closed (ternary) conformation, Arg283 (R283) located in the middle of α-helix N interacts
(dashed line) with the sugar of the Tn-1 templating strand nucleotide. The methylene side chains
of Asp276 (D276) and Lys280 (K280) stack with the bases of the incoming and templating
nucleotides, respectively. Asp190 (D190), Asp192 (D192), and Asp256 (D256) coordinate the
metal ions in the active site, and several other interactions are also shown. Lys289 (K289) forms a
salt bridge with Gln324 (Q324) in the ternary complex, and this stabilizes α-helix N in the closed
conformation. The K289M variant enzyme could have an alteration in the position of α-helix N in
the closed ternary complex. Protein Data Bank codes for the binary and ternary complex crystal
structures are 1BPX
66
and 2PXI,
56
respectively.

2.6 Conclusions
In summary, we show that a single mutation in pol β can lead to changes in the
relative rate constants for catalysis of correct incorporation of dGTP. This K289M
mutation may slow prechemical conformational changes upon dNTP binding that make
the rate of product formation less dependent on variation in the basicity of the leaving

31
group. For incorrect incorporation, the K289M and WT enzymes exhibit similar dNTP
binding affinities, and their rate constants show a similar dependence on the pK
a4
of the
leaving group in the dNTP analogues. This unexpected result demonstrates that despite
its distal position relative to the active site in the ground state conformation of the
protein, Lys289Met modulates the relative rate constants for correct and incorrect
incorporation in different ways, suggesting that it (and possibly other pol β variants) is a
plausible target for therapeutic inhibition.

32
2.7 References

1. Alnajjar, K. S.; Garcia-Barboza, B.; Negahbani, A.; Nakhjiri, M.; Kashemirov,
B.; McKenna, C.; Goodman, M. F.; Sweasy, J. B., A Change in the Rate-
Determining Step of Polymerization by the K289M DNA Polymerase beta
Cancer-Associated Variant. Biochemistry 2017, 56 (15), 2096-2105.
2. Wallace, S. S.; Murphy, D. L.; Sweasy, J. B., Base excision repair and cancer.
Cancer Lett. 2012, 327 (1-2), 73-89.
3. Donigan, K. A.; Sun, K. W.; Nemec, A. A.; Murphy, D. L.; Cong, X.; Northrup,
V.; Zelterman, D.; Sweasy, J. B., Human POLB gene is mutated in high
percentage of colorectal tumors. J Biol Chem 2012, 287 (28), 23830-9.
4. Starcevic, D.; Dalal, S.; Sweasy, J. B., Is there a link between DNA polymerase
beta and cancer? Cell cycle (Georgetown, Tex.) 2004, 3 (8), 998-1001.
5. Murphy, D. L.; Donigan, K. A.; Jaeger, J.; Sweasy, J. B., The E288K colon tumor
variant of DNA polymerase beta is a sequence specific mutator. Biochemistry
2012, 51 (26), 5269-75.
6. Dalal, S.; Hile, S.; Eckert, K. A.; Sun, K. W.; Starcevic, D.; Sweasy, J. B.,
Prostate-cancer-associated I260M variant of DNA polymerase beta is a sequence-
specific mutator. Biochemistry 2005, 44 (48), 15664-73.
7. Nemec, A. A.; Donigan, K. A.; Murphy, D. L.; Jaeger, J.; Sweasy, J. B., Colon
cancer-associated DNA polymerase beta variant induces genomic instability and
cellular transformation. J Biol Chem 2012, 287 (28), 23840-9.
8. Nemec, A. A.; Murphy, D. L.; Donigan, K. A.; Sweasy, J. B., The S229L colon
tumor-associated variant of DNA polymerase beta induces cellular transformation
as a result of decreased polymerization efficiency. J Biol Chem 2014, 289 (20),
13708-16.
9. Eckenroth, B. E.; Towle-Weicksel, J. B.; Sweasy, J. B.; Doublie, S., The E295K
cancer variant of human polymerase beta favors the mismatch conformational
pathway during nucleotide selection. J Biol Chem 2013, 288 (48), 34850-60.
10. Yamtich, J.; Nemec, A. A.; Keh, A.; Sweasy, J. B., A germline polymorphism of
DNA polymerase beta induces genomic instability and cellular transformation.
PLoS Genet. 2012, 8 (11), e1003052.
11. Lang, T.; Dalal, S.; Chikova, A.; DiMaio, D.; Sweasy, J. B., The E295K DNA
polymerase beta gastric cancer-associated variant interferes with base excision
repair and induces cellular transformation. Mol. Cell. Biol. 2007, 27 (15), 5587-
96.
12. Yamtich, J.; Sweasy, J. B., DNA polymerase family X: function, structure, and
cellular roles. Biochim. Biophys. Acta 2010, 1804 (5), 1136-50.
13. Matsumoto, Y.; Kim, K., Excision of deoxyribose phosphate residues by DNA
polymerase beta during DNA repair. Science 1995, 269 (5224), 699-702.

33
14. Freudenthal, B. D.; Beard, W. A.; Shock, D. D.; Wilson, S. H., Observing a DNA
polymerase choose right from wrong. Cell 2013, 154 (1), 157-68.
15. Steitz, T. A.; Steitz, J. A., A general two-metal-ion mechanism for catalytic RNA.
Proc. Natl. Acad. Sci. U. S. A. 1993, 90 (14), 6498-502.
16. Pelletier, H.; Sawaya, M. R.; Kumar, A.; Wilson, S. H.; Kraut, J., Structures of
ternary complexes of rat DNA polymerase beta, a DNA template-primer, and
ddCTP. Science 1994, 264 (5167), 1891-903.
17. Joyce, C. M.; Steitz, T. A., Polymerase structures and function: variations on a
theme? J. Bacteriol. 1995, 177 (22), 6321-9.
18. Lang, T.; Maitra, M.; Starcevic, D.; Li, S. X.; Sweasy, J. B., A DNA polymerase
beta mutant from colon cancer cells induces mutations. Proc. Natl. Acad. Sci. U.
S. A. 2004, 101 (16), 6074-9.
19. Washington, S. L.; Yoon, M. S.; Chagovetz, A. M.; Li, S. X.; Clairmont, C. A.;
Preston, B. D.; Eckert, K. A.; Sweasy, J. B., A genetic system to identify DNA
polymerase beta mutator mutants. Proc. Natl. Acad. Sci. U. S. A. 1997, 94 (4),
1321-6.
20. Kosa, J. L.; Sweasy, J. B., 3'-Azido-3'-deoxythymidine-resistant mutants of DNA
polymerase beta identified by in vivo selection. J Biol Chem 1999, 274 (6), 3851-
8.
21. Shah, A. M.; Conn, D. A.; Li, S. X.; Capaldi, A.; Jager, J.; Sweasy, J. B., A DNA
polymerase beta mutator mutant with reduced nucleotide discrimination and
increased protein stability. Biochemistry 2001, 40 (38), 11372-81.
22. Shah, A. M.; Li, S. X.; Anderson, K. S.; Sweasy, J. B., Y265H mutator mutant of
DNA polymerase beta. Proper teometric alignment is critical for fidelity. J Biol
Chem 2001, 276 (14), 10824-31.
23. Clairmont, C. A.; Narayanan, L.; Sun, K. W.; Glazer, P. M.; Sweasy, J. B., The
Tyr-265-to-Cys mutator mutant of DNA polymerase beta induces a mutator
phenotype in mouse LN12 cells. Proc. Natl. Acad. Sci. U. S. A. 1999, 96 (17),
9580-5.
24. Dalal, S.; Kosa, J. L.; Sweasy, J. B., The D246V mutant of DNA polymerase beta
misincorporates nucleotides: evidence for a role for the flexible loop in DNA
positioning within the active site. J Biol Chem 2004, 279 (1), 577-84.
25. Kosa, J. L.; Sweasy, J. B., The E249K mutator mutant of DNA polymerase beta
extends mispaired termini. J Biol Chem 1999, 274 (50), 35866-72.
26. Lin, G. C.; Jaeger, J.; Eckert, K. A.; Sweasy, J. B., Loop II of DNA polymerase
beta is important for discrimination during substrate binding. DNA Repair (Amst)
2009, 8 (2), 182-9.
27. Maitra, M.; Gudzelak, A., Jr.; Li, S. X.; Matsumoto, Y.; Eckert, K. A.; Jager, J.;
Sweasy, J. B., Threonine 79 is a hinge residue that governs the fidelity of DNA
polymerase beta by helping to position the DNA within the active site. J Biol
Chem 2002, 277 (38), 35550-60.

