University of Southern California Dissertations and Theses

Post-translational modification crosstalk regulates KAP1 co-repressor functions in response to DNA damages

(USC Thesis Other)

Post-translational modification crosstalk regulates KAP1 co-repressor functions in response to DNA damages

PDF

Download

Open document

Flip pages

Download a page range

Download transcript

Copy asset link

Request this asset

Transcript (if available)

Content

POST-TRANSLATIONAL MODIFICATION CROSSTALK
REGULATES KAP1 CO-REPRESSOR FUNCTIONS IN RESPONSE TO
DNA DAMAGES

by

Xu Li

A Dissertation Presented to the
FACULTY OF THE USC GRADUATE SCHOOL
UNIVERSITY OF SOUTHERN CALIFORNIA
In Partial Fulfillment of the
Requirements for the Degree
DOCTOR OF PHILOSOPHY
(MOLECULAR PHARMACOLOGY AND TOXICOLOGY)

December 2009

Copyright 2009 Xu Li

ii

DEDICATION

To my beloved wife Lan Qin, my beautiful newborn daughter Joyce, my loving
parents Mr. Pin Li and Mrs. Suying Sun.

iii

ACKNOWLEDGEMENTS

Foremost, I wish to give my sincere gratitude to my co-advisor Dr. Wei-Chiang
Shen for so much assistance after my relocation to City of Hope. Without your kind
support to be my co-advisor, this thesis would never have been possible.
I can’t thank enough my advisor Dr. David Ann for your support and guidance
which inspired the whole process. The commitment, the confidence and the dedication to
work I learned from you are the most precious treasures and will benefit my whole life.
You also taught me how to write papers and present findings, which greatly benefited my
research and thesis writing.
My sincere thanks go to Dr. Bangyan Stiles, Dr. Curtis Okamoto and Dr. Michael
Stallcup for all your guidance during my years of research at USC, as well as for
reviewing my work as my dissertation committee members.
I’d also like to thank all past and current members of Dr. Ann’s laboratory for
their helpful discussions and sharing reagents. Especially, I would like to thank Dr.
Helen Lin for sharing her professional experience on cloning works and Dr. Xuefei Cao
for helping me during my rotation.
To begin studying and living in a foreign country could be overwhelming, PIBBS
program of Keck School of Medicine helped me to settle down. I would also like to
acknowledge all faculties, staffs and fellow students of the USC School of Pharmacy,
Keck School of medicine and City of Hope National Cancer Center who helped me
during my Ph.D. research and studies.
iv
TABLE OF CONTENTS

DEDICATION ii

ACKNOWLEDGEMENTS iii

LIST OF FIGURES vii

LIST OF ABBREVIATIONS xi

ABSTRACT xiii

CHAPTER 1 INTRODUCTION
Rationale 1
Hypothesis 2
Background 2
• SUMOylation and its cellular function 2
• KRAB domain-containing

zinc finger (KZF) proteins and their function 4
• KRAB domain associate protein 1 (KAP1) and its function 5
• Dox-treatment downregulates KAP1 SUMOylation that relieves its 8
transcription repression on p21
WAF1/CIP1
in breast cancer MCF-7 cells
• Protein serine/threonine phosphatases 1 (PP1) and its function 9
• Ring finger proteins and their function as an E3 ligase 10
• RNF4 as a SUMO-targeted ubiquitin ligase 10

CHAPTER 2 MATERIALS AND METHODS 12
• Cloning and construction of expression plasmids 12
• Site-directed mutagenesis of KAP1 13
• Cell culture 13
• Western analysis and antibodies 14
• Luciferase assays 15
• Production of lentivirus in HEK293-FT cells 15
• Lentivirus transduction 16
• Construction of inducible sh-KAP1 cell line MCF-7/TR/sh-KAP1 16
• In vivo SUMOylation assay 17
• Immunoprecipitation (IP) of KAP1 18
• Co-immunoprecipitation (Co-IP) assay 18
• Total RNA extraction, reverse transcription and real-time PCR 19
• Chromatin immunoprecipitation (ChIP) and ChIP-ReIP assay 19
• Flow cytometric cell cycle analysis and data analysis 21
• Flow cytometric Annexin-V/FITC apoptosis assay 21
• Flow cytometric H3/Ser10-FITC mitosis assay 22
• Real-time cell growth assay 22
v
• MTT assay 23
• Statistical analysis 23

