University of Southern California Dissertations and Theses

Studies Of Topoisomerase Ii As The Target Of Anti-Cancer Agents

(USC Thesis Other)

Studies Of Topoisomerase Ii As The Target Of Anti-Cancer Agents

PDF

Download

Open document

Flip pages

Download a page range

Download transcript

Copy asset link

Request this asset

Transcript (if available)

Content INFORMATION TO USERS
This manuscript has been reproduced from the microfilm master. UM I
films the text directly from the original or copy submitted. Thus, some
thesis and dissertation copies are in typewriter face, while others may
be from any type of computer printer.
The quality of this reproduction is dependent upon the quality of the
copy submitted. Broken or indistinct print, colored or poor quality
illustrations and photographs, print bleedthrough, substandard margins,
and improper alignment can adversely afreet reproduction.
In the unlikely event that the author did not send UMI a complete
manuscript and there are missing pages, these will be noted. Also, if
unauthorized copyright material had to be removed, a note will indicate
the deletion.
Oversize materials (e.g., maps, drawings, charts) are reproduced by
sectioning the original, beginning at the upper left-hand comer and
continuing from left to right in equal sections with small overlaps. Each
original is also photographed in one exposure and is included in
reduced form at the back of the book.
Photographs included in the original manuscript have been reproduced
xerographically in this copy. Higher quality 6" x 9" black and white
photographic prints are available for any photographs or illustrations
appearing in this copy for an additional charge. Contact UMI directly
to order.
A Bell & Howell Information Com pany
300 North Z eeb Road. Ann Arbor. M l 48106-1346 USA
313.-761-4700 800/521-0600