34
28. Murphy, D. L.; Kosa, J.; Jaeger, J.; Sweasy, J. B., The Asp285 variant of DNA
polymerase beta extends mispaired primer termini via increased nucleotide
binding. Biochemistry 2008, 47 (31), 8048-57.
29. Starcevic, D.; Dalal, S.; Jaeger, J.; Sweasy, J. B., The hydrophobic hinge region
of rat DNA polymerase beta is critical for substrate binding pocket geometry. J
Biol Chem 2005, 280 (31), 28388-93.
30. Yamtich, J.; Starcevic, D.; Lauper, J.; Smith, E.; Shi, I.; Rangarajan, S.; Jaeger, J.;
Sweasy, J. B., Hinge residue I174 is critical for proper dNTP selection by DNA
polymerase beta. Biochemistry 2010, 49 (11), 2326-34.
31. Donigan, K. A.; Hile, S. E.; Eckert, K. A.; Sweasy, J. B., The human gastric
cancer-associated DNA polymerase beta variant D160N is a mutator that induces
cellular transformation. DNA Repair (Amst) 2012, 11 (4), 381-90.
32. Sweasy, J. B.; Lang, T.; Starcevic, D.; Sun, K. W.; Lai, C. C.; Dimaio, D.; Dalal,
S., Expression of DNA polymerase {beta} cancer-associated variants in mouse
cells results in cellular transformation. Proc. Natl. Acad. Sci. U. S. A. 2005, 102
(40), 14350-5.
33. Towle-Weicksel, J. B.; Dalal, S.; Sohl, C. D.; Doublie, S.; Anderson, K. S.;
Sweasy, J. B., Fluorescence resonance energy transfer studies of DNA
polymerase beta: the critical role of fingers domain movements and a novel non-
covalent step during nucleotide selection. J Biol Chem 2014, 289 (23), 16541-50.
34. Moscato, B.; Swain, M.; Loria, J. P., Induced Fit in the Selection of Correct
versus Incorrect Nucleotides by DNA Polymerase beta. Biochemistry 2016, 55
(2), 382-95.
35. Kellinger, M. W.; Johnson, K. A., Nucleotide-dependent conformational change
governs specificity and analog discrimination by HIV reverse transcriptase. Proc.
Natl. Acad. Sci. U. S. A. 2010, 107 (17), 7734-9.
36. Kellinger, M. W.; Johnson, K. A., Role of induced fit in limiting discrimination
against AZT by HIV reverse transcriptase. Biochemistry 2011, 50 (22), 5008-15.
37. Kirmizialtin, S.; Nguyen, V.; Johnson, K. A.; Elber, R., How conformational
dynamics of DNA polymerase select correct substrates: experiments and
simulations. Structure 2012, 20 (4), 618-27.
38. Kirmizialtin, S.; Johnson, K. A.; Elber, R., Enzyme Selectivity of HIV Reverse
Transcriptase: Conformations, Ligands, and Free Energy Partition. J. Phys. Chem.
B 2015, 119 (35), 11513-26.
39. Jin, Z.; Johnson, K. A., Role of a GAG hinge in the nucleotide-induced
conformational change governing nucleotide specificity by T7 DNA polymerase.
J Biol Chem 2011, 286 (2), 1312-22.
40. Kunkel, T. A., The mutational specificity of DNA polymerase-beta during in vitro
DNA synthesis. Production of frameshift, base substitution, and deletion
mutations. J Biol Chem 1985, 260 (9), 5787-96.