CHAPTER 3 ROLE FOR KAP1 SERINE 824 PHOSPHORYLATION 24
AND SUMOYLATION/DESUMOYLATION SWITH IN
REGULATING KAP1-MEDIATED TRANSCRIPTIONAL
REPRESSION
Introduction 24
Results 26
• Differential activation of ATM and ATR in response to Dox- and 26
UV-treatment
• Dox-treatment induces KAP1 phosphorylation at Ser-824 via ATM 30
• KAP1 Ser-824 phosphorylation regulates its SUMOylation status 33
• SENP1 enhances basal Ser-824 phosphorylation of KAP1 36
• KAP1 and KAP1 SUMOylation are essential for ZBRK1-mediated 40
repression of p21, Gadd45 α, Bax, Puma, and Noxa
• Table 1: Real-time PCR primer pairs 43

Discussion 44

CHAPTER 4 SUMOYLATION OF KAP1 IS REGULATED BY 51
SER/THR PHOSPHOTASE PP1, WHICH SUBSEQUENTLY
REGULATES ITS CELLUAR FUNCTIONS
Introduction 51
Results 52
• KAP1 depletion impairs cell cycle progression 52
• PP1cA physically interacts with KAP1 through PP1-docking motif 57
• PP1cA/cB dephosphorylates KAP1 at Ser-824 62
• PP1cA and PP1cB differentially regulate KAP1 SUMOylation 68
• PP1cA/cB knockdown promotes derepression of KAP1-targeted gene in 72
MCF-7 cells upon the exposure of DNA damage indults
• PP1cA and PP1cB complex with KAP1 at the p21 proximal promoter 75
Discussion 79

CHAPTER 5 THE ROLE OF SUMOYLATION, PHOSPHORYLATION 85
AND UBIQUITINATION IN REGULATING RNF4
INDUCED KAP1 DEGRADATION
Introduction 85
Results 87
• Phosphorylation affects KAP1 SUMOylation in vitro 87
• Overexpression of SUMO-1 accelerates KAP1(S824D) degradation 88
in vivo
• E3 ligase RNF4 induces poly-ubiquitination and degradation of KAP1 89

vi
• Mono-ubiquitination blocks KAP1 SUMOylation, which further blocks 91
KAP1 degradation under cellular stress
• KAP1 is mono-ubiquitinated at K554, which blocks the SUMOylation 97
and poly-ubiquitination/degradation.
Discussion 101

CHAPTER 6 OVERALL DISCUSSION AND FURURE DIRECTION 105
Overall discussion 105
Future direction 108

BIBLIOGARAPHY 113
vii
LIST OF FIGURES

Figure 1.1 Functional domains of KAP1 6
Figure 1.2 Functional annotation of genome-wide KAP1 targets 7
Figure 3.1 Functional domains of KAP1 27
Figure 3.2 Activation of ATM by Dox-treatment 28
Figure 3.3 ATM is required for the Dox-induced Gadd45α transcriptional 29
activation

Figure 3.4 ATR is not required for the Dox-induced Gadd45α 30
transcriptional activation

Figure 3.5 Dox-treatment induces KAP1 phosphorylation on Ser-824 31
Figure 3.6 ATM is required for Dox-induced KAP1 phosphorylation 32
at Ser-824

Figure 3.7 KAP1 Ser-824 phosphorylation is essential for derepressing 33
its transcriptional co-repressor activity

Figure 3.8 S824A mutation represses KAP1 SUMOylation 34
Figure 3.9 Dynamic interaction between KAP1 phosphorylation and 35
SUMOylation

Figure 3.10 Dox-treatment fails to induce Ser-824 phosphorylation (p-) 56 36
of SUMO-1-KAP1 fusion protein

Figure 3.11 SENP1 activates p21 transcription 37
Figure 3.12 SENP1 deSUMOylates SUMO-modified KAP1 38
Figure 3.13 SENP1 induces basal KAP1 Ser-824 phosphorylation 39
Figure 3.14 Knockdown of SENP1 inhibits p21 and Gadd45α expression 40
Figure 3.15 The p53-responsive element and putative ZBRK1-binding 41
elements at the promoters of Bax, Puma, and Noxa genes

viii
Figure 3.16 sh-KAP1 de-represses the ZBRK1-mediated inhibition of p21, 42
Gadd45α, Bax, Puma, and Noxa expression

Figure 3.17 SUMO-1-KAP1 represses Dox-induced p21, Gadd45α, Bax, 44
Puma, and Noxa expression in MCF-7 cells