Studies of Topoisomerase II as the Target of Anti-
Cancer Agents
by
Yuchu Hsiung
A Dissertation Presented to the
FACULTY OF THE GRADUATE SCHOOL
UNIVERSITY OF SOUTHERN CALIFORNIA
In Partial Fulfillment of the
Requirements for the Degree
DOCTOR OF PHILOSOPHY
(Biochemistry and Molecular Biology)
December 1994
Copyright 1994 Yuchu Hsiung
UMI Number: 9600991
OMI Microform 9600991
Copyright 1995, by UMI Company. All rights reserved.
This microform edition is protected against unauthorized
copying under Title 17, United States Code.
UMI
300 North Zeeb Road
Ann Arbor, MI 48103
UNIVERSITY OF SOUTHERN CALIFORNIA
THE GRADUATE SCHOOL
UNIVERSITY PARK
LOS ANGELES, CALIFORNIA 90007
under the direction of h.&T Dissertation
Committee, and approved by all its members,
has been presented to and accepted by The
Graduate School, in partial fulfillment of re
quirements for the degree of
This dissertation, written by
Kf u c h u H'Slu n n
DOCTOR OF PHILOSOPHY
Dean o f Graduate Studies
Date .. . 3 . Q a ., 1994
DISSERTATION COMMITTEE
Chairperson
DEDICATION
To my beloved parents....
Yunchin and Hsiangtien
ACKNOWLEDGMENTS
First I thank the Lord for everything He has made
possible!
I would like to thank Dr. John L. Nitiss as my mentor,
whose guidance has been invaluable. I am deeply grateful for
the advice from my Dissertation committee members: Dr. Daniel
Broek, Dr. James J. H. Ou, and Dr. Robert H. Stellwagen. I would
also like to thank Dr. Richard Moran for his role in my graduate
guidance committee.
In addition, I thank my colleagues for their support and
assistance. They are Dennis Duncan, M ehrdad Jannatipour,
Jeannette McMahon, Vanessa King, Ya-Xia Liu, Dr. Patricia
Vilalta, and Linda Wu. I especially thank Ms Katie Wu, for her
advice on PCR strategy to construct hum an topoisomerase II
mutants; Dr. Neil Osheroff and Dr. Sarah Elsea for their help on
topoisomerase II purification.
I would also like to thank my husband, Dr. Wilfred Li, for
his companionship in every way. I am especially delightfully
indebted to Ariel, our daughter, for her forever endearing and
soothing smile.
TABLE OF CONTENT
DEDICATION........................................................................................ii
ACKNOWLEDGMENTS......................................................................... iii
LIST OF FIGURES................................................................................. ix
LIST OF TABLES..................................................................................xii
ABSTRACT............................................................................................. xiii
INTRODUCTION...................................................................................1
CHAPTER I ISOLATION AND CHARACTERIZATION OF NEW
YEAST TOPOISOMERASE II MUTANTS SELECTED FOR
RESISTANCE TO TOPOISOMERASE II-TARGETING AGENTS 24
1.1 INTRODUCTION..................................................................24
1.2 MATERIALS AND METHODS........................................30
1.2.1 Yeast growth and transform ation................30
1.2.2 Yeast strains.......................................................30
1.2.3 In vitro m utagenesis....................................... 30
1.2.4 Determination of drug senstitivity..............32
1.2.5 D eterm ination of topoisom erase II
activity.............................................................................33
1.2.6 R ecovery of p lasm id s c arry in g
to p o iso m e rase II m u ta tio n s a n d DNA
sequence determ ination.............................................34
1.2.7 Plasmids.............................................................. 35
1.2.8 Oligonucleotide-directed mutagenesis....... 36
1.2.9 Construction of drug permeable strains
carrying the top2 m utant allele and rad52-
m utation..........................................................................37
1.3 RESULTS.............................................................................. 37
iv
1.3.1 Selection of a m s a c rin e -re s is ta n t
mutants.............................................................................37
1.3.2 Characterize the potential drug resistant
mutants: m easurem ent of drug sensitivity in
vivo....................................................................................41
1.3.3 D eterm ination of topoisom erase II
activity of the drug resistant alleles in crude
cell extracts.................................................................... 42
1.3.4 Determination of the mutational changes
by DNA sequencing........................................................ 43
1.3.5 R econstruction of the id en tified
m utations by site-directed mutagenesis, and
m easurem ent of the drug sensitivity of the
reconstructed topoisomerase II m utants................ 48
1.4 DISCUSSION...................................................................... 51
CHAPTER II A NEW YEAST TOP2 DRUG RESISTANT
MUTANT CARRIES TWO MUTATIONS THAT ARE CLOSE TO
THE gyrB HOMOLOGY DOMAIN....................................................... 85
2.1 INTRODUCTION....................................................................85
2.2 MATERIALS AND METHODS...........................................86
2.2.1 Yeast strains........................................................ 86
2.2.2 C o n s tru c tio n of p la s m id for
overexpression..............................................................86
2.2.3 Induction and overexpression of yeast
topoisomerase II.............................................................. 87
2.2.4 Purification of topoisomerase II.......................88
2.2.5 D eterm ination of topoisom erase II
activity.............................................................................90
2.2.6 Quantitative determ ination of drug-
stabilized cleavage....................................................... 91
2.3 RESULTS.............................................................................. 93
2.3.1 Neither m utation of histidine 507 nor
h istid in e 521 to ty ro sin e a lters drug
sensitivity.......................................................................93
2.3.2 Strains (JN394t2-A4) carrying both
histidine 507 and histidine 521 to tyrosine
v
m utations are resistan t to mAMSA and
etoposide.........................................................................94
2.3.3 Purification of top2-A4 protein.....................95
2.3.4 D eterm ination of topoisom erase II
activity............................................................................ 95
2.3.5 The top2-A4 protein is drug resistant in
vitro...................................................................................96
2.4 DISCUSSION...................................................................... 97
CHAPTER III IDENTIFICATION OF A EUKARYOTIC
TOPOISOMERASE II MUTATION CONFERRING
HYPERSENSITIVITY TO ETOPOSIDE: THE AMINO ACID
HOMOLOGOUS TO SER83 OF gyrA INTERACTS WITH
EUKARYOTIC TOPOISOMERASE INHIBITORS............................... 117
3.1 INTRODUCTION....................................................................117
3.2 MATERIALS AND METHODS...........................................120
3.2.1 Oligonucleotide-directed mutagenesis 120
3.2.2 Construction of drug permeable strains
carrying the Ser741 and rad52- mutations..............120
3.2.3 Determination of cleavage pattern with
etoposide.........................................................................120
3.2.4 Determ ination of etoposide-stabilized
cleavage with various c o n ce n tra tio n of
topoisomerase II.............................................................. 121
3.2.5 Heat reversibility of the etoposide-
stabilized cleavage complexes..................................121
3.3 RESULTS.............................................................................. 121
3.3.1 Strains carrying the Ser741Trp mutation
in yeast topoisom erase II are resistant to
f l u o r o q u i n o l o n e CP-1 1 5 ,9 5 3 a n d
hypersensitive to etoposide in vivo........................121
3.3.2 Ser741Trp protein is resistant to CP-
115,953 and hypersensitive to etoposide in
vitro................................................................................... 124
3.3.3 Pattern of drug-stabilized cleavage by
S e r 7 4 ] T rp p r o te in a n d w ild ty p e
topoisomerase II with pUC18 DNA..........................125
vi
3.3.4 Linear increase of drug-stabilized
cleavage with increasing Ser74]Trp or wild
type proteins..................................................................127
3.3.5 Cleavage com plexes stabilized by
etoposide with the Ser74]Trp protein are not
heat reversible..............................................................127
3.4 DISCUSSION.......................................................................129
CHAPTER IV FUNCTIONAL EXPRESSION OF HUMAN TOP2a
IN YEAST: MUTATIONS AT AMINO ACIDS 450 OR 803 OF
TOPOISOMERASE Ha RESULTS IN ENZYMES THAT CAN
CONFER RESISTANCE TO ANTI-TOPOISOMERASE II
AGENTS..................................................................................................153
4.1 INTRODUCTION....................................................................153
4.2 MATERIALS AND METHODS.......................................... 156
4.2.1 Yeast strains........................................................ 156
4.2.2 Construction of drug resistant alleles of
hum an topoisomerase II in p M J l............................156
4.2.3 Determination of drug sensitivitv....................159
4.3 RESULTS.........................................................'......................159
4.3.1 Expression of hum an topoisomerase II a
c o m p le m e n ts a d e fic ie n c y of y e a st
topoisomerase II.............................................................. 159
4.3.3 Expression of hum an topoisomerase II
supports growth of yeast strains lacking both
topoisomerase I and topoisomerase II.................. 160
4.3.4 Expression of hum an topoisomerase II
restores drug sensitivity to yeast cells
carrying topoisomerase II m utations..................... 162
4.3.5 Reconstruction of hum an topoisomerase
II a m utations: Arg450Gln results in drug
resistant topoisomerase.................................................164
4.3.6 Reconstruction of hum an topoisomerase
II a m utations: Pro803 Ser results in drug
resistant topoisomerase.................................................166
4.3.7 An enzyme carrying both Arg450Gln and
Pro803Ser m utations results in a highly drug
resistant topoisomerase II.........................................167
4.4 DISCUSSION...................................................................... 168
DISCUSSION...........................................................................................192
REFERENCES...........................................................................................200
LIST OF FIGURES
Figure 1.1 Proposed m odel for the catalytic cycle of
topoisomerase II ............................................................................... 22
Figure 1.1 Selection and characterization of drug-resistant
mutants................................................................................................... 56
Figure 1.2 Restriction pattern of plasmid DNA isolated
from transform ants that failed to com plem ent top2ts
mutation.................................................................................................57
Figure 1.3 mAMSA and etoposide sensitivity of yeast
strains carrying the top2-Al allele................................................58
Figure 1.4 Drug sensitivity of cells carrying pDEDlTOP2.........61
Figure 1.5 Yeast strains carrying the top2-A4 allele are
resistant to mAMSA and etoposide............................................... 64
Figure 1.6 mAMSA and etoposide sensitivity of yeast
strains carrying the top2-A10 allele.............................................67
Figure 1.7 Topoisomerase II activity of m utant alleles.............70
Figure 1.8 Drug sensitivity of the reconstructed top2-
103b allele.............................................................................................. 71
Figure 1.9 The recontructed top2-103a allele confers
resistance to mAMSA and etoposide.............................................73
Figure 1.10 Fluoroquinolone sensitivity of yeast strains
carrying the top2-4 or reconstructed top2-103a allele 76
Figure 2.1. Sequence homology of hum an topoisomerase
Ha near the top2-A4 allele...................................................................103
Figure 2.2. Drug sensitivity of strains carrying His507 Tyr
or His52iTyr m utation in yeast topoisomerase II......................105
Figure 2.3. Strains carrying both His507Tyr and I-Iis52iTyr
mutations are resistant to mAMSA and etoposide....................109
Figure 2.4. Electrophoretic patterns of proteins in an
SDS/polyacrylamide gel stained with Coomassie Blue............. 112
Figure 2.5. Determination of topoisomerase II activity..........113
Figure 2.6. Quantitative determination of drug-stabilized
cleavage with the top2-A4 protein................................................114
Figure 3.1 Fluoroquinolone sensitivity of yeast cells
carrying Ser741Trp or wild type topoisomerase II....................132
Figure 3.3 Yeast strains carrying the Ser741Trp m utation
in topoisomerase II is hypersensitive to etoposide.................. 137
Figure 3.4 Quantitative determination of drug stabilized
cleavage with the Ser74]Trp protein.................................................. 140
Figure 3.5 Pattern of etoposide-stabilized cleavage by
wild type and the Ser741Trp proteins with pUC18 DNA............143
Figure 3.6 Linear relationship of etoposide-stabilized
cleavage with the wild type and the Ser741T r p
topoisomerase II.....................................................................................145
Figure 3.7 Heat reversibility of the drug-stabilized
cleavage complexes.............................................................................147
Figure 4.1. Com plem entation of top2-5 by expressing
hum an topoisomerase II in yeast...................................................171
x
Figure 4.2. Complementation of Atopl top2-4 strains by
human topoisomerase Ha.................................................................... 172
Figure 4.3. Sensitivity to etoposide of yeast cells
expressing human or yeast topoisomerase II................................ 173
Figure 4.4. Sensitivity to mAMSA of yeast cells
expressing human or yeast topoisomerase II................................ 176
Figure 4.5. Drug sensitivity of yeast cells expressing
h u m an topoisom erase II carrying the Arg450G ln
mutation.................................................................................................179
Figure 4.6. Sensitivity to teniposide of yeast cells
expressing wild type hum an topoisom erase II or its
Arg450Gln m utant................................................................................182
Figure 4.7. Sensitivity to etoposide and mAMSA of yeast
cells expressing hum an topoisom erase II carrying a
mutation that converts Pro8 0 3 to Ser................................................. 185
Figure 4.8. Sensitivity to etoposide and mAMSA of cells
expressing hum an topoisomerase II carrying Arg450Gln
and ProgosSer double mutations........................................................ 188
Figure D.l Summary of the mutations identified in yeast
topoisomerase II that are potentially im portant for drug
action and their relative locations in the polypeptide............. 198
LIST OF TABLES
Table 1.1 Type II topoisomerase inhibitors................................21
Table 1.2 Mutations identified in yeast topoisomerase II.....80
Table 1.3 Reconstructed yeast strains..............................................81
Table 1.4 Summary of the preliminary characterization of
the isolates.......................................................................................... 82
Table 1.5 Minimum Lethal Concentration (gg/ml) of the
m utant alleles carried on the overexpression plasmid
pDEDlTOP2 to mAMSA and etoposide at 36°C..........................83
Table 1.6 Resistance of the mutants to anti-topoisomerase
II agents............................................................................................... 84
Table 3.1 Mutagenic oligonucleotides............................................. 150
Table 3.2 Yeast strains...................................................................... 151
Table 3.3 Sensitivity of strains carrying m utations at
Ser741 of topoisomerase II to anti-topoisomerase agents 152
Table 4.1 Yeast strains..................................................................... 191
ABSTRACT
Drugs that target topoisomerase II have been shown to
have anticancer activity. However, the mechanistic details of
drug/topoisom erase II interaction is unknown. A genetic and
biochemical system has been developed in yeast to allow the
isolation and characterization of sites in topoisomerase II when
m utated lead to alterations in drug sensitivity. Several
m utations have been identified that are located in the gyrA
and gyrB homology domains. Region surrounding active site
tyrosine m ight play an im portant role in altering drug
sensitivity.
Sery4 i was m utated to several amino acids according to
quinolone resistant m utations identified in gyrA subunit of E.
coli. Yeast cells carrying Sery^Trp in topoisomerase II display
re s is ta n c e to q u in o lo n e a n d h y p e rs e n s itiv ity to
epipodophyllotoxins. Purified Sery^Trp exhibits lower level of
DNA cleavage in the presence of the CP-115,953 and higher
level of cleavage when treated with etoposide as com pared to
wild type enzyme. Heat irreversability of the cleavage complex
formed with Sery^Trp protein strongly suggests that Serj4 i is
near the drug-interacting site. While Sery4 i might lie near a
binding site for etoposide, mutations of Hisso7 Tyr/His 5 2 iTyr in
xiii
the top2-A4 allele conferring drug resistance might not affect
directly drug-enzyme interactions.
H um an TO P 2a has been expressed in yeast and
expressing the hum an enzyme can com plem ent yeast top2
mutations. Human TOP2a when expressed in yeast displays
com parable sensitivity to etoposide b u t hypersensitivity to
mAMSA as com pared to the yeast enzyme. Based on the
m utations identified in hum an TOP2a from the teniposide
resistant cell line, Arg4 5 oGln an d PrososSer have been
constructed in hum an TOP2a and expressed in yeast cells that
carry top2ts allele. Yeast cells carrying either single mutation
are resistant to epipodophvllotoxins and slightly insensitive to
mAMSA. Both m utations have been constructed in hum an
TOP2a and expressed in yeast. Yeast cells carrying both
mutations exhibit comparable level of resistance to etoposide
as cells carrying either single m utation, but higher level of
resistance to mAMSA. These results suggest th at both
mutations when present in cis confer higher level of resistance
to mAMSA.
xiv
INTRODUCTION
DNA topoisomerases
There are two classes of topoisomerases, the type I and
the type II enzymes. These enzymes exert their catalytic
function by forming enzyme-bridged strand-break(s) that in
turn serve as transient gates for the passage of other DNA
strand(s). The type I enzymes transiently break one strand of
duplex DNA and allow the unbroken, complementary strand to
pass through the stran d break, thereby effecting DNA
relaxation prior to resealing. Type I topoisomerases include
the very first identified c o protein (product of topA) of E. coli
(Wang, 1971) and E. coli topoisomerase III (product of topB)
(Dean et ah, 1983). Prokaryotic type I enzymes relax negative
but not positive supercoils. A single-stranded break in a DNA
duplex is required for the type I enzymes to decatenate
double-stranded catenated DNA rings. In eukaryotes, the
major type I activity was first identified in extracts of mouse
cells (Champoux and Dulbecco, 1972). and has since be found
in all eukaryotes. The more recently identified yeast TOPS
gene product, DNA topoisomerase III, has been shown to have
sequence homology to E. coli DNA topoisomerase I (Wallis et ah,
1989). The expression of the bacterial enzyme in yeast topS
1
m utants has been shown to suppress the poor growth
phenotype of the mutants (Wallis, et al., 1989). The purified
enzyme has a distinct topoisomerase activity, which is similar
to E. coli DNA topoisomerase I and III in th at it partially
relaxes negatively but not positively supercoiled DNA. The
activity has strong preference for single-stranded DNA (Kim
and Wang, 1992).
The type II enzym es transiently b reak a pair of
com plem entary strands, pass another double-stranded DNA
segment and reseal the break. By breakage, strand passage
and religation, the type II enzymes can catalyze many types of
in te rc o n v e rsio n s b etw een DNA to p o lo g ical isom ers
(topoisomers). Examples are catenation/decatenation and
knotting/unknotting. DiNardo et al. have dem onstrated that
the unique ability of the type II topoisomerases to decatenate
intertwined DNA molecule is required at the term ination of
replication to segregate the daughter molecules (DiNardo,
Voelkel and Sternglanz, 1984). The major type II activity in
prokaryotic organism s is DNA gyrase. In an attem p t to
establish the E. coli host factors required for bacteriophage X
site-specific integration, an ATP-dependent activity capable of
converting relaxed closed-circular DNA to the negatively
supercoiled form was discovered (Gellert et al., 1976). While
prokaryotic topoisomerase I can relax negative supercoiling,
2
DNA gyrase relaxes positive supercoiling by introducing
negative supercoiling. The unique action of gyrase is explained
by a mechanism termed "sign inversion" (Brown and Cozzarelli,
1979) because the positive supercoils are not relaxed but
actively inverted to negative supercoils in the following
fashion. Gyrase binds to a DNA molecule in a way by which the
bound segments cross to stabilize a positive supercoil and
introduce a couterposing negative supercoil. Gyrase introduces
a double-strand break in the positively supercoiled DNA and
inverts the sign of the node before resealing the break. The
type II enzymes in eukaryotic cells were found later (Baldi et
al., 1980; Hsieh and Brutlag, 1980; Miller, Liu and Englund,
1981). Unlike DNA gyrase, the eukaryotic type II
topoisom erases do not have DNA supersoiling activity,
however, they are able to relax both positively and negatively
supercoiled DNA (Wang, 1985).
Topoisom erases are nuclear enzym es th at play an
im portant role in a wide range of cellular activities that involve
DNA m etabolism , such as replication, transcription and
recom bination. While the type I topoisomerases have been
shown to be dispensable for survival in yeast (Thrash et al.,
1984; Uemura and Yanagida, 1984), the enzyme is essentail for
grow th and developm ent of the fru it fly, D r o s o p h ila
melanogaster (Lee et al., 1993). Although topoisomerase I can
provide the swivel function during DNA synthesis, its role can
be substituted by DNA topoisomerase II. Since topoisomerase I
is more effective during elongation, it probably functions as the
m ajor "swivel" in the replication fork m ovem ent (Kim and
Wang, 1989a). The "swivel" function of topoisomerases also
occurs in transcription (Brill et al., 1987).
Liu and Wang have proposed a twin-supercoiled domain
model which describes that as transcription proceeds, DNA in
front of the transcription ensem ble becom es positively
supercoiled, and DNA behind the ensemble becomes negatively
supercoiled (Liu an d W ang, 1987). In prokaryotes,
transcription contributes a m ajority of supercoiling to the
intracellular DNAs (Wu et al., 1988). Since bacterial DNA
topoisom erase I and DNA gyrase act differentially on
negatively and positively supercoiled domains (Gellert, et al.,
1976; Wang, 1971), these enzymes are potentially involved in
transcription to relieve the torsional strain that arises during
the elongation step. In eukaryotes, since both topoisomerase I
and II can remove positive and negative supercoils (Wang,
1985), these enzymes are im portant for relieving torsional
stress that arises during transcriptional elongation (Brill and
Sternglanz, 1988).
Several lines of evidence suggest that topoisomerases are
involved in hom ologous recom bination. Christm an et al
4
reported that the combined action of DNA topoisomerase I and
II appears to suppress mitotic recom bination w ithin the
Saccharom yces cerevisiae rDNA gene cluster (Christman,
Dietrich and Fink, 1988). Kim and Wang found that in yeast
DNA topoisomerase double mutants (Ato pltopZ ^), over half of
the rDNA is present as extrachromosomal rings (Kim and Wang,
1989b). Studies of a hyper-recom bination m utation in 5.
c e r e v is ia e by Wallis et al. identify a novel eukaryotic
topoisom erase that is homologous to the bacterial type I
enzyme, the c o protein. The novel protein term ed yeast
topoisomerase III is required to m aintain wild type level of
recom bination (Wallis, et al., 1989). The yeast gene HPR1,
which prevents intrachrom osom al excision recom bination,
encodes a protein with C-terminal hom ology to yeast 5.
c ere visia e topoisom erase I; m utations in HPR1 cause a
h y p e rre co m b in atio n p h en o ty p e in non-ribosom al DNA
(Aguilera and Klein, 1990).
In a d d itio n to the essential catalytic function,
experim ents by Earnshaw and colleagues using polyclonal
antibody suggested that topoisomerase II plays a structural
role in mitotic chromosomes as one of the major components of
chromosome scaffold (Earnshaw et al., 1985). Subsequently,
using indirect im m unofluorescence and im m unoelectron
microscopy, Earnshaw el al. suggested that topoisomerase II is
bound to the bases of the radial loop dom ains of mitotic
chromosomes (Earnshaw and Heck, 1985). Experiments using
cold se n sitiv e st-rains c a rry in g m u ta tio n s in the
Sch izo sa cch a ro m yces p o m b e TOP2 gene suggested that
topoisomerase II is required for chrom osom e condensation
(Uemura et al., 1987).
DNA topoisomerase II of yeast S acch arom yces
cerevisiae
T h eTOP2 gene of the budding yeast S a cch a ro m yces
cerevisiae was isolated by immunological screening of a yeast
genomic library constructed in the phage X expression vector,
k g t l l (Goto and Wang, 1984), an d the gene m aps to
chromosome XIV (DiNardo, Voelkel and Sternglanz, 1984). The
yeast enzyme, encoded by a single-copy gene, is a homodimer
composed of 1,429 amino acids (164 kDa). Yeast topoisomerase
II bears significant homology to the sequences of bacterial
gyrase subunits (Lynn et al., 1986; Reece and Maxwell, 1991).
Based on the amino acid sequence, the single subunit yeast
topoisomerase II can be divided into three distinct domains
(Lynn, et al., 1986; Wyckoff et al., 1989). The amino terminal
dom ain is homologous to the gyrB subunit and contains ATP-
binding consensus sequences A (GXXGXG) and B (GXGXXG)
(W alker et al., 1982). Studies of Lindsley and Wang
dem onstrated that replacem ent of Glyi4 4 with lie, Val or Pro
6
inactivated the ATPase and DNA transport activity (Lindslev
and Wang, 1993). The central DNA binding dom ain is
hom ologous to the A subunit of gyrase and contains the
tyrosine residue at which the breakage and religation reactions
occur, form ing the covalent linkage with DNA during the
cleavage reaction (Worland and Wang, 1989). While all type II
DNA topoisomerases are homologous, there is little homology
within the carboxy-terminal domains. The C-terminus of yeast
topoisomerase II is highly variable and has no corresponding
region of homology in gyrase (Lynn, et al., 1986; Wyckoff, et al.,
1989). Nevertheless, Cardenas and colleague dem onstrated
that the C-terminus contains a num ber of sites that are
phosphorylated by casein kinase II in vivo (Cardenas et al.,
1992; Cardenas and Gasser, 1993). Furtherm ore, it was
postulated that the C-terminal dom ain plays a role in the
p h y sio lo g ic al re g u la tio n of th e en zy m e th ro u g h
phosphorylation (Cardenas, et al., 1992; Corbett, Fernald and
Osheroff, 1993). Deletion studies on the C-terminal domain of
the yeast gene revealed that truncation of the C-terminus to
Hei 2 2 0 has little effect on the function of the enzyme in vitro or
in vivo, yet truncations extending beyond G lnnss give rise to
fully inactive proteins (Caron, Watt and Wang, 1994). Results
from the same studies also suggested that the C-terminal
7
dom ain of topoisomerase II may provide a signal for nuclear
localization (Caron, Watt and Wang, 1994).
C atalytic cycle o f topoisom erase II
O sheroff p ro p o se d th a t the enzym e activity of
topoisomerase II can be divided into the following discrete
steps: (1) DNA recognition/binding; (2) cleavage of the first
DNA duplex; (3) passage of the second DNA duplex; (4)
religation of the first DNA double strands; (5) enzyme turnover
(Osheroff, 1986). The catalytic cycle of topoisomerase II is
diagram ed in Figure 1.1. This enzyme initiates its catalytic
cycle by recognizing/binding to the DNA substrate. Following
binding to DNA, the enzyme creates double-stranded breaks in
the DNA phosphodiester backbone in the first pair of DNA
duplex, form ing DNA-enzvme cleavage com plex (Tse,
Kierkegaard and Wang, 1980). The step of cleavage requires
divalent cations (Osheroff, 1987) and results in covalent
attachment of the enzyme to the four-base protruding 5' end of
the cleaved DNA. Upon ATP-binding, strand passage occurs.
Topoisom erase II passes the second pair of DNA duplex
through the break. Strand passage is followed by religation of
the first pair of double strands (the cleaved strands). This
process uses the energy conserved in the phosphotyrosine
bond form ed between the phosphate group of DNA and the
active site tyrosine in the enzyme. After religation, the enzyme
8
regenerates its initial conform ation (enzyme turnover) by
hydrolyzing ATP. Osheroff et al. have dem onstrated that non-
hydrolyzable analogs of ATP do not support enzyme turnover
(Osheroff, Shelton and Brutlag, 1983).
The catalytic cycle of topoisom erase II is strictly
dependent to ATP hydrolysis, however, how ATP binding and
hydrolysis are coupled to the various steps of the cycle is not
clear. Recent studies of Lindsley and W ang using
immunotagging method revealed that in the yeast enzyme, the
polypeptide consists of at least four distinct domains divided
by the three protease-sensitive sites (Lindsley and Wang,
1991). It has been proposed that ATP-binding in the domain
which contains the ATPase site initiates a conform ational
change. This local conform ational change in turn triggers
allosteric movements across adjacent domains. The overall
movements of the domains in the enzyme might provide a way
of com m unication between the ATPase site and the DNA
binding sites in topoisom erase II and thus perm it strand
passage (Lindsley and Wang, 1991).
Unlike transcription factors, the DNA sequence specificity
of topoisom erase II is less ap p aren t although sequence
preferences have been detected. Both weak and strong
consensus recognition sequences have been observed for the
Drosophila topoisomerase II (Andersen et al., 1989; Muller et
9
al., 1988; Sander and Hsieh, 1983; Sander and Hsieh, 1985). It
has also been reported that it is the chrom atin structure but
not the DNA sequence specificity m ay be the prim ary
d eterm in an t of topoisom erase II sites of action in vivo
(Udvardy and Schedl, 1991).
Type II top oisom erase-targeted agents (DNA
to p o iso m e ra se II as a target o f can cer
chemotherapeutic agents)
The topoisom erase II in h ib ito rs can be bro adly
categorized into the intercalators and the non-intercalating
epipodophyllotoxins. Some of the m ost com m only used
topoisomerase inhibitors are listed in Table 1.1. They have
diverse structures yet exert anticancer activity through a
common mechanism. Regardless of the structural difference
among these agents, these drugs have been shown to have the
ability to inhibit the type II enzym es by stabilizing the
intermediate in catalytic cycle, term ed the covalent cleavage
complex. In the complex, DNA strands are broken and the
enzyme is covalently attached to DNA; therefore, the covalent
complex w'hen stabilized by a drug may act as a type of DNA
damaging agent (Liu, 1990).
One example of DNA intercalators that have been shown
to have antitum or activity is the acridine derivative 4'-(9-
acridinylam ino)m ethanesulfon-m -anisidide (m-AMSA). m-
10
AMSA (amsacrine), but not its ortho isomer, o-AMSA, was
shown to stimulate topoisomerase II-mediated DNA cleavage
(Nelson, Tewev and Liu, 1984). Both com pounds intercalate
DNA equally well, but only mAMSA has strong anticancer
activity (Wilson et al., 1981). It is likely that the m inor
difference in these drugs contributes to the drastically distinct
enzym e/DN A/drug interaction. In addition to intercalative
antitum or drugs, two nonintercalative glycosidic derivatives of
podophyllotoxins, VP-16 (etoposide) and VM-26 (teniposide)
have been also shown to be active against topoisomerase II and
have significant antitumor activity.
Recent studies have dem onstrated that the derivatives of
the antim icrobial quinolones which target DNA gyrase
(Maxwell, 1992; Reece and Maxwell, 1991) are p o ten t
inhibitors of the eukaryotic enzymes and display cytotoxicity to
cells in culture (Robinson et al., 1991; Robinson et al., 1992;
Yamashita et al., 1992b; Elsea et al., 1993). One example is the
fluoroquinolone CP-115,953.
Other topoisomerase II-targeted drugs such as ICRF193
and novobiocin (Goto and Wang, 1982) also inhibit the enzyme,
but not via the m echanism of stabilization of the cleavage
complex. ICRF193, has been shown to inhibit the catalytic
activity of topoisomerase II (Ishimi, Ishida and Andoh, 1992),
11
novobiocin inhib its enzy m e-catalyzed ATP hydrolysis
(Robinson, Corbett and Osheroff, 1993).
Mechanisms of drug action and cell killing
These topoisom erase II-targeted agents inhibit the
enzym e by stabilizing the cleavage complex in which the
enzyme is covalently bound to the broken DNA strands, and
trapped in the enzyme-DNA-drug ternary complex (Liu, 1989;
Liu, 1990). The stabilization of enzym e-m ediated DNA
breakage by topoisomerase II inhibitors can be achieved by
two different but not mutually exclusive mechanisms. Since
topoisom erase II breaks and reseals DNA, an overall
equilibrium is established between "cleavage" and "religation."
Drugs may act either by inhibiting religation or by stimulating
the forward rate of cleavage. In either case, the equilibrium
lies towards the "cleavage" part. Results from DNA religation
assays dem onstrated that some drugs, such as etoposide and
mAMSA, stabilize the enzym e-m ediated DNA cleavage
prim arily, by inhibiting DNA religation (Osheroff, 1989;
Robinson and Osheroff, 1990; Robinson and Osheroff, 1991).
O ther drugs, such as the fluoroquinolone CP-115,953 acts
prim arily by increasing the forward rate of DNA cleavage
(Robinson, et al., 1991; Robinson, et al., 1992).
It has been hypothesized that these inhibitors convert
topoisomerase II to a type of DNA damaging agent, and the
12
conversion of topoisomerase II to a poison may represent the
most im portant aspect in cell killing by these agents (Kreuzer
and Cozzarelli, 1979). This hypothesis has been tested by
decreasing the level of topoisomerase II activity. If the drug
converts topoisomerase II to a DNA dam aging agent, then
reducing the level of topoisomerase II activity is to reduce the
dose of the DNA damaging agent. This prediction has been
confirm ed by the experiments using yeast (Nitiss, Liu and
Hsiung, 1993). On the contrary, elevating the enzyme activity7
is to increase the level of damage (Nitiss et al., 1992). It has
been observed th at high levels of topoisom erase II are
associated with proliferating cells, and many cancer cells have
elevated levels of topoisomerase II (Hsiang, Wu and Liu, 1988,
and review ed in Liu, 1989). It is the high levels of
topoisom erase II th at may7 be partly responsible for the
efficacy of topoisomerase II inhibitors in treating cancer. On
the other hand, in some cases, resistance to anti-topoisomerase