35
41. Showalter, A. K.; Tsai, M. D., A reexamination of the nucleotide incorporation
fidelity of DNA polymerases. Biochemistry 2002, 41 (34), 10571-6.
42. Zhong, X.; Patel, S. S.; Werneburg, B. G.; Tsai, M. D., DNA polymerase beta:
multiple conformational changes in the mechanism of catalysis. Biochemistry
1997, 36 (39), 11891-900.
43. Radhakrishnan, R.; Arora, K.; Wang, Y.; Beard, W. A.; Wilson, S. H.; Schlick,
T., Regulation of DNA repair fidelity by molecular checkpoints: "gates" in DNA
polymerase beta's substrate selection. Biochemistry 2006, 45 (51), 15142-56.
44. Roettger, M. P.; Bakhtina, M.; Tsai, M. D., Mismatched and matched dNTP
incorporation by DNA polymerase beta proceed via analogous kinetic pathways.
Biochemistry 2008, 47 (37), 9718-27.
45. Radhakrishnan, R.; Schlick, T., Correct and incorrect nucleotide incorporation
pathways in DNA polymerase beta. Biochem. Biophys. Res. Commun. 2006, 350
(3), 521-9.
46. Joyce, C. M.; Benkovic, S. J., DNA polymerase fidelity: kinetics, structure, and
checkpoints. Biochemistry 2004, 43 (45), 14317-24.
47. Sucato, C. A.; Upton, T. G.; Kashemirov, B. A.; Batra, V. K.; Martinek, V.;
Xiang, Y.; Beard, W. A.; Pedersen, L. C.; Wilson, S. H.; McKenna, C. E.;
Florian, J.; Warshel, A.; Goodman, M. F., Modifying the beta,gamma leaving-
group bridging oxygen alters nucleotide incorporation efficiency, fidelity, and the
catalytic mechanism of DNA polymerase beta. Biochemistry 2007, 46 (2), 461-71.
48. Joyce, C. M.; Steitz, T. A., Function and structure relationships in DNA
polymerases. Annu. Rev. Biochem. 1994, 63, 777-822.
49. Wells, P. R., Linear Free Energy Relationships. Chem. Rev. 1963, 62 (2), 171-
219.
50. Lowry, T. H. R., K. S., Mechanism and Theory in Organic Chemistry. 3rd ed.;
Harper & Row: New York, 1987.
51. Sucato, C. A.; Upton, T. G.; Kashemirov, B. A.; Osuna, J.; Oertell, K.; Beard, W.
A.; Wilson, S. H.; Florian, J.; Warshel, A.; McKenna, C. E.; Goodman, M. F.,
DNA polymerase beta fidelity: halomethylene-modified leaving groups in pre-
steady-state kinetic analysis reveal differences at the chemical transition state.
Biochemistry 2008, 47 (3), 870-9.
52. Oertell, K.; Chamberlain, B. T.; Wu, Y.; Ferri, E.; Kashemirov, B. A.; Beard, W.
A.; Wilson, S. H.; McKenna, C. E.; Goodman, M. F., Transition state in DNA
polymerase beta catalysis: rate-limiting chemistry altered by base-pair
configuration. Biochemistry 2014, 53 (11), 1842-8.
53. Oertell, K.; Wu, Y.; Zakharova, V. M.; Kashemirov, B. A.; Shock, D. D.; Beard,
W. A.; Wilson, S. H.; McKenna, C. E.; Goodman, M. F., Effect of beta,gamma-
CHF- and beta,gamma-CHCl-dGTP halogen atom stereochemistry on the
transition state of DNA polymerase beta. Biochemistry 2012, 51 (43), 8491-501.

36
54. Moffatt, J. G., A general Synthesis of Nucleosides-5' Triphosphate. Can. J. Chem.
1964, 42, 599-604.
55. Moffatt, J. G., and Khorana, H. G., Nucleoside Polyphosphates. X.1 The
Synthesis and Some Reactions of Nucleo- side-5′ Phosphoromorpholidates and
Related Compounds. Improved Methods for the Preparation of Nucleoside-5′
Polyphosphates. J. Am. Chem. Soc. 1961, 83, 684-658.
56. McKenna, C. E.; Kashemirov, B. A.; Upton, T. G.; Batra, V. K.; Goodman, M. F.;
Pedersen, L. C.; Beard, W. A.; Wilson, S. H., (R)-beta,gamma-fluoromethylene-
dGTP-DNA ternary complex with DNA polymerase beta. J. Am. Chem. Soc.
2007, 129 (50), 15412-3.
57. Upton, T. G.; Kashemirov, B. A.; McKenna, C. E.; Goodman, M. F.; Prakash, G.
K.; Kultyshev, R.; Batra, V. K.; Shock, D. D.; Pedersen, L. C.; Beard, W. A.;
Wilson, S. H., Alpha,beta-difluoromethylene deoxynucleoside 5'-triphosphates: a
convenient synthesis of useful probes for DNA polymerase beta structure and
function. Org. Lett. 2009, 11 (9), 1883-6.
58. Batra, V. K.; Pedersen, L. C.; Beard, W. A.; Wilson, S. H.; Kashemirov, B. A.;
Upton, T. G.; Goodman, M. F.; McKenna, C. E., Halogenated beta,gamma-
methylene- and ethylidene-dGTP-DNA ternary complexes with DNA polymerase
beta: structural evidence for stereospecific binding of the fluoromethylene
analogues. J. Am. Chem. Soc. 2010, 132 (22), 7617-25.
59. Dalal, S.; Starcevic, D.; Jaeger, J.; Sweasy, J. B., The I260Q variant of DNA
polymerase beta extends mispaired primer termini due to its increased affinity for
deoxynucleotide triphosphate substrates. Biochemistry 2008, 47 (46), 12118-25.
60. Lin, P.; Pedersen, L. C.; Batra, V. K.; Beard, W. A.; Wilson, S. H.; Pedersen, L.
G., Energy analysis of chemistry for correct insertion by DNA polymerase beta.
Proc. Natl. Acad. Sci. U. S. A. 2006, 103 (36), 13294-9.
61. Klvana, M.; Murphy, D. L.; Jerabek, P.; Goodman, M. F.; Warshel, A.; Sweasy, J.
B.; Florian, J., Catalytic effects of mutations of distant protein residues in human
DNA polymerase beta: theory and experiment. Biochemistry 2012, 51 (44), 8829-
43.
62. Joyce, C. M.; Potapova, O.; Delucia, A. M.; Huang, X.; Basu, V. P.; Grindley, N.
D., Fingers-closing and other rapid conformational changes in DNA polymerase I
(Klenow fragment) and their role in nucleotide selectivity. Biochemistry 2008, 47
(23), 6103-16.
63. Santoso, Y.; Joyce, C. M.; Potapova, O.; Le Reste, L.; Hohlbein, J.; Torella, J. P.;
Grindley, N. D.; Kapanidis, A. N., Conformational transitions in DNA
polymerase I revealed by single-molecule FRET. Proc. Natl. Acad. Sci. U. S. A.
2010, 107 (2), 715-20.
64. Freudenthal, B. D.; Beard, W. A.; Wilson, S. H., Structures of dNTP intermediate
states during DNA polymerase active site assembly. Structure 2012, 20 (11),
1829-37.

37
65. Kraynov, V. S.; Showalter, A. K.; Liu, J.; Zhong, X.; Tsai, M. D., DNA
polymerase beta: contributions of template-positioning and dNTP triphosphate-
binding residues to catalysis and fidelity. Biochemistry 2000, 39 (51), 16008-15.
66. Sawaya, M. R.; Prasad, R.; Wilson, S. H.; Kraut, J.; Pelletier, H., Crystal
structures of human DNA polymerase beta complexed with gapped and nicked
DNA: evidence for an induced fit mechanism. Biochemistry 1997, 36 (37), 11205-
15.

38
BIBLIOGRAPHY

1. Batra, V. K.; Pedersen, L. C.; Beard, W. A.; Wilson, S. H.; Kashemirov, B. A.;
Upton, T. G.; Goodman, M. F.; McKenna, C. E., Halogenated beta,gamma-
methylene- and ethylidene-dGTP-DNA ternary complexes with DNA polymerase
beta: structural evidence for stereospecific binding of the fluoromethylene
analogues. J. Am. Chem. Soc. 2010, 132 (22), 7617-25.