Figure 4.1 Knockdown of KAP1 resulted in a slower proliferation rate of 52
MCF-7/TR/sh-KAP1 cells

Figure 4.2 KAP1 is essential for genotoxicity-induced cell cycle arrest 53
Figure 4.3 The effect of KAP1 depletion on cell cycle progression 54
Figure 4.4 KAP1 is essential for genotoxicity-induced cell apoptosis 55
Figure 4.5 Knocking down of KAP1 affected mRNA level of genes related 56
with cell apoptosis

Figure 4.6 Knocking down of KAP1 affected genotoxicity-induced cell 56
apoptosis level

Figure 4.7 Physical interaction of endogenous PP1c with KAP1 58
Figure 4.8 Overexpression PP1cB fails to force the interaction with KAP1 59
Figure 4.9 Physical interaction of PP1c with KAP1 mutants 60
Figure 4.10 KAP1(I368G), not KAP1(K366G), complements KAP1 62
knockdown and efficiently suppresses basal p21-Luc activity
in KAP1-depleted MCF-7/TR/sh-KAP1 cells

Figure 4.11 The effect of PP1cA, PP1cB and PP1cC on endogenous KAP1 63
phosphorylation level

Figure 4.12 PP1cA dephosphorylates DSB-induced KAP1 Ser-824 64
phosphorylation

Figure 4.13 Phosphorylation status of KAP1(I368G) and KAP1(K366G) 65

Figure 4.14 PP1/I-2 exclusively complexes with PP1cA among the three 66
catalytic subunits examined

Figure 4.15 PP1/I-2 might sequester PP1cA away from KAP1, rendering 67
KAP1 Ser-824 hyper-phosphorylation while MG132 and E64d
decrease KAP1 phosphorylation level
ix
Figure 4.16 MG132 and E64d block PP1cA degradation 68
Figure 4.17 Knocking down PP1cA/cB in MCF-7 cells regulates KAP1 69
SUMOylation status

Figure 4.18 Diminish of PP1cA in MCF-7 cells allows PP1cB bind to KAP1 70
more rigidly

Figure 4.19 PP1cA and PP1cB differentially regulate KAP1 mutants 71
SUMOylation

Figure 4.20 PP1cB, but not PP1cA, stimulates SUMOylation of endogenous 72
RanGAP1

Figure 4.21 MCF-7/sh-PP1cA and MCF-7/sh-PP1cB cells show relatively 73
slower cell growth rates compared to MCF-7/sh-control cells

Figure 4.22 PP1cA governs KAP1-mediated regulation of cell cycle 74
Figure 4.23 PP1cA governs KAP1-mediated regulation of gene expression 75
Figure 4.24 PP1cA and PP1cB differentially bind at the p21 proximal promoter 76
Figure 4.25 PP1cA and PP1cB do not bind at the p21 distal promoter 77
Figure 4.26 PP1cA and PP1cB differentially regulate histone H3 K9/K14 78
acetylation

and H3-K9 dimethylation at the p21 proximal promoter

Figure 4.27 PP1cA and PP1cB do not affect histone H3 K9/K14 acetylation 79
and H3-K9 dimethylation at the p21 distal promoter

Figure 4.28 Model depicting the regulation of KAP1 SUMOylation and 84
transcriptional repression

Figure 5.1 Phosphorylation of KAP1 affects its SUMOylation affinity 87
kinetically

Figure 5.2 Overexpression of SUMO-1 accelerated the degradation of 88
KAP1(S824D)

Figure 5.3 Knock down of RNF4 partially reversed degradation of 89
SUMOylated KAP1

Figure 5.4 K554R and K676R mutations blocked SUMO induced 90
KAP1(S824D) degradation (pic.1)
x

Figure 5.5 K554R and K676R mutations blocked SUMO-1 induced 91
KAP1(S824D) degradation (pic.2)

Figure 5.6 K554R and K676R mutations blocked SUMO-1 induced 92
KAP1(S824D) degradation (pic.3)

Figure 5.7 RNF4 plays a central role on SUMO-2 induced KAP1 degradation 94
Figure 5.8 Ub stabilized KAP1(wt) more efficiently than KAP1(S824D) 95
and knock down of RNF4 stabilized KAP1(wt) in the absence
or presence of Ub

Figure 5.9 Knock down of RNF4 stabilized KAP1(wt) in the presence of 97
SUMO-2 and Ub