II drugs is associated with reduced levels of topoisomerase II
(Friche et al., 1991; Pommier et al., 1986; Tan et al., 1989).
It should be em phasized that the topoisom erase II-
m ediated DNA breakage is transient in nature and can be
reversed upon the removal of the drugs, elevated tem perature
(65°C) or high salt. This observation has led to the question
that how can topoisomerase II-targeted drugs kill the cells if
13
the cleavage reaction is reversible. Although the details of the
cell killing event are not yet clear, it has been proposed that
breakage of DNA strands might be resonsible for cell killing.
D'Arpa et al. (D'Arpa and Liu, 1989; D'Arpa, Beardmore and Liu,
1990) suggested that moving replication complex can collide
with the cleavage complex and break it. As a consequence,
secondary stran d breaks th at can not be resealed are
generated. It has been suggested that these DNA breaks in
turn trigger a cascade of events that eventually lead to cell
d e ath by apoptosis, an active cell-killing m echanism
characterized by internucleosomal DNA cleavage (Hickman,
1992; Kaufmann, 1989; Onishi et al., 1993).
A m ajor shortcom ing of cancer chem otherapy is the
d ev elo p m e n t of drug resistance. R esistance to the
chemotherapeutic agents may be mediated by several different
but not mutually exclusive mechanisms. Drug resistance may
be due to reduced intracellular drug accum ulation, e.g.,
decreased drug uptake a n d /o r efficient drug removal. A
comm on experimental phenom enon during the selection for
resistant tum or cells in culture is the developm ent of multiple
drug resistance (MDR), which is characterized by cross
resistance to a num ber of structurally unrelated drugs,
including topoisomerase II poisons (reviewed in Endicott and
Ling, 1989). This multiple drug resistance phenotype has been
14
well characterized to be due to amplification of the MDR1 gene
hence the overexpression of the P-glycoprotein (Roninson,
1987). The MDR1 gene encodes a 170-kDa ATP-dependent
m em brane protein involved in drug efflux.
Drug resistance in m any cases may be due to gene
amplification and subsequent overexpression of the cellular
target. One example is the treatm ent of tum or cells with
m ethotrexate, a potent inhibitor of dihydrofolate reductase
(DHFR). This enzyme is required for the regeneration of
tetrahydrofolate from dihydrofolate and hence the conversion
of dUMP to dTMP. By interfering with this essential enzyme-
catalvzed event, m ethotrexate blocks DNA synthesis and
th erefo re exerts its anticancer activity. In this case,
overexpression of the drug target, DHFR, would lead to drug
resistance. As written in the previous section, in the case of
a n ti-to p o iso m e rase II agents th a t stabilize cleavage,
overexpression of the target enzyme would lead to drug
hypersensitivity.
In contrast to the classical MDR, atypical MDR phenotype
(atMDR) has been found in cell culture that have been selected
with cytotoxic drugs (Beck and Danks, 1991). Cells expressing
atMDR are generally unaltered in drug accum ulation and
retention (Danks, Yalowich and Beck, 1987) and do not
overexpress P-glycoprotein (Beck, Cirtain and Dank, 1987).
15
Recently, alterations in topoisomerase II (atMDR) have been
proposed as a possible mechanism of atypical multiple drug
resistance for drugs that target this enzyme (Pommier, et al.,
1986).
Studies of topoisomerase II-targeted anticancer drugs
in mammalian systems
In addition to topoisomerase H oc (170-kDa), mammalian
cells also express a 180-kDa isozyme, topoisomerase 1 1 ( 3 . The
gene encoding the 180-kDa variant, TOP2(3, is m apped to
chrom osom e 3 (Tan et al., 1992), while the gene (TOPIa)
e n co d in g the first id en tified 170-kD a h u m a n DNA
topoiosmerase II resides on 17q21-22 (Tsai-Phlugfelder et al.,
1988). Studies of drugs that target mammalian topoisomerase
II have been complicated with the discovery of the second
isoform, lip. Since most studies which utilized mammalian
systems have not attempted to define the specific contributions
of the two isozymes to the pharmacological effects of drugs, the
following discussion on mammalian topoisomerase II refers to
the H oc form.
Recently, several cell lines have been described that are
resistant to topoisomerase II poisons. For example, a Chinese
h am ster ovary (CHO) line, VpmR-5, was selected in the
presence of VM-26 (Gupta, 1983). In addition to teniposide,
V pm R -5 displays cross resistance to other topoisomerase II
16
poisons, such as etoposide, m-AMSA, m ito x an tro n e and
adriam ycin. The resistance of V pm R-5 to these anti-
topoisom erase II agents is characterized by the decreased
drug-stabilized DNA cleavage activity7 in crude nuclear extracts
(Glisson, Gupta and Hodges, 1986; Glisson, G upta and
Smallwood-Kentro, 1986). Nevertheless, the catalytic activity
has been shown to be identical in both the VpmR -5 line and its
wild type counterpart (Glisson, Gupta and Smallwood-Kentro,
1986). Furtherm ore, catalytic activity from both lines is
equally sensitive to inhibition by etoposide (Glisson, Gupta and
Smallwood-Kentro, 1986). No alterations in drug uptake has
been detected as assayed in crude nuclear extracts (Glisson,
Gupta and Smallwood-Kentro, 1986). Therefore, resistance of
V p m R -5 line to topoisomerase II poisons is unlikely to be
m ediated by the MDR1 product, P-glycoprotein. It has been
shown directly that topoisomerase II purified from VpmR -5
cells has similar specific activity to the enzyme purified from
the wild type line. However, VpmR -5 cell line has religation
activity which is less affected by drug than that of the wild
type cells (Sullivan et al., 1989). Thus, VpmR -5 CHO cell line
carries a qualitatively altered topoisom erase II that may
account for the cellular resistance to topoisomerase II poisons.
HL-60/AMSA is a hum an leukemic cell line that is 100
times more resistant to m-AMSA than its parental HL-60 line
17
(Bakic et al., 1986). Nuclear extracts from both lines have been
shown to contain a similar level of topoisomerase II activity
(Estey et al., 1987). As for the V pm R-5 CHO cell line, a
decreased drug-stabilized cleavage was detected in the nuclear
extracts from the HL-60/AMSA cells (Estey, et al., 1987). In
agreem ent with the results obtained from nuclear extracts,
topoisom erase II purified from HL-60/AMSA line displays
resistance to m-AMSA-stabilized DNA cleavage (Zwelling et al.,
1989). This represents an o th er example of resistance to
topoisomerase II poisons that may be due to a qualitative
alteration in the enzyme.
Several other cell lines have been shown to have altered
catalytic activity of topoisomerase II. For example, P388/A20
is a murine leukemia cell line that has developed resistance to
m-AMSA and cross-resistance to teniposide, bisantrene, and
doxorubicin, b u t n o t to the topoisom erase I poison,
camptothecin. This cell line has been shown to contain 2-3-fold
less topoisomerase II activity than its parental line, as well as
reduced topoisomerase II immuno-reactivity (Per et al., 1987).
A hum an leukemic cell line, CEM/VM-1, selected for resistance
to VM-26 also has an "atypical" MDR phenotype (Danks,
Yalowich and Beck, 1987) and displays altered catalytic activity
of topoisomerase II and DNA cleavage by the enzyme (Danks et
al., 1988). The CEM/VM-1-5 cells that were selected from the
18
CEM/VM-1 line by in te rm itte n t exposure to increasing
concnetrations of VM-26 exhibit a similar phenotype (Danks, et
al., 1988).
M utation s have b een id en tifie d in m am m alian
topoisom erase Ila from some of these cell lines described
above. The majority of these mutations are located in a small
but highly conserved region (amino acids 450-500). Hinds et
al. isolated a mutation in topoisomerase from the HL-60/AMSA
cell line that changes Arg4 8 7 to Lys (Hinds et al., 1991).
Subsequently, Lee and colleagues isolated an identical point
m utation in another hum an leukemic cell line, KBM-3/AMSA
which were independently selected for resistance to m-AMSA
(Lee, Wang and Beran, 1992). A m utation was detected in the
topoisomerase II cDNA from VpmR -5 cell line. The m utation
from this cell line changes Arg4 9 4 to Gin and is located near the
ATPase domain of topoisomerase II (Chan et al., 1993). Bugg
and colleagues identified a m utation in CEM/VM-1 line which
changes amino acid 450 from Arg to Gin (Bugg et al., 1991).
Subsequently, a second m utation was detected in CEM/VM-1
and its subline CEM/VM-1-5 by Danks and colleagues using
single strand conformation polymorphism analysis (SSCP) and
DNA sequencing analysis. The second mutation changes Prosos
to Ser (Danks et al., 1993). Since most drug resistant mutations
would be expected to be recessive to a drug sensitive
19
topoisomerase II, it is very difficult to dem onstrate that the
identified mutation actually plays a role in drug resistance.
Using y east to stu d y m echanism s d ru g action
As w ritten, drugs th a t stabilize cleavage inhib it
topoisomerase II by converting the enzyme to a cellular toxin.
Nevertheless, the m echanistic details of the interaction of
topoisom erase II and its inhibitors have not been well
understood. Little is known concerning the residues in the
topoisomerase II protein that are im portant in interacting with
anti-topoisomerase II agents. Microorganisms such as yeast
has served as an advantageous system for the studies of
topoisomerase II as target of anticancer drugs. A genetic and
biochem ical system utilizing the yeast Saccharom yces
cerevisiae has been developed in Dr. Nitiss' laboratory to probe
the mechanism of action of these drugs. Yeast can be used to
overcome the difficulty of dem onstrating w hether a specific
m utation in topoisomerase II can lead to drug resistance. It
can also be used for studying topoisomerase II mutations that
confer drug resistance and in turn to define the binding site(s)
on the protein that interact with anti-topoisomerase II agents.
20
Table 1.1 Type II topoisomerase inhibitors
Drue class
Intercalators
anilinoacridines
anthracenediones
anthracyclines
Nonintercalators
epipodophyllotoxins
examples
Drugs with clinical application
amsacrine (m-AMSA)
mitoxantrone
doxorubicin
etoposide(VP-l 6)
teniposide (VM-26)
Drugs currently in clinical trials
Intercalators
benzoisoquinolinediones amonafide
ellip ticin es ellipticine
2-m ethy-9-hydroxyellipticine
Drugs currently in lab/experimental
Nonintercalators
isoflavones genistein
quinolones CP-115,953
Figure 1.1 Proposed m odel for the catalytic cycle of
topoisomerase II (Beck and Danks, 1991). Part of this model
was proposed by Kohn et al. (Kohn et al., 1987) and based on
the steps involved in strand-passing, as sum m arized by
Osheroff (Osheroff, 1989b).
22
23
C H A PT E R I ISO L A T IO N A ND C H A R A C T E R IZ A T IO N OF
N EW Y E A ST T O P O ISO M E R A SE II M U T A N T S SE L E C T E D
FO R R E SIST A N C E TO T O P O ISO M E R A SE II-T A R G E T IN G
AGENTS
1.1 INTRODUCTION
In addition to its indispensable role in the cellular
processes, topoisomerase II represents an important target for
chemotherapy. Topoisomerase II-targeted drugs, despite their
structural differences, inhibit topoisomerase II through a
common mechanism. These anti-topoisomerase II agents exert
their therapeutic action by stabilization of an intermediate,
called the cleavage complex, in the topoisomerase II catalytic
cycle. Unlike the conventional enzyme inhibitors, such as
methotrexate, which acts on its targets by depriving the cell of
an essential enzyraati-c activity, these inhibitors convert the
enzyme to a cellular toxin. This unique mechanism of drug
action predicts that high topoisomerase II activity leads to drug
hypersensitivity, while low activity leads to drug resistance.
This prediction has been confirmed by genetic studies in yeast.
A yeast temperature-sensitive allele, to p 2 -l , had close to wild
type topoisomerase II activity at permissive temperature, and
showed relatively high sensitivity to mAMSA and etoposide.
At semi-permissive temperature (30°C), the enzyme activity
was reduced to about 1 0 % of the wild type level, and the cells
then became very resistant to both drugs (Nitiss, Liu and
Hsiung, 1993). The cells were still sensitive to camptolhecin
which inhibits topoisomerase I, hence the resistance is specific
for drugs that target topoisomerase II. In contrast, a drug
sensitive strain carrying the plasmid pD E D lT O P2, which
overexpresses topoisomerase II about 20-40 fold, showed
enhanced sensitivity to mAMSA and etoposide (Nitiss, et al.,
1992).
Drugs that stabilize cleavage in the prokaryotic type II
enzyme, DNA gyrase, are mainly the quinolone-based
antibiotics and their derivatives (Reece and Maxwell, 1991).
The fluoroquinolone analogs, such as norfloxacin and
ciprofloxacin, represent a major group of antibacterial agents
that target DNA gyrase (Reece and Maxwell, 1991). Recently, it
has been shown that some fluoroquinolones are potent
inhibitors of eukaryotic topoisomerase II (Barrett et al., 1989;
Elsea. Osheroff and Nitiss, 1992; Robinson, et al., 1991;
Yamashita et al., 1992a). For example, CP-115,953 [6 ,8 -
d iflu o ro -7 -(4 ’-hydroxyphenyl)-l -cyclopropyl-4-quinolone-3-
carboxylic acid], a quinolone-based analog, is highly toxic to
mammalian cells in culture (Robinson, et al., 1991), and active
against topoisomerase II in vitro (Robinson and Osheroff,
1991). Additionally, genetic studies have demonstrated that
25
the eukaryotic topoisomerase II is the primary physiological
target for quinolone cytotoxicity (Elsea, Osheroff and Nitiss,
1992).
The biochemical evidences suggest that these anti-
topoisomerase II agents appear to stabilize cleavage by two
distinct mechanisms: interference of the religation or
stimulation of the forward rate of cleavage. However, the
detailed biochemical mechanism of drug action is not well
understood. M oreover, little inform ation is available
concerning the residues in topoisomerase II that interact with
these inhibitors. In bacteria, various mutations have been
identified that confer resistance to quinolone. Mutants that
carry mutation at S e r^ of gyrA have been frequently isolated
(Reece and Maxwell, 1991). Recently, several mutations have
been reported in eukaryotic DNA topoisomerase II that may
play a role in drug resistance. Mutation of Arg4 X 7 to Lys in
human topoisomerase II a has been identified by Zwelling et al
in cell line selected for resistance to mAMSA (Hinds, et al.,
1991; Zwelling, et al., 1989). Lee and colleagues also reported
the same mutation in the same cell line (Lee, Wang and Beran,
1992). Bugg et al. have identified a mutation of topoisomerase
Ila that changes Arg4 5o to Gin in a leniposide resistant cell line
(Bugg, et al., 1991). The cell line carries a topoisomerase II
with an altered requirement for ATP. More recently, Danks et
26
al. have identified another mutation in the same cell line that
changes Promos to Ser (Danks, et al., 1993). However, it is not
yet clear whether these two mutations reside on the same
allele. Since the mechanism of cell killing predicts that drug
resistance to be recessive, it might be expected that in the drug
resistant cell lines, one allele has to be completely inactive.
Therefore, it has been difficult to confirm whether the
identified mutations represent the drug resistant allele or the
inactive allele, and to rigorously verify the role of the
mutations in drug resistance.
More recently W asserman and W ang constructed a
number of yeast topoisomerase II mutants that are resistant to
mAMSA by hydroxylamine mutagenesis as well as site-
directed mutagenesis (Wasserman and Wang, 1994a). Three
classes of mutants have been isolated. The first class of
mutants carries single or multiple changes in a highly
conserved region bearing the sequence PLRGKMLN located at
positions 474-481. The second class of mutants bears changes
of Alaf,4 2 to Thr or Gly. The third class of mutants are the
carboxy-terminal deletion mutants. Biochemical studies of
these m utant enzym es suggested that m utations in
topoisomerase II leading to drug resistance may not affect
directly the drug-enzyme interactions but affect certain
catalytic steps of the enzyme (Wasserman and Wang, 1994b).
27
In the case of the C-terminal deletion mutant, resistance to
mA M SA may be a consequence of reduced nuclear
concentration of the mutant enzyme (Wasserman and Wang,
1994b). which may result from a defect in the nuclear
localization signal (Caron, Watt and Wang, 1994).
A yeast system has been developed for isolating and
characterizing mutations in topoisomerase II resistant to drugs
that target the enzyme (Liu et al., 1994). One of the obstacles
for studying the action of anti-topoisomerase drugs in yeast is
the impermeability of yeast cells to the agents of interest. This
difficulty is overcome by using a yeast permeability mutation,
ISE 2 (inhibitor sensitive). 1SE2 mutation was originally
isolated by ethyl methanesulfonate mutagenesis (Nitiss and
Wang, 1988). ISE2 strains show enhanced drug permeability
(drug accumulation) to the cytotoxic agents cycloheximide and
aphidicolin as well as anti-topoisomerase agents such as
mAMSA and camptothecin. In yeast, sensitivity to drugs such
as etoposide requires the ISE2 mutation in order to exhibit
drug sensitivity (Nitiss and Wang, 1988). Since drug resistance
is expected to be recessive, a temperature sensitive top2 allele
was used to recover the drug resistant mutants. To enhance
the sensitivity of yeast cells to drugs, a DNA repair difficient
mutation, rad52~ was also used in the scheme.
28
One mode of drug resistance is due to low level of
topoisomerase II activity. Since DED1 promoter confers a
moderate level (about 20-30 fold) of overexpression of TOP2,
the resistant mutants whose resistance is due solely to low
topoisomerase II activity is reduced.
The greatest advantage of using yeast is the availability
of genetic tools and the easy manipulation of this unicellular
organism. This chapter describes this yeast genetic system for
isolating and characterizing mutations in topoisomerase II
resistant to mAMSA and etoposide. Several drug resistant
mutant alleles have been characterized, and the mutations in
each of the alleles identified. Two of the reconstructed mutant
alleles, the t o p 2 - A 4 and the io p 2 - 103ci, display resistant
phenotypes observed in the original overexpressing plasmids;
the mutations of which map to the gyrB and gyrA homology
domains, respectively. I demonstrate that Pros 24 to Ser
mutation in the top2-103 allele, is located around the active
site tyrosine and close to the previously described top2-4
mutation, and is sufficient and responsible for the observed
drug resistance. In addition, both mutations, Hisso7 to Tyr and
H i s 5 2 1 to Tyr, are required to give rise to drug resistance,
neither single mutation is sufficient.
29
1.2 M ATERIALS AND M ETHODS
1.2.1 Yeast growth and transformation
Yeast cells were typically grown in rich medium YPDA or,
to select for plasmids carrying URA3 (or L E U 2) as a marker, in
synthetic complete medium lacking uracil (or leucine) , SC-URA
(or SC-LEU) (Sherman, Fink and Hicks, 1979). Yeast
transformation was carried out using the modified lithium
acetate protocol of Schiestl and Gietz (Schiestl and Gietz, 1989).
1.2.2 Yeast strains
The yeast strains used for this study are derivatives of
JN362a. The genotype of this strain is MATa ura3-52 leu2 trpl
his7 a d e l-2 ISE2. JN394 is the isogenic rad52::LEU2 derivative
of JN362a; JN394t2-4 is the top2-4 rad52 double mutant
derivative. These strains and their genotypes are listed in
Table 1.1. The m utagenized plasmid carrying yeast
topoisomerase II was pDEDlTOP2, which carries the yeast TOP2
gene under the control of the yeast DED1 promoter (Nitiss, et
al., 1992).
1.2.3 In vitro mutagenesis
The conditions for in vitro mutagenesis were determined
by the pilot experiment described below. Briefly, 10 pg
pBR322 was treated with 0.67 M hydroxylamine in PE buffer
(0.4 ml of 0.25 M PE buffer and 0.8 ml of 1 M hydroxylamine)
for 1 h, 2 h or 3 h at 65°C. PE buffer is 0.25 M KP04 (pH 6.0)-5
30
mM EDTA. 1 M hydroxylamine is made of 0.56 ml of 4 M NaOH
and 0.35 g of NI-EOH-HCl in a total volume of 5 ml HtO. After
the treatment with hydroxylamine and extensive dialysis (first
with 1 liter of TE [10 mM Tris-HCl (pH 7.5)-1 mM EDTA] for 1
h, then with 1 liter of TE for 4 h. finally with 1 liter of TE
overnight) of the plasmid DNA against TE, the DNA was
precipitated with ethanol and transformed into Escherichia coli
strain JM101. Cells were plated to LB containing 50 jig /m 1
ampicillin then replica plated to LB containing 12 [ tg /m l
tetracycline. Treatment of pBR322 with hydroxylamine at 65°C
for 1 h resulted in the highest frequency of recovering
tetracycline sensitive transformants (2 %).
Mutations were introduced into the yeast T O P 2 gene by
in vitro mutagenesis using hydroxylamine (Sikorski and Boeke.
1991). 10 p g pDEDlTOP2 was treated with hydroxylamine
using the conditions described above. After precipitation with
ethanol, the DNA was transformed into Escherichia coli strain
XL-1 blue. The transformants were pooled and grown for
about 10 h in Terrific Broth medium. Plasmid DNA was then
prepared by alkaline lysis (Birnboim and Doly, 1979), and the
DNA was purified by ultracentrifugation in CsCl gradients
containing ethidium bromide. The efficiency of mutagenesis
was determined by transforming the mutagenized plasmid pool
obtained above into a yeast strain carrying the top2-4
31
mutation and by determining the frequency of transformants
carrying intact plasmid that fail to grow at the nonpermissive
temperature for top2-4.
1.2.4 Determination of drug senstitivity
Etoposide was obtained from Sigma. mAMSA was a gift
from Bristol Myer Laboratories. Quinolone CP-1 15.953 was
synthesized at Pfizer Central Research by P.R. McGuirk and Dr.
T.D. Gootz. Etoposide and mAMSA were dissolved in 100%
dimethyl sulfoxide (DMSO), and CP-115,953 was dissolved as a
25 mM solution in 0.1 N NaOH. diluted to a 5 mM stock with 10
mM Tris-HCl. pH 8.0. All drugs were stored at -80°C. Drug
sensitivity of yeast strains was determined as described
previously (Nitiss and Wang, 1988). Cells were grown in YPDA
medium at the temperature used for assaying drug sensitivity;
for the study presented here, some of the characterization of
mutants was performed at 36°C. This temperature eliminates
the effects of the iop2-4 allele, which does not have enzymatic
activity at this temperature (Jannatipour. Liu and Nitiss, 1993).
The cells were grown to logarithmical phase and the cell titer
was adjusted to 2 x 106 cells/ml. Drugs (or drug solvent for no
drug sample) were added at zero time, and 1 0 0 (_ L l aliquots of
samples were removed at the indicated times, diluted, and
plated to YPDA plates, and the viable titer was determined by
duplicate plating. Plates were incubated at 30l) C for 3-4 days.
32
1.2.5 Determination of topoisomerase II activity
Topoisomerase II activity was determined in crude cell
extracts using knotted phage P4 as a substrate (Liu, Davis and
Calender, 1981). The crude cell extracts were prepared by
disrupting cells using glass bead. Cells were grown to mid
logarithm phase (OD 6 0 0 = 0.4-0.9) in 10-ml of appropriate
medium. Cells were harvested and the wet weight (one
volume) was determined. Cells were kept on ice through out
the procedure. Cells were resuspended in 3 volumes of cold
glass bead disruption buffer [20 mM potassium phosphate,
pH7. 10 mM MgCK 1 mM EDTA, 5% glycerol, 0.3 M (NH4)2S0 4 . 1
mM DTT, 1 mM PMSF] in an appropriately sized screw-cap
eppendorf tube. Four volumes of cold glass beads were added
to the cell suspension. The suspension was vortexed at
maximum speed for 1 min and chilled on ice for 1 min. This
procedure was repeated for 5-7 times, and the breakage of
cells was examined under a microscope. The supernatant was
decanted from the tube to a clean tube. Two-four volumes of
disruption buffer were added to glass beads and the tube was
inverted to mix. The supernatant was decanted and combined
with the previous one. Finally, the combined supernatant was
spun in an eppendorf microcentrifuge at top speed for 5 min
and the extract was collected.
33
Topoisomerase II activity was determined in 20 (j. 1 of
TOP2 buffer (20 mM Tris-HCl, pH 7.5, 10 mM MgCD, 0.5 mM
ATP, 1 mM EDTA, 1 mM dithiothreitol, 150 mM KC1, and 30
(I g/ml acetylated bovine serum album in) with equal
concentration of protein added. Each reaction contained 20 ng
of knotted DNA. The products of the reaction were analyzed by
agarose gel electrophoresis after incubation at 37"C for 30 min.
Protein concentrations in cell extracts were determined by the
Bradford method (Bradford, 1976). Reactions for activity
assays were terminated by adding loading dye containing 2 0
mM EDTA.
1 .2 .6 R eco v ery o f p la sm id s c a r r y in g to p o iso m e r a se II
mutations and DNA sequence determination
Plasmids carrying the mutant alleles were recovered
using a modified version of methods of Strathern (Strathern
and Higgins. 1991). Cells from a 10-ml saturated culture
growing in synthetic medium minus uracil were lysed using
glass beads with a inini-Bead-Beater (Bio-Spec). Cells were
harvested and the cell pellet was equally divided into four
portions and transfered to four appropriately sized screw-cap
eppendorf tubes. 0.8 g of glassbeads (425-600 microns) and
200 |il of lysis buffer [2 % (v/v) Triton X-100, 1 % (w/v) SDS,
100 mM NaCl, 10 mM Tris-HCl, pH 8.0, 1 mM EDTA, pH 8.0] and
200 (_ l 1 of PCI [a 25:24:1 (v/v) mixture of phenokCHCl.^isoamyl
34
alcohol] were added. Cells were vortexed at the top speed for 2
min, then spun at top speed in an eppendorf microcentrifuge
for 5 minutes. The aqueous phase from each tubes was
collected and precipitated with ethanol. The nucleic acids were
resuspended in 50 |Il of 10 mM Tris-HCl (pH 8.0)-l inM EDTA
and used to transform E. coli strain DH5a (or XL-1 blue). E. coli
competent cells were prepared by C aC h method (Sambrook,
Fritsch and Maniatis, 1989). A much better transformation
efficiency was obtained with the freshly prepared competent
cells that have been kept on ice overnight.
DNA sequence of the mutant alleles was determined
using dideoxynucleotide chain termination (Sanger, Nicklen and
Coulson. 1977) with double-stranded tem plates using
Sequenase 2.0 from United States Biochemical (Tabor and
Richardson. 1989).
1.2.7 Plasmids
pMJ2 was made by Mehrdad Jannatipour in Nitiss'
laboratory. The procedure is detailed as the following: pMJ2
was constructed by first eliminating the Asp7 \ 8 site of pRS306
(Sikorski and Hieter, 1989) by digestion with A sp 7 J 8 , fill-in
synthesis with the Klenow fragment of DNA polymerase I, and
religation. Then the 4.1-kb Bglll-Bglll fragment from pYl
(Goto and Wang, 1984) which carries most of the yeast T O P 2
gene (but lacks the promoter and the first 487 nucleotides of
35
the coding sequence) was introduced into the unique Bam HI
site. The resulting recombinant plasmid has a unique Asp71 8
site within TOP2 for integration into the chromosomal yeast
T O P 2 locus using two-step gene replacement (Scherer and
Davis, 1979) and also carries the yeast URA3 gene for selection
of transformation in yeast.
1.2.8 Oligonucleotide-directed mutagenesis
Point mutations were reconstructed in the plasmid pMJ2
described above. Mutagenesis was performed using the Kunkel
method (Kunkel, Roberts and Zakour, 1987) with the Muta-
gene kit (Bio-Rad) following the supplier's instructions except
that E.coli DH5a was used for the propagation of plasmids. The
m utant alleles and the mutagenic oligonucleotides for
construction of the particular mutations in the topoisomerase II
gene are listed in Table 1.2.
The two mutations of the top2-A4 allele were constructed
using both mutagenic oligonucleotides that were used for
constructing pMJ2-H507*Y and pMJ2-H52i*Y. The pMJ2 plasmid
carrying these two mutations is designated as pMJ2 -H 507:i:Y &
H 5 2 1 Y . The bold letters indicate the changes from the wild
type yeast TOP2 sequence. All of the constructed mutations
were verified by DNA sequencing.
36
1.2 .9 C o n stru ctio n o f d ru g p erm ea b le str a in s ca rr y in g
the top2 mutant allele and rad52~ mutation
Yeast strain JN362a was transformed with Asp7i8-
digested yeast plasmid pMJ2 carrying the particular mutations,
and the transformants selected with SC-URA medium. The
resultant strain is isogenic to JN362a except that the new strain
carries the particular mutations in the topoisomerase II gene
and the sequences of yeast plasmid pMJ2. These strains were
then converted to rad52' by one step gene disruption using
pSM20, which carries a LEU2 disruption of the RAD52 gene
(Schild, et al.. 1983). The reconstructe strains are listed in
Table 1.3. The strains listed also carry U R A 3 gene in the
chromosome as a result of integration of pMJ2.
1.3 RESULTS
1.3.1 Selection of amsacrine-resistant mutants
The scheme for isolating topoisomerase II mutants that
are resistant to mAMSA is shown in Figure 1.1. The library
used to screen for the mutants was constructed by collecting at
least 10,000 independent plasmids pD ED lTO P2 that has been
mutagenized with hydroxylamine. The mutagenesis efficiency
was assesed by transforming the mutagenized plasmid pool
into JN362at2-4 and selecting for URA+ clones at 25°C. 420 of
the transformants were tested for growth at the non-
permissive temperature (36°C); about 5% of the clones tested
37
failed to grow at 36° C. To determine that the failure of the
plasmid to complement temperature sensitive mutation (top2-
4) is due to point mutations introduced by hydroxylamine
rather than large deletions or gross DNA rearrangements,
restriction analysis was performed on the plasmids isolated
from clones that failed to grow at 36°C. As shown in Figure 1.2,
All of the plasmids showed the same restriction pattern as un-
mutagenized pDEDlTOP2.
The mutagenized pool of pDEDlTOP2 was transformed
into JN 394at2-4. A p p ro x im ately 10,000 individual
transformants were collected and resuspended in SC-URA
medium. A portion of the cells was taken from the pool and
diluted to a concentration of 2 x 106 cells/ml in YPDA medium.
mAMSA was added to the final concentration of 10 |ig/ml or 50
(J.g/ml, and the cells were incubated at 36°C with shaking for
48 h. After 48 h, the cells were diluted to 2 x 106 cells/ml in
YPDA medium, and fresh mAMSA was added to the final
concentration as above. The purpose of using different
concentrations of drugs is to obtain mutants with differential
sensitivity to topoisomerase II inhibitors. The cells were
plated to SC-URA plates after additional 48 h. The colonies that
grew on SC-URA plates were replica-plated to YPDA plates
containing 20 Jdg/ml or 50 |4g/ml of mAMSA. Almost all of the
colonies recovered after two rounds of selection were able to
38
grow on plates containing either 20 or 50 (Ig/ml of mAMSA. In
contrast, cells carrying the un-mutagenized pD ED lTO P2 that
have not been exposed to drug selection could not grow on
plates containing mAMSA. As an intention to recover
topoisomerase II mutants that are resistant to one drug
(mAMSA) but sensitive to another drug, all the mAMSA
resistant colonies were then screened with 2 0 jig/ml or 1 0 0
|ig/ml of etoposide. Most of the colonies were also viable on
etoposide-containing plates. The scheme of selection and
screening are designed to recover topoisomerase II mutants
with differential sensitivity to different topoisomerase II
inhibitors.
I have isolated a large number of colonies that were
resistant to mAMSA. They were assigned to three classes
(Table 1.4). The majority of the isolates tested (class III, about
600) were resistant to high concentrations of both mAMSA and
etoposide. Four isolates (class I) showed resistance to 50 pig/m l
of mAMSA but sensitivity to 20 |4g/ml of etoposide; whereas,
five isolates (class II) appeared to be resistant to 50 jig/ml of
mAMSA but sensitive to 100 |4g/ml etoposide.
All of the isolates in classes I and II, and ten of the class
III isolates were subjected to further characterization. To
verify that the drug phenotypes observed were due to the
mutagenized plasmid, plasmids were isolated from these
39
resistant colonies, transformed into E. coli, and reiransformed
into JN394at2-4. Drug sensitivity of cells carrying the
retransformed plasmids was measured in liquid culture as
detailed in the "Materials and Methods." Three of the 19
plasmids gave rise to transformants that had indistinguishable
sensitivity to mAM SA or etoposide as un-m utagenized
pD E D lT O P 2. The rest of the plasmids gave rise to
transformants that were resistant to both mAM SA and
etoposide. The previously seen phenotypes, resistant to one
drug but relatively sensitive to another drug (for example,
isolates of class I) were not recovered in the secondary
screening. This is probably due to the qualitatively minor
differences in the primary screening and in replica-plating
procedure. Although the scheme was originally designed to
recover mutants with differential sensitivity to topoisomerase
Il-targeled drugs, no such mutants were isolated. Therefore,
hereinafter the isolates are referred as the individual alleles
but not categorized as either class I. 1 1 or III. Five isolates
from classes II {lop2-Al, top2-A2, top2-A3) and III (iop2-A4 ,
top2-A 10) displayed relative more resistance to both mAMSA
and etoposide. Results obtained from the measurement of drug
sensitivity for these five mutants are discribed in the next
section.
40
1 .3 .2 C h a r a c t e r iz e th e p o t e n t ia l d r u g r e s is t a n t
mutants: m easurem ent of drug sensitivity in vivo
Figure 1.3 shows the sensitivity of JN394t2-4 strain with
the pDEDlTOP2 plasmid carrying the top2-Al allele to mAMSA
and etoposide. The drug sensitivity was determined at 36l1 C
This strain carrying this mutant plasmid was able to grow in
medium containing 100 jig/ml mAMSA. By contrast. JN394t2-
4 carrying the un-mutagenized pD ED lTO P2 has an minimum
lethal concentration (MLC) of mAMSA less than 20 )lg /m l
(Figure 1,4A). Moreover, Liu et al. have demonstrated that the
MLC of mAMSA is as low as 2 jig/ml (Liu et al., 1994). For
etoposide, the MLC conferred by the mutant allele is 100 |Lig/ml
as compared to an MLC less than 20 |I g/ml of the un-
mutagenized plasmid (Figure 1.3B and 1.4B). The profile of
sensitivity of top2-A2, and top2-A3 to mAMSA and etoposide
is similar to that of top2-Al.
Although all the alleles described above exhibited drug
resistance, differences in level of resistance exist. The top2-A4
allele confers higher level of resistance to mAM SA and
etoposide as compared to top2-AJ allele. Figure 1.5 shows the
sensitivity of JN394t2-4 with the mutant plasmid carrying the
top2-A4 allele to mAMSA and etoposide. The cells were able to
grow in medium containing 100 pg/ml of mAMSA (Figure 1.5A)
or 100 pg/ml of etoposide (Figure 1.5B). After 24 h, the
41
survival of cells carrying the top2-A4 allele is about 700% at
100 Jig/nil of mAMSA as compared to 500% for cells carrying
the top2-Al allele. (Figures 5A and 3A, respectively). The
comparison of etoposide sensitivity of the top2-Al and top2-
A4 alleles is shown in figures 3B and 5B. The top2-A4 allele
confers about 800% of survival at 100 pg/ml of etoposide after
24 h, while the same drug concentration results in killing in
JN394t2-4 strain harboring the plasmid-borne \op2-Al allele.
The MLC of all of the mutant alleles to mAMSA and etoposide
are summarized in Table 1.5.
Figure 1.6 shows the drug sensitivity of JN394t2-4
carrying the plasmid-borne tnp2-A 10 allele. The cells were
able to grow in medium containing 100 pg/ml of mAMSA and
displayed about 900% of survival (Figure 1.6A). A similar
profile of resistance to etoposide was obtained and shown in
Figure 1.6B.
1.3.3 D eterm in a tio n o f to p o iso m era se II a ctiv ity o f the
drug resistant alleles in crude cell extracts
I next determined the topoisomerase II activity in crude
cell extracts. Cell extracts were prepared from strain JN394t2-
4 carrying the pDEDlTOP2-borne top2 alleles, to p 2 - A l, \op2-
A 2 , t o p 2 -A3 . top 2 -A4 , t o p 2 - A J 0 or u n -m utagenized