2. Beard, W. A.; Wilson, S. H., Structure and mechanism of DNA polymerase Beta.
Chem. Rev. 2006, 106 (2), 361-82.

3. Canitrot, Y.; Frechet, M.; Servant, L.; Cazaux, C.; Hoffmann, J. S.,
Overexpression of DNA polymerase beta: a genomic instability enhancer process.
FASEB J. 1999, 13 (9), 1107-11.

4. Chamberlain, B. T.; Batra, V. K.; Beard, W. A.; Kadina, A. P.; Shock, D. D.;
Kashemirov, B. A.; McKenna, C. E.; Goodman, M. F.; Wilson, S. H.,
Stereospecific formation of a ternary complex of (S)-alpha,beta-fluoromethylene-
dATP with DNA pol beta. ChemBioChem 2012, 13 (4), 528-30.

5. Clairmont, C. A.; Narayanan, L.; Sun, K. W.; Glazer, P. M.; Sweasy, J. B., The
Tyr-265-to-Cys mutator mutant of DNA polymerase beta induces a mutator
phenotype in mouse LN12 cells. Proc. Natl. Acad. Sci. U. S. A. 1999, 96 (17),
9580-5.

6. Dalal, S.; Hile, S.; Eckert, K. A.; Sun, K. W.; Starcevic, D.; Sweasy, J. B.,
Prostate-cancer-associated I260M variant of DNA polymerase beta is a sequence-
specific mutator. Biochemistry 2005, 44 (48), 15664-73.

7. Dalal, S.; Kosa, J. L.; Sweasy, J. B., The D246V mutant of DNA polymerase beta
misincorporates nucleotides: evidence for a role for the flexible loop in DNA
positioning within the active site. J Biol Chem 2004, 279 (1), 577-84.

8. Dalal, S.; Starcevic, D.; Jaeger, J.; Sweasy, J. B., The I260Q variant of DNA
polymerase beta extends mispaired primer termini due to its increased affinity for
deoxynucleotide triphosphate substrates. Biochemistry 2008, 47 (46), 12118-25.

9. Donigan, K. A.; Hile, S. E.; Eckert, K. A.; Sweasy, J. B., The human gastric
cancer-associated DNA polymerase beta variant D160N is a mutator that induces
cellular transformation. DNA Repair (Amst) 2012, 11 (4), 381-90.

10. Donigan, K. A.; Sun, K. W.; Nemec, A. A.; Murphy, D. L.; Cong, X.; Northrup,
V.; Zelterman, D.; Sweasy, J. B., Human POLB gene is mutated in high
percentage of colorectal tumors. J Biol Chem 2012, 287 (28), 23830-9.
11. Donigan, K. A.; Sun, K. W.; Nemec, A. A.; Murphy, D. L.; Cong, X.; Northrup,
V.; Zelterman, D.; Sweasy, J. B., Human POLB gene is mutated in high

39
percentage of colorectal tumors. J Biol Chem 2012, 287 (28), 23830-9.

12. Echols, H.; Goodman, M. F., Fidelity mechanisms in DNA replication. Annu. Rev.
Biochem. 1991, 60, 477-511.

13. Eckenroth, B. E.; Towle-Weicksel, J. B.; Sweasy, J. B.; Doublie, S., The E295K
cancer variant of human polymerase beta favors the mismatch conformational
pathway during nucleotide selection. J Biol Chem 2013, 288 (48), 34850-60.

14. Freudenthal, B. D.; Beard, W. A.; Shock, D. D.; Wilson, S. H., Observing a DNA
polymerase choose right from wrong. Cell 2013, 154 (1), 157-68.

15. Freudenthal, B. D.; Beard, W. A.; Wilson, S. H., Structures of dNTP intermediate
states during DNA polymerase active site assembly. Structure 2012, 20 (11),
1829-37.
16. Jin, Z.; Johnson, K. A., Role of a GAG hinge in the nucleotide-induced
conformational change governing nucleotide specificity by T7 DNA polymerase.
J Biol Chem 2011, 286 (2), 1312-22.

17. Joyce, C. M.; Benkovic, S. J., DNA polymerase fidelity: kinetics, structure, and
checkpoints. Biochemistry 2004, 43 (45), 14317-24.

18. Joyce, C. M.; Benkovic, S. J., DNA polymerase fidelity: kinetics, structure, and
checkpoints. Biochemistry 2004, 43 (45), 14317-24.

19. Joyce, C. M.; Potapova, O.; Delucia, A. M.; Huang, X.; Basu, V. P.; Grindley, N.
D., Fingers-closing and other rapid conformational changes in DNA polymerase I
(Klenow fragment) and their role in nucleotide selectivity. Biochemistry 2008, 47
(23), 6103-16.
20. Joyce, C. M.; Steitz, T. A., Function and structure relationships in DNA
polymerases. Annu. Rev. Biochem. 1994, 63, 777-822.

21. Joyce, C. M.; Steitz, T. A., Polymerase structures and function: variations on a
theme? J. Bacteriol. 1995, 177 (22), 6321-9.

22. Kellinger, M. W.; Johnson, K. A., Nucleotide-dependent conformational change
governs specificity and analog discrimination by HIV reverse transcriptase. Proc.
Natl. Acad. Sci. U. S. A. 2010, 107 (17), 7734-9.

23. Kellinger, M. W.; Johnson, K. A., Role of induced fit in limiting discrimination
against AZT by HIV reverse transcriptase. Biochemistry 2011, 50 (22), 5008-15.

24. Kirmizialtin, S.; Johnson, K. A.; Elber, R., Enzyme Selectivity of HIV Reverse
Transcriptase: Conformations, Ligands, and Free Energy Partition. J. Phys. Chem.
B 2015, 119 (35), 11513-26.

40
25. Kirmizialtin, S.; Nguyen, V.; Johnson, K. A.; Elber, R., How conformational
dynamics of DNA polymerase select correct substrates: experiments and
simulations. Structure 2012, 20 (4), 618-27.

26. Klvana, M.; Murphy, D. L.; Jerabek, P.; Goodman, M. F.; Warshel, A.; Sweasy, J.
B.; Florian, J., Catalytic effects of mutations of distant protein residues in human
DNA polymerase beta: theory and experiment. Biochemistry 2012, 51 (44), 8829-
43.

27. Kosa, J. L.; Sweasy, J. B., The E249K mutator mutant of DNA polymerase beta
extends mispaired termini. J Biol Chem 1999, 274 (50), 35866-72.

28. Kosa, J. L.; Sweasy, J. B., 3'-Azido-3'-deoxythymidine-resistant mutants of DNA
polymerase beta identified by in vivo selection. J Biol Chem 1999, 274 (6), 3851-
8.
29. Kraynov, V. S.; Showalter, A. K.; Liu, J.; Zhong, X.; Tsai, M. D., DNA
polymerase beta: contributions of template-positioning and dNTP triphosphate-
binding residues to catalysis and fidelity. Biochemistry 2000, 39 (51), 16008-15.