Figure 5.10 SUMO-2 greatly induced KAP1 ubiquitination 99
Figure 5.11 KAP1 is ubiquitinated on K554 and 676, which related with 100
SUMO-dependent degradation

Figure 5.12 KAP1 K554 ubiquitination is required for its SUMO-dependent 101
phosphorylation induced degradation

Figure 6.1 Model depicting the cross talk between KAP1 phosphorylation, 107
SUMOylation and ubiquitination

xi
LIST OF ABBREVIATIONS

Ab antibody
ATM ataxia telangiectasia mutated
ChIP chromatin immunoprecipitation
Co-IP co-immunoprecipitation
DDR DNA damage responses
Dox Doxorubicin
DSB DNA double-strand break
EGFP enhanced green fluorescent protein
FACS fluorescence activated cell sorting
FBS fetal bovine serum
HDAC1 Histone deacetylase 1
HIF-1 hypoxia-inducible factor-1
HP1 heterochromatin protein 1
KRAB-ZFP Krüppel-associated box zinc finger proteins
KAP1 KRAB domain-associated protein 1
Luc luciferase
MYPT1 myosin phosphatase targeting subunit 1
PAGE polyacrylamide gel electrophoresis
PCR polymerase chain reaction
PML Promyelocytic leukemia
Q-PCR quantitative PCR
xii
RNF4 RING finger protein 4
RT-PCR reverse transcriptase PCR
siRNA small interfering RNA
shRNA small hairpin RNA
Snurf small nuclear RING finger protein
Ub ubiquitin
WT wild type
xiii
ABSTRACT

As a multifunctional protein, KRAB domain-associated protein 1 (KAP1) is
reportedly subjected to multiple protein post-translational modifications, including
phosphorylation and SUMOylation. However, gaps exist in our knowledge of how
KAP1 phosphorylation crosstalks with KAP1 SUMOylation, how those post-translational
modifications are regulated and what the biological consequence is.
In the first part of study, we found that doxorubicin (Dox)-treatment induces
KAP1 phosphorylation at Ser-824 in an ataxia telangiectasia mutated (ATM)-dependent
manner, correlating with the transcriptional de-repression of p21
WAF1/CIP1
and Gadd45α.
A S824A substitution of KAP1, which ablates the ATM-induced phosphorylation, results
in an increase of KAP1 SUMOylation and repression of p21 transcription in Dox-treated
cells. By contrast, a S824D mutation of KAP1, which mimics constitutive
phosphorylation of KAP1, leads to a decrease of KAP1 SUMOylation and stimulation of
p21 transcription before the exposure of Dox. We further provided evidence that SENP1
deSUMOylase is involved in activating basal, but not Dox-induced, KAP1 Ser-824
phosphorylation, rendering a stimulation of p21
WAF1/CIP1
and Gadd45α transcription by
attenuating KAP1 basal SUMOylation. Moreover, KAP1 and differential SUMOylation
of KAP1 were also demonstrated to fine-tune the transcription of three additional KAP1-
targeted genes, including Bax, Puma, and Noxa. Taken together, our results suggest a
novel role for ATM that selectively stimulates KAP1 Ser-824 phosphorylation to repress
its SUMOylation, leading to the de-repression of expression of a subset of genes involved
in promoting cell cycle control and apoptosis in response to genotoxic stresses.
xiv
In the second part of study, we found that while protein phosphatase PP1cA
directly interacts with KAP1, myosin phosphatase targeting subunit 1 bridges the PP1cB-
KAP1 interaction. PP1cA or PP1cB overexpression/knockdown leads to a differential
inverse co-regulation of basal and DNA double-strand break (DSB)-induced KAP1 Ser-
824-phosphorylation versus SUMOylation. ChIP-ReIP experiments revealed PP1cA and
PP1cB were recruited to KAP1, with different kinetics pre and post DSB induction,
providing a mechanistic basis for the KAP1 dephosphorylation-SUMOylation switch.
Interestingly, PP1cB stimulated KAP1 SUMOylation by both Ser-824-
dephosphorylation-dependent and -independent mechanisms. We posit a novel
mechanism whereby PP1 confers KAP1 Ser-824-dephosphorylation and assures KAP1
SUMOylation to counter the ATM effect, regulating transcription of KAP1-targeted
genes in unstressed and stressed cells.
In the third part of study, we observed a decrease in the steady-state level of
KAP1 upon overexpression of SUMO-2 under Dox-treatment. By using KAP1(S824D)
to mimic Dox-induced, ATM-mediated KAP1 Ser-824 phosphorylation, K554R mutation
blocked SUMO-promoted degradation. By utilizing co-IP assay, we found that KAP1 is
ubiquitinated in vivo and that SUMO-2 greatly enhances KAP1 ubiquitination. We then
explored the possibility that RNF4 (really interesting new gene) mediates SUMO-
dependent ubiquitination and degradation of KAP1. Our results suggested that RNF4
serves as the E3 ligase of KAP1 SUMO-dependent ubiquitination and degradation.
These findings may explain how KAP1 phosphorylation antagonizes its SUMOylation.
Our results presented in this chapter suggested that, KAP1 Ser-824 phosphorylation leads
to the degradation of already SUMOylated KAP1.
1
CHAPTER 1: INTRODUCTION