pDEDlTOP2. Topoisomerase II activity was demonstrated by
unknotting assay in the crude cell extracts. Results obtained
42
from the assays are shown in Figure 1.7. All the mutant alleles
confer relatively lower activity than the wild type. No
topoisomerase II activity was detected in cell extracts prepared
from strains carrying the top2-A10 allele. Strains carrying the
Iop2-A 1, lop2-A2 or top2-A3 allele have similar unknotting
activity. Among the five mutants assayed, strains carrying the
top2-A4 allele has highest unknotting activity and this activity
was close to the wild type topoisomerase II activity.
1.3.4 Determination of the mutational changes by DNA
sequencing
Previously three mutants, top2-101, top2-102 and top2-
103 have been isolated using the system described above with
slightly different strategy (Liu, et al.. 1994). Table 1.6
summerizes the drug resistance of the three alleles. Briefly,
the t o p 2 - J 0 1 allele has wild type level of sensitivity to
mAMSA but is resistant to etoposide with a MLC of 50 flg/ml
versus 10 )Llg/ml for wild type TOP2. Unlike top2-10J allele,
the top2-103 allele is relatively resistant to mAMSA, but has
an MLC to etoposide similar to that with top2-101 allele.
Overall, the mutant alleles described above {top2-Al , top2-A2,
l o p 2 - A 3 , l o p 2 - A 4 and t op2 - A 10) confer higher level of
resistance to mAMSA and etoposide than top2-J0J and top2-
103 alleles, while, as shown in Table 1.6, top2-102 has a
comparable level of mAMSA and etoposide resistance.
43
It has been reported that topoisomerase II is the primary
cellular target in yeast for the fluoroquinolone CP-115,953
(Elsea, Osheroff and Nitiss, 1992). As shown in Table 1.6,
JN394t2-4 carrying the plasmid-borne Iop2-101 or top2-102
allele displays high level of resistance to CP-115,953, while
top2-103 mutant plasmid confers only a low level of resistance
to CP-115,953, having an MLC of 10 pM versus 5 pM for wild
type TOP2. In summary, the top2-102 plasmid confers high
levels of resistance to mAMSA, etoposide and CP-1 15,953.
JN394t2-4 strain haboring the top2-101 plasmid is relatively
insensitive to etoposide, but resistant to CP-115.953. lop2-103.
on the other hand, has moderate resistance to all of the three
drugs tested. The five mutants isolated by selection with
mAMSA display high levels of drug resistance, while top2-J0J,
lop2-102 and lop2-103 alleles confer a unique spectrum of
drug sensitivity to JN394t2-4. Hence, the system described
above has proven to be useful for isolating mutants
characterized by different sensitivity to anti-topoisomerase II
agents.
Even though topoisomerase II activity was not detected
in extracts prepared from cells carrying the top2-A10 allele,
there must be some activity in vivo for viability. I next
determined the mutational changes in all of the mutant alleles
described above by DNA sequencing analysis. In all of the
44
alleles sequenced, the mutations identified are either G to A or
C to T transitions. Hydroxylamine is a highly specific mutagen.
It reacts almost exclusively with cytosine by deamination to
give a derivative (uracil) that pairs with adenine rather than
with guanine (). As a result, base pair transition was obtained.
All the mutations I identified are listed in Table 1.2. The top2-
A 1 , top2-A2 and top2-A3 alleles all have a change of G3026 to
A; this DNA sequence results in a change of Argioog to Lys of
topoisomerase II. Since the entire TOP2 gene in these alleles
have sequenced and no other change was detected, the three
isolates are derived from one individual mutagenized plasmid
and are not independent. This mutation is located in the C-
terininal portion of the gyrA homology domain.
Two mutations were detected in the top2-A4 allele. Both
changes are located in the gyrB homology domain, and 14
amino acids apart. The first mutation changes C 1519 to T,
resulting in a change of Hisso7 to Tyr; the second one converts
C i5 6 i to T, changing Hissoi to Tyr. The two mutations are close
to the consensus ATP binding sequence (amino acids 400-500)
described by Walker et al. (Walker, et al., 1982); however, they
do not correspond to amino acids at the equivalent positions in
the relatively homologous regions of the yeast and the human
topoisomerase II. It is interesting to note that in human
45
topoisomerase II, there is a Tyr at residue 518 (Hisso7 in yeast
topoisomerase II).
Three mutations were identified in the top2-A10 allele.
All three have a change of G to A. The change at nucleotide
1689 results in a synonym (Pro5 6 3 ), at 1962 results in a
nonsense mutation (TGG to TGA), at 3343 converts G lu m s to
Lys (missense). Since topoisomerase II is essential for survival,
a functional polypeptide has to be synthesized in the cells. It is
likely that a nonsense suppressor is present, for example, a
suppressor tRNA, and this nonsense suppressor causes a change
from Trp (TGG) to another amino acid. The amino acid
insertion apparently does not affect cell survival, but it likely
affects topoisomerase II activity in strains carrying the topl-
A10 allele (Figure 1.7).
There is a change of G2213 10 A in the top2-101 allele, and
this new DNA sequence results in a change of Gly7 3 g of yeast
topoisomerase II to Asp. Gly7 3 s is three amino acids from
Sei‘741 that is homologous to Ser^s of gyr A. Ser«3 is the major
site at which mutations have been found that confer resistance
to fluoroquinolones in E.coli (Reece and Maxwell, 1991). As
described above, the top2-101 allele also confers resistance to
the fluoroquinolone, CP-115,953 (Table 1.6). The sequence
around the Ser§3 homologue is well conserved among all type
II topoisomerases (Huang, 1990).
46
The top2-102 allele has a change of G 3 5 8 4 to A, and
results in a conservative change, A r g n 95 to Lys. This mutation
is located in the relatively non-conserved C terminus. It is not
clear what role the mutation of A rg n y jL y s plays in drug
resistance. ArgimsLys is five amino acids from He 12 2 0 > a site
beyond which truncation of the C terminus has little effect on
the function of the enzyme in vivo and in vitro (Caron, Watt
and Wang, 1994).
Two mutations were detected in the top2-J03 allele. The
first one changes C2470 to T, resulting in a change of Pros24 to
Ser {t op2 -103 a) and the second one changes G 3 5 5 7 to A.
converting Gly 11 s6 to Glu {top2-103h). Pros24 is conserved
among eukaryotic type II topoisomerases, E .c o li gyrA protein
and the product of bacteriophage T4 gene 52 (Huang, 1990). In
addition, the region surrounding Proa24 is homologous among
eukaryotic topoisomerase II (Huang, 1990). Proa24 is close to
the mutation identified in the top2-4 allele, which carries a
change of Pros2 i to Gin. Like the mutation identified in the
top2-J02 allele, Glynsfi to Glu of the top2-J03b allele is located
in the non-conserved C terminus.
47
1.3.5 Reconstruction of the identified m utations by
site-directed m utagenesis, and m easu rem en t of the
drug sensitivity of the reconstructed topoisomerase II
mutants
I next determined whether the identified mutation in a
particular allele is necessary and sufficient for conferring the
phenotypes observed. I constructed m utant alleles
corresponding to the mutations identified in the alleles
described above. Since the entire TOP2 gene of the iop2-AJ,
t o p 2 - A 2 and to p 2 -A 3 has been sequenced, and the only
mutation identified is Arg | ooyLys, these three alleles represent
the same one and were derived from one individual plasmid.
Therefore, only the top2-Al allele was reconstructed. I did not
pursue the study of the top2-A 10 mutant for the following
reasons: topoisomerase II activity can not be detected by
unknotting assay in extracts prepared from strains carrying the
top2-A10 allele and the study of this allele may be complicated
by the existence of a nonsense mutation. The mutant alleles
were constructed in plasmid pMJ2 as described in " Materials
and Methods." Because both the top2-A4 and the top2-103
alleles consist of two mutations, it was of interest to determine
which of the two mutations was responsible for the observed
drug resistance. I therefore constructed mutant alleles
corresponding to the two single mutations as well as the double
48
ones identified in the top2-A4 and the top2-103 alleles. The
mutations were introduced into pMJ2 by oligonucleotide-
directed mutagenesis and the newly constructed pMJ2 carrying
the mutations were integrated into JN362a. The resulting
strain then carried the particular mutation on chromosome, and
was converted to rad52~ using one-step gene disruption. The
reconstructed strains were denoted JN394t2-Al, JN394t2-A4a,
JN 394t2-A 4b. JN 394t2-A 4, JN 3 9 4 t2 -103a, JN 3 9 4 t2 -103b,
JN394t2-103.
I next determ ined the drug resistance of the
reconstructed mutant alleles. I examined the sensitivity of the
reconstructed mutant alleles to mAMSA and etoposide, and in
some cases, to the quinolone CP-115,953. Surprisingly, neither
the reconstructed mutant alleles, /op2-A 1 , top2-1 01 or iop2-
1 0 2 , conferred resistance to the drugs tested as previously
seen in strains harboring the overexpressing plasmids carrying
the corresponding mutations. Since the original overexpressing
plasmid carrying the tn p 2 - A 4 allele had a high level of
resistance to mAMSA and etoposide, I also examined the
reconstructed His5 Q7 to Tyr, HiSfoi to Tyr and the double
mutant for sensitivity to these agents. Neither single mutation
confers resistance to any of the agents. If both mutations were
present, a high level of resistance to both mAMSA and
etoposide was seen. Both mutations are necessary and
49
responsible for resistance to mAMSA and etoposide. The
details of the top2-A4 allele are discussed in Chapter II.
I also determined which of the mutations in the top2-103
allele was reponsible for the observed drug resistance. Unlike
the top2-A4 allele, the reconstructed Prox24 to Ser mutation is
sufficient for drug resistance. Strain carrying the top2-103a
allele is highly resistant to both mAMSA and etoposide. The
plasmid carrying the G lyns6 to Glu change does not alter the
sensitivity to either agent (Figure 1.8). Figure 1.9 shows the
sensitivity of the top2-103a allele. The lop2-103a allele has an
MLC of about 100 pg/ml mAMSA (Figure 1.9A) and greater
than 100 pg/ml etoposide (Figure 1.9B) versus an MLC of less
than 20 pg/ml for mAMSA or less than 20 pg/ml for etoposide
with the wild type TOP2. Since the original overexpressing
plasmid carrying the Iop2-103 allele had limited resistance to
CP-115,953. I also examined the reconstructed Pros24 to Ser
allele for sensitivity to this agent. In agreement with the result
obtained from the overexpressing plasmid (Table 1.6), the
reconstructed Prox24 to Ser allele has an MLC of 5-10 pM for
CP-115,953 (Figure 1.10A) after 24 h as compared to 5 pM for
the wild type T O P 2 (Table 1.6). As described above, the top2-
103a allele is three residues from the top2-4 allele, which has a
change of Pros2 i to Gin. Therefore, I also examined whether
this change is important for sensitivity to fluoroquinolones.
50
Since the top2-4 allele is temperature sensitive, I measure the
sensitivity of both the lop2-103ci and iop2-4 alleles to
CPI 15,953 at 25°C. Interestingly, the top2-4 allele confers a
higher level of resistance to the fluoroquinolone than the topl-
103a allele (Figure 1.10B). Previously, it has been
demonstrated that the top2-4 allele is resistant to etoposide
but not to mAMSA (Niliss, et al., 1992). Collectively, these
results suggest that a domain that includes the region from
Pros2 i to Pros24 plays important specific roles in the interaction
of different classes of anti-topoisomerase II agents with the
enzyme.
1.4 DISCUSSION
A genetic system in yeast has been developed to isolate
mutations in topoisomerase II that are resistant to drugs that
target the enzyme. Several mutants have been isolated and
characterized using this system. I was able to demonstrate
that the drug resistance is due to the plasmid-borne mutant
allele by isolating the plasmid and re-transforming the plasmid
into a yeast strain that had not been exposed to drug selection.
I have reconstructed the identified mutations in pMJ2;
however, in some cases, I could not observe the drug resistant
phenotypes conferred by the overexpressing plasm id.
Nevertheless, I was able to demonstrate that Prog24 10 Ser of
the top2-103 allele is reponsible for drug resistance seen in the
51
original overexpressing plasmid; both His5 0 7 , His5 2 i to Tyr of
the lop2-A4 allele are required for the resistance to mAMSA
and etoposide.
Moreover, the reconstructed tap2-J03a allele is much
more resistant (Figure 1.10) than the allele in the
overexpressing pDEDlTOP2, having an MLC of about 100 pg/m l
to mAMSA and greater than 100 pg/ml to etoposide. In
agreement with the expected pattern for drugs that stabilize
cleavage, these results demonstrate that low topoisomerase II
activity leads to drug resistance (lop2-103a) and high activity
leads to drug hypersensitivity {top2-103 in pD ED !TO P2).
Similarly, the reconstructed lop2-A4 allele (in pMJ2 with a
wild type level of expression) is more resistant than the allele
when it is overexpressed (see Figure 1.5 and Chapter II).
The goal of this part of the study was to identify the
regions of topoisomerase II that are important for drug action.
The mutation detected in the to p 2 -103a allele defines a site
that is close to the mutation Pros2 i lo Gin of the top2-4 allele
(Thomas et al., 1991). It has been reported previously that the
top2-4 strain is highly resistant to etoposide but in contrast to
the top2-103a allele, the resistance to mAMSA is minor (Nitiss,
et al., 1992). Interestingly, the strains carrying the top2-4
allele are more resistant to fluoroquinolone than the iop2-l03a
allele. Taken together, these results suggest that the domain
defined by these two mutations is important for drug action.
Most of the mutations identified in human topoisomerase
Ila that lead to drug resistance are located in the g y r B
homology domain, particularly one of the ATPase consensus
domains of TO PI (Bugg, et al., 1991; Hinds, et al., 1991). The
mutations (HissoyTyr/Hi S521 Tyr) detected in the \op2-A4 allele
are also located in the gyrB homology domain. These mutations
do not correspond to amino acids at the equivalent positions in
the relatively homologous regions of the human topoisomerase
II. Mutation of A rg ^o G ln of topoisomerase IIex has been
reported by Bugg et al. in a teniposide resistant cell line (Bugg,
et al., 1991). Topoisomerase II from this cell line has been
shown to have altered the requirement for ATP. Genetic
studies have demonstrated that the yeast equivalent mutation
(Lys-nyGln) of Arg4 soGln confers resistance to mAMSA and
etoposide (Nitiss et al., 1994). The discovery of the
H is 5 0 7 T y r/H is 5 2 iTyr mutations in this region further suggests
an important role of the #.v/'B homology domain in drug
resistance (see Chapter II).
Reconstruction of the t o p 2 - A I , top2-J 01 and top2-102
alleles in pMJ2 does not result in drug resistance. It is possible
that in this case resistance requires overexpression of mutant
topoisomerase II. It is very likely the case because I have
53
sequenced the entire T 0 P 2 gene of these three alleles, and no
other mutation was detected. To determine whether it might
be the case, the mutations detected in the mutant alleles can be
reconstructed on the overexpressing plasmid pDEDlTOP2. Drug
sensitivity of cells carrying the reconstructed pDEDlTOP2 with
the particular mutations can be determined. Whether the
particular m utations are responsible for the observed
phenotypes will be readily known. For all three cases
described above, one possibility for the cells to require
overexpression of mutant enzymes to confer drug resistance is
that the mutant enzymes may be more sensitive to the
complete inhibition of cleavage by the drugs, and as a result
the transient nature of the cleavage complex is somewhat
altered. The cells would be dying due to a lack of
topoisomerase II activity rather than just the stabilization of
the cleavage complex in the presence of drugs. As a
consequence, the cells require overexpressed level of mutant
topoisomerase II in order to survive.
Since the mutation of Gly738 to Asp detected in the top2-
101 allele is close to Ser7 4 i, that is homologous to Ser 1*3 in gyrA,
the major site for quinolone resistance, I constructed various
mutations at Sei’7 4 | in yeast topoisomerase II (see Chapter III).
The results demonstrates that Sei' 7 4 1 is important for resistance
to fluoroquinolones and also for sensitivity to etoposide. Hence,
54
I believe that Gly738 to Asp of the top2-101 allele is important
for drug resistance/sensitivity. Additionally, the homology
around the mutation in the to p 2 -1 0 1 allele suggests the
significance of the conserved residue. The mutation of top2-
101 identifies a particular site that might be important for
interacting with quinolone and etoposide.
The mutations detected in the yeast topoisomerase II
suggest "where to look for mutations" in the human enzyme
from either cell lines or cells from patients treated with anti-
topoisomerase II agents. Since human topoisomerase Ila has
been functionally expressed in yeast, I am able to directly
analyze the mutations identified in human TOP2. For example,
I construct Arg4 5 o to Gin and Pros03 to Ser and the double
mutant in human T O P 2 a . The details of the expression of
human TOP2a and the construction and analysis of these
mutants will be discussed in Chapter IV.
55
Mutagenize plasmid pDEDlT0P2 with hydroxylamine
I
T ra n sfo rm m u ta g en ize d p la s m id i n t o JN 394t2-4
( S t r a i n c a r r y i n g top2-4 rci(152 ISE2)
I
Select for resistance to etoposide at 36 H C
I
Isolate plasmid from resistant colonies
I
Retransform into JN394t2-4
I
Determine drug resistance at 36 °C
I
Verify level of topoisomerase II activity
I
Determine DNA sequence of the mutant allele
I
Reconstruct identified mutation by
oligonucleotide directed mutagenesis
Figure 1.1 Selection and characterization of drug-resistant
mutants.
The scheme for isolation of drug-resistant yeast topoisomerase
II is summarized.
56
Figure 1.2 Restriction pattern of plasmid DNA isolated from
transformants that failed to complement iop2ls mutation.
Plasmid DNA was isolated from yeast transformants that were
unable to grow at 36°C. The plasmids were transformed into
E.coli, plasmid DNA was isolated, and digested with EcoRI.
Lanes 1 and 20 are the molecular weight marker; lane 10 is the
unmutagenized pDEDlTOP2. The rest of the lanes are the
plasmid DNA isolated from the 17 transformants that failed to
grow at non-permissive temperature.
Figure 1.3 mAMSA and etoposide sensitivity of yeast strains
carrying the top2-Al allele.
The sensitivity of JN394t2-4 cells carrying the top2-AJ allele
on the overexpression plasmid pD ED lTO P2 to mAMSA and
etoposide was determined at 36° C as described in the
"Materials and Methods." This figure shows the sensitivity to
various concentrations of mAMSA (3A) or etoposide (3B). Open
circles indicate no drug; open squares indicate either 20 |4g/ml
mAMSA or 20 |4g/ml etoposide, while open triangles represent
100 |4g/ml of mAMSA or etoposide.
58
Relative survival (%)
A
10000
1000
100
10
5 1 5 1 0 20 3 0
Time (hr)
Relative survival (%)
B
10000
1000
100
10
0 5 1 5 20 2 5 3 0 I 0
Time (hr)
60
Figure 1.4 Drug sensitivity of cells carrying pDEDlTOP2.
Drug sensitivity of JN394t2-4 strains carrying unmutagenized
pDEDlTOP2 was determined under the same conditions as the
experiment shown in figure3. The sensitivity to various
concentrations of mAMSA (4A) or etoposide (4B) is shown. The
conditions shown are: no drug (open circles), 20 (Ig/ml mAMSA
or 20 J4g/ml etoposide (open squares), 100 |4g/ml of mAMSA or
etoposide (open triangles).
61
Relative survival (%)
A
10000
1000
100
10
0 5 1 5 2 0 25 3 0 1 0
Time (hr)
62
Relative survival (%)
B
10000
1000
100
5 I 5 20 25 1 0 3 0
Time (hr)
63
Figure 1.5 Yeast strains carrying the to p 2 - A 4 allele are
resistant to mAMSA and etoposide.
mAMSA (5A) or etoposide (5B) sensitivity of JN394t2-4
carrying the top2-A4 allele on plasmid pD ED lTO P2 was
determined at 36" C as described in the "Materials and
Methods." No drug (open circles); 20 ftg/ml mAMSA or 20
)Ig/m] etoposide (open squares); 100 flg/ml m A M SA or
etoposide (open triangles).
64
Relative survival (%)
10000
1000
100
Time (hr)
65
Relative survival (%)
B
1 0000
1000
100
Time (hr)
66
Figure 1.6 mAMSA and etoposide sensitivity of yeast strains
carrying the top2-A10 allele.
mAMSA (6A) or etoposide (6B) sensitivity of JN394t2-4
carrying the top2-AJ0 allele on plasmid pD ED lTO P2 was
determined at 36c 'C as described previously. The conditions
were: no drug (open circles), 20 |4g/ml mAMSA or 20 Jig /m l
etoposide (open squares), 100 |J.g/ml mAMSA or etoposide
(open triangles).
67
Relative survival (%)
B
1 0000
1000
100
0 15 2 0 2 5 3 0
Time (hr)
68
Relative survival (%)
B
10000
1000
100
Time (hr)
69
Figure 1.7 Topoisomerase II activity of mutant alleles.
DNA topoisomerase II activity was determined in crude
extracts from JN394t2-4 cells carrying pD ED lTO P2 with the
\ o p 2 - A l , top2-A2, top2-A3. top2-A4, top2-A 1 0 or the wild
type enzyme. All of the reactions were carried out at 37°Q
hence the activity assayed is due to the plasmid borne
topoisomerase II. Lane 1: iop2-Al\ lane 2: top2-A2; lane 3:
top2-A3; lane 4: top2-A4; lane 5: top2-Al 0; lane 6: wild type;
lane 7: purified wild type topoisomerase II. Lane 8 contains
the substrate DNA (knotted P4 DNA) without treatment of
extract.
70
Figure 1.8 Drug sensitivity of the reconstructed t o p 2 - 103b
allele.
The two mutations identified in the t o p 2 -J 0 3 allele were
reconstructed on plasmid pMJ2. The mutations were
introduced into JN362a by gene replacement, and the strains
were converted to rad52~. mAMSA (open symbols) and
etoposide (filled symbols) sensitivity of the reconstructed top2-
103b allele was determined according to "Materials and
Methods" at 30°C. The conditions shown are: no drug (circles),
20 (ig/ml mAMSA or 20 (J.g/ml etoposide (squares), 100 (ig/ml
mAMSA or 100 )Ig/ml etoposide (triangles).
71
Relative survival (%)
1 0 0 0
10
.01
3 0 I 5 2 0 5 I 0
Time (hr)
72
Figure 1.9 The recontructed to p i-103a allele confers resistance
to mAMSA and etoposide.
The reconstructed to p 2 - 1 0 3 a allele carries a mutation of
P r o s 2 4 Ser in topoisom erase II. Drug sensitivity was
determined under the same conditions as the experiment
shown in Figure 1.8. The open symbols indicate strains
carrying P r o ^ S e r mutation in topoisomerase II, while the
filled symbols represent the wild type enzyme. Sensitivity of
the mutant strains versus wild type strains to mAMSA (9A)
and etoposide (9B) is shown. The conditions were: no drug
(circles), 20 jig/ml mAMSA or 20 |J.g/ml etoposide (squares),
100 Jj.g/ml mAMSA or 100 |Ig/ml etoposide (triangles).
73
Relative survival
( % )
O
o
o
H
Mi
3
ft
sr
» ‘ 1 * » ' m l «
►
i l l — ■ I * t «
> □ o »
-J
4^
Relative survival
— o c
>ft* »-»»»»«»«! t ...........
(%)
o
o
o
o
c
w
I
Figure 1.10 Fluoroquinolone sensitivity of yeast strains
carrying the top2-4 or reconstructed top2-103a allele.
The sensitivity of the reconstructed top2-103a allele and top2-
4 allele to C P-115,953 was determined at 25°C. Figure 1.10A
shows the sensitivity of top2-103a strain; Figure 1.1 OB shows
the sensitivity of top2-4 strain. The conditions shown are: no
drug (open circles), 5 (I M (open squares), 10 |HM (open
triangles), 20 jlM (filled squares), 50 |-lM (filled triangles) CP-
115,953.
76
Relative survival (%)
A
10000
1000
100
10
.01
5 1 0 1 5 2 0 3 0 0
Tim e (hr)
77
Relative survival (%)
10000
1000
100
10
.01
0 1 0 1 5 2 0
T
3 0
Tim e (hr)
78
Table 1.1 Yeast strains
Strain ______________________________ G enotype
JN 362a M A T a u m 3 -5 2 Icu2 tr p l h is7 a d d -2 ISE2
JN 394 as JN 362a but rad52:. A L E U 2
JN 39412-4 as JN 394 but to p 2 -4
JEL MATa, Ieii2, trp l, ura3-52 . prb 1 -11 22, p e p 4 - 3 ,
Aliis3::pGALl-GAL4
19
Table 1.2 Mutations identified in yeast topoisomerase II
M utant allele M utagenic oligon u cleotid e pM J2 mutant plasm id
to p 2 -A I C T A T C A A A A A A A A A A A G A C C p M J2-R louy *K
top2-A 4a G G G G T T A C A A T A T C G C A A G A
pM J2-H S 0 7 *Y
top 2 -A 4 b G A T A T G G G T A T C T T A T G A T C pM J2-H 52i *Y
top2-IO I C A T A T C A C C A T G A T G A G C A G pM J2 -G 7 3 8 *D
to p 2 -1 0 2 A A G G A A A A A A A A A G C T T G T T G pM J2-R | 195 *K
to p -1 0 3 a C C A A T T C T T T C T A T G A T T C T pM J2-P 8 2 4 *S
to p 2 -1 0 3 b C C A A T A A A G A G A G C A A A A C G p M J 2 -G ||g() *E
80
Table 1.3 Reconstructed yeast strains
Strains G enotype
JN 394t2-A 1
as JN 394 but carries R 1 00 9 *K in TO P2
JN 394t2-A 4a
as JN 394 but carries H 5 0 7 * Y in T O P2
JN 394t2-A 4b
as JN 394 but carries H 521 * Y in T O P 2
JN 394t2-A 4
as J N 394 but carries H 5 0 7 *Y & H52i *Y in T O P 2
JN 394t2-101
as JN 394 but carries G 7 3 8 *D in TO P2
JN 394t2-102
as JN 394 but carries R i | 95 *K in TO P2
JN 394t2-103a
as JN 394 but carries P^-t *S in TO P2
JN 394 t2 -I0 3 b
as J N 394 but carries G | | *E in T O P2
81
Table 1.4 Summary of the preliminary characterization of the
isolates
Class_______________________________________________Number of mutants isolated
Class I
Resistant to 50 |4g/ml amsacrine
Sensitive to 20 (4g/ml etoposide 4
Class II
Resistant to 50 |Ig/ml amsacrine
Sensitive to 100 (Ig/ml etoposide 5
Class III
. Resistant to 50 (Ig/ml amsacrine
Resistant to 100 |4g/ml etoposide >600 @
@ Not all of these mutants are independent.
82
Table 1.5 Minimum Lethal Concentration (|lg/ml) of the mutant
alleles carried on the overexpression plasmid pD ED lTO P2 to
mAMSA and etoposide at 36° C
Allele mAMSA EtODOside
top2-Al > 1 0 0 1 0 0
top2-A4 > 1 0 0 > 1 0 0
top2-A10 > 1 0 0 > 1 0 0
83
Table 1.6 Resistance of the mutants to anti-topoisomerase II
agents
Allele___________Etoposide (jlg/mP mAMSA ('p.g/ml') FO ('p.Ml
TOP2+ 10
MLC in top2-4 at 36°C
2 5
top2-101 50 1-5 50
top2-I02 > 1 0 0 1 0 0 > 50
toP2-103 50 2 0 10
MLC of mutant alleles at 25^C
top2-103ci 5-10
top2-4 10-20
84
CHAPTER II A NEW Y EAST TOP2 DRUG R ESISTA NT
M UTANT CARRIES TWO M UTATIO NS THAT ARE CLOSE
TO THE gyrB HOMOLOGY DOMAIN
2.1 INTRODUCTION
One of the key elements in the catalytic cycle of
topoisomerase II is the high energy cofactor ATP. ATP-binding
initiates strand passage, while ATP hydrolysis leads to the
regeneration of active enzym e conform ation (Osheroff,
Zechiedrich and Gale, 1991). Hence, the catalytic cycle of
topoisomerase II is strictly coupled to ATP hydrolysis.
Besides its essential physiological role, topoisomerase II
is also a major target for a wide variety of anti-cancer drugs.
The therapeutic function of these agents correlates with their
ability to stabilize the intermediate cleavage complex (Corbett
and Osheroff, 1993). Although the cleavage reaction is
reversible, it becomes lethal when the replication complex
attempts to traverse the double strand DNA breaks.
A genetic and biochemical system in yeast was
previously described to allow easy isolation and construction of
mutations in topoisomerase II that confer resistance to agents
that target this enzyme (Liu, et al., 1994). Mutations detected
in the g y rA homology domain flanking the active site tyrosine
have been reported to play a role in drug resistance
85
(Jannatipour, Liu and Nitiss, 1993; Liu, et al., 1994). Using the
system, mutations in the gyrB homology domain have also been
isolated. In the present studies, reconstruction of the single
and double changes demonstrated that both His507 and Hiss 21
in the top2-A4 allele must be mutated to produce the observed
drug resistance. Neither single mutation results in resistance to
either etoposide or mAMSA. Although they do not correspond
to equivalent amino acids in the human topoisomerase Hot,
these changes are located in a relatively conserved region
(Figure 2.1). In order to understand the intrinsic alterations of
the top2-A4 protein and characterize drug resistance in vitro, I
overexpressed and purified the t o p 2 - A 4 protein. My
experiments demonstrate that in agreement with the in vivo
results, the to p 2 -A 4 protein is resistant to mAMSA and
etoposide in vitro.
2.2 MATERIALS AND METHODS
2.2.1 Yeast strains
The yeast strains used in this study are JN394t2-A4a,
JN394t2-A4b, JN394t2-A4 and JE L l. Their genotypes are
listed in Table 1.1 (JELl) and Table 1.3 (JN394t2-A4a.
JN394t2-A4b, JN394t2-A4) in Chapter I.
2.2.2 Construction of plasmid for overexpression
Plasmid pMJ2-H507*Y & H5 2 i*Y (see Table 1.2 in Chapter
I) and YEpTOP2-PGALl (Giaever, Snyder and Wang, 1988)
86
were digested with Kpnl and Avr II. The 2.2 kb fragment from
pMJ2-H507*Y & H 5 2 i*Y, and 11.5 kb fragment from YEpTOP2-
PGAL1 were gel purified, ligated and subsequently
transformed into E.coli DH5a competent cells. Plasmids that
had an identical restriction pattern to YEpTOP2-PGALl were
identified. The presence of the His5 0 7*Y & His5 2 i*Y encoding
mutation was confirmed by DNA sequencing. The plasmid
carrying the mutation was termed Y Eptop2-A 4-PGA Ll, and
used to transform the yeast strain JELl for overexpression and
purification of topoisomerase II.
2 .2 .3 I n d u c t i o n an d o v e r e x p r e s s i o n o f y e a s t
topoisomerase II
A modification of the protocol of Worland and Wang
(Worland and Wang, 1989) was used. Overexpression of
topoisomerase II in yeast Saccharom yces cerevisiae was driven
from PGAL1 (Yocum et al., 1984). an galactose-inducible
promoter of the G A L I gene. The yeast strain JELl transformed
with Y Eptop2-A 4-PGA Ll was grown in synthetic medium
lacking uracil for the maintenance of the plasmid. The
synthetic medium was supplemented with 3% (v/v) glycerol,
2 % (w/v) lactic acid, and 2 % (w/v) glucose; in the presence of
glucose, PGAL1 is repressed. At late log phase the culture was
diluted 1:100 and grown to an OD 600 of -0.7. Galactose was
then added to a final concentration of 2 %; the cells were
87
incubated for an additional 10-14 hours. Cells were harvested
by centrifugation, and washed with deionized water followed
by HARVEST BUFFER (50 mM Tris-HCl, pH 7.7, 1 mM EDTA, 1
mM EGTA, 10% glycerol, 25 mM NaF, 1 mM Na 2SOs, 1 mM (3-
mercaptoethanol, 1 mM phenylmethylsulfonylfluoride [PMSF]).
The cells then were resuspended in 2 ml of HARVEST BUFFER
per g of wet packed cells, quickly frozen in an ethanol/dry ice
bath, and stored at -80 0 C until use.
2.2.4 Purification of topoisomerase II
The top2-A4 protein was purified from 2 liters of culture
(~ 9 g of frozen wet-packed cells). Prior to column
chromatography, the purification scheme was based on the
protocol of Worland and Wang (Worland and Wang, 1989). All
purification steps were carries out at 4°C. Cells were thawed on
ice and distributed equally to four 50-ml conical tubes. Cells
were disrupted in BUFFER I (50 mM Tris-HCl. pH 7.7, 1 mM
EGTA, 1 mM EDTA, 10% glycerol, 1 mM PMSF, 1 mM (3-
mercaptoethanol, 0.5 |4g/ml leupeptin, 1 jig/ml pepstatin) using
50% volume of acid-washed glass beads on a votex mixer at
highest speed. Cell debris was removed by centrifugation for
15 min at 10,000 rpm in an SS-34 rotor. Lysates were diluted
to 5 mg/ml protein with BUFFER I plus 25 mM KC1. Nucleic
acids and protein-nucleic acid complexes were precipitated by
the slow addition of polyethyleneimine to a final concentration
88
of 2%, followed by stirring for 30 min. Samples were
centrifuged for 10 min at 10,000 rpm in an SS-34 rotor. Pellets
were washed with 30 ml BUFFER I plus 150 mM KC1, stirred for
10 min, and centrifuged as above. The washed pellets were
extracted twice by stirring for 15 min in 30 ml BUFFER I plus
750 mM KC1, followed by centrifugation as above.
Supernatants were combined, brought to 35% saturation with
the addition of finely ground NFUCSCUb and stirred for 30 min.
Following centrifugation for 25 min at 15,000 rpm in an SS-34
rotor, the supernatant was brought to 65% saturation with
N H 4 (SC>4 ) 2 and stirred for 30 min. Topoisomerase II was
pelleted by centrifugation for 25 min at 15,000 rpm in an SS-
34 rotor. The pellet was resuspended in BUFFER I to a
conductivity that approximately equaled to that of the COLUMN
BUFFER (10 mM Tris-HCl, ph7.7, 1 mM EDTA, 1 mM EGTA, 10%
glycerol, 0.5 mM dithiothreitol) containing 250 mM KC1.
Colum n chrom atography was carried out by a
modification of the protocol of Shelton (Shelton, Osheroff and
Brutlag, 1983) using an automated FPLC system (Pharmacia
HR). The sample was applied to a 10 ml phosphocellulose (P81,
Whatman) column (Pharmacia HR). The column was washed
with 3 column volumes of COLUMN BUFFER containing 250 mM
KC1 and 0.1 mM PMSF. Topoisomerase II was eluted over a
linear 10 column volume gradient with COLUMN BUFFER
89
containing 250 mM KC1 to 1 M KC1. Topoisomerase II eluted at
~ 650 mM KC1, as monitored by polyacrylamide/SDS gel
electropheresis (PAGE) on 7.5% acrylamide gel stained with
Coomassie Blue. Fractions containing topoisomerase II were
pooled and diluted with BUFFER I to a conductivity equal to
that of the COLUMN BUFFER plus 250 mM KC1. Topoisomerase
II was applied to a 2 ml phosphocellulose collection column
(Pharmacia HR), and the column was washed with 5 column
volumes of COLUMN BUFFER plus 250 mM KC1. Topoisomerase
II was eluted with 3 column volumes of COLUMN BUFFER
containing 750 mM KC1 and 40% glycerol. Fractions were
assayed for protein concentration by Bradford method
(BioRad), using bovine serum albumin as a standard. Fractions
containing topoisomerase II were pooled, aliquoted, and stored
in -80° C. The yield was about 0.3 mg/g of wet packed cells.
2.2.5 Determination of topoisomerase II activity
T o p o iso m e ra se II activity was d eterm in e d by
decatenation of kinetoplast DNA (kDNA). kDNA is the highly
compact interlinked minicircle network of Crithidia fasciculata,
and was prepared by the method of Morel et al. (Morel et al.,
1980). Enzyme activity was determined in 20 jll of TOP2
buffer (20 mM Tris-HCl, pH 7.5, 10 mM MgCL, 0.5 mM ATP, 1
mM EDTA, 1 mM dithiothreitol, 150 mM KC1, and 30 |ig /m l
acetylated bovine serum albumin. Each reaction contained 100
90
ng of kDNA. The products of the reaction were analyzed by
agarose gel electrophoresis at 100 volts for 1 hr. One unit of
topoisomerase II activity was defined as the activity required
to completely decatenate 100 ng of kDNA in 30 min at 37°C
The purified top2-A4 protein and wild type topoisomerase II
were diluted to 0.005, 0.01, 0.02, 0.05 g/J-f 1 with COLUMN
BUFFER containing 750 mM KC1 and 40% glycerol. 1 (id of the
diluted enzymes was added to each 9 jll decatenation reaction
mixture. Reactions for activity assays were terminated by
adding 6X loading dye [0.25% bromophenol blue, 0.25% xylene
cyanol FF, 40% (w/v) sucrose in water] containing 20 mM EDTA.
2 .2 .6 Q u a n tita tiv e d e te r m in a tio n o f d r u g -sta b iliz e d
cleavage
Quantitative DNA cleavage was determined using a
modified version of the K+/SDS method (Liu et al., 1983; Muller,
1983). pUC18 DNA was linearized by digesting with restriction
endonuclease EcuRI, and end-labeled by filling in with a - 32P-
labeled ATP using the Klenow fragment. The specific activity
of the labeled DNA was about 1-3 x 106 cpm /|lg of DNA.
Approximately 5-10 x 105 cpm were added per reaction. Each
sample with different drug concentrations was analyzed in
triplicate. The cleavage reaction was carried out in TOP2
buffer, in a total volume of 50 jll, with 8 units of topoisomerase
II. The reaction was incubated for 30 min and then stopped
91
with 1 ml of STOP BUFFER (1.25 % SDS, 5 mM EDTA, pH 8.0, 0.4
mg/ml salmon sperm DNA). Then 250 |Il of 325 mM KC1 was
added, and the reaction was incubated at 65 °C for 10 min. The
reactions were placed on ice for 10 min followed by
centrifugation in a microcentrifuge at top speed for 10 min.
The supernatant was removed, and the samples were
resuspended by adding 1 ml of 65° C WASH BUFFER (10 mM
Tris-HCl, pH 8.0, 100 mM KC1, 1 mM EDTA, 1 mg/ml salmon
sperm DNA). Samples were further incubated at 65°C for 10