30. Kunkel, T. A., The mutational specificity of DNA polymerase-beta during in vitro
DNA synthesis. Production of frameshift, base substitution, and deletion
mutations. J Biol Chem 1985, 260 (9), 5787-96.

31. Lang, T.; Dalal, S.; Chikova, A.; DiMaio, D.; Sweasy, J. B., The E295K DNA
polymerase beta gastric cancer-associated variant interferes with base excision
repair and induces cellular transformation. Mol. Cell. Biol. 2007, 27 (15), 5587-
96.

32. Lang, T.; Maitra, M.; Starcevic, D.; Li, S. X.; Sweasy, J. B., A DNA polymerase
beta mutant from colon cancer cells induces mutations. Proc. Natl. Acad. Sci. U.
S. A. 2004, 101 (16), 6074-9.

33. Lin, G. C.; Jaeger, J.; Eckert, K. A.; Sweasy, J. B., Loop II of DNA polymerase
beta is important for discrimination during substrate binding. DNA Repair (Amst)
2009, 8 (2), 182-9.

34. Lin, P.; Pedersen, L. C.; Batra, V. K.; Beard, W. A.; Wilson, S. H.; Pedersen, L.
G., Energy analysis of chemistry for correct insertion by DNA polymerase beta.
Proc. Natl. Acad. Sci. U. S. A. 2006, 103 (36), 13294-9.

35. Lowry, T. H. R., K. S., Mechanism and Theory in Organic Chemistry. 3rd ed.;
Harper & Row: New York, 1987.

36. Maitra, M.; Gudzelak, A., Jr.; Li, S. X.; Matsumoto, Y.; Eckert, K. A.; Jager, J.;
Sweasy, J. B., Threonine 79 is a hinge residue that governs the fidelity of DNA
polymerase beta by helping to position the DNA within the active site. J Biol

41
Chem 2002, 277 (38), 35550-60.

37. Matsumoto, Y.; Kim, K., Excision of deoxyribose phosphate residues by DNA
polymerase beta during DNA repair. Science 1995, 269 (5224), 699-702.

38. McKenna, C. E.; Kashemirov, B. A.; Upton, T. G.; Batra, V. K.; Goodman, M. F.;
Pedersen, L. C.; Beard, W. A.; Wilson, S. H., (R)-beta,gamma-fluoromethylene-
dGTP-DNA ternary complex with DNA polymerase beta. J. Am. Chem. Soc.
2007, 129 (50), 15412-3.

39. Moffatt, J. G., and Khorana, H. G., Nucleoside Polyphosphates. X.1 The
Synthesis and Some Reactions of Nucleo- side-5′ Phosphoromorpholidates and
Related Compounds. Improved Methods for the Preparation of Nucleoside-5′
Polyphosphates. J. Am. Chem. Soc. 1961, 83, 684-658.

40. Moffatt, J. G., A general Synthesis of Nucleosides-5' Triphosphate. Can. J. Chem.
1964, 42, 599-604.

41. Moon, A. F.; Garcia-Diaz, M.; Batra, V. K.; Beard, W. A.; Bebenek, K.; Kunkel,
T. A.; Wilson, S. H.; Pedersen, L. C., The X family portrait: structural insights
into biological functions of X family polymerases. DNA Repair (Amst) 2007, 6
(12), 1709-25.

42. Moscato, B.; Swain, M.; Loria, J. P., Induced Fit in the Selection of Correct
versus Incorrect Nucleotides by DNA Polymerase beta. Biochemistry 2016, 55
(2), 382-95.

43. Murphy, D. L.; Donigan, K. A.; Jaeger, J.; Sweasy, J. B., The E288K colon tumor
variant of DNA polymerase beta is a sequence specific mutator. Biochemistry
2012, 51 (26), 5269-75.

44. Murphy, D. L.; Kosa, J.; Jaeger, J.; Sweasy, J. B., The Asp285 variant of DNA
polymerase beta extends mispaired primer termini via increased nucleotide
binding. Biochemistry 2008, 47 (31), 8048-57.

45. Nemec, A. A.; Donigan, K. A.; Murphy, D. L.; Jaeger, J.; Sweasy, J. B., Colon
cancer-associated DNA polymerase beta variant induces genomic instability and
cellular transformation. J Biol Chem 2012, 287 (28), 23840-9.

46. Nemec, A. A.; Murphy, D. L.; Donigan, K. A.; Sweasy, J. B., The S229L colon
tumor-associated variant of DNA polymerase beta induces cellular transformation
as a result of decreased polymerization efficiency. J Biol Chem 2014, 289 (20),
13708-16.

47. Oertell, K.; Chamberlain, B. T.; Wu, Y.; Ferri, E.; Kashemirov, B. A.; Beard, W.

42
A.; Wilson, S. H.; McKenna, C. E.; Goodman, M. F., Transition state in DNA
polymerase beta catalysis: rate-limiting chemistry altered by base-pair
configuration. Biochemistry 2014, 53 (11), 1842-8.

48. Oertell, K.; Wu, Y.; Zakharova, V. M.; Kashemirov, B. A.; Shock, D. D.; Beard,
W. A.; Wilson, S. H.; McKenna, C. E.; Goodman, M. F., Effect of beta,gamma-
CHF- and beta,gamma-CHCl-dGTP halogen atom stereochemistry on the
transition state of DNA polymerase beta. Biochemistry 2012, 51 (43), 8491-501.

49. Pelletier, H.; Sawaya, M. R.; Kumar, A.; Wilson, S. H.; Kraut, J., Structures of
ternary complexes of rat DNA polymerase beta, a DNA template-primer, and
ddCTP. Science 1994, 264 (5167), 1891-903.

50. Radhakrishnan, R.; Arora, K.; Wang, Y.; Beard, W. A.; Wilson, S. H.; Schlick,
T., Regulation of DNA repair fidelity by molecular checkpoints: "gates" in DNA
polymerase beta's substrate selection. Biochemistry 2006, 45 (51), 15142-56.

51. Radhakrishnan, R.; Schlick, T., Correct and incorrect nucleotide incorporation
pathways in DNA polymerase beta. Biochem. Biophys. Res. Commun. 2006, 350
(3), 521-9.

52. Roettger, M. P.; Bakhtina, M.; Tsai, M. D., Mismatched and matched dNTP
incorporation by DNA polymerase beta proceed via analogous kinetic pathways.
Biochemistry 2008, 47 (37), 9718-27.

53. Santoso, Y.; Joyce, C. M.; Potapova, O.; Le Reste, L.; Hohlbein, J.; Torella, J. P.;
Grindley, N. D.; Kapanidis, A. N., Conformational transitions in DNA
polymerase I revealed by single-molecule FRET. Proc. Natl. Acad. Sci. U. S. A.
2010, 107 (2), 715-20.