1.1 Rationale
Transcriptional cofactor KRAB domain-associated protein

1 (KAP1) was first
identified

as a transcriptional co-repressor, which contains an N-terminal RING-B boxes-
coiled-coil

domain, serving as a protein-protein interaction motif

for the KRAB (Krüppel-
associated box) domain. KRAB domain-containing

zinc finger (KZF) proteins,
characteristic of their N-terminal

KRAB domain and a number of zinc fingers at their C
terminus,

constitute the largest single protein family of transcription

factors known by far
(20, 42, 60, 99). Although the majority of KZF proteins

function to repress RNA
polymerase II-mediated transcription,

their respective target genes and underlying
transcriptional

regulation mechanism(s) remain largely elusive. However, these KZF
proteins cannot repress transcription without interacting with a co-repressor. Recently,
zinc

finger and BRCA1-interacting protein with KRAB domain 1 (ZBRK1),

a KZF
protein, was found to repress the

transcription of DNA damage-responsive gene Gadd45 α
through

a 15-bp ZBRK1-binding element located at the third intron of Gadd45α (116).
Several DNA damage-responsive genes, such as Gadd153, p21
WAF1/CIP1
and Bax, also
possess this consensus ZBRK1-binding element,

implying its role and possibly its partner
KAP1’s role as well in

regulating the transcription of these DNA damage responsive

genes. By performing a complete genome search of KAP1 targets, O’Geen and his
colleagues have identified about 7,000 KAP1 binding sites in the whole genome. They
also found a large percentage of KAP1 target genes (~25%) are subjected to H3-K9 tri-
2
methylation, a hallmark of transcriptional repression (68). It is still unclear how KAP1
regulates that many genes. Previous studies from our laboratory and others have revealed
that KAP1 is subjected to multiple post-translational modifications, including
phosphorylation and SUMOylation (36, 47, 106). However, there lacks reports regarding
how KAP1 phosphorylation crosstalks with KAP1 SUMOylation, how those post-
translational modifications are regulated and what the biological consequence is.
Therefore, to understand how KAP1’s post-translational modifications are regulated may
greatly improve our understanding of DNA damage-response and further benefit cancer
research and treatments.

1.2 Hypothesis
KAP1 is post-translationally modified by phosphorylation, SUMOylation and
ubiquitination. Through the crosstalk among these post-translational modifications,
KAP1 tightly regulates the expression of its downstream DNA damage-responsive genes,
such as Gadd45α, p21
WAF1/CIP1
, Bax, Puma and Noxa, therefore in turn regulating the fate
of cells during the exposure to genotoxic stresses.

1.3 Background
1.3.1 SUMOylation and its cellular function
Covalent attachment of ubiquitin (Ub) or small ubiquitin-like

modifier (SUMO) to
proteins plays a major role in regulating

cellular function (21). Although ubiquitination

generally promotes protein degradation, SUMOylation regulates

a variety of cellular
processes, including nuclear transport,

genome integrity, signal transduction and
3
transcriptional regulation

(62, 81). Briefly, SUMO is activated in an ATP-dependent

manner by an E1 activating enzyme, transferred to the E2 conjugating

enzyme, and
subsequently attached covalently to the lysine acceptor

site, within a particular sequence
of ΨKX(D/E) (where Ψ represents

hydrophobic amino acid) of SUMO-target proteins by
a distinct

E3 ligase. Similar to phosphorylation, SUMOylation is a reversible

process
catalyzed by deSUMOylation enzymes. The list of known

SUMO targets has grown
substantially in recent years, and, remarkably,

over half of the presently identified SUMO
targets are transcriptional

factors or co-regulators. In many cases, SUMOylation leads to

a modified protein-protein interaction of target protein(s),

thus altering the biological
consequences (82, 111). Recently,

a SUMO-interacting motif (SIM) that binds non-
covalently to the SUMO moieties of SUMOylated

proteins was reported (86), and SIM

is
found to exist in nearly all proteins known to be involved

in SUMO-dependent processes
(85).