min, placed on ice for 10 min, and centrifuged as above. The
wash procedure was carried out for a total of three times.
After the final wash, the samples were resuspended in 400 Jll
of water by incubating at 65°C. 100 Jll of the sample was
removed and added to 4 ml of scintillation fluid (Aquasol), and
counts were determined. Using this procedure, less than 2 % of
the counts remain in the precipitate when no DNA
topoisom erase II was added as com pared to when
topoisomerase II was added along with drug diluent. The
multiple washes are required to reduce the background to this
level. Independent determination of cleavage with the same
substrate shows levels of cleavage with a standard error of no
more than 10 %.
92
2.3 RESULTS
2.3.1 N eith er m utation of histid in e 507 nor h istid in e
521 to tyrosine alters drug sensitivity
JN394t2-4 carrying pDEDltop2-A4 is resistant to mAMSA
and etoposide (see Chapter I). Two mutations, His5 0 7 and
HiS5 2 i to Tyr were identified by DNA sequencing. In order to
determine which m utation of the t o p 2 - A 4 allele was
responsible for the observed drug resistance, I first constructed
new mutant alleles, top2-A4a (His5 0 7 to Tyr) and top2-A4b
(H is 521 to Tyr) with the two single changes. Mutation of His507
or Hiss 21 to Tyr was constructed on plasmid pMJ2 by
oligonucleotide directed mutagenesis (see "Materials and
Methods"). The detailed procedure for construction of the
strains carrying the t o p 2 - A 4 a or the to p 2 -A 4 b allele is
described in "Materials and Methods." As shown in figure 2.2A
and 2.2B, the level of sensitivity of strains carrying His507 to
Tyr mutation to mAMSA and etoposide is indistinguishable as
compared to that of the isogenic T O P 2 + strain. Similar results
were obtained with H iss 2 iTyr strains (Figure 2.2C). Hence,
neither single mutation results in resistance to either drug.
93
2.3.2 Strains (JN 394t2-A 4) carrying both histidine 507
and histid in e 521 to tyrosin e m utation s are resistant
to mAMSA and etoposide
I then constructed both Hisso7 and Hissii to Tyr on pMJ2
and replaced the wild type TOP2 allele with the allele carrying
both mutations. The newly constructed strain was then
converted to racl52~ and designated as JN394t2-A4. Unlike the
strains carrying either single mutations, JN394t2-A4 cells
display high levels of resistance to mAMSA and etoposide
(Figure 2.3). The minimum lethal concentration (MLC) for
isogenic strains carrying TOP2+ was < 20 jdg/ml mAMSA; the
viability of the cells was approximately 1% after 24 hours drug
exposure (Figure 2.3A) By contrast, JN394t2-A4 cells were
able to grow in medium containing 100 (dg/ml of mAMSA
(Figure 2.3A). As shown in Figure 2.3B, growth of strains
carrying wild type TOP2 was inhibited in medium containing
2 0 (Ig/ml etoposide; at 1 0 0 ftg/ml etoposide, the viability of
cells was < 10%. Strains carrying HissoyTyr and His5 2 iTyr were
able to grow in medium containing 1 0 0 |-tg/ml etoposide
(Figure 2.3B). Therefore, both Hisso7 and His521 must be
mutated to Tyr to produce the drug resistant phenotype seen
in JN394t2-A4.
94
2.3.3 Purification of top2-A4 protein
In order to gain more understanding of the intrinsic
alterations of the top2-A4 protein and characterize the drug
resistance of the protein in vitro, I constructed the
overexpression vector YEptop2-A4-PGALl in which the gene
encoding top2-A4 protein is driven by the yeast GAL1
promoter. The detailed procedure for purifying topoisomerase
II was described in "Materials and Methods." Figure 2.4 shows
the electrophoretic pattern of proteins in the various fractions
from the purification procedure. The top2-A4 protein was
enriched by saturating the glassbead-disrupted cell extracts
(Figure 2.4. lane 2) with 65% NH4 (S 0 4 )o (Figure 2.4 lane 3) and
purified to 90% pure by phosphocellulose chromatography
(Figure 2.4 lanes 4-7).
2.3.4 Determination of topoisomerase II activity
In order to characterize the level of catalytic activity of
the purified top2-A4 protein, topoisomerase II activity was
determined by decatenation of kinetoplast DNA (kDNA) as
described in the "Materials and Methods." As shown in Figure
2.5 (lane 2), 0.02 fJ. g was the lowest amount of the top2-A4
protein required to entirely decatenate 100 ng kDNA.
Therefore, 0.02 Jig was determined as one unit for the top2-A4
protein. Figure 2.5 (lanes 6-9) also shows that the level of
95
catalytic activity of the top2-A4 protein is equivalent to wild
type topoisomerase II.
2.3.5 The top2-A4 protein is drug resistant in vitro
In order to determine whether there is an alteration in
drug-stabilized cleavage that leads to resistance of the top2-A4
protein, the quantitative level of cleavage stabilized by
mAMSA or etoposide was assessed. Radioactively labeled
substrate was incubated with 8 units of either the top2-A4
protein or the wild type topoisomerase II in the presence of
different concentrations of drugs. As shown in Figure 2.6. the
amount of counts precipitated with the top2-A4 protein is
drastically lower as compared to the counts precipitated with
the wild type topoisomerase II. The increase in precipitable
counts with either the wild type enzyme or the top2-A4
protein reaches a maximum at 5-10 flg/ml mAMSA (Figure
2.6A) and 10-20 |J.g/ml etoposide (Figure 2.6B). The in vivo
drug resistance conferred by the top2-A4 allele is in agreement
with the observed low level of drug-stabilized cleavage in
vitro. Nevertheless, the top2-A4 protein still responds to both
mAMSA and etoposide. Unlike the top2-5 protein which shows
a small increase in the precipitable counts in the presence of
mAMSA (Jannatipour, Liu and Nitiss, 1993), the precipitated
counts with the top2-A4 protein increase about 10 folds at 5
96
|lg/ml mAMSA (Figure 2.6A). A similar result was observed in
the presence of etoposide (Figure 2.6B).
2.4 DISCUSSION
A mutant topoisomerase II selected for resistance to
mAMSA was isolated using a yeast genetic system. Drug
resistance was conferred by two point mutations that convert
both H is 5 0 7 and H iss 2 i to Tyr; neither single change is
sufficient. Strains carrying these mutations are highly resistant
to mAMSA and etoposide. Moreover, the reconstructed top2-
A4 allele (in pMJ2 with a wild type level of expression) is much
more resistant (Figure 2.3) than the allele when it is
overexpressed (see Figure 1.5 in Chapter I). At 100 |J.g/ml
mAMSA or etoposide, the survival of cells harboring the top2-
A4 allele in pMJ2 is 1400% as compared to 700% (mAMSA) or
800% (etoposide) for cells carrying the same allele in the
overexpressing plasmid. In agreement with the predicted
pattern for drugs that stabilize cleavage, these results
demonstrate that low topoisomerase II activity leads to higher
level of drug resistance (top2-A4 in pMJ2) while high activity
leads to lower level of drug resistance (t o p 2 - A 4 in the
overexpressing plasmid, pDEDlTOP2).
In order to verify whether the enzyme encoded by the
top2-A4 allele is altered in its interactions with mAMSA and
etoposide or other biochemical characteristics, I have
97
overexpressed and purified the top2-A4 protein. I have shown
that the top2-A4 protein has reduced level of drug-stabilized
cleavage demonstrated by the K+/SDS method. I therefore
confirm that the to p 2 - A 4 allele encodes a drug resistant
enzyme.
The drug-independent cleavage carried out by the top2-
A4 protein is less than 10% of that by the wild type enzyme.
The reasons of obtaining low drug-independent cleavage
remain unclear. However, there are several possibilities that
may result in low level of drug-independent cleavage. First,
the low drug-independent cleavage is due to low topoisomerase
II activity of the top2-A4 protein. This possibility is excluded
since the specific activity of the top2-A4 protein is similar to
the wild type enzyme. Second, the DNA binding affinity may
be different between the top2-A4 and the wild type enzyme.
DNA binding of topoisomerase II is not strictly sequence-
dependent (weak consensus recognition sequence), however,
differences between the substrates, namely. kDNA in the
activity assay and pUCIS in the K+/SDS cleavage assay may
result in variations in DNA binding. As a consequence, the
top2-A4 protein might not bind pUCIS as well as the wild type
protein. The low DNA binding activity in turn results in low
drug-independent cleavage.
98
In order to expand the understanding of the drug
interaction with DNA-enzyme complex, a variety of mutations
need to be collected. Previously, it has been reported that the
mutations detected in the top2-5ts allele define a region of
topoisomerase II that plays a role in sensitivity to etoposide
and mAMSA (Jannatipour, Liu and Nitiss, 1993). The region
surrounding the active site tyrosine defined by the top2-101
and top2-103a alleles is important for drug resistance ((Liu, et
al., 1994) and Chapter I). Genetic studies using yeast directly
provide evidence that mutations that are located in the gyr A
homology domain define a region that plays a major role in
sensitivity to drugs that target topoisomerase II.
The region that the top2-A4 defines is highly homologous
to the equivalent region in the human topoisomerase Ila
although neither Hisjov nor HisjTi of the yeast topoisomerase II
corresponds to amino acids that are conserved in the human
enzyme. My experiments have not only demonstrated that the
mutations detected in the top2-A4 allele are responsible for
the drug resistance in vivo but also lead to a drug resistant
enzyme in vitro.
Most mutations detected in the human topoisomerase Ila
are located in the gyrB homology domain. Bugg et al. reported
a mutation of Arg4 5 oGln of human topoisomerase I la in
CEM/VM1 and CEM/VM1-5 cell lines (Bugg, et al.. 1991) and
99
suggested that this mutation confers semi-dominant drug
resistance (Danks, et al., 1988). Resistance to teniposide can be
observed in the presence of both wild type and Arg4 5 o G ln
mutant alleles. Genetic studies using yeast diploid strains have
proven that the equivalent mutation of yeast topoisomerase II
confers semi-dominant resistance to mAMSA and etoposide
(Nitiss, et al., 1994). This type of mutation will be expected to
be observed more often than mutations that require multiple
changes for the developm ent of resistance including
inactivation of the second allele.
It is unclear why resistance to drugs that stabilize
cleavage can be semi-dominant. One explanation is that in the
presence of the wild type allele, drug resistance is determined
by heterodimeric topoisomerase II (Nitiss et al., 1994). If both
the wild type and the mutant alleles are present and active, the
cell will contain three forms of topoisomerase II holoenzymes:
wild type homodimers, mutant hom odim ers, and wild
type/mutant heterodimers with the relative ratio of 1:1:2.
Whether a particular mutation is recessive or semi-dominant
will depend on the drug sensitivity of the wild type/mutant
heterodimers. If the heterodimer is drug sensitive, then 75% of
the topoisomerase II holoenzymes in the cell will be drug
sensitive. If the heterodimeric enzyme is drug resistant, then
100
75% of the holoenzymes in the cell will be drug resistant, and
the overall sensitivity is reduced compared to wild type.
It also not clear how such a heterodimer might lead to a
drug resistant enzyme. It has been demonstrated that ATP-
binding triggers a conformational change in topoisomerase II
(Lindsley and Wang, 1991). Perhaps the mutant subunit is
able to enforce a conformational change on the enzyme that
alters its ability to interact with drugs that target the enzyme.
Mutations located in the g y rB homology domain might
generally have such characteristics. This might represent one
of the reasons that most mutations in human cell lines resistant
to anti-topoisomerase II agents are located in the g.vrB
homology domain.
The to p 2 -A 4 allele might represent a case of which
mutations confer semi-dominant resistance. Although the
overall drug-stabilized cleavage catalyzed by the top2-A4
protein is lower as compared to the wild type enzyme, the
mutant enzyme still responds to both mAMSA and etoposide.
The level of cleavage increases as the concentration of drug
increases. The overall reduction of the cleavage complex
formation may not be the consequence of the defect in
enzyme's ability to interact with drug but may reflect some
alterations in the catalytic steps of the enzyme. This type of
mutations may indirectly affect drug-enzyme interactions, and
101
formation of cleavage complexes. If it is the case, resistance to
drugs that stabilize cleavage need not to be recessive. As
written, drug resistance will be determined by the nature of
the heterodimeric topoisomerase II.
102
Figure 2.1. Sequence homology of human topoisomerase I l a
near the top2-A4 allele.
Sequence (amino acids 512-556) of the human topoisomerase
I la near the top2-A4 allele is shown in "A." Sequence of wild
type yeast topoisomerase II in this region is shown in "B"
(amino acids 501-542). "C" is the sequence around the top2-A4
allele. The identical sequences are underlined. The
conservative changes are indicated by italic letters. The
oultined letters indicate amino acid changes with less
similarity. HissoyTyr and HissyiTyr of the top2-A4 allele are
outlined and shadowed. "X" indicates the spacing in homology
alignment.
103
A. 512- KIVGLQ'/ £KNYED DSLK LRYGK /MIMTDOD DGSHIKGLLINF-559
B. 501- KIMGLOH 7?KKYED XXXK LRYGfl LMIMTDOD DGSHIKGL/ INF-542
C. 501- KIMGLOY RKKYED XXXK LRYG YLMIMTDOD DGSHIKGL/ INF-542
Figure 2.2. Drug sensitivity of strains carrying HissovTyr or
Hiss2iTyr mutation in yeast topoisomerase II.
mAMSA and etoposide sensitivity of JN394 (Figure 2.2B),
JN394t2-A4a carrying HisstnTyr mutation (Figure 2.2A) and
JN394t2-A4b carrying His5 2 iTyr mutation (Figure 2.2C) was
determined at 30° C as described in the "Materials and
M ethods." Open symbols indicate various mA M SA
c o n c e n tra tio n s , filled sy m b o ls re p re s e n t e to p o sid e
concentrations. No drug (circles); 20 |J.g/ml mAMSA or 20
|L Lg/mI etoposide (squares); 100 |lg/ml mAMSA or etoposide
(triangles).
105
Relative survival (%)
A
1000
30 1 5 2 0 25 1 0 5 0
T im e (hr)
106
Relative survival (%)
B
100000
10000
1000
ioo A
3 0 1 0 1 5 2 0 25 5 0
Tim e (hr)
107
Relative survival (%)
C
1000
100
1 5 20 25 3 0 0 5 1 0
T im e (hr)
LO S
Figure 2.3. Strains carrying both HissovTyr and H issiiT y r
mutations are resistant to mAMSA and etoposide.
Drug sensitivity of JN394t2-A4 cells were measured with
either mAMSA (Figure 2.3A) or etoposide (Figure 2.3B) under
the same conditions as for Figure 2.1. Open symbols (mAMSA),
filled symbols (etoposide); no drug (circles), 20 |4g/ml mAMSA
or 20 |-lg/ml etoposide (squares); 100 |Llg/ml mAMSA or
etoposide (triangles).
109
A
100000
ea
>
• M
>
u
3
O J
"3
e*
10000
1000
100
B
100000
_ 10000
e s
’>
u
< u
>
a
1000
100
1 2 3 4 5 6 7
Figure 2.4. Electrophoretic patterns of proteins in an
SDS/polyacrylamide gel stained with Coomassie Blue.
Lane 1, molecular weight standards (200, 1 16, 97, 68 and 43
kDa). Lane 2 contains 0.01% of the glassbead-disrupted cell
extracts. Lane 3 contains 0.01% of the 65% N FU C SO ^ saturated
lysate. Lane 4 conatins 0.01% of the pooled fractions from a
10-ml phosphocellulose column. Lane 5 contains 0.01% of the
pooled fractions from a 2-ml mini-phosphocellulose column,
about 1 jig of topoisomerase II. Lanes 6 and 7 contain about 7
and 10 jig enzyme, respectively.
112
Figure 2.5. Determination of topoisomerase II activity.
Topoisomerase II activity was determined by decatenation of
kDNA as described in the "Materials and Methods." Lanes 1 to
4 contain 0.05. 0.02. 0.01. 0.005 jig top2-A4 protein,
respectively; lanes 6-9 contain the wild type enzyme, the
concentrations of which are in the same order as for the top2-
A4 protein. Lane M is the molecular weight standard, 1 kb
marker. Lane S is kDNA only.
113
Figure 2.6. Quantitative determination of drug-stabilized
cleavage with the top2-A4 protein.
Drug-stabilized cleavage was carried out in the presence of
mAMSA (Figure 2.7A) or etoposide (Figure 2.7B) using the
K+/SDS procedure as described in the "Materials and Methods."
Wild type topoisomerase II (open squares), top2-A4 protein
(open circles).
114
A
5 0 0 0 0
4 0 0 0 0 -
3 0 0 0 0 -
20000
10000
8 0 1 00 1 2 0 0 2 0 4 0 6 0
m A M SA c o n cen tra tio n
115
C P M precipitated
B
3 0 0 0 0
2 5 0 0 0 -
20000 -
15000
10000 -
5 0 0 0
0 2 0 4 0 6 0 8 0 I 0 0 120
E to p o sid e c o n c e n tr a tio n
116
C H A P T E R III ID E N T IFIC A T IO N OF A E U K A R Y O T IC
T O P O I S O M E R A S E II M U T A T IO N C O N F E R R I N G
HY PERSENSITIVITY TO ETOPOSIDE: THE AM INO ACID
HO M OLO GOUS TO SER83 OF gyrX IN T E R A C T S W ITH
EUKARYOTIC TOPOISOMERASE INHIBITORS
3.1 INTRODUCTION
As topoisomerase II is required for the survival of
eukaryotic cells, the prokaryotic type II enzyme, DNA gyrase, is
essential to E. coli. The indispensible and unique nature of
gyrase makes it an ideal target for anti-bacterial drugs. A
number of gyrase specific antibacterial agents have been
reported (Reece and Maxwell. 1991). Fluoroquinolone
antibiotics, such as norfloxacin and ciprofloxacin, along with
their less active congeners nalidixic and oxolinic acid represent
a major group of antibacterial agents that target DNA gyrase,
while a variety of DNA intercalative agents such as
aminoacridines, ellipticines, and mitoxantrone, and non-
intercalative agents such as epipodophyllotoxins are active
against eukaryotic topoisomerase II (Chen and Liu, 1994; Liu,
1990).
Recently, it has been shown that CP-1 15,953 [6,8-
d iflu o ro -7 -(4 ’-hydroxy phenyl)- l-cyclopropyl-4-quinolone-3-
117
carboxylic acid], a fluoroquinolone closely related to
ciprofloxacin, is highly toxic to mammalian cells in culture
(Robinson, et al., 1991), and active against topoisomerase II in
vitro (Robinson, et al., 1992). Genetic studies in yeast have
demonstrated that the eukaryotic topoisomerase II is the
primary physiological target for quinolone cytotoxicity (Elsea,
Osheroff and Nitiss, 1992). Unlike etoposide, which stabilizes
cleavage mainly by inhibiting the religation reaction of
topoisomerase II (Osheroff, 1989; Robinson and Osheroff, 1990;
Robinson and Osheroff, 1991), CP-115,953 stabilizes cleavage
by promoting the forward rate of reaction (Robinson, et al..
1991; Robinson, et al., 1992). Therefore, fluoroquinolones
represent a novel class of non-intercalating anti-topoisomerase
II agents with anti-cancer potential but a different mechanism
than etoposide. Although the detailed mechanism of action of
quinolone-based drugs differs from agents such as etoposide,
the underlying cause of cell killing by these agents, enhanced
levels of the cleavage complex, is the same (Kreuzer and
Cozzarelli, 1979).
In E.coli, the mutation that leads to quinolone resistance
is often found in the gyr A gene, the structural gene for the DNA
gyrase A subunit although other changes that lead to quinolone
resistance have also been found in the gyr B subunit (Nakamura
et al., 1989; Yamagishi et al., 1986). Serg3 of gyr A, is
118
frequently found to be mutated in strains that exhibit high
level of quinolone resistance (Cullen et al., 1989; Hallett and
Maxwell, 1991; Oram and Fisher, 1991; Yoshida et al., 1988).
Among the substitutions in quinolone resistant mutants are
mutations of S e r ^ to Ala, Leu or Trp, with higher levels of
resistance in strains carrying S e ^ T r p or S ei^ L eu mutations
(Cullen, et al., 1989; Oram and Fisher, 1991; Yoshida, et al.,
1988). It has recently been reported that gyrase protein with
the Serg 3 Trp mutation in gyr A has reduced binding of
ciprofloxacin compared to the wild type protein. This
observation further demonstrates the importance of this region
of the protein.
These findings have led me to examine the effects of the
yeast equivalent mutations of Ser«3 in the TOP 2 gene that
changes Sei'7 4 i, on the yeast type II enzyme for sensitivity to
fluoroquinolones as well as other topoisomerase II inhibitors.
Strains carrying the Sei‘7 4 iTrp mutation of yeast topoisomerase
II exhibit resistance to CP-1 15,953 and hypersensitivity to
etoposide. In addition, the purified Sei'7 4 iTrp protein is
relatively insensitive to CP-1 15,953 and hypersensitive to
etoposide. My results demonstrate that Ser7 4 iTrp of yeast
topoisomerase II plays a critical role in the action of some anti-
topoisomerase II agents, and may be directly involved in the
interactions of the eukaryotic enzyme with etoposide.
119
3.2 MATERIALS AND METHODS
3.2.1 Oligonucleotide-directed mutagenesis
Detailed procedure is described in the "Materials and
Methods" in Chapter I. The mutant pMJ2 plasmid (carrying
mutation at Sei‘7 4 i) and the mutagenic oligonucleotides for
construction of the particular mutations in the topoisomerase II
gene are listed in Table 1. The bold letters indicate the changes
from the wild type yeast T OP2 sequence. The constructed
mutations were verified by DNA sequencing.
3.2.2 C onstruction of drug perm eable strains carrying
the Ser7 4 i and rad52~ mutations
Details of constructing drug permeable strains carrying
the Sei'741 and rad52 mutations are described in the "Materials
and Methods" in Chapter I. The newly constructed strains are
listed in Table 2.
3.2.3 Determination of cleavage pattern with etoposide
Cleavage reactions were performed as described as in the
"Materials and Methods" in Chapter II. The reactions were
terminated with 1.25% SDS and 5 mM EDTA; no wash was
required. The reaction mixture was then treated with 0.4
JJ.g/JJ. 1 of proteinase K for 1 h at 65° C. In order to demonstrate
that the reaction generated cleavage with protein covalently
attached, the sample with 5 jig/ml of etoposide was treated in
duplicate, and one sample was treated without proteinase K.
120
Gel loading dye was added to each sample and samples were
analyzed on an 0.8 % agarose gel. The gel was run at about 1.7
volts/cm for 18 hours. The gel was dried and exposed to Kodak
XAR5 film.
3 .2 .4 D e te r m in a tio n o f e to p o s id e -s ta b iliz e d cle a v a g e
with various concentration of topoisomerase II
Cleavage reaction was performed as described above
except that the drug concentration was fixed and different
concentrations of topoisomerase II were added. 5 jl g/ml of
etoposide was chosen for this reaction. 0, 1, 2, 4, 8, or 16 units
of topoisomerase II was added to each of the triplicated
samples.
3 .2 .5 H ea t r e v e r sib ility o f the e to p o s id e -s ta b iliz e d
cleavage complexes
K+/SDS cleavage reaction was carried out with either wild
type or Ser7 4 [Trp topoisomerase II as described above, except
that the reaction was incubated at 65H C for one minute prior to
the addition of STOP BUFFER.
3.3 RESULTS
3.3.1 Strains carrying the S er 7 4 iT rp m utation in yeast
top oisom erase II are resistant to flu o ro q u in o lo n e CP-
115,953 and hypersensitive to etoposide in vivo
I constructed mutations in the yeast T O P 2 gene by
oligonucleotide directed mutagenesis at Ser7 4 i, the amino acid
homologous to Serg3 of gyr A. Since mutations to tryptophan,
alanine and leucine have been reported to lead to quinolone
resistance, I changed Ser7 4 i of yeast topoisomerase II to each
of these am ino acids to characterize sensitivity to
fluoroquinolone. Replacement of the chromosomal TOP2 gene
with each of the constructed mutant T OP2 genes produced
viable colonies; therefore, none of the mutations inactivated
topoisomerase II. The strains were then converted to rad52'
by one step gene disruption. The resulting strains (JN394t2-
S 7 4 ] *W, JN394t2-S741 *A or JN 3 9 4 t2 -S7 4 i *L) were tested for
sensitivity to the fluoroquinolone, CP-115,953.
As shown in Figure 3.1 A, strains carrying Sei'7 4 |T rp
mutation are able to grow in medium containing 20 , 11m CP-
115,953. In comparison, the isogenic T O P 2 + strains are killed
by 5 |im CP-115,953 (Figure 3.IB). At 20 |Im, the viability of
T O P 2 + cells is reduced to less than 0.1% after 24 hours of
exposure to CP-1 15,953 (Figure 3 .IB), while the Sei'7 4 |T r p
mutant strains had essentially 100% viability (Figure 3.1 A).
Mutation of Sei’7 4 i to either leucine or alanine had negligible
effects on sensitivity to CP-1 15,953 although the Sei‘7 4 iL e u
strains are slightly resistant to CP-115,953, having a minimum
lethal concentration of 5-10 jlm CP-115,953, compared to 5 |lm
for wild type TOP2 (Table 3).
122
I also characterized the sensitivity of strains carrying the
S e r 7 4 iTrp mutation to other classes of drugs, such as
intercalative and non-intercalative agents that target
eukaryotic topoisomerase II. The presence of the Ser7 4 jT rp
mutation had minimal effects on sensitivity of JN394t2-S741W
strains to the intercalative agents, mAMSA, mitoxantrone and
adriamycin (Table 3). Results obtained with mAMSA are
shown in Figure 3.2. Unlike CP-115,953, mAMSA has little
effect on strains carrying the Ser74|Trp mutation.
A striking difference was obtained with the non-
intercalative topoisomerase II poison, etoposide. Strains
carrying Ser7 4 >Trp mutation are hypersensitive to etoposide.
Mutant cells are killed by less than 5 |lg/ml etoposide (Figure
3.3A), while the minimum lethal concentration for the isogenic
wild type strain is 50 |I g/ml (Figure 3.3B). At 50 j-lg/ml of
etoposide, the viability of cells carrying the Ser7 4 )Trp mutation
is approximately 1 % after 24 hours drug exposure (Figure
3.3A). The mutant strains also exhibit hypersensitivity to
another epipodophyllotoxin, teniposide. The minimum lethal
concentration for the mutant strain is less than 5 j i g / m l
teniposide, compared to 50 |lg/ml for strains carrying wild
type topoisomerase II (Table 3).
123
3.3.2 S er 7 4 iT rp protein is resistant to C P-115,953 and
hypersensitive to etoposide in vitro
In order to better characterize the effects of etoposide
and CP-1 15,953 on the Ser7 4 |Trp topoisomerase II, a large
quantity of pure protein is required. Hence, in an effort of
collaboration with Osheroff and Elsea, the mutant protein was
overexpressed and purified as detailed in the "Materials and
Methods" of Chapter II except that the automated FPLC system
was not employed in the purification procedure. Even though
the same catalytic activity of topoisomerase II of the Sei'7 4 |T rp
or the wild type protein was included in the cleavage reaction,
the level of drug-independent cleavage is reduced to about 70-
80% compared to the wild type enzyme (Figure 3.4A). It is
likely that the Ser7 4 jTrp mutant enzyme is slightly less active
than the wild type enzyme.
Result obtained with CP-115.953 is shown in Figure 3.4A.
Wild type topoisom erase II produces a dose-dependent
increase in precipitated counts with increasing CP-115.953
concentrations. A concentration of about 1-2 jam CP-115,953
produces a two-fold increase in precipitated counts as
compared to no drug samples. At 10 jlm CP-1 15.953, there is
an approximate four-fold increase in precipitated counts with
wild type topoisomerase II. When normalized to the level of
drug-independent cleavage produced by the wild type protein
124
(relative DNA cleavage), the Ser7 4 iTrp mutant enzyme
generated less than a two-fold increase in precipitated counts
at 10 |Im CP-115,953. Hence, the Sei'7 4 |Trp topoisomerase II is
less sensitive to CP-115,953.
I next examined the sensitivity of the Ser7 4 ]Trp protein
to etoposide using the K+/SDS assay. At 1 jig/ml of etoposide,
wild type topoisomerase II produced a two-fold increase in
precipitated counts, while the similar level of precipitated
counts generated by the Ser7 4 |Trp protein occurs at < 0.1 jig/m l
drug concentration. At etoposide concentration of 1 jig/ml, the
S e r 7 4 |Trp protein had greater than a five-fold increase in
precipitated counts. The difference in the level of cleavage
between Sei’7 4 |Trp and wild type proteins is most striking at
etoposide concentrations lower than 1 |L l g/ml; there is an
approximate three-fold increase in the precipitated counts with
the Sei'7 4 iTrp mutant protein. The etoposide hypersensitivity
is less pronounced at higher drug concentrations; at 5 |l g / m l
etoposide there is a two-fold difference in the level of cleavage
between Sei^iTrp and wild type proteins.
3.3.3 Pattern of drug-stab ilized cleavage by S er 7 4 iTrp
protein and w ild type to p o iso m era se II w ith pU C 18
DNA
To illustrate whether qualitatively the patterns of drug-
stabilized cleavage are similar for the wild type topoisomerase
125
II protein and the Ser7 4 |Trp protein, I performed K+/SDS assay
and examined the cleavage products on the gel. Results
obtained with the Ser7 4 iTrp and the wild type topoisomerase
II in the presence of different concentrations of etoposide are
shown in Figure 3.5. As shown in Panel B, an etoposide
concentration of 0.1 jig/ml readily produces high level of
cleavage with Ser7 4 iTrp (lane 3') as compared to the cleavage
generated by the wild type enzyme at the same drug
concentration (Panel A, lane 3). Although some of the major
prominent bands are observed with the wild type and the
S er 7 4 )Trp enzymes (indicated by the arrows), difference can be
seen. For example, the doublets seen in Panel B are not in
Panel A (only singlets). The absence of particular bands in the
lanes that contain wild type topoisomerase II is probably due
to the lower levels of cleavage produced with this protein. It
can not be excluded that Sei'7 4 |Trp protein might generate
different banding pattern than wild type enzyme. To
demonstrate that the cleaved fragments generated in the
reaction had protein covalently attached, the sample with 5
jig/ml of etoposide was treated in duplicate and one sample
was treated without proteinase K (lanes 9 and 9’). The
retarded mobility of DNA (the labeled substrate) indicates that
a protein is covalently bound to the cleaved fragments;
126
therefore, no cleavage pattern was detected in the absence of
proteinase K treatment.
3.3.4 L inear in crease o f d ru g-stab ilized cleavage with
increasing Ser7 4 iTrp or wild type proteins
Next I demonstrated whether the K+/SDS cleavage assay
was linear with respect to the amount of enzyme added. [oc-
32P]ATP end-labeled DNA was incubated with 5 | l g / m l
etoposide and different concentrations of the purified
Ser 7 4 iTrp or wild type enzyme was added. As shown in Figure
3.6, I observed that the precipitated counts increase linearly
with the increasing units of either Ser7 4 |Trp or wild type
topoisomerase II. And at all concentrations of enzyme, the
counts precipitated with the Sei‘7 4 |Trp protein are higher than
those with the wild type topoisomerase II.
3.3.5 C leavage com plexes stabilized by etop osid e with
the Ser7 4iTrp protein are not heat reversible
The topoisomerase II covalent DNA complexes are
intermediates in the catalytic cycle of the enzyme and are
reversible. The elevated levels of cleavage generated by the
Sei‘7 4 iTrp protein in the presence of etoposide suggest that the
equilibrium favors the ternary covalent complexes more than
v
with the wild type protein. For wild type topoisomerase II, the
reversibility of the cleavage complexes can be detected by
exposure to heat (65°C) or high salt, and these conditions
127
change the equilibrium to favor dissociation of the ternary
complexes. If the ternary complex is more stable, it may be
favored even at 65°C or high salt. I examined whether I could
d e te c t a d if f e r e n c e in the s ta b ility of the
etoposide/DNA/topoisomerase II cleavage complex with the
S er 7 4 |Trp mutant protein by assessing the heat reversibility of
the ternary complex. Figure 3.7 shows that the cleavage assays
were carried out with either wild type or the Ser7 4 iTrp
proteins, except that the reactions were incubated at 65°C for
one minute prior to the addition of SDS. In the absence of
etoposide, the heat treatment reduces the am ount of
precipitated counts by 2-3 fold for both the wild type and
Sei'7 4 iTrp proteins (Figure 3.7A). No significant difference is
observed in the levels of heat reversal seen with the two
different proteins. In the presence of 10 pg/ml of etoposide,
most of the cleavage complexes formed with the wild type
protein can be reversed by heat treatment; the amount of
precipitated counts was reduced by 2-3 fold. However, no
reversal is seen when the Ser7 4 |Trp protein is treated with
etoposide (Figure 3.7A).
Since the cleavage complex formed with the Ser7 4 |T r p
protein in the absence of drugs is heat reversible, it is unlikely
that this complex is qualitatively different than the cleavage
complex formed with the wild type protein. To further exclude
128
the possibility that the cleavage complex formed with the
S e r 7 4 |Trp protein have inherently different properties, I also
examined the heat reversibility of the cleavage complexes
formed in the presence of 10 pg/ml CP-115,953. For both the
wild type and Ser7 4 |Trp proteins, the complexes formed were
completely reversed by treatment at 65°C (Figure 3.7B). These
results taken to g e th e r stro n g ly su g g est that the
e t o p o s i d e / D N A / S e r 7 4 iTrp protein ternary complex has
enhanced stability; this enhanced - stability is not due to any
inherently different properties in the DNA/Ser7 4 iTrp cleavage
complexes but due to the alteration in the interactions between
etoposide and the Ser74|Trp mutant protein.
3.4 DISCUSSION
I have constructed several changes at Sei‘7 4 i in the yeast
TOP2 gene of Saccharomyces cerevisiae and have demonstrated
that mutation at Ser7 4 iTrp of yeast topoisoemrase II confers
hypersensitivity to etoposide and resistance to quinolone CP-
115,953 in vivo. In order to demonstrate that the unique
sensitivity of the mutant strain to anti-topoisomerase II agents
is due to an alteration in the enzyme-drug interactions, I have
characterized the effects of etoposide and CP-1 15,953 on the
drug-stabilized cleavage using the purified proteins In
agreement with the in vivo results, the S e i ^ T r p protein has
increased drug-stabilized cleavge when treated with etoposide,
129
and reduced drug-stabilized cleavge in response to the
fluoroquinolone CP-1 15,953. These results indicate that the
Ser 7 4 |Trp mutant allele encodes an enzyme that is altered in its
interactions with anti-topoisomerase II drugs.
The Ser 7 4 iTrp change represents one of the first
m utations that confer drug hypersensitivity found in
eukaryotic topoisomerase II. My experiments demonstrate
that the hypersensitivity is specific to epipodophyllotoxins but
not to intercalative anti-topoisomerase II agents. The results
from heat reversal experiments suggest that the ternary
complex formed with the Ser7 4 iTrp protein is more stable than
the complex formed with the wild type enzyme. As a result,
the rate of accumulating double stranded breaks is facilitated,
and the cells are killed by low concentrations of etoposide. One
explanation is that Sei‘7 4 i likely represents a key element in
the region that is important for drug binding and the Sei‘7 4iTrp
mutation confers the protein higher affinity for
epipodophyllotoxins. Since gyrA protein carrying a Sers.^Trp
mutation has reduced fluoroquinolone binding, S e r ^ is likely
close to a domain of gyrase that binds to quinolone. My results
would suggest that the domain including Ser7 4 ]Trp in yeast
topoisomerase II interacts with both fluoroquinolones and
epipodophyllotoxins. This result is consistent with the recent
report that the etoposide interaction domain overlaps with
130
several DNA cleavage-enhancing drugs including quinolone CP-
115,953 (Corbett, Hong and Osheroff, 1993).
The finding of Ser7 4 iTrp mutation conferring drug
hypersensitivity opens an avenue in new drug design. It
should be feasible to design more specific etoposide derivatives
that can interact with wild type topoisomerase II forming
te rn a r y c o m p l e x that b e h a v e s like the
Sei74iTrp/etoposide/DNA complex.
131
Figure 3.1 Fluoroquinolone sensitivity of yeast cells carrying
Ser7 4 |Trp or wild type topoisomerase II.
The sensitivity of JN394t2-S74 1 *W (Figure 3.1 A) and JN394
(Figure 3.IB) strains to CP-115,953 was determined as
described in the "Materials and Methods." No drug (open