54. Sawaya, M. R.; Prasad, R.; Wilson, S. H.; Kraut, J.; Pelletier, H., Crystal
structures of human DNA polymerase beta complexed with gapped and nicked
DNA: evidence for an induced fit mechanism. Biochemistry 1997, 36 (37), 11205-
15.

55. Shah, A. M.; Conn, D. A.; Li, S. X.; Capaldi, A.; Jager, J.; Sweasy, J. B., A DNA
polymerase beta mutator mutant with reduced nucleotide discrimination and
increased protein stability. Biochemistry 2001, 40 (38), 11372-81.

56. Shah, A. M.; Li, S. X.; Anderson, K. S.; Sweasy, J. B., Y265H mutator mutant of
DNA polymerase beta. Proper teometric alignment is critical for fidelity. J Biol
Chem 2001, 276 (14), 10824-31.

57. Showalter, A. K.; Tsai, M. D., A reexamination of the nucleotide incorporation
fidelity of DNA polymerases. Biochemistry 2002, 41 (34), 10571-6.

43
58. Starcevic, D.; Dalal, S.; Jaeger, J.; Sweasy, J. B., The hydrophobic hinge region
of rat DNA polymerase beta is critical for substrate binding pocket geometry. J
Biol Chem 2005, 280 (31), 28388-93.

59. Starcevic, D.; Dalal, S.; Sweasy, J. B., Is there a link between DNA polymerase
beta and cancer? Cell cycle (Georgetown, Tex.) 2004, 3 (8), 998-1001.

60. Steitz, T. A.; Steitz, J. A., A general two-metal-ion mechanism for catalytic RNA.
Proc. Natl. Acad. Sci. U. S. A. 1993, 90 (14), 6498-502.
61. Sucato, C. A.; Upton, T. G.; Kashemirov, B. A.; Batra, V. K.; Martinek, V.;
Xiang, Y.; Beard, W. A.; Pedersen, L. C.; Wilson, S. H.; McKenna, C. E.;
Florian, J.; Warshel, A.; Goodman, M. F., Modifying the beta,gamma leaving-
group bridging oxygen alters nucleotide incorporation efficiency, fidelity, and the
catalytic mechanism of DNA polymerase beta. Biochemistry 2007, 46 (2), 461-71.

62. Sucato, C. A.; Upton, T. G.; Kashemirov, B. A.; Osuna, J.; Oertell, K.; Beard, W.
A.; Wilson, S. H.; Florian, J.; Warshel, A.; McKenna, C. E.; Goodman, M. F.,
DNA polymerase beta fidelity: halomethylene-modified leaving groups in pre-
steady-state kinetic analysis reveal differences at the chemical transition state.
Biochemistry 2008, 47 (3), 870-9.

63. Sucato, C. A.; Upton, T. G.; Kashemirov, B. A.; Osuna, J.; Oertell, K.; Beard, W.
A.; Wilson, S. H.; Florian, J.; Warshel, A.; McKenna, C. E.; Goodman, M. F.,
DNA polymerase beta fidelity: halomethylene-modified leaving groups in pre-
steady-state kinetic analysis reveal differences at the chemical transition state.
Biochemistry 2008, 47 (3), 870-9.

64. Sweasy, J. B.; Lang, T.; Starcevic, D.; Sun, K. W.; Lai, C. C.; Dimaio, D.; Dalal,
S., Expression of DNA polymerase cancer-associated variants in mouse cells
results in cellular transformation. Proc. Natl. Acad. Sci. U. S. A. 2005, 102 (40),
14350-5.

65. Towle-Weicksel, J. B.; Dalal, S.; Sohl, C. D.; Doublie, S.; Anderson, K. S.;
Sweasy, J. B., Fluorescence resonance energy transfer studies of DNA
polymerase beta: the critical role of fingers domain movements and a novel non-
covalent step during nucleotide selection. J Biol Chem 2014, 289 (23), 16541-50.

66. Upton, T. G.; Kashemirov, B. A.; McKenna, C. E.; Goodman, M. F.; Prakash, G.
K.; Kultyshev, R.; Batra, V. K.; Shock, D. D.; Pedersen, L. C.; Beard, W. A.;
Wilson, S. H., Alpha,beta-difluoromethylene deoxynucleoside 5'-triphosphates: a
convenient synthesis of useful probes for DNA polymerase beta structure and
function. Org. Lett. 2009, 11 (9), 1883-6.

67. Wallace, S. S.; Murphy, D. L.; Sweasy, J. B., Base excision repair and cancer.
Cancer Lett. 2012, 327 (1-2), 73-89.

44
68. Washington, S. L.; Yoon, M. S.; Chagovetz, A. M.; Li, S. X.; Clairmont, C. A.;
Preston, B. D.; Eckert, K. A.; Sweasy, J. B., A genetic system to identify DNA
polymerase beta mutator mutants. Proc. Natl. Acad. Sci. U. S. A. 1997, 94 (4),
1321-6.

69. Wells, P. R., Linear Free Energy Relationships. Chem. Rev. 1963, 62 (2), 171-
219.

70. Yamtich, J.; Nemec, A. A.; Keh, A.; Sweasy, J. B., A germline polymorphism of
DNA polymerase beta induces genomic instability and cellular transformation.
PLoS Genet. 2012, 8 (11), e1003052.

71. Yamtich, J.; Starcevic, D.; Lauper, J.; Smith, E.; Shi, I.; Rangarajan, S.; Jaeger, J.;
Sweasy, J. B., Hinge residue I174 is critical for proper dNTP selection by DNA
polymerase beta. Biochemistry 2010, 49 (11), 2326-34.

72. Yamtich, J.; Sweasy, J. B., DNA polymerase family X: function, structure, and
cellular roles. Biochim. Biophys. Acta 2010, 1804 (5), 1136-50.

73. Zhong, X.; Patel, S. S.; Werneburg, B. G.; Tsai, M. D., DNA polymerase beta:
multiple conformational changes in the mechanism of catalysis. Biochemistry
1997, 36 (39), 11891-900.

45
Appendix A. Chapter 2 Supporting Data

Figure A1.
1
H NMR spectrum (400 MHz, D2O) of 2’-deoxycytidine 5’-triphosphate β,γ CHF, 2a.

46

Figure A2.
19
F NMR spectrum (376 MHz, D2O) of 2’-deoxycytidine 5’-triphosphate β,γ-CHF, 2a.

47

Figure A3.
31
P NMR spectrum (162 MHz, D2O) of 2’-deoxycytidine 5’- triphosphate β,γ-CHF, 2a.

48

Figure A4. LRMS [M-H]- of 2’-deoxycytidine 5’- triphosphate β,γ-CHF, 2a.

49

Figure A5.
1
H NMR spectrum (400 MHz, D2O) of 2’-deoxycytidine 5’-triphosphate β,γ-CF2, 2b.