SUMO proteins, SUMO-1 through -3, form an Ub-like fold in the

central region,
containing α-helix packed in β-sheets (2, 34). However, its N-terminal extension, which
is not found in

ubiquitin, is highly flexible and does not adopt any defined

three-
dimensional structure in solution. In addition, the amino

acid residues at the protein
surfaces of SUMO differ from those

of ubiquitin, resulting in completely different surface
charge

distribution. Together, these two unique features of SUMO lead

to the notion that
SUMO functions as a special module that is

covalently linked to target proteins and/or as
a moiety to mediate

non-covalent SUMO-dependent interaction with other proteins,

hence
modulating cellular function (37, 62, 90). An advantage

of such a combined covalent
modification and non-covalent interaction

is to transiently and rapidly modulate protein-
4
protein

interaction and its subsequent signaling in response to extracellular

stimulation
(33). Importantly, SUMOylation has emerged as an

imperative regulatory scheme to
modify diverse cellular functions,

including intracellular protein compartmentalization,
DNA repair,

cell-cycle regulation, transcriptional control, and hormone

response (38, 81).

1.3.2 KRAB domain-containing

zinc finger (KZF) proteins and their function
The Krüppel-associated box zinc finger proteins (KRAB-ZFP)

comprise
approximately one-third of the 799 different zinc finger

proteins, constituting the largest
single-family transcriptional

regulators in mammals (99). The Krüppel associated box
(KRAB) domain is a category of transcriptional repression domains present in
approximately 200 human zinc finger protein-based transcription factors. The KRAB
domain typically consists of about 75 amino acid residues whilst the minimal repression
module is approximately 45 amino acid residues. It is predicted to function through
protein-protein interactions via two amphipathic helices. Substitutions for the conserved
residues abolish transcriptional repression. Over 10 independently encoded KRAB
domains have been shown to be effective transcription repressors, suggesting a common
property of KRAB domain (73).
ZBRK1, one of the KRAB-ZFP members, was first identified by yeast-two-hybrid
screening using BRCA1 as bait and was later characterized by its interaction with
BRCA1 in vitro and in vivo (10). ZBRK1 encodes a 60-kDa protein with an N-terminal
KRAB domain and eight central zinc fingers. It binds to a specific sequence, namely
ZBRK1-binding element: GGGxxxCAGxxxTTT. For example, one ZBRK1-binding
element is located at the intron 3 of Gadd45 α, which is occupied by a nuclear complex
5
containing both ZBRK1 and BRCA1. ZBRK1 represses Gadd45 α transcription through
its interaction with ZBRK1-binding element in a BRCA1-dependent manner (116).

1.3.3 KRAB domain associated protein 1 (KAP1) and its function
KRAB domain-associated protein 1

(KAP1) functions as a transcriptional co-
repressor for ZBRK1, by acting as a transcription intermediary

factor to connect KRAB-
ZFPs to transcriptional repression machinery. Because KAP1 itself cannot bind DNA
directly, the specificity

of transcriptional repression is dictated by its interaction

with
ZBRK1 through protein-protein interaction. The RING finger-B

box-coiled-coil domain
of KAP1 associates with the KRAB domain

of ZBRK1, repressing the transcription of
DNA damage-responsive

gene Gadd45α (116) and p21
WAF1/CIP1
(47). KAP1 recruits and
coordinates the assembly of gene silencing machinery, containing histone deacetylase
complex NuRD and N-CoR1

and histone methyltransferase SETDB1 etc. (79, 80, 98).
KAP1 also

recruits heterochromatin protein 1 (HP1) to histones through

a binding
between PXVXL motif of KAP1 and the shadow chromodomain (CSD) on
chromodomain (CD) of HP1 (46, 87).
Emerging evidence supports the idea that post-translational

modifications,
including phosphorylation and SUMOylation, play

a pivotal role in regulating
transcriptional control in response

to different extracellular milieu. Our laboratory have
recently reported that SUMOylation