circles), 5 (IM (filled circle), 10 (IM (open squares), 20 jlM (open
triangles), 50 jlM (crosses).
132
Relative survival (%)
>
O
o
H
3
ft
ro
u>
u>
Relative survival (%)
B
10000
1000
100
■o,
.001
5 2 0 3 0 0 1 0 25 3
Time (hr)
134
Figure 3.2 mAM SA sensitivity of yeast strains carrying
Ser7 4 iTrp or wild type topoisomerase II.
The sensitivity of JN394 (filled symbols) JN394t2-S74i *W (open
symbols) strains to mAMSA was determined at 30°C. No drug
(circles), 20 jig/ml (squares), 100 jig/ml (triangles).
135
100000
10000
1000
100 ...........................
‘" • ■ " • I . . . . . . , , , , , , , , , , , ,
Time (hr)
136
Figure 3.3 Yeast strains carrying the Ser7 4 iTrp mutation in
topoisomerase II is hypersensitive to etoposide.
Drug sensitivity was measured in JN394t2-S741 *W (Figure 3A)
and JN394 (Figure 3B) strains under the same conditions as in
Figure 3.1 and 2. No drug (open circles), 5 jig/ml (open
squares), 10 (Ig/ml (open triangles). 20 (Ig/ml (filled circles),
50 (ag/ml (filled squares), 100 jig/ml (filled triangles).
137
Relative survival (%)
A
100000
10000
1000
1 00 ^
n
0 5 1 5 20 25 30 1 0
Time (hr)
138
Relative survival
B
10000
1000
100
2 0 3 0 I 0 0 5 5
Time (hr)
139
Figure 3.4 Quantitative determination of drug stabilized
cleavage with the Ser7 4 iTrp protein.
Drug-stabilized cleavage by CP-115,953 (Figure 3.4A) or
etoposide (Figure 3.4B) was determined using the K + /S D S
procedure as described in the "Materials and Methods." Wild
type topoisomerase II (open square), Ser7 4 iTrp protein (open
circle).
140
CP-115,953 con centration
Ser741Trp
Relative DNA cleavage
Relative DNA cleavage w
C to 4 ^ * C\ 00 O
to
n
©
a
n
n >
a
'I
a
r* t-
o
a
to
Figure 3.5 Pattern of etoposide-stabilized cleavage by wild
type and the Ser7 4 iTrp proteins with pUC18 DNA.
The pattern of drug-stabilized cleavage was assessed by
examining the products of the cleavage assay after treatment
with proteinase K as described in the "Materials and Methods."
Lanes 2-9 contain wild type topoisomerase II (Panel A), and
lanes2'-9' contain the Ser7 4 iTrp protein (Panel B). Lanes 1 and
1', radioactively labeled substrate DNA only (no drug, no
topoisomerase II); lanes 2 and 2' contain no drug but with 8
units of topoisomerase II; lanes 3 and 3', 0.1 |I g/ml; lanes 4 and
4', 0.2 (Ig/ml; lanes 5 and 5', 0.5 (Ig/ml; lanes 6 and 6', 1 (Ig/ml;
lanes 7 and 7', 2 (Ig/ml; lanes 8 and 8', 5 (Ig/ml. Lanes 9 and 9'
are the duplicates of lanes 8 and 8' except that the reactions
were not treated with proteinase K.
143
t i l * 0
144
Figure 3.6 Linear relationship of etoposide-stabilized cleavage
with the wild type and the Sei- 7 4 iTrp topoisomerase II.
K+/SDS cleavage assays were carried out in the presence of 5
(Ig/ml etoposide and various concentrations of topoisomerase
II. Wild type (open square); Sei'7 4 |Trp (open circle).
145
C PM precipitated
12000
10000 -
8 0 0 0 -
6 0 0 0 -
4 0 0 0 -
2000 -
0
o
6 8 1 0 4
i
14 16 18 20
Topoisom erase II concentration (units)
146
Figure 3.7 Heat reversibility of the drug-stabilized cleavage
complexes.
The cleavage reactions were carried out in the presence of drug
diluent (no drug) or 10 [Ig/ml etoposide (Figure 3.7A). Prior to
the addition of STOP BUFFER, the reactions were incubated at
65°C for one minute. Figure 3.7B shows the similar reactions
except that 10 mM Tris-HCl, pH 8 (drug diluent) or 10 (iM of
CP-115,953 was added instead.
147
Relative DNA cleavage
5.0
4.5
4.0
3.5
3.0
2.5
2.0
1.5
1.0
0.5
0.0
0 1 0
Etoposide concentration
□ W T
□ W T + heat
E l Ser741T rp
E l Ser741T rp + heat
Relative DNA cleavage
5.0
4.5
4.0
3.5
3.0
2.5
2.0
1.5
1.0
0.5
0.0
C P -115,953 concen tration
□ W T
□ W T + heat
□ Ser741T rp
E l Ser741T rp + heat
0 1 0
Table 3.1 Mutagenic oligonucleotides
nM J2 mutant nlasm id
PMJ2 -S 7 41 *A
pM J2-S 7 41 *L
pMJ2 -S 7 4 ] *W
pMJ2 -S 7 4 | *Y
pM J2 ~S7 4 |
*p
M utagenic oligon u cleotid e ____
GG TG AG CAG G CG TTG G CACAA
G G TG A G C A G C T G T T G G C A C A A
GG TG A G C A G TG G TTG G C A C A A
G G T G A G C A G T A C T T G G C A C A A
G G TG A G C A G T TC TT G G C A C A A
Table 3.2 Yeast strains
S tr a in s G e n o tv p e
JN 394t2-S 74| *A as J N 3 9 4 but carries S 74| *A in TO P2
JN 394t2-S 741 *L as J N 394 but carries S 74| *L in T O P 2
JN 394t2-S 74) *W as J N 394 but carries S 74| *W in TO P2
JN 394t2-S 74| *Y as J N 394 but carries S74| *Y in TO P2
JN 394t2-S 741
*p
as J N 394 but carries S 74i *F in TO P2
Table 3.3 Sensitivity of strains carrying mutations at Ser74: of
topoisomerase II to anti-topoisomerase agents
M inim um lethal concentration ( |i g/m l)
D rus W T S eri,|| Trp Ser-j.j | Leu Ser7,| | A la
etoposide 50 < 5 50 50
leniposide 50 < 5 N T N T
C P -1 15,953 ( |i m) 5 2 0-50 5 -1 0 5
m A M S A < 2 0 < 2 0 N T N T
m itoxantrone < 2 0 10-20 N T N T
adriam ycin < 5 < 5 N T N T
152
CHAPTER IV FUNCTIONAL EXPRESSION OF HUMAN
TOP2a IN YEAST: MUTATIONS AT AMINO ACIDS 450 OR
803 OF TOPOISOMERASE I l a RESULTS IN ENZYMES
T H A T C AN C O N F E R R E S IS T A N C E TO A N T I-
TOPOISOMERASE II AGENTS
4.1 INTRODUCTION
Drug resistance mediated by topoisomerase II may arise
from quantitative (Danks, et al., 1988; Glisson, Gupta and
Smallwood-Kentro, 1986; Zwelling, et al., 1989) and/or
qualitative alterations in the enzyme. In some cases, mutations
in the structural gene encoding topoisomerase II have been
described in mammalian cell lines that were selected for
resistance to topoisomerase II targeting drugs such as
adriamycin, etoposide or mAMSA (Beck and Danks, 1991; Bugg,
et al.. 1991; D'Arpa and Liu, 1989; Danks, et al., 1988; Danks, et
al., 1993; Hinds, et al., 1991; Lee, Wang and Beran, 1992; Patel
and Fisher, 1993). Since resistance to anti-topoisomerase II
agents that stabilize cleavage is expected to be recessive, it is
difficult to demonstrate that the identified mutations are
responsible and sufficient for the observed drug resistance.
Some regions of the type II topoisomerases are highly
co n serv ed am ong all species, including eukaryotes,
153
prokaryotes, and the T4 phages (Caron and Wang, 1993; Huang,
1990; Lynn, et al., 1986); certain regions play important
functions of topoisomerase II, such as the consensus ATP
binding sites and the sequences surrounding the active site
tyrosine (Huang, 1990). It has been demonstrated that the
expression of Drosophila topoisomerase II can complement a
deficiency of the yeast enzyme (Wyckoff and Hsieh, 1988).
Recently, human topoisomerase Ila has been successfully
expressed in yeast using yeast GAL I promoter and shown to
compensate the deficiency of both yeast enzymes (Wasserman
et al., 1993). These observations indicate the functionally
equivalent role of human topoisomerase II to other eukaryotic
enzymes.
Several mutations in yeast topoisomerase II that confer
altered sensitivity to anti-topoisomerase II agents have been
identified (Liu. et al., 1994; Wasserman and Wang, 1994).
Nitiss et al. have taken advantage of the homology between
human topoisomerase II and the yeast enzyme to reconstruct
mutation of Arg 4 5 o to Gin of human topoisomerase Ila
originally identified by Bugg et al in the yeast TOP2 (Nitiss, et
al., 1994). This mutation was first identified in a human cell
line (CCRF-CEM) that had been selected for resistance to
teniposide (CEM/VM-1) by growth in the intermittent presence
of sublethal concentration of drug (Danks, Yalowich and Beck,
154
1987). It has been demonstrated that the equivalent mutation
of Lys439 to Gin of yeast topoisomerase II results in resistance
to etoposide and mAMSA (Nitiss, et al., 1994). This result
suggests that mutating the equivalent amino acid in human
topoisomerase II would result in a drug resistant enzyme.
Subsequently, a second mutation that changes Proso3 to
Ser was identified by Danks and colleagues in the teniposide
resistant sublines (C E M /V M -1-5) using single strand
conformation polymorphism analysis (SSCP) (Danks, et al.,
1993). The CEM/VM-1-5 cells were selected from CEM/VM-1
line by intermittent exposure to increasing concentration of
VM-26 (Danks et al., 1988). Since Proso3 is not conserved
between yeast and human topoisomerase II, it is not possible
to determine whether this mutation has effects on drug
sensitivity using the yeast enzyme. A system that permits the
expression of human TOP2a in yeast was therefore constructed.
The yeast T O P I promoter is used to drive the constitutive
expression of the human protein. I confirmed that expressing
human topoisomerase II in yeast can compensate the in vivo
functions of the yeast enzymes as what was previously shown
using yeast GAL1 or DED1 promoter (Wasserman, et al., 1993):
therefore, the sensitivity of the hum an enzym e to
topoisomerase II-targeting agents can be determined in this
system.
This system can be also used to test mutations identified
in the drug resistant cell lines using human topoisomerase II.
In addition to TOP2a, mammalian cells also express the second
isozyme for type II topoisomerase, the p i 80 form, TOP2$
(Chung et al., 1989; Drake et al., 1987). One of the advantages
of the system is to eliminate the potential complications due to
the presence of human topoisom erase 11 (3 when the
mammalian system is used. I demonstrate that mutating
either Arg4 5 o to Gin or Proso3 to Ser of human topoisomerase
Ila results in resistance to etoposide and mAMSA in yeast.
Interestingly, when both mutations are introduced into the
human enzyme, the cells display higher levels of resistance to
both drugs.
4.2 MATERIALS AND METHODS
4.2.1 Yeast strains
The strains used in the studies are listed in Table 1. They
are isogenic derivatives of JN362a and JN394 (see "Materials
and Methods" in Chapter I).
4.2.2 Construction of drug resistant alleles of human
topoisomerase II in pMJl
Human TOP2a containing the mutation of Arg4 5 o to Gin
was constructed by polymerase chain reaction (PCR). Two pairs
of PCR primers were used. The first pair was: primer A
(universal primer) which corresponds to the sequences located
156
5' of h T O P 2 a in p B S h T O P 2 ; and p r im e r B
(TCAGTGGAGTTTTGGCCCCCTGCATCATTG) which corresponds to
the anti-sense strand of the hTOP2a cDNA, and also contains a
nucleotide change corresponding to the Arg4 5o to Gin mutation
(bold letter). The second pair of primers was: primer C
(ATGCAGGGGGCCAAAACTCCACTGAGTGTA) which corresponds
to the sense strand of the gene and also contains the nucleotide
change which alters Arg4 5 o to Gin (bold letter); primer D
(C A A A G A G C T G A G C ATTGT A) which corresponds to the anti
sense strand of the gene and contains a B pull02 I restriction
endonuclease site (underlined).
A 1.3 kb fragment was synthesized via PCR using primers
A and B, and a 1.1 kb fragment was synthesized using primers
C and D. These fragments were gel purified and used as
templates for secondary PCR. The two fragments were allowed
to anneal and polymerize for five cycles without primers, and
25 cycles with primers A and D. A 2.4 kb fragment containing
Mlu I site and Bpul 102 I site was obtained.
pBShTOP2a (Tsai-Pflugfelder et al., 1988) was digested
with BstBI, filled in with the Klenow fragment of E.coli DNA
polymerase I, and further digested with EcoRV. The resulting
DNA was ligated to give rise to a truncated form of pBShTOP2a
(6.6 kb) in which a second Bpul 102 I site in the 3' UTR was
deleted. The truncated plasmid as well as the 2.4 kb PCR
157
fragment were digested with M lul and B p u ll0 2 I. The
plasmid and PCR fragment were gel purified and then ligated.
The ligation mixture was transformed into E .c o li D H 5a
competent cells; and plasmids carrying the Arg4 5oGln mutation
(designated pB ShT O P2-R *Q ) were confirm ed by DNA
sequencing. pMJl (Hsiung et al., 1994) and pBShTOP2-R:1 :Q
were then digested with Mlul and Pstl. The 8.3 kb fragment
from pMJl and the Mlul-Pstll fragment from pBShTOP2-R:1 :Q
were gel purified, and subsequently ligated. The resulting
plasmid was transformed into £ ra /( DH 5 a competent cells; and
plasmids which had an identical restriction pattern to pMJl
were identified. The presence of the Arg4 5 oGln encoding
mutation was confirmed by DNA sequencing. The plasmid
carrying the mutation was termed pMJ 1-R*Q.
Human TO P2a containing a mutation which changes
Pro«o3 to Ser was constructed by PCR using primers A and E
(CAAAGAGCTGAGCATTGTAAAGATGT ATCGTGA ACT AGCAGAATC
). Primer E corresponds to the anti-sense strand of the gene
and contains both a mutation that changes Promos to Ser (bold
letter) and a unique B p u ll0 2 I restriction site sequences
(underlined). After a PCR reaction, a 2.4 kb fragment
containing Mlu I and B p u ll0 2 I sites was obtained. This
fragment along with the 6.6 kb truncated pBShTOP2a were
digested with Mlu I and B pull02 I to generate pBShTOP2-P*S.
158
The mutation in pM Jl, pM Jl-P*S, was constructed using the
same method as was used for pMJl-R*Q.
A version of pM Jl carrying both the Arg4 5 o to Gin
mutation and the Pro,so3 to Ser mutation (pMJl-P*S/R*Q) was
constructed by Jeannette McMahon. The 3.8 kb Kpnl fragment
of pM Jl-P*S was ligated with the 8.4 kb Kpnl fragment of
pMJl-R*Q. The presence of both mutations was verified by
DNA sequencing.
4.2.3 Determination of drug sensitivity
Drug sensitivity in vivo was measured at 34°C in these
studies. Detailed procedure is described in the "Materials and
Methods" in Chapter I.
4.3 RESULTS
4.3.1 E x p ressio n of h u m an to p o iso m e r a se II a
complements a deficiency of yeast topoisomerase II
The vector pMJl was previously constructed to express
the human topoisomerase I l a gene in yeast. It has been
demonstrated that human topoisomerase Ila while expressed
in yeast is biochemically active. Since the type II
topoisomerases are essential for viability, attempt has been
made to determine whether the human TO P 2a gene could
complement the essential function of the enzyme. Mehrdad
Jannatipour has dem onstrated that expression of human
topoisomerase I l a can complement to p 2 ts mutations. pMJl
159
was transformed into strain CH326 (Holm, et al., 1985), which
carries a temperature sensitive topoisomerase II allele, top2-5.
The transformed colonies were selected in SC-URA medium at
25 °C. CH326 cells, cells transformed with the truncated human
TOP2a or pMJl were grown in the rich medium YPDA at 25°C
and replica plated at 36°C. Results obtained are shown in
figure 4.1. Cells which carries no plasmid, or which were
transformed with a truncated human T O P 2 a were unable to
grow at 36°C, while cells carrying the intact human
topoisomerase Ila gene are able to grow at this temperature.
The result suggests that expressing human TOP2 a in yeast is
able to replace the essential function of the yeast
topoisomerase II.
4.3.3 Expression of human topoisomerase II supports
growth of yeast strains lacking both topoisom erase I
and topoisomerase II
T opoisom erase II is essential for viability, yet
topoisomerase I is dispensable (Goto and Wang, 1985; Thrash
et al., 1985). Nevertheless, topoisomerase I plays an important
role in some cellular processes, such as providing the swivel
function during DNA synthesis and transcription (Brill, et al.,
1987; Kim and Wang, 1989a). Although the deficiency of T O P I
can be compensated for by the action of topoisomerase II
(Yanagida and Wang, 1987), several lines of evidence suggest
160
that topoisomerase I is more effective in some cellular
activities (Kim and Wang, 1989a). For example, the extension
of short nascent chains into long replicated strands is delayed
in t o p i mutants; normlly topoisomerase I rather than
topoisomerase II functions in transcription elogation (Heck,
Hittelman and Earnshaw, 1988). As a consequence, cells
carrying both topi and top2ts mutations at the non-permissive
temperature are defective in DNA replication and transcription
as well as the defect in chromosome segregation caused by
to p 2 single mutations (Goto and Wang., 1985). At the
permissive temperature these cells grow considerably more
slowly than either single mutant. I therefore examined
whether expression of human topoisomerase II in yeast could
complement a lack of both T O P I and T O P 2. I transformed
pMJl into JCW2 strain that carries a yeast T O P I deletion and
the to p 2 -4 mutations. Figure 4.2 shows that JCW2 strain
carrying pM Jl are able to grow at 36°C, the non-permissive
temperature for top2-4 mutation. Hence, the expression of the
human TOP2a can complement the loss of yeast TOPI and TOP2
functions. Collectively, these results suggest that human
topoisomerase II when expressed in yeast not only carries out
the essential functions of topoisomerase II (Figure 4.1) but also
conducts the in vivo functions of topoisomerase I as the yeast
enzymes (Figure 4.2). It should be noted that the growth of
161
JCW2 carrying pM Jl is considerably poorer than the same
strain harboring a single copy plasmid expressing yeast TOP2
(yTOP2, Figure 4.2). The poor growth may be due to the
incomplete complementation of both yeast enzymes by human
topoisom erase II. Alternatively, the level of human
topoisomerase II expressed from pMJl may not be optimal for
growth of the Atopl top2ts double mutant.
4.3.4 Expression of human topoisom erase II restores
drug sensitivity to yeast cells carrying topoisomerase
II mutations
In order to assess the drug sensitivity of human
topoisomerase II when it is expressed in yeast, I transformed
the expression vector pMJl into the strain JN394t2-5. This
strain carries the ISE2 mutation that allows drug permeability,
the r a d 5 2 mutation to enhance drug sensitivity and the
temperature sensitive allele top2-5. Previously, it has been
reported that the top2-5 allele is resistant to etoposide and
mAMSA (Jannatipour, Liu and Nitiss, 1993) at the permissive
temperature. However, the top2-5 allele encodes an enzyme
that is not active at 34°C, the non-permissive temperature;
hence, the enzyme will not contribute to drug sensitivity at this
temperature. Therefore, under these conditions, the only
functional topoisomerase II for growth is expressed from the
vector pM Jl. JN394t2-5 strains carrying pMJl are sensitive to
162
etoposide at 34°C (Figure 4.3A). The minimum lethal
concentration (MLC) to etoposide is approximately 50-100
pg/ml. At 200 pg/ml etoposide, the survival is about 10% after
24 h drug exposure as compared to 1200% for JN394 carrying
the top2-5 allele (Jannatipour, Liu and Nitiss, 1993). Yeast cells
expressing its own topoisomerase II have an MLC of 50 (ig/ml
to etoposide. The survival is about 0.5% after 24 h exposure to
200 pg/ml etoposide (Figure 4.3B). These results demonstrate
that expressing human topoisomerase Ila in yeast can restore
drug sensitivity to yeast cells carrying top2 mutations.
Yeast cells expressing human topoisomerase Ila display
much higher level of sensitivity to mAMSA than cells
expressing its own topoisomerase II. The MLC of JN394t2-5
expressing the human enzyme to mAMSA at the non-
permissive temperature is less than 2 pg/ml (Figure 4.4A).
Exposure of these cells to 50 (ig/ml mAMSA reduces the
viability to 0.01% after 24 h. Cells expressing wild type yeast
topoisomerase II at the same temperature have an MLC of 5-
10 pg/ml to mAMSA (Figure 4.4B). Therefore, yeast cells
expressing human topoisomerase Ila are hypersensitive to
mAMSA. Collectively, cells expressing human topoisomerase
Ila have a comparable level of sensitivity to etoposide and
hypersensitivity to mAMSA as c o m p a r e d t o yeast cells
expressing its own enzyme. This observation may reflect some
163
difference between the yeast and human enzymes, which leads
to variation in drug sensitivity. Similar experiments were
performed in the JN394t2-4 strain. Although slightly different
results were obtained with the JN394t2-4 strain, these two
alleles do not seem to impose difference in drug sensitivity of
the human enzyme.
4.3.5 R econstruction of hum an topoisom erase II a
m u t a t io n s : A r g 4 5 oGln results in drug resistan t
topoisomerase
The yeast equivalent mutation of Arg4 5 o to Gin has been
previously constructed. Nitiss and colleagues have
demonstrated that the mutation of Lys4 3 9 to Gin in the yeast
topoisomerase II results in an enzyme that confers resistance
to both mAMSA and etoposide (Nitiss, et al., 1994). In order to
directly demonstrate whether mutation of Arg 4 5 o to Gin
originally identified by Bugg et al. can lead to a drug resistant
topoisomerase II, I constructed this mutation in the vector
pMJl that expresses human topoisomerase II. The detailed
procedure of constructing the mutant is described in the
"Materails and Methods", and the newly constructed plasmid
carrying the A rg 4 so to Gin mutation is designated as
pM J 1 A r g 4 5 oGln. The plasmid pM Jl Arg4 5 oGln was then
transformed into JN394t2-5 cells, and sensitivity to etoposide
and mAMSA was determined at 34°C. Figure 4.5A shows the
results obtained with etoposide. JN394t2-5 cells expressing
human topoisomerase II carrying Arg4 5 o to Gin mutation are
able to grow at 200 pg/ml etoposide (Figure 4.5A). At the
same drug concentration, cells expressing the wild type enzyme
have only 10% survival (Figure 4.3A). Drug concentrations of
100 pg/ml have little effects on cell growth; on the contrary, 50
p.g/ml etoposide is sufficient to cause cell killing with the wild
type human topoisomerase Ila (Figure 4.3A).
Sim ilar results were obtained with the related
epipodophyllotoxin, teniposide. JN394t2-5 cells carrying pMJ 1
have an MLC of 20-50 pg/ml (Figure 4.6A). By contrast, the
same strain carrying pM JlA rg 4 5(jGln is able to grow in medium
containing 200 pg/ml teniposide although cell killing was
observed in the first few doubling cycles (Figure 4.6B). I
therefore conclude that the Arg4 5 o to Gin mutation in human
topoisomerase Ila results in resistance to epipodophyllotoxins.
Strains carrying pMJ 1 Arg 4 5 (>Gln also have enchanced
resistance to mAMSA. The MLC increases from less than 2
pg/ml for the wild type human topoisomerase II (Figure 4.4A)
to about 5 |ig/ml (Figure 4.5B). This results further confirm
that the Arg 4 5 o to Gin mutation results in a drug resistant
topoisomerase II.
165
4.3.6 R econstruction of hum an topoisom erase II a
m u ta tio n s: P r o s o 3 Ser resu lts in d ru g r e sista n t
topoisomerase
As described above, the human cell lines which carried
the A rg 4 5 oGln mutation in human TOP2a. also carried an
additional mutation in top2a, which changed Progo3 to Ser. To
determine whether ProgtnSer can result in a drug resistant
topoisomerase II, I constructed the Pro go 3 to Ser mutation in
pMJl by site-directed mutagenesis using PCR technique. The
plasmid was transformed into JN394t2-5 and drug sensitivity
was measured at 34° C as described above. Cells carrying the
Progo 3 to Ser mutation have enhanced resistance to etoposide
(Figure 4.7A), compared to cells expressing wild type human
topoisomerase II (Figure 4.3A). The Progo3 to Ser mutation also
confers resistance to mAMSA. Cells expressing pMJ lProgojSer
have an MLC to mAMSA of about 5 pg/ml (Figure 4.7B).
compared to less than 2 p. g/ml for wild type human
topoisomerase II (Figure 4.4A). The resistance to mAMSA of
JN394t2-5 cells carrying the Prog(>3 to Ser mutation is similar to
cells carrying the Arg4 5o to Gin mutation. Therefore, Progo3 to
Ser is also likely to alter the sensitivity of topoisomerase Ila to
its inhibitors.
166
4.3.7 An en zym e ca rry in g both A rg4 5 oGIn and
P r o s o 3 Ser mutations results in a highly drug resistant
topoisomerase II
Although the teniposide resistant cell line VM-1 carries
both the Arg4 so to Gin and the Proso3 to Ser mutations, it is not
yet confirmed whether these changes are present on the same
allele. I examined the effect of having two mutations in the
same poly p ep tid e. T herefore, the double m utant,
pM J 1 A r g 4 5 o G ln ,P ro s o 3 Ser was constructed by introducing
Proso 3Gln to pM JlA rg 4 5 <)Gln. The plasmid pMJl containing
double mutations was transformed into JN394t2-5. As shows
in Figure 4.8A, the double mutant displays higher resistance to
etoposide as compared to either single mutation (Figure 4.5A
and 7A).
The double mutant also shows much higher resistance to
mAMSA. Cells expressing a human topoisomerase with both
the mutations have an MLC to mAMSA of about 10 pg/ml. At
50 fig/ml mAMSA, the viability of yeast cells expressing wild
type human topoisomerase Ila decreases to about 0.02%
(Figure 4A). At the same drug concentration, the viability of
yeast cells expressing pM JlA rg 4 5() G l n ,P r o ^ S e r is 5% (Figure
4.8B), while the viable counts for either single mutants are at
least ten-fold lower (Figures 5B and 7B). Hence, the two
167
mutations together give a significantly greater resistance to
mAMSA than either single mutation.
4.4 DISCUSSION
I have demonstrated that human topoisomerase Ila
when expressed in yeast not only carries out the essential
functions of topoisomerase II but also conducts the in vivo
functions of topoisomerase I as the yeast enzymes. I observed
that the complementation by human topoisomerase II is
considerably poorer than by the yeast enzyme. There are
several possibilities that may account for the poor growth
complementation of the A t o p I t o p 2 ts strain by human
topoisomerase II at the non-permissive temperature. First, it
may be due to the incomplete complementation of both yeast
enzymes by human topoisomerase II. There may exist some
specific interactions between topoisomerase II and other DNA
metabolic proteins. Even though these interactions may not be
essential, they may optimize the cellular activities. In yeast,
the heterologous human protein may impose some difference
in the interactions. Secondly, the poor growth may be due to
relatively lower stability of the human protein in yeast, or less
efficient import into the nucleus. Thirdly, the level of human
topoisomerase II expressed from pM Jl may not be optimal for
growth of the A to p i to p 2 ts double mutant. Although the yeast
T OP I promoter was used to drive higher level of expression,
168
the yeast system may not provide optimal translational control
or post-translational modifications for the human protein.
TOP2 mutations have been recently identified in several
human cell lines that were selected for resistance to anti-
topoisom erase II agents. Since resistance to anti-
topoisomerase II drug is recessive, it is quite difficult to
demonstrate that the particular mutations result in drug
resistant topoisomerase II. Therefore, as a first step in
determ ining w hether identified m utations encode drug
resistant topoisomerases, a vector that carries the human
TOP2a coding sequence was constructed under the control of
the yeast TOPI promoter and expressed in yeast. My
experiments were performed at condition where the enzyme is
inactive. Hence, the only functional topoisomerase II is
expressed from the vector pMJ 1.
Although there is a good homology between the yeast
and human type II topoisomerases, the human enzyme is much
more sensitive to mAMSA than the yeast protein. The
difference in drug sensitivity may indicate some inherent
difference between the two enzymes.
Since the expression of human topoisomerase II restores
drug sensitivity to yeast cells carrying topoisomerase II
mutations (top2-5 and top2-4), this system can be used to
analyze the mutations identified in cell lines that are resistant
169
to anti-topoisomerase II agents. The system I employ allows
me to confirm that either Arg4 5oGln or P r o ^ S e r mutation can
confer drug resistance. Nonetheless, my experiments do not
exclude the possibility that there may be other mechanisms
also operating drug resistance in the mammalian cell line from
which these two mutations were isolated. Interestingly, the
expression of human TOP2a carrying double mutations confers
higher levels of resistance to etoposide and mAMSA than
expressing the human enzyme carrying either single ones. It
appears that these two mutations are able to act additively to
produce a highly drug resistant topoisomerase II. It has not
yet been confirmed whether these two mutations are present
on the same allele. It should be noted that these two mutations
are located in separate domains, with Arg4 5 (jGln in the g yr B
homology subunit and P r o ^ S e r in the gyr A homology subunit.
Overexpression of human topoisomerase Ila as well as the
mutant enzymes in yeast will provide an ample source of the
enzyme for biochemical analyses.
170
yCP pMJ.\1 pMJ 1
Figure 4.1. Complementation of top2-5 by expressing human
topoisomerase II in yeast.
CH326 cells were transformed with yCP50 (yCP). pMJA 1 or
pM Jl. The cells were grown on YPDA plates at 25°C, and
replica plated to YPDA plates that were incubated at 36°C. Two
independent isolates of each transformant are shown.
171
yCP pMJ1 yTOP2 +
Figure 4.2. Complementation of A topi top2-4 strains by human
topoisomerase Ila
Yeast strain JCW2 (A top I top2-4) was transformed with yCP50,
pMJl or yCP50TOP2 (yTOP2+ ). Cells were replica plated to
YPDA medium, and the plates were incubated at 36" C
172
Figure 4.3. Sensitivity to etoposide of yeast cells expressing
human or yeast topoisomerase II.
The sensitivity of JN394t2-5 cells carrying pM Jl to etoposide
was determined at 34°C as described in the "Materials and
Methods." Figure 4.3A shows the sensitivity JN394t2-5 cells
expressing human topoisomerase I la to various concentrations
of etoposide. The sensitivity of JN394 cells (expressing wild
type yeast topoisomerase II) to etoposide was determined at
the same temperature (Figure 4.3B). The conditions shown are:
no drug (open circles), 10 Hg/ml (open squares), 20 |0.g/ml
(open triangles), 50 |ig/m l (filled circles). 100 |lg/ml (filled
squares), 200 |Llg/ml (filled triangles) etoposide.
173
Relative survival (%)
A
10000
.......
1000
100
30 1 5 25 0 5 1 0 20
Time (hr)
174
Relative survival (%)
B
10000
1000
O"
100 Jilf
10
.1
0 5 1 0 1 5 25 30 20
Time (hr)
175
Figure 4.4. Sensitivity to mAMSA of yeast cells expressing
human or yeast topoisomerase II.
The sensitivity of JN394t2-5 cells carrying pMJl and JN394
cells to mAMSA was determined at 34°C under the same
conditions as the experiment shown in Figure 4.3. The
conditions shown are: no drug (open circles), 0.5 |!g/ml (open
squares), 2 |Llg/ml (open triangles), 5 |lg/ml (filled circles), 10
(Ig/ml (filled squares), 50 |J.g/ml (filled triangles) mAMSA.
176
Relative survival (%)
A
10000
1000
100
10
.01
.001
0 5 1 0 2 0 2 5 3 0 5
Time (hr)
177
Relative survival (%)
B
10000
1000
100 ix
0 5 20 25 3 0
Time (hr)
178
Figure 4.5. Drug sensitivity of yeast cells expressing human
topoisomerase II carrying the Arg45oGln mutation.
Sensitivity to etoposide and mAMSA of JN394t2-5 cells
carrying pMJ 1 Arg 4 5 oGln was determined under the same
conditions as described for figures 3 and 4. Figure 4.5A shows
the sensitivity to etoposide; the conditions shown are: no drug
(open circle), 50 (Ig/ml (open square), 100 (Ig/ml (open
triangle), 200 (Ig/ml (cross) etoposide. Figure 4.5B shows the
sensitivity to mAMSA; drug concentrations are: no drug (open
circle), 0.5 (Ig/ml (open square), 2 (Ig/ml (open triangle), 5
|Ig/ml (filled circle), 10 (Ig/ml (filled square), 50 (Ig/ml (filled
triangle) mAMSA.
179
Relative survival (%)
A
100000
10000
1000
100 •£
0 5 1 0 1 5 2 0
- >
3 0
Time (hr)
180
Relative survival (%)
B
10000
1000
....
100
10
.01
.001
0 I 5 20 5 25 3
Time (hr)
Figure 4.6. Sensitivity to teniposide of yeast cells expressing
wild type human topoisomerase II or its Arg45oGln mutant.
Drug sensitivity experiments were carried out with teniposide
as described previously. Figure 4.6A shows the sensitivity of
JN394t2-5 cells expressing wild type human topoisomerase II
to teniposide. The sensitivity to teniposide of the same strain
expressing human topoisomerase II carrying the Arg4 5oGln
mutation is shown in Figure 4.6B. The conditions shown are: no
drug (open circles), 20 |lg/ml (open squares), 50 flg/ml (open
triangles), 100 |lg/ml (crosses) teniposide.
182
Relative survival (%)
O
o
o
o
o
o
o
o
o
L fi
H
3
a >
sr
c
Ui
00
u>
U )
o
Relative survival (%)
B
10000
1000
100
10
1
0 5 1 0 20 25 30 5
Time (hr)
184
Figure 4.7. Sensitivity to etoposide and mAMSA of yeast cells
expressing human topoisomerase II carrying a mutation that
converts Prc>803 to Ser.
Drug sensitivity was measured at 34°C. Figure 4.7A shows the
sensitivity of JN394t2-5 carrying pMJ 1 Proso^Ser to etoposide;
the conditions shown are: no drug (open circle), 20 flg/ml (open
square), 50 jig/ml (open triangle), 100 |Ig/ml (filled square),
200 flg/ml (filled triangle). Figure 4.7B shows the sensitivity of
the same strain to mAMSA; the drug concentrations are: no
drug (open circle), 0.5 |I g/ml (open square), 2 flg/ml (open
triangle), 5 (lg/ml (filled circle), 10 |4g/ml (filled square), 50
(Ig/ml (filled triangle).
185
Relative survival
A
10000
1000
100
5 2 0 3 0 1 0
Time (hr)
186
Relative survival (%)
B
10000
1000
n il* "
100
.001
25 3 0 0 5 1 0 2 0
Time (hr)
187
Figure 4.8. Sensitivity to etoposide and mAMSA of cells
expressing human topoisomerase II carrying Arg4 5 oGln and
PrososSer double mutations.
Figure 4.8A shows the sensitivity to etoposide; drug
concentrations are: no drug (open circle), 20 jig/m l (open
square), 50 (Ig/ml (open triangle), 100 |4g/ml (filled square),
200 |4g/ml (filled triangle). Figure 4.8B shows the sensitivity to
mAMSA; the conditions were: no drug (open circle), 0.5 |Llg/ml
(open square), 2 (J.g/ml (open triangle), 5 (4 g/ml (filled circle),
10 |Ig/ml (filled square), 50 jig/ml (filled triangle).
188
681
(jq ) s u iix
0 £ SZ OZ SI 0 1 S 0
- 01
001
- 0001
00001
V
Relative survival (%)
v O
O
Time (hrs)
Relative survival (%)
Table 4.1 Yeast strains
Strain _____________________G enotype ___________________________________________
JCW 2 M A T a ura3-52 h is4 -5 3 9 lys2-801 top2-4 top 1:: H IS4
JN 394t2-4 as JN 394 but top2-4
JN 394t2-5 as JN 394 but top2-5
C H 326 M A T a ura3-52 h is4-539 Iys2-8()1 top2-5
191
DISCUSSION
Drugs that target topoisomerase II represent a major
group of cancer chemotherapeutic agents. It has been
observed that actively proliferating cells express high levels of
topoisomerase II, and many cancer cells have elevated levels of
topoisomerase II (Hsiang, Wu and Liu, 1988; Liu, 1989). It is
the high levels of topoisomerase II that may be partly
responsible for the efficacy of topoisomerase II inhibitors in
treating cancer. In other cases, resistance to anti-
topoisomerase II drugs has been found to be associated with
reduced levels of topoisomerase II (Friche, et al., 1991;
Pommier. et al., 1986; Tan, et al., 1989). Genetic studies using
yeast have clearly demonstrated topoisomerase II poisons
convert the enzyme to a cellular toxin. The level of enzyme
activity parallels with the level of drug sensitivity, with low
activity leading to drug resistance (Nitiss, Liu and Hsiung,
1993), elevated activity leading to drug hypersensitivity
(Nitiss. et al., 1992).
Any change leading to decreased topoisomerase II
activity might be expected to confer resistance to drugs that
stabilize cleavage. For example, mutations in the TOP2
promoter that down-regulate TOP2 expression are expected to
192
exhibit drug resistance. Mutations leading to a reduction of the
nuclear concentration of topoisomerase II are expected to
display drug resistance due to the overall reduction of
intracellular DNA cleavage. For example, yeast topoisomerase
II mutant expressing a C-terminally truncated enzyme displays
resistance to mAMSA (Wasserman and Wang, 1994b). The
presence of nuclear localization signal near the carboxyl
terminus of topoisomerase II has been shown for the enzyme
(Caron, Watt and Wang, 1994), and a defect in this signal is
likely to contribute to the reduced nuclear concentration of the
mutant enzyme.
Another class of drug-resistant topoisomerase II mutants
is those carrying mutations in TOP2 that affect directly and
specifically enzyme-drug interactions. Microorganisms such as
yeast provides an advantageous system to study topoisomerase
II as target of anticancer drugs. One purpose for studying
topoisomerase II mutants that confer drug resistance is to
define the binding site(s) on the protein that interact with anti-
topoisomerase agents. The system described in Chapter I was