50
Figure A6.
19
F NMR spectrum (376 MHz, D2O) of 2’-deoxycytidine 5’-triphosphate β,γ-CF2, 2b.

51
Figure A7.
31
P NMR spectrum (162 MHz, D2O) of 2’-deoxycytidine 5’- triphosphate β,γ-CF2, 2b.

52

Figure A8. LRMS [M-H]- of 2’-deoxycytidine 5’- triphosphate β,γ-CF2, 2b.

53

Figure A9.
1
H NMR spectrum (600 MHz, D2O) of 2’-deoxycytidine 5’-triphosphate β,γ-CHCl, 2c.

54

Figure A10.
19
F NMR spectrum (243 MHz, D2O) of 2’-deoxycytidine 5’-triphosphate β,γ- CHCl,
2c.

55
Figure A11. LRMS [M-H]- of 2’-deoxycytidine 5’- triphosphate β,γ-CHCl, 2c.

56
Figure A12.
1
H NMR spectrum (500 MHz, D2O) of 2’-deoxycytidine 5’-triphosphate β,γ-CCl2, 2d.

57

Figure A13.
31
P NMR spectrum (202 MHz, D2O) of 2’-deoxycytidine 5’- triphosphate β,γ-CCl2,
2d.

58
Figure A14. LRMS [M-H]- of 2’-deoxycytidine 5’- triphosphate β,γ-CCl2, 2d.

59

Figure A15.
1
H NMR spectrum (500 MHz, D2O) of 2’-deoxycytidine 5’-triphosphate β,γ-CClF,
2e.

60

Figure A16.
19
F NMR spectrum (376 MHz, D2O) of 2’-deoxycytidine 5’-triphosphate β,γ-CClF,
2e.

61

Figure A17.
31
P NMR spectrum (162 MHz, D2O) of 2’-deoxycytidine 5’- triphosphate β,γ-CClF,
2e.

62

Figure A18. LRMS [M-H]- of 2’-deoxycytidine 5’- triphosphate β,γ-CClF, 2e.

63

Figure A19.
1
H NMR spectrum (500 MHz, D2O) of 2’-deoxycytidine 5’-triphosphate β,γ-CHBr,
2f.

64

Figure A20.
31
P NMR spectrum (162 MHz, D2O) of 2’-deoxycytidine 5’- triphosphate β,γ- CHBr,
2f.

65
Figure A21. LRMS [M-H]- of 2’-deoxycytidine 5’- triphosphate β,γ-CHBr, 2f.

66
NMR Analysis
2’-Deoxycytidine 5’-triphosphate β,γ-CHF, 2a.
1
H NMR (500 MHz, D2O, pH= 10.5) δ 7.97 (d,
J = 7.5 Hz, 1H), 6.34 (t, J = 7.3 Hz, 1H), 6.15 (d, J = 8.0 Hz, 1H), 4.69 – 4.53 (m, 1H), 4.20 (s,
3H), 2.50 – 2.38 (m, 1H), 2.36 – 2.25 (m, 1H), 2.01 (s, 1H);
19
F NMR (376 MHz, D2O, pH=
11.0) δ -216.91 (dddd, J = 65.0, 55.2, 45.7, 15.2 Hz);
31
P NMR (202 MHz, D2O, pH= 11.0) δ
7.19 (ddd, J = 55.3, 14.7, 3.4 Hz), 4.98 (ddd, J = 64.8, 28.7, 15.6 Hz), -10.85 (dt, J = 28.0, 2.9
Hz).
2’-Deoxycytidine 5’-triphosphate β,γ-CF2, 2b.
1
H NMR (400 MHz, D2O, pH= 11.2) δ 7.97 (d,
J = 7.6 Hz, 1H), 6.34 (t, J = 6.7 Hz, 1H), 6.15 (d, J = 7.5 Hz, 1H), 4.72 – 4.52 (m, 1H), 4.22 (d, J
= 4.4 Hz, 3H), 2.48 – 2.38 (m, 1H), 2.36 – 2.27 (m, 1H);
19
F NMR (376 MHz, D2O, pH= 11.12)
δ -118.05 (dd, J = 90.1, 72.1 Hz);
31
P NMR (162 MHz, D2O, pH= 11.2) δ 1.30 (td, J = 72.1, 56.5
Hz), -5.25 (tdd, J = 89.8, 56.6, 31.9 Hz), -13.42 (d, J = 32.0 Hz).
2’-Deoxycytidine 5’-triphosphate β,γ-CHCl, 2c.
1
H NMR (600 MHz, D2O, pH= 10.0) δ 8.03
(d, 1H), 6.32 (t, 1H), 6.18 (d, 1H), 4.68 – 4.56 (m, 1H), 4.21 (s, 3H), 4.02 (t, J = 16.3 Hz, 1H),
2.59 – 2.37 (m, 1H), 2.38 – 2.23 (m, 1H);
31
P NMR (243 MHz, D2O, pH= 10.0) δ 11.91, 4.97 (d,
J = 26.5 Hz), -9.06 (d, J = 26.6 Hz).
2’-Deoxycytidine 5’-triphosphate β,γ-CCl2, 2d.
1
H NMR (500 MHz, D2O, pH= 10.7) δ 7.99
(dd, J = 7.6, 1.5 Hz, 1H), 6.34 (t, J = 6.7 Hz, 1H), 6.15 (dd, J = 7.6, 1.4 Hz, 1H), 4.72 – 4.61 (m,
1H), 4.36 – 4.11 (m, 3H), 2.57 – 2.38 (m, 1H), 2.39 – 2.25 (m, 1H);
31
P NMR (202 MHz, D2O,
pH= 10.7) δ 7.90 (d, J = 18.3 Hz), 3.12 – -0.15 (m), -11.10 (d, J = 31.1 Hz).
2’-Deoxycytidine 5’-triphosphate β,γ-CClF, 2e.
1
H NMR (500 MHz, D2O, pH= 11.5) δ 7.98 (d,
J = 7.6 Hz, 1H), 6.35 (t, J = 6.7 Hz, 1H), 6.15 (d, J = 7.6 Hz, 1H), 4.65 (s, 1H), 4.22 (d, J = 10.7
Hz, 3H), 2.47 – 2.38 (m, 1H), 2.36 – 2.27 (m, 1H);
19
F NMR (376 MHz, Chloroform-d) δ -134.02
(dd, J = 79.1, 64.8 Hz);
31
P NMR (162 MHz, Chloroform-d) δ 8.42 (dd, J = 64.8, 32.9 Hz), 2.02
(dt, J = 79.5, 32.4 Hz), -8.32 (d, J = 31.8 Hz).
2’-Deoxycytidine 5’-triphosphate β,γ-CHBr, 2f.
1
H NMR (500 MHz, D2O, pH= 10.0) δ 8.01
(dd, J = 7.6, 1.4 Hz, 1H), 6.34 (t, J = 6.3 Hz, 1H), 6.17 (d, J = 7.5 Hz, 1H), 4.75 – 4.49 (m, 1H),
4.22 (d, J = 3.9 Hz, 3H), 3.94 (t, J = 15.7 Hz, 1H), 2.55 – 2.37 (m, 1H), 2.38 – 2.22 (m, 1H);
31
P
NMR (162 MHz, D2O, pH= 10.0) δ 8.01 (d, J = 5.5 Hz), 6.38 (dt, J = 26.7, 4.9 Hz), -11.01 (dd, J
= 26.5, 3.4 Hz).