plays a major role in

mediating KAP1 transcriptional
co-repressor function and attenuating

Dox-induced p21
WAF1/CIP1
transcriptional activation

in breast cancer MCF-7 cells (47). There are at least three Lys

residues, 554, 779, and
804 that serve as the major SUMOylation

targets for KAP1, and the overall
6
SUMOylation capacity of KAP1

is transiently decreased upon Dox exposure. Moreover,
the differential

SUMOylation status of KAP1 functions to modulate p21 transcription

by
switching the histone H3-K9 methylation and H3-K9/-K14 acetylation statuses without
affecting the occupancy

of the p21 proximal promoter by KAP1/ZBRK1 in MCF-7 cells.
The

KAP1 SUMOylation-mimetic, SUMO-1-KAP1, desensitizes MCF-7 cells

to Dox-
induced cell death. Collectively, the KAP1 SUMOylation/deSUMOylation

switch
suppresses KAP1 transcriptional co-repressor function

by downregulating histone H3-K9
methylation and

fostering H3-K9/-K14 acetylation. However,

it remains unclear what
signal regulates the KAP1 SUMOylation/deSUMOylation

switch in response to Dox-
induced DNA damage. (Fig. 1.1)

www.hsc.wvu.edu/mbrcc/fs/ivanovLab/
Figure 1.1. Functional domains of KAP1. KAP1 binds to KRAB domain of KZF proteins through it’s
N-terminal RBCC domain which further binds to DNA. KAP1 also

recruits heterochromatin protein 1
(HP1) to histones through

a PXVXL motif and binds to NuRD complex and SETDB1 through
SUMOylation on its PHD and Bromo domains
7
Very recently, O'Geen et al. (68) have

identified 7000 KAP1 target sites by
using chromatin immunoprecipitation

assays coupled with a human 5-kilobase promoter
array or a complete

genomic tiling array (Fig. 1.2). In light of the recent evidence for the

multifunction of KAP1 (46, 68, 69, 79, 80, 87, 98, 104), it is tempting to speculate

that
the identified Dox-stimulated KAP1 deSUMOylation (47) could

have a profound effect
on the regulation of global gene expression

in response to genotoxins. Moreover, KAP1
is demonstrated to

be phosphorylated at Ser-824 by the phosphatidylinositol 3-kinase

protein-like kinase (PIKK) family member of kinases during DNA damages (106, 118).
Despite extensive literature investigating

KAP1 function, little is known regarding the
coordinated relieving

of KAP1-mediated repression on p21, Gadd45α and other ZBRK1-
binding

element-containing genes by its multiple post-translational

modifications, such as
SUMOylation, phosphorylation and ubiquitination, in response

to DNA damaging insults.

PLoS Genet. 2007 June; 3(6)
Figure 1.2. Functional annotation of genome-wide KAP1 targets. Left. Chromosomal locations of
KAP1 targets. Right. A large potion of KAP1 targets is subjected to H3K9K27 tri-methylation and involve
in many cellular events.
8

1.3.4 Dox-treatment downregulates KAP1 SUMOylation that relieves its
transcription repression on p21
WAF1/CIP1
in breast cancer MCF-7 cells
Doxorubicin (Dox) is a commonly used cancer chemotherapy drug (trade name
Adriamycin) in the treatment of many types of cancers, including leukemia, breast
carcinoma, soft tissue sarcoma, multiple myeloma and many other cancers. Dox
intercalates double strands and covalently binds to topoisomerase II, leading to DNA
double-strand breaks (DSBs) (19, 59).
Our laboratory

has previously shown that KAP1 is subjected to SUMO-1-
mediated modification

and the KAP1 SUMOylation status correlates with its
transcriptional

repressive ability through ZBRK1-binding element. Through a
combination of proteomic screening and site-directed

mutagenesis approaches, our
laboratory have identified Lys-554, -779,

and -804 as the major SUMOylation sites in
KAP1 (47). We found that KAP1 SUMOylation modulates both p21-Luc reporter

activation and the relative extents of H3-K9 and H3-K14 acetylation

versus H3-K9
methylation at the p21 promoter in Dox-treated breast cancer MCF-7 cells. Moreover,
the KAP1 SUMOylation level was transiently

decreased upon Dox-exposure, and
transfection with the KAP1

SUMOylation mimetic, SUMO-1-KAP1, desensitizes breast
cancer

MCF-7 cells to Dox-elicited cell death and greatly enhances

the cell viability
against Dox-treatment. However, the occupancy of ZBRK1-binding element located at
the p21 proximal promoter by ZBRK1/KAP1