designed for isolating mutations in TOP2 that confer alterations
in drug sensitivity. Mutations identified in these mutants are
potentially important for drug action. My results suggested
that the region flanking the active site tyrosine (Tyi^s?) in the
g y r A homology domain defined by several mutations plays
193
specific roles in the interaction of different classes of anti-
topoisomerase II agents (Figure D.l). Among these mutations,
S er7 4 )Trp is specific for interacting with epipodophyllotoxins
such as etoposide and teniposide but not to intercalative anti-
topoisomerase II agents (Chapter III).
The results from heat reversal experiments suggest that
the ternary complex formed with the Ser741Trp protein is
more stable than the complex formed with the wild type
enzym e. The increase in stability of S er7 4 | T r p
protein/DNA/etoposide ternary complex strongly suggested
that the Sei'7 4 iTrp mutation confers the protein higher affinity
for epipodophyllotoxins. Hence, Sei‘7 4 i likely represents a key
element in the region that is important for drug binding and
mutation of Ser7 4 iTrp might affect directly and specifically the
interaction between etoposide and the mutant protein. My
results would also suggest that the domain including Ser74 | in
yeast topoisomerase II interacts with both fluoroquinolone and
epipodophyllotoxins. This result is in consistance with the
recent report that the etoposide interaction domain overlaps
with several DNA cleavage-enhancing drugs including
quinolone CP-115,953 (Corbett, Hong and Osheroff, 1993).
Collectively, these observations suggest that different classes of
drugs are likely to target the common interaction domain of
topoisomerase II, where cleavage and religation occur but
194
different drugs are likely to interact with different amino acid
residues on the protein. Since the region surrounding active
site tyrosine is highly conserved, it would be interesting to
demonstrate whether the Sei'7 4 iTrp equivalent mutation in
human TOP2 would give rise to the same results.
While Ser7 4 i might lie near a binding site for etoposide,
mutations in the T O P 2 structural gene that lead to alterations
in drug sensitivity do not necessarily affect directly and
specifically drug-enzyme interactions. His50 7T y r/H is 52 1Tyr in
the to p 2 - A 4 allele (Chapter II) are potentially this type of
mutations based on the following observations. Although the
overall drug-stabilized cleavage catalyzed by the top2-A4
protein is lower as compared to the wild type enzyme, the
mutant protein is not "insensitive" to drugs. The level of
cleavage increases as the concentration of drug increases. The
reduction of the cleavage complex formation may not be the
consequence of the defect in enzyme's ability to interact with
drug but may reflect some alterations in the catalytic steps of
the enzyme. This type of mutations might indirectly influence
drug-enzyme interaction, and formation of cleavage complex.
If it is the case, resistance to drugs that stabilize cleavage need
not to be recessive; instead, it depends on the nature and the
location of the mutation in the topoisomerase II protein. For
example, the yeast topoisomerase II mutation Lys43t>Gln
195
confers semi-dominant drug resistance (Nitiss et al., 1994). As
discussed in Chapter II, whether a particular mutation is
recessive or semi-dominant will depend on the drug sensitivity
of the wild type/mutant heterodimeric topoisomerase II. One
reason that a heterodimer might lead to a drug resistant
enzyme is that the mutant subunit might enforce a
conformational change on the enzyme that alters its ability to
interact with drugs that target the enzyme. Mutations located
in the g y r B homology domain might generally have such
characterictics.
In addition to the mutations that were isolated in the
g y r A and g y rB homology domains that might contribute a
significant role in drug-enzyme interaction, other mutations
that can confer drug resistance have been also identified. For
example, a mutation of A rgnysL ys in topoisomerase II was
identified in the to p 2 - I 0 2 mutants that are highly resistant to
etoposide and mAMSA. The top2-102 mutation localizes to the
C-terminal region of yeast topoisomerase II. Another mutation,
H iS|oi2Tyr in yeast topoisomerase II potentially defines a new
drug resistance-conferring domain on topoisomerase II (Elsea
et al., 1995). Hence, these studies suggest that amino acid
residues toward the C-terminus of the enzyme may as well
play an important role in drug-enzyme interactions. Mutation
of Argtoo9Lys in the top2-Al allele also fall into this category.
196
The yeast system is useful not only for defining the
spectrum of the potential sites that lead to altered drug
sensitivity, but also for testing the effects of the yeast
equivalent change corresponding to mutations identified in the
human enzyme. The success of developing yeast system to
express human TO P 2 a opens an avenue for directly testing
mutations detected in the drug resistant cell lines (Chapter IV).
Moreover, overexpression of the T O P 2 gene in yeast provides
an easy and ample source of the enzyme for biochemical
studies.
197
Figure D .l Summary of the mutations identified in yeast
topoisomerase II that are potentially important for drug action
and their relative locations in the polypeptide.
198
N --------
t
top2-A4
His507 Tyr/His 52| Tyr
VO
VO
Ser74, Trp
Arg 884 Pro
top2-5 Arg 886 lie
Pro 824 Ser
top2-103P*S
Tyr
783
886
Met 887 lie
G 1y i 186 G l u
top2-103b
t
I
^ top2-4
top2-l01 Pro 821 Gin
G*y738 AsP
top2-Al
Ar§ io o 9 Lys
▼
top2-102
Arg ii95 Lys
REFERENCES
Aguilera, A., and Klein, H. L. (1990). H P R 1, a novel yeast gene
that prevents intrachromosomal excision recombination, shows
carboxy-terminal homology to the Saccharom yces cerevisiae
TOPI gene. Mol. Cell. Biol./O, 1439-51.
Andersen, A. H., Christiansen, K., Zechiedrich, E. L., Jensen, P. S.,
Osheroff, N., and Westergaard, O. (1989). Strand specificity of
the topoisomerase II-mediated double-stranded DNA cleavage
reaction. Biochemistry2tf, 6237-6244.
Bakic, M., Beran, M., Andersson, B. S.. Silberman, L., Estey, E.,
and Zwelling, L. A. (1986). The production of topoisomerase II-
mediated DNA cleavage in human leukemia cells predicts their
su sc ep tib ility to 4 ’ - (9 - a c rid in y la m in o ) m ethanes ulfon-m -
anisidide (m-AMSA). Biochem. Biophys. Res. Commun./54, 638-
645.
Baldi, M. I., Benedetti, P., Mattoccia, E., and Toccini-Valentini, G.
P. (1980). In vito catenation and decatenation of DNA and a
novel eukaryotic ATP-dependent topoisomerase. Cell20, 46 1-
467.
Barrett. J. F., Gootz, T. D., McGuirk, P. R., Farrell, C. A., and
Sokolowski, S. A. (1989). Use of in vitro topoisomerase II
assays for studying quinolone antibacterial agents. Antimicrob.
Agents ChemotherJi, 1697-1703.
Beck. W. T., Cirtain, M. C., and Dank, M. K. (1987).
Pharmacological, molecular, and cytogenetic analysis of
"atypical" multidrug-resistant human leukemic cells. Cancer
Res.47, 5455-5460.
200
Beck, W. T., and Danks, M. K. (1991). Mechanisms of resistance
to drugs that inhibit DNA topoisomerases. Seminars In Cancer
Biology2, 235-44.
Birnboim, H. C., and Doly. J. (1979). A rapid alkaline extraction
procedure for screening recombinant plasmid DNA. Nucleic
Acids Res.7, 1513-1523.
Bradford, M. M. (1976). A rapid and sensitive method for the
quantitation of microgram quantities of protein utilizing the
principle of protein dye binding. Anal. Biochem.72, 248-254.
Brill, S. J., DiNardo, D., Voelkel-Meiman, K., and Sternglanz, R.
(1987). Need for DNA topoisomerase activity as a swivel for
DNA replication and for transcription of ribosomal RNA.
Nature326, 414-416.
Brill, S. J.. and Sternglanz, R. (1988). Transcription-dependent
DNA supercoiling in yeast DNA topoisomerase mutants. Cell54,
403-11.
Brown, P. O. and Cozzarelli, N. R. (1979). A sign inversion
mechanism for enzymatic supercoiling of DNA. Science 2 06,
1081.
Bugg, B. Y., Danks, M. K., Beck, W. T., and Suttle. D. P. (1991).
Expression of a mutant DNA topoisomerase II in CCRF-CEM
human leukemic cells selected for resistance to teniposide.
Proc. Natl. Acad. Sci. USA##, 7654-58.
Cardenas, M. E., Dang, Q.. Glover. C. V., and Gasser, S. M. (1992).
Casein kinase II phosphorylates the eukaryote-specific C-
terminal domain of topoisomerase II in vivo. Embo Journal//,
1785-96.
Cardenas, M. E., and Gasser, S. M. (1993). Regulation of
topoisomerase II by phosphorylation: a role for casein kinase
II. J. Cell Science/04, 219-225.
201
Caron, P. R., and Wang, J. C. (1993). DNA topoisomerases as
targets of therapeutics: a structural overview. Eds. (Boca Raton
FL, CRC press)
Caron, P. R., Watt, P., and Wang, J. C. (1994). The C-terminal
domain of Saccharom yces cerevisiae DNA topoisomerase II.
Mol. Cell. Biol. 14, 3197-3207.
Champoux, J. J., and Dulbecco, R. (1972). An activity from
mammalian cells that untwists superhelical DNA-a possible
swivel for DNA replication. Proc. Natl. Acad. Sci. U.S.A.69, 143-
146.
Chan, V. T. W., Ng, W.-w., Eder, J. P., and Schnipper, L. E. (1993).
Molecular cloning and identification of a point mutation in the
topoisomerase II cDNA from an etoposide-resistant Chinese
hamster ovary cell line. J. Biol. Chem.2(5£, 2160-2165.
Chen. A. Y.. and Liu. L. F. (1994). DNA topoisomerases: essential
enzymes and lethal targets. Annu. Rev. Pharmacol. Toxicol.34,
191-218.
Christman, M. F., Dietrich. F. S.. and Fink, G. R. (1988). Mitotic
recombination in the rDNA of S. cerevisiae is suppressed by the
combined action of DNA topoisomerases I and II. Cell55, 4 13-
25.
Chung, T. D. Y., Drake, F. H., Tan, K. B., Per, S. R., Crook, S. T., and
Mirabelli, C. K. (1989). Characterization and immunological
identification of cDNA clones encoding two human DNA
topoisomerase II isozymes. Proc. Natl. Acad. Sci. U.S.A.86, 943 1-
9435.
Corbett, A. FL, Fernald, A. W., and Osheroff, N. (1993). Protein
kinase C modulates the catalytic activity of topoisomerase II by
enhancing the rate of ATP hydrolysis: evidence for a common
mechanism of regulation by phosphorylation. BiochemistryJ2,
2090-2097.
202
Corbett, A. H., Hong, D., and Osheroff, N. (1993). Exploiting
mechanistic differences between drug classes to define
functional drug interaction domains on topoisomerase II:
evidence that several diverse DNA cleavage-enhancing agents
share a common site of action on the enzyme. J. Biol. Chem.268,
14394-14398.
Corbett, A. H., and Osheroff, N. (1993). When good enzyme go
bad: conversion of topoisomerase II to a cellular toxin by
antineoplastic drugs. Chem. Res. Toxicol.6, 585-597.
Cullen, M. E., Wyke, A. W., Kuroda. R., and Fisher, L. M. (1989).
Cloning and characterization of a DNA gyrase A gene from
Escherichia coli that confers clinical resistance to 4-quinolones.
Antimicrob. Agents Chemother.53, 886.
D'Arpa, P., Beardmore. C., and Liu, L. F. (1990). Involvement of
nucleic acid synthesis in cell killing m echanism s of
topoisomerase poisons. Cancer Res.50, 6919-24.
D'Arpa, P., and Liu, L. F. (1989). Topoisomerase-targeting
antitumor drugs. Biochimica et Biophysica Acta9<89, 163-177.
Danks, M. K., Schmidt, C. A., Citrain, M. C., Suttle, D. P.. and Beck,
W. T. (1988). Altered catalytic activity of DNA cleavage by DNA
topoisomerase II from human leukemic cells selected for
resistance to VM-26. Biochemistry27, 8861-8869.
Danks. M. K., Warmouth, M. R., Friche, E., Granzen, B., Bugg, B. Y.,
Harker, W. G., Zwelling, L. A., Futscher. B. W.. Suttle. D. P., and
Beck, W. T. (1993). Single-strand conformational polymorphism
analysis of the Mr 170,000 isozyme of DNA topoisomerase II in
human tumor cells. Cancer Res.53, 1373-1379.
Danks, M. K., Yalowich, J. C., and Beck. W. T. (1987). Atypical
multiple drug resistance in a human leukemic cell line selected
for resistance to teniposide (VM-26). Cancer Res.47, 1 2 9 7-
1301.
203
Dean, F., Krasnow, M. A., Otter, R., Matzuk, M. M., Spengler, S. J.,
and Cozzarelli, N. R. (1983). Escherichia coli type I
topoisom erases: identification, m echanism , and role in
recombination. Eds.
DiNardo, S., Voelkel, K., and Sternglanz, R. (1984). DNA
topoisom erase II mutant of Scicchciromyces cerevisiae :
topoisomerase II is required for segregation of daughter
molecules at the termination of DNA replication. Proc. Natl.
Acad. Sci. U.S.A.87, 2616-2620.
Drake, F. H., Zimmerman, J. P., McCabe, F. L., Bartus, H. F.. Per, S.
R., Sullivan, D. M., Ross, W. E., Mattern, M. R., Johnson, R. K.,
Crooke, S. T., and Mirabelli, C. K. (1987). Purification of
topoisomerase II from amsacrine-resistant P388 leukemia
cells. J. Biol. Chem.262, 16739-47.
Earnshaw, W. C., Halligan, B.. Cooke, C. A., Heck. M. M., and Liu,
L. F. (1985). Topoisomerase II is a major component of mitotic
chromosome scaffolds. J. Cell Biol./00, 1706-1715.
Earnshaw, W. C., and Heck, M. M. S. (1985). Localization of
topoisomerase II in mitotic chromosomes. J. Cell Biol. 100, 17 16-
1725.
Elsea, S. H., Osheroff, N., and Nitiss, J. L. (1992). Cytotoxicity of
quinolones toward eukaryotic cells. J. Biol. Chem.267, 13 150-
13153.
Elsea. S. H., McGuirk, P. R.. Gootz, T. D., Moynihan. M., and
Osheroff, N. (1993). Drug features that contribute to the activity
of quinolones against mammalian topoisomerase II and culture
cells: correlation between enhancement of enzyme-mediated
DNA c leav ag e in vitro and c y to to x ic p o te n tia l.
Antimicrob.Agents ChemotherJ7, 2179-2186.
Elsea, S. H., Hsiung, Y., Nitiss, J. L., and Osheroff, N. (1995). A
yeast type II topoisomerase selected for resistance to
quinolone: mutation of histidine 1012 to tyrosine confers
204
resistance to non-intercalative drugs but hypersensitive to
ellipticine. J. Biol. Chem. (in press).
Endicott, J. A., and Ling, V. (1989). The biochemistry of P-
glycoprotein-m ediated m ultidrug resistance. Annu. Rev.
Biochem.5S, 137-171.
Estey, E. H., Silberman, L., Beran, M., Andersson, B. S., and
Zwelling, L. A. (1987). The interaction between nuclear
topoisom erase II activity from human leukem ia cells,
exogenous DNA, and 4'-(9-acridinylamino)methanesulfon-m-
a n isid id e (m -A M S A ) or 4 - ( 4 ,6 - 0 - e t h y lid e n e - b e ta - D -
glucopyranoside) (VP-16) indicates the sensitivity of the cells
to the drugs. Biochem. Biophys. Res. Commun.744, 787-793.
Friche, E., Danks, M. K., Schmidt, C. A., and Beck, W. T. (1991).
Decreased DNA topoisomerase II in daunorubicin-resistant
Ehrlich ascites tumor cells. Cancer Res.5/, 4213-18.
Gellert, M., Mizuuchi, K., O'Dea, M. H., and Nash, H. A. (1976).
DNA gyrase: an enzyme that introduces superhelical turns into
DNA. Proc. Natl. Acad. Sci. U.S.A.75, 3872-3876.
Giaever, G. N., Snyder, L.. and Wang. J. C. (1988). DNA
supercoiling in vivo. Biophys. Chem.29, 1-2.
Glisson, B., Gupta. R., and Hodges, P. (1986). Cross-resistance to
intercalating agents in an epipodophyllotoxin-resistant Chinese
hamster ovary cell line: evidence for a common intracellular
target. Cancer Res.46, 1939-1942.
Glisson, B., Gupta, R., and Smallwood-Kentro, S. (1986).
Characterization of acquired epipodophyllotoxin resistance in a
Chinese hamster ovary cell line: loss of drug-stimulated DNA
cleavage activity. Cancer Res.46, 1934-1938.
Goto, T., and Wang, J. C. (1982). Yeast DNA topoisomerase II. J.
Biol. Chem.257, 5866-5872.
205
Goto, T., and Wang, J. C. (1984). Yeast DNA topoisomerase II is
encoded by a single-copy, essential gene. CellJb, 1073-80.
Goto, T., and Wang, J. C. (1985). Cloning of yeast T O P I, the gene
encoding DNA topoisomerase I, and construction of mutants
defective in both DNA topoisomeras I and topoisomerase II.
Proc. Natl. Acad. Sci. U.S.A.S2, 7178-7182.
Gupta, R. (1983). Genetic, biochemical, and cross-resistance
studies with mutants of Chinese hamster ovary cells resistant
to the anticancer drugs, VM-26 and VP16-213. Cancer Res.43,
1568-1574.
Hallett, P., and Maxwell, A. (1991). Novel quinolone-resistant
mutations of the Escherichia cali DNA gyrase A protein:
enzymatic analysis of the mutant proteins. Antimicrob. Agents
ChemotherJ5, 387.
Heck. M. M. S., Hittelman, W. N.. and Earnshaw. W. C. (1988).
Differential expression of DNA topoisomerase I and II during
the eukaryotic cell cycle. Proc. Natl. Acad. Sci. USAS5, 1086-90.
Hickman, J. A. (1992). Apoptosis induced by anticancer drugs.
Cancer Metastasis Rev.//, 121-139.
Hinds, M., Deisseroth, K., Mayes. J., Altschuler, E., Jansen, R.,
Ledley, F. D., and Zwelling, L. A. (1991). Identification of a point
mutation in the topoisomerase II gene from a human leukemia
cell line containing an am sacrine-resistant form of
topoisomerase II. Cancer Res.51, 4729-31.
Holm, C., Goto, T., Wang, J. C., and Bostein, D. (1985). DNA
topoisomerase II is required at the time of mitosis in yeast.
Cell47, 553-563.
Hsiang, Y. H., Lihou, M. G., and Liu, L. F. (1989). Arrest of
replication forks by drug-stabilized topoisomerase I-DNA
cleavable complexes as a mechanism of cell killing by
camptothecin. Cancer Res.49, 5077-82.
206
Hsiang, Y. H„ Wu, H. Y„ and Liu, L. F. (1988). Proliferation-
dependent regulation of DNA topoisomerase II in cultured
human cells. Cancer Res.4£, 3230-5.
Hsieh, T., and Brutlag, D. (1980). ATP-dependent DNA
topoisomerase from D. m elanogaster reversibly catenates
duplex DNA rings. Cell27, 115-125.
Hsiung, Y., Jannatipour, M., McMahon, J., Duncan, D., and Nitiss,
J. L. (1994). Functional expression of human topoisomerase II a
in yeast: mutations at amino acids 450 or 803 of topoisomerase
II a result in enzymes that can confer resistance to anti-
topoisomerase II agents, (submitted for publication).
Huang, W. (1990). Nucleotide sequences and the encoded amino
acids of DNA topoisomerase genes. DNA Topology and Its
Biological Effects. Eds. (Cold Spring Harbor. New York, Cold
Spring Harbor Press)
Ishimi, Y„ Ishida, r„ and Andoh, T. (1992). Effect of ICRF-193, a
novel DNA topoisomerase II inhibitor, on simian virus 40 DNA
and chromosome replication in vitro.
Jannatipour. M., Liu, Y. X., and Nitiss. J. L. (1993). The top2-5
mutant of yeast topoisomerase II encodes an enzyme resistant
to etoposide and amsacrine. J. Biol. Chem.268. 18586-18592.
Kaufmann, S. H. (1989). Induction of endonucleolytic DNA
cleavage in human acute myelogenous leukemia cells by
etoposide, camptothecin, and other cytotoxic anticancer drugs: a
cautionary note. Cancer Res.49, 5870-5878.
Kim, R. A., and Wang, J. C. (1989a). Function of DNA
topoisomerases as replication swivels in Sa c ch a r o m y c es
cerevisiae. J. Mol. Biol.208, 257-67.
Kim, R. A., and Wang, J. C. (1989b). A subthreshold level of DNA
topoisomerases leads to the excision of yeast rDNA as
extrachromosomal rings. Cell57, 975-85.
207
Kim, R. A., and Wang, J. C. (1992). Identification of the yeast
T O P 3 gene product as a single strand-specific DNA
topoisomerase. J. Biol. Chem.267, 17178-85.
Kohn, K. W., Pommier, Y., Kerrigan, D., Markovits, J., and Covey,
J. M. (1987). Topoisomerase II as a target of anticancer drug
action in mammalian cells. NCI monograph^, 61-72.
Kreuzer, K. N., and Cozzarelli, N. R. (1979). Escherichia coli
mutants thermosensitive for deoxyribonucleic acid gyrase
subunit A:effects on deoxyribonucleic acid replication,
transcription, and bacteriophage growth. J. Bacteriol. 140, 4 2 4 -
435.
Kunkel, T. A., Roberts, J. D., and Zakour, R. A. (1987). Rapid and
efficient site-specific mutagenesis with phenotypic selection.
Methods in Enzymology/54, 367-382.
Lee, M. P., Brown. S. D., Chen. A., and Hsieh, T.-s. (1993). DNA
topoisomerase I is essential in Drosophila melanogaster. Proc.
Natl. Acad. Sci. USA90, 6656-6660.
Lee, M. S., Wang, J. C., and Beran, M. (1992). Two independent
amsacrine-resistant human myeloid leukemia cell lines share
an identical point mutation in the 170 kDa form of human
topoisomerase II. J. Mol. Biol.223, 837-43.
Lindsley, J. E., and Wang, J. C. (1991). Proteolysis patterns of
epitopically labeled yeast DNA topoisomerase II suggest an
allosteric transition in the enzyme induced by ATP binding.
Proc. Natl. Acad. Sci. USA88. 70485-9.
Lindsley, J. E., and Wang, J. C. (1993). On the coupling between
ATP usage and DNA transport by yeast DNA topoisomerase II.
J. Biol. Chem.265, 8096-8104.
Liu, L. F. (1989). DNA topoisomerase poisons as antitumor
drugs. Annu. Rev. Biochem.55, 351-75.
208
Liu, L. F. (1990). Anticancer drugs that convert DNA
topoisomerases into DNA damaging agents. DNA Topology and
Its Biological Effects. Eds. Cold Spring Harbor Laboratory Press)
Liu, L. F., Davis, J. L., and Calender, R. (1981). Novel
topologically knotted DNA from bacteriophage P4 capsids:
studies with DNA topoisomerases. Nucleic Acids Res.9, 3 9 7 9 -
3989.
Liu, L. F., Rowe, T. C., Yang, L., Tewey, K. M., and Chen, G. L.
(1983). Cleavage of DNA by mammalian DNA topoisomerase II.
J. Biol. Chem.255, 15365-15370.
Liu, L. F., and Wang, J. C. (1987). Supercoiling of the DNA
template during transcription. Proc. Natl. Acad. Sci. USA84,
7024-7.
Liu, Y. X., Hsiung, Y., Jannatipour, M., Yeh, Y., and Nitiss, J. L.
(1994). Yeast topoisomerase II mutants resistant to anti-
topoisomerase aAgents: identification and characterization of
new yeast topoisomerase II mutants selected for resistance to
etoposide. Cancer Res.54, 2943-2951.
Lynn, R., Giaever, G., Swanberg, S. L., and Wang, J. C. (1986).
Tandem regions of yeast DNA topoisomerase II share homology
with different subunits of bacterial gyrase. Science2J5, 647-49.
Maxwell, A. (1992). The molecular basis for quinolone action.
Antimicrob. Agents Chemother.30, 409-414.
Miller, K. G., Liu. L. F., and Englund, P. T. (1981). A
homogeneous type II DNA topoisomerase from HeLa cell nuclei.
J. Biol. Chem.256, 9334-9339.
Morel, C., Chiari, E., Mattei, D. M., Romanha, H. A., and Simpson,
L. (1980). Strains and clones of Trypanosoma cruzi can be
characterized by pattern of restriction endonuclease products
of kinetoplast DNA minicircles. Proc. Natl. Acad. Sci. USA77,
6810-6814.
209
Muller, M. T. (1983). Nucleosomes contain DNA binding proteins
that resist dissociation by sodium dodecyl sulfate. Biochem.
Biophys. Res. Commun.//4, 99-105.
Muller, M. T., Spitzner, J. R„ DiDonato, J. A., Mehta, V. B., Tsutsui,
K., and Tsutsui, K. (1988). Single-strand DNA cleavages by
eukaryotic topoisomerase II. Biochemistry27, 8369-8379.
Nakamura, S., Nakamura, T., Kojima, T., and Yoshida, H. (1989).
g y r A and g y r B mutations in quinolone-resistant strains of
Escherichia coli. Antimicrob. Agents Chemother.55, 254-255.
Nelson, E. M., Tewey, K. M., and Liu, L. F. (1984). Mechanism of
anti tum or drug action: poisoning of m am m alian DNA
to p o iso m erase II on D NA by 4 '-(9 -acrid in y lam in o )-
methanesulfon-m-anisidide. Proc. Natl. Acad. Sci. USA#/, 1361-
65.
Nitiss, J. L., Liu, Y. X., Harbury, P., Jannatipour, M., Wasserman,
R.. and Wang. J. C. (1992). Amsacrine and etoposide
hy p ersen sitiv ity of yeast cells o v erex p ressin g DNA
topoisomerase II. Cancer Res.52, 4467-72.
Nitiss, J. L., Liu, Y. X., and Hsiung, Y. (1993). A temperature
sensitive topoisom erase II allele confers tem perature
dependent drug resistance on amsacrine and etoposide: a
genetic system for determining the targets of topoisomerase II
inhibitors. Cancer Res.55, 89-93.
Nitiss, J. L., Vilalta, P. M„ Wu, H.. and McMahon, J. (1994).
Mutations in the g y r B domain of eukaryotic topoisomerase II
can lead to partially dominant resistance to etoposide and
amsacrine. Mol. Parmacol. (in press).
Nitiss, J. L., and Wang, J. C. (1988). DNA topoisomerase-
targeting antitumor drugs can be studied in yeast. Proc. Natl.
Acad. USAS5, 7501-5.
210
Onishi, Y., Azuma, Y., Sato, Y., Mizuno, Y., Tadakuma, T., and
Kizaki, H. (1993). Topoisomerase inhibitors induce apoptosis in
thymocytes. Biochim. Biophys. Acta1175, 147-154.
Oram, M., and Fisher, L. M. (1991). 4-quinolone resistance
mutations in the DNA gyrase of Escherichia coli clinical isolates
identified by using the polymerase chain reaction. Antimicrob.
Agents Chemother.55, 387.
Osheroff, N., Shelton, E. R., and Brutlag, D. L. (1983). DNA
topoisomerase II from Drosophila melanogaster: relaxation of
supercoiled DNA. J. Biol. Chem.258, 9536-9543.
O sheroff, N. ( 1986). E u k ary o tic to p o iso m e ra se II:
characterization of enzyme turnover. J. Biol. Chem.261, 9 9 4 4 -
9950.
Osheroff, N. (1987). Role of the divalent cation in topoisomerase
II mediated reactions. Biochemistry#6, 6402-6406.
Osheroff, N. (1989a). Effect of antineoplastic agents on the DNA
cleavage/religation equilibrium of eukaryotic topoisomerase II:
inhibition of DNA religation by etoposide. Biochemistry2 6\
6157-6160.
Osheroff, N. (1989b). Biochemical basis for the interaction of
type I and type II topoisomerases with DNA. Pharmacol.
Ther.47, 223-241.
Osheroff, N., Zechiedrich, E. L.. and Gale. K. C. (1991). Catalytic
function of DNA topoisomerase II. BioEssays/3, 269-273.
Patel, S., and Fisher, L. M. (1993). Novel selection and genetic
characterization of an etoposide-resistant human leukemic
CCRF-CEM cell line. Br. J. Cancer67, 456-463.
Per, S. R., Mattern, M. R., Mirabelli, C. K., Drake, F. H., Johnson, R.
K., and Crooke, S. T. (1987). Characterization of a subline of
P388 leukemia resistant to amsacrine: evidence of altered
topoisomerase II function. Mol. Pharmacol.32, 17-25.
211
Pommier, Y., Kerrigan, D., Schwartz, R. E., Swack, J. A., and
McCurdy, A. (1986). Altered DNA topoisoemrase II activity in
Chinese hamster cells resistant to topoisomerase II inhibitors.
Cancer Res.46, 3075-3081.
Pommier, Y., Zwelling, L. A., M.R., M., Erickson, L. C., Kerrigan, D.,
and al., e. (1983). Effects of dimethyl sulfoxide and thiourea
upon intercalator-induced DNA single-strand breaks in mouse
leukemia (L1210) cells. Cancer Res.43, 5718-5724.
Reece, R. J., and Maxwell, A. (1991). DNA gyrase: structure and
function. Critical Reviews in Biochemistry and Molecular
Biology2<5, 335-75.
Robinson, M. J.. Corbett, A. H., and Osheroff, N. (1993). Effects of
topoisomerase II-targeted drugs on enzyme-mediated DNA
cleavage and ATP hydrolysis: evidence for distinct drug
interaction domains on topoisomerase II. Biochemistry52,
3638-3643.
Robinson, M. J.. Martin, B. A., Gootz, T. D., McGuirk, P. R.,
Moynihan, M., Sutcliffe, J. A., and Osheroff, N. (1991). Effects of
quinolone derivatives on eukaryotic topoisomerase II. A novel
mechanism for enhancem ent of enzym e-m ediated DNA
cleavage. J. Biol. Chem.266, 14585-92.
Robinson. M. J., Martin, B. A., Gootz, T. D., McGuirk, P. R., and
Osheroff. N. (1992). Effects of novel fluoroquinolones on the
catalytic activities of eukaryotic topoisomerase II: Influence of
the C-8 fluorine group. Antimicrob. Agents Chemother.36, 75 1-
6 .
Robinson. M. J.. and Osheroff, N. (1990). Stabilization of the
topoisomerase II-DNA cleavage complex by antineoplastic
drugs: inhibition of enzyme-mediated DNA religation by 4'-(9-
acridiny lam i no )me thanes ulfon-m -anisidide. B iochem istry 2 9,
2511-5.
212
Robinson, M. J., and Osheroff, N. (1991). Effects of antineoplastic
drugs on the post-strand-passage DNA cleavage/religation
equilibrium of topoisomerase II. BiochemistryJO, 1807-13.
Roninson, I. B. (1987). Molecular mechanism of multidrug
resistance in tumor cells. Clin. Physiol. Biochem.5, 140-151.
Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989). Molecular
cloning: a laboratory manual. Cold Spring Harbor Laboratory
Press, 2nd ed.
Sander, M., and Hsieh, T.-s. (1983). Double-strand DNA cleavage
by type II DNA topoisomerase form Drosophila melanogaster .
J. Biol. Chem.25S, 8421-8428.
Sander. M., and Hsieh, T.-s. (1985). Drosophila topoisomerase II
double-strand DNA cleavage: analysis of DNA sequence
homology at the cleavage site. Nucleic Acids Res./3, 1057-1072.
Sanger, F., Nicklen, S., and Coulson. A. R. (1977). DNA
sequencing with chain-terminating inhibitors. Proc. Natl. Acad.
Sci. U.S.A.74, 5463-5467.
Scherer, S., and Davis, R. W. (1979). Replacement of
chromosome segments with altered DNA sequences constructed
in vitro. Proc. Natl. Acad. Sci. U.S.A.76, 4951-4955.
Schiestl, R. H., and Gietz, R. D. (1989). High efficiency
transformation of intact yeast cells using single stranded
nucleic acids as a carrier. Curr. Genet. 16, 339-346.
Schild, D. B., Konforti, B.. Perez, C., Gish, W., and Mortimer, R. K.
(1983). Isolation and characterization of yeast DNA repair
genes. I. Cloning of RAD52 gene. Curr. Genet.7, 859-892.
Schneider, E., Hsiang, Y.-H., and Liu, L. F. (1990). DNA
topoisomerases as anticancer drug targets. Adv. Pharmacol.2 1,
149-183.
213
Schneider, E., Lawson, P. A., and Ralph, R. K. (1989). Inhibition
of protein synthesis reduces the cytotoxicity of 4'-(9-
acridinylam ino)m ethanesulfon-m -anisidide without affecting
DNA breakage and DNA topoisomerase II in a murine
mastacytoma cell line. Biochem. PharmacoUS, 263-269.
Shelton, E. R., Osheroff, N., and Brutlag, D. L. (1983). DNA
topoisomerase II from Drosophila melanogaster: purification
and physical characterization. J. Biol. Chem.258, 9530-9535.
Sherman, F., Fink, G. R., and Hicks, J. B. (1979). Methods in Yeast
Genetics. Eds. (New York, Cold Spring Harbor Laboratory)
Sikorski, R. S., and Boeke, J. D. (1991). In vitro mutagenesis and
plasmid shuffling: from cloned gene to mutant yeast. Methods
in Enzymology/94, 302-318.
Sikorski. R. S., and Hieter, P. (1989). A system of shuttle
vectors and yeast host strains designed for efficient
manipulation of DNA in Saccharomvces cerevisiae. Genetics722,
19-27.
Strathern, J. N., and Higgins, D. R. (1991). Recovery of plasmids
from yeast into Escherichia coli shuttle vectors. Methods in
Enzymology/94, 319-329.
Sullivan. D. M.. Latham, M. D., Rowe, T. C., and Ross, W. E.
(1989). Purification and characterization of an altered
topoisomerase II from a drug-resistant Chinese hamster ovary
cell line. Biochemistry2$, 5680-5687.
Tabor, S., and Richardson, C. C. (1989). Selective inactivation of
the exonuclease activity of bacteriophage T7 DNA polymerase
and E.coli DNA polymerase I. J. Biol. Chem.264, 6447-6458.
Tan, K. B„ Dorman, T. E„ Falls, K. M„ Chung, T. D. Y„ Mirabelli, C.
K., Crooke, S. T., and Mao, J.-i. (1992). Topoisomerase Ila and
topoisomerase lip genes: characterization and mapping to
214
human chromosomes 17 and 3, respectively. Cancer Res.52,
231-234.
Tan, K. B., Mattern, M. R., Eng, W.-K., McCabe, F. L., and Johnson,
R. K. (1989). N onproductive rearrangem ent of DNA
topoisomerase I and II genes: correlation with resistance to
topoisomerase inhibitors. Journal of the National Institutes/,
1732-35.
Thomas, W„ Spell, R. M„ Ming, M. E„ and Holm, C. (1991).
Genetic analysis of the gyrase A-like domain of DNA
topoisomerase II of Saccharomvces cerevisiae. Genetics/2S,
703-16.
Thrash, C., Voelkl, K., DiNardo, S., and Sternglanz, R. (1984).
Identification of Saccharomvces cerevisiae mutants deficient in
DNA topoisomeras I activity. J. Biol. Chem.259, 1375.
Thrash. K.. Bankier, A., Barrell, B., and Sternglanz. R. (1985).
Cloning, characterization, and sequencing of the yeast DNA
topoisomerase I gene. Proc. Natl. Acad. Sci. U.S.A.S2, 4 3 7 4 -
4378.
Tsai-Pflugfelder, M., Liu, L. F., Liu, A. A., Tewey, K. M., Whang-
Peng, J., Knutsen, T., Huebner, K., Croce, C. M., and Wang, J. C.
(1988). Cloning and sequencing of cDNA encoding human
topoisomerase II and localization of the gene to chromosome
region 17q21-22. Natl. Acad. Sci. USAS5, 7177-7181.
Tse, Y. D., Kierkegaard, K., and Wang, J. C. (1980). Covalent
bonds betw een protein and DNA. F orm ation of
phosphotyrosine linkage between certain DNA topoisomerases
and DNA. J. Biol. Chem.255, 5560-5565.
Udvardy, A., and Schedl, P. (1991). Chromatin structure, not
DNA sequence specificity, is the primary determinant of
topoisomerase II sites of action in vivo. Mol. Cell. Biol.//, 4973-
84.
215
Uemura, T., Ohkura, H., Adachi, Y., Morino, K., Shiozaki, K., and
Yanagida, M. (1987). DNA topoisomerase II is required for
condensation and separation of mitotic chromosomes in S.
pombe. Cell50, 917-925.
Uemura, T., and Yanagida, M. (1984). Isolation of type I and II
DNA topoisomerase mutants from fission yeast: single and
double mutants show different phenotypes in cell growth and
chromatin organization. EMBO J.3, 1737-1744.
Walker, J. E., Saraste, M., Runswick, M. J., and Gay, N. J. (1982).
Distantly related sequence in the a- and b-subunits of ATP
synthetase, myosin, kinases and other ATP-requiring enzymes
and a common nucleotide binding fold. EMBO Jl, 945-951.
Wallis, J. W., Chrebet, G., Brodsky, G., Rolfe, M., and Rothstein, R.
(1989). A hyper-recombination mutation in S. cerevisiae
identifies a novel eukaryotic topoisomerase. Cell5<3, 409-419.
Wang, J. C. (1971). Interaction between DNA and an Escherichia
coli protein C O . J. Mol. Biol.55, 523-533.
Wang, J. C. (1985). DNA topoisomerases. Ann. Rev. Biochem.54,
665-97.
Wasserman, R., Austin, C. A., Fisher, L. M., and Wang, J. C.
(1993). Use of yeast in the study of anticancer drugs targeting
DNA topoisomerase : expression of a functional recombinant
topoisomerase Ila in yeast. Cancer Res.55, 3591-3596.
Wasserman, R. A., and Wang, J. C. (1994a). Analysis of yeast
DNA topoisomerase II mutants resistant to the antitumor drug
amsacrine. Cancer Res.54, 1795-1800.
Wasserman, R. A., and Wang, J. C. (1994b). Mechanistic studies
of amsacrine-resistant derivatives of DNA topoisomerase II:
implications in resistance to multiple antitumor drugs targeting
the enzyme. J. Biol. Chem.269, 20943-20951.
216
Wilson, W., Baguley, B. C., Wakelin, L. P. G., and Waring, M. J.
(1981). In te ra c tio n of the an titu m o r drug 4'-(9-
a c r id in y la m in o ) m e th a n e s u lf o n -m - a n is id id e and re la te d
acridines with nucleic acids. Mol. Pharmacol.20, 404-414.
Worland, S. T., and Wang, J. C. (1989). Inducible overexpression,
purification, and active site mapping of DNA topoisomerase II
from the yeast Saccharom yces cerevisiae. J. Biol. Chem.264,
4412-6.
Wu, H. Y., Shyy, S. H., Wang, J. C., and Liu, L. F. (1988).
Transcription generates positively and negatively supercoiled
domains in the template. Cell55, 433-40.
Wyckoff, E., and Hsieh, T. (1988). Functional expression of a
D ro so p h ila gene in yeast: genetic complementation by DNA
topoisomerase II. Proc. Natl. Acad. Sci. USA55, 6272-6276.
Wyckoff. E.. Natalie. D., Nolan, J. M., Lee, M., and Hsieh, T.-s.
(1989). Structure of the Drosophila DNA topoisomerase II gene:
nucleotide sequence and homology among topoisomerase II. J.
Mol. Biol.205, 1-13.
Yamagishi, J.-I., Yoshida, H., Yamayoshi, M., and Nakamura, S.
(1986). Nalidixic acid resistant mutations of the gvrB gene of
Escherichia coli. Mol. Gen. Genet.204, 367-373.
Yamashita, Y., Ashizawa, T., Morimoto, M., Hosomi, J., and
Nakano, H. (1992a). Antitumor quinolones with mammalian
topoisomerase II mediated DNA cleavage activity. Cancer
Res.52, 2818-22.
Yamashita, Y., Ashizawa, T., Morimoto, M., Hosomi, J., and
Nakano, H. (1992b). Antitumor quinolones with mammalian
topoisomerase II mediated DNA cleavage activity. Cancer
Res.52, 2818-2822.
Yanagida, M., and Wang, J. C. (1987). Yeast DNA topoisomerases
and their structural genes. Eds. Springer-Verlag, Berlin,
Heidelgerg and New York)
217
Yocum, R. R., Hanley, S., West, R.. and Ptashne, M. (1984). Use of
lacZ fusions to delimit regulatory elements of the inducible
divergent GAL1-GAL10 promoter in Saccharomyces cerevisiae.
Mol. Cell. Biol.4, 1985-1998.
, Yoshida, H., Kojima, T., Yamagishi. J.-I., and Nakamura, S.
'■(1988), Quinolone-resistant mutations of the g y r A gene of
Escherichia coli. Mol. Gen. Genet.211, 1.
Zechiedrich. E. L., Christiansen, K., Andersen, A. H., Westergaard,
O., and O sheroff, N. (1989). D ouble-stranded DNA
cleavage/religation reaction of eukaryotic topoisomerase II:
evidence for a nicked DNA intermediate. Biochemistry28,
6229-6236.
Zechiedrich. E. L., and Osheroff. N. (1990). Eukaryotic
to p o iso m erases reco g n ize nucleic acid topology by
preferentially interacting with DNA crossovers. Embo Journal9,
4555-62.
Zhang. H.. D'Arpa, P., and Liu. L. F. (1990). A model for tumor
cell killing by topoisomerase II poisons. Cancer Cells2, 23-27.
Zwelling. L. A., Hinds, M., Chan, D., Mayes, J., Sie, K. L., Parker, E.,
Silberman, L.. Radcliffe, A.. Beran. M., and Blick. M. (1989).
Characterization of an amsacrine-resistant line of human
leukemia cells. J. Biol. Chem.264, 16411-20.
218