67
Figure A22. Single Turnover Kinetics for the Incorporation of the Correct Parent dGTP.
Representative plots showing single turnover kinetics of product formation by WT (A,B) and
K289M (C,D) in the presence of varying concentrations of the parent dGTP opposite template C
(Blue, 0.25 µM; Red, 0.5 µM; Green, 1; Purple, 2.5 µM; Orange, 5 µM; Black, 10 µM; Brown, 25
µM). Pol β and the CL-CP-CG DNA template with a single nucleotide gap (750 nM and 50 nM,
respectively) were premixed and reactions were initiated upon mixing with dGTP on the Kin-Tek
rapid quench-flow for various times at 37°C. Reactions were quenched with EDTA and product
was separated by PAGE. Bands were quantified and product formed was plotted as a function of
time. Points were fitted to a single exponential equation to obtain rates (k
obs
) at each dGTP
concentration. Rates were plotted as a function of dGTP concentration and fitted with a
hyperbolic equation to obtain k
pol
and K
d
for WT (B) and K289M (D). k
pol
for WT and K289M are
27.6 ± 1.2 s
-1
and 0.9 ± 0.1 s
-1
, respectively; K
d
for WT and K289M are 2.3 ± 0.3 µM and 1.3 ±
0.3 µM, respectively. These experiments were repeated for each of the dNTP analogues to obtain
k
pol
and K
d
as reported in Tables 2.1 and 2.2.

Abstract (if available)

Abstract DNA polymerases (DNA pols) that are involved in genome replication must maintain a high degree of fidelity. In order to understand how DNA pols achieve such a high degree of fidelity, it is important to comprehend their catalytic mechanisms. Whether said mechanism proceeds via a chemical rate-determining step (RDS), or a conformational change RDS prior to the “chemistry”, can help determine exactly how a particular polymerase functions. DNA pol β is of particular interest due to its essential function in repairing simple base lesions on damaged DNA through base excision repair (BER), as well as its role in the development of anticancer drug resistance. In recent years, the McKenna research group has developed a series of modified dNTP analogue probes in order to elucidate the mechanism of action of DNA pol β. The work presented for the purposes of this thesis details the synthesis, characterization and purification of novel deoxycytidine triphosphate series (dCTP), an expansion of the DNA ""tool-kit"" developed in the McKenna research group.

Linked assets

University of Southern California Dissertations and Theses

Conceptually similar

PDF

The contribution of chemical steps to DNA polymerase beta catalysis and fidelity

PDF

Synthetic studies of chemical probes for i) DNA, ii) RNA polymerases and iii) tropomyosin receptor kinase

PDF

Nucleotide analogs and molecular probes for LFER, time-resolved crystallography, FRET, and EPR studies of human DNA polymerase: probing mechanism, conformation and structure

PDF

Novel stereochemical probes for DNA polymerases: nucleoside triphosphate beta,gamma-CXY analogues

PDF

Deoxynucleotide analog probes and model compounds for studying DNA polymerase structure and mechanism: synthesis and evaluation of alkyl-, azido-, and halomethylene bisphosphonate-substituted tri...

PDF

Design and synthesis of a series of methylenebisphosphonates: a nucleotide analogue toolkit to probe nucleic acid polymerase structure and function

PDF

Fluorinated probes of enzyme mechanisms

PDF

Activation mechanism of damaged-induced DNA polymerase V in Escherichia coli

PDF

Nucleophilic fluorination of bisphosphonates and its application in PET imaging

PDF

Deoxyribonucleoside triphosphate analogues for inhibition of therapeutically important enzymes

PDF

I. Microwave-assisted synthesis of phosphonic acids; II. Design and synthesis of polymerase β lyase domain inhibitors

PDF

Studies of bisphosphate-conjugated fluorescent imaging compounds and 8-oxo-dGTP derivatives

PDF

Reactivity-based chemical-genetic study of protein kinases

PDF

Selective bromodomain inhibition of fungal transcriptional activator Bdf1

PDF

The study of allosteric regulation of signaling proteins

PDF

Studies on methane functionalization: efficient carbon-hydrogen bond activation via palladium and free radical catalyses

PDF

Synthesis, structural analysis and in vitro antiviral activities of novel cyclic and acyclic (S)-HPMPA and (S)-HPMPC tyrosinamide prodrugs

PDF

Generation of monoclonal antibodies via phage display and in vitro affinity maturation using activation induced deoxycytidine deaminase and DNA polymerase eta

PDF

Advancing computational methods for free energy calculations in proteins and the applications for studies of catalysis in nucleotide-associated proteins

Asset Metadata

Creator Garcia-Barboza (Renner), Beatriz Jael (author)

Core Title Expansion of deoxynucleotide analog probes for studying DNA polymerase mechanism: synthesis of novel beta, gamma-CXY deoxycytidine series

School College of Letters, Arts and Sciences

Degree Master of Science

Degree Program Chemistry

Publication Date 05/11/2018

Defense Date 05/11/2018

Publisher University of Southern California (original), University of Southern California. Libraries (digital)

Tag deoxycitidine,DNA pol,dNTP analog probes,dNTPs,functionalized dCTPs,OAI-PMH Harvest,polymerase beta,polymerase mechanism

Format application/pdf (imt)

Language English

Contributor Electronically uploaded by the author (provenance)

Advisor McKenna, Charles (committee chair), Feakins, Sarah (committee member), Zhang, Chao (committee member)

Creator Email beatrizj@bu.edu,garciaba@usc.edu

Permanent Link (DOI) https://doi.org/10.25549/usctheses-c40-504249

Unique identifier UC11266404

Identifier etd-GarciaBarb-6324.pdf (filename),usctheses-c40-504249 (legacy record id)

Legacy Identifier etd-GarciaBarb-6324.pdf

Dmrecord 504249

Document Type Thesis

Format application/pdf (imt)

Rights Garcia-Barboza (Renner), Beatriz Jael

Type texts

Source University of Southern California (contributing entity), University of Southern California Dissertations and Theses (collection)

Access Conditions The author retains rights to his/her dissertation, thesis or other graduate work according to U.S. copyright law. Electronic access is being provided by the USC Libraries in agreement with the a...

Repository Name University of Southern California Digital Library

Repository Location USC Digital Library, University of Southern California, University Park Campus MC 2810, 3434 South Grand Avenue, 2nd Floor, Los Angeles, California 90089-2810, USA