Linked assets

University of Southern California Dissertations and Theses

Conceptually similar

PDF

Transcriptional induction of the 78 kiloDalton glucose regulated protein (grp78) gene through depletion of intracellular calcium ion from endoplasmic reticulum

PDF

Identification of oncogenes cooperating in murine mammary tumorigenesis and transgenic mouse models of breast cancer

PDF

Molecular mechanism of genomic imprinting in somatic cell cultures

PDF

A Study Of The Mechanism Of Lead Chromate Induced Neoplastic Transformation Of C3H/10T1/2 Mouse Embryo Cells

PDF

Biochemical factors determining tumor response to 5,10-dideazatetrahydrofolate, a folate antimetabolite inhibitory to de novo purine biosynthesis

PDF

Dna Methylation Patterns In Human Tumor Suppressor Genes

PDF

Analysis of the ALOX5 gene in atherosclerosis

PDF

Fidelity of DNA polymerase holoenzymes

PDF

Biochemical characterization of hydrogen,potassium-ATPase-rich membranes from the gastric parietal cell

PDF

An in vivo study of G protein coupled receptor mediated signaling

PDF

A coactivator complex among GRIP1, CARM1, and TIF1alpha contributes to gene activation directed by androgen receptor

PDF

Biochemistry of nonhomologous DNA end joining (NHEJ) and its role in V(D)J recombination

PDF

Functional analysis of MSX2 and its role in skull patterning

PDF

Cellular factors involved in mouse hepatitis virus replication

PDF

Molecular studies of the human galactose-1-phosphate uridyltransferase gene

PDF

Characterizing the function of murine epididymal secretory protein 1 (ME1) in hematopoietic stem cells

PDF

Amelogenin domains in a self-assembly process

PDF

Characterization of target cell entry by murine leukemia viruses

PDF

Anomalies at NGX6 locus: Potential involvement in feline lymphomas

PDF

Development and secretions of salivary glands using mouse models

Asset Metadata

Creator Hsiung, Yuchu Grace (author)

Core Title Studies Of Topoisomerase Ii As The Target Of Anti-Cancer Agents

Degree Doctor of Philosophy

Degree Program Biochemistry and Molecular Biology

Publisher University of Southern California (original), University of Southern California. Libraries (digital)

Tag biology, molecular,Health Sciences, Pharmacology,OAI-PMH Harvest

Language English

Contributor Digitized by ProQuest (provenance)

Advisor Nitiss, John L. (committee chair), Broek, Daniel (committee member), Ou, Jing-Hsiung James (committee member), Stellwagen, Robert H. (committee member)

Permanent Link (DOI) https://doi.org/10.25549/usctheses-c20-573121

Unique identifier UC11226409

Identifier 9600991.pdf (filename),usctheses-c20-573121 (legacy record id)

Legacy Identifier 9600991.pdf

Dmrecord 573121

Document Type Dissertation

Rights Hsiung, Yuchu Grace

Type texts

Source University of Southern California (contributing entity), University of Southern California Dissertations and Theses (collection)

Access Conditions The author retains rights to his/her dissertation, thesis or other graduate work according to U.S. copyright law. Electronic access is being provided by the USC Libraries in agreement with the au...

Repository Name University of Southern California Digital Library

Repository Location USC Digital Library, University of Southern California, University Park Campus, Los Angeles, California 90089, USA