is independent of KAP1 SUMOylation.
The SUMOylation-dependent

stimulation of KAP1 function is achieved by enhancing the
dimethylation

of H3-K9 and by attenuating the acetylation of H3-K9 and H3-K14

at the
9
p21 proximal promoter. Hence, SUMOylation of KAP1

represses p21 transcription via a
chromatin-silencing process

without affecting interaction between ZBRK1/KAP1 and

DNA, thus providing a novel mechanistic basis for the understanding

of Dox-induced de-
repression of p21 transcription. Taken together,

our previous results suggest that
SUMOylation plays a major role in regulating

the ability of KAP1/ZBRK1 by modifying
H3-K9 dimethylation versus H3-K9/K14 acetylation profile at the p21 proximal promoter,
and Dox-induced decrease in KAP1 SUMOylation

is essential for Dox to induce p21
expression and subsequent

cell growth inhibition in MCF-7 cells.

1.3.5 Protein serine/threonine phosphatases 1 (PP1) and its function
Protein serine/threonine phosphatases, including protein phosphatase 1 (PP1),
PP2A, PP2B, PP4, PP5, PP6, and PP7, function by reversing the phosphorylation of key
structural and regulatory proteins (8, 15). The PP1 catalytic subunit exists in different
isoforms (PP1cA, PP1cB and PP1cC) with distinct subcellular localization patterns (1, 48,
96). PP1 regulates a large number of cellular activities, including neurotransmission,
protein synthesis, muscle contraction, DNA damage response and cell cycle progression
(8, 15, 91). One critical question is how PP1 executes such pleiotropic effects at the right
time and in the right place. Recent studies have emphasized that PP1cs are targeted to
specific substrates by an interaction with one of many regulatory subunits that also
interact with substrate. The consensus primary PP1-docking motif, [KR][X]
0-
1
[VI]{P}[FW], is derived from the majority of PP1-interacting proteins that are
associated with PP1 by binding to a hydrophobic groove on the surface of the PP1
catalytic subunit (58). Mutation or deletion of this motif often reduces the binding
10
between PP1 catalytic subunit(s) and its interacting proteins. Several substrates of PP1
also contain this consensus PP1-docking motif (8, 29).

1.3.6 RING finger proteins and their function as an E3 ligase
RING (really interesting new gene) finger protein family is the largest subset of
ubiquitin E3 ligases. The RING finger is a unique zinc-binding domain with consensus
sequence defined as CX
2
CX
(9-39)
CX
(1-3)
HX
(2-3)
C/HX
2
CX
(4-48)
CX
2
C, in which C and H are
zinc-binding Cys and His residues (35). This family of ubiquitin E3 ligases is reported to
participate in many signaling pathways, including Mdm2-induced p53 degradation (53).
It is still unknown whether there exists a SUMO E3 ligase with typical RING finger.
However, several SP-RING SUMO E3 ligases were found to harbor an atypical RING
finger with missing zinc-binding residues (35).

1.3.7 RNF4 as a SUMO-targeted ubiquitin ligase
RNF4 (RING finger protein 4, also known as Snurf (small nuclear RING finger
protein), was first found as a transcriptional co-regulator which interacts with nuclear
receptor family members such as androgen receptor (75). Recent studies revealed RNF4
co-localized with PML nuclear bodies and response to SUMO induced PML degradation
(26, 45, 92). RNF4 contains four tandem SUMO-interacting motifs (SIMs) at its N-
terminal region and RING finger domain at its C-terminus. In addition, RNF4 shares
significant amino acid sequence similarity with Rfp1/Rfp2 in fission yeast, S1x5 in
budding yeast and MIP1 in Dictyostelium, and RNF4 functionally compensates the loss
of both Rfp1 and Rfp2 (74, 89). The Slx5-Slx8 complex is reported to mediate
11
ubiquitination-dependent degradation of proteins involved in homologous recombination
(64, 77). Knocking down of Slx5 or Slx8 resulted in an accumulation of SUMOylated
proteins in budding yeast, suggesting that one of Slx5/Slx8’s functions is to degrade the
SUMOylated proteins (27). Deletion of Rfp1 and Rfp2 together also resulted in an
accumulation of SUMOylated proteins in fission yeast. The presence of both SIM and
RING finger in RNF4 suggests that SUMO can be recognized by RNF4 as a signal for
ubiquitination.
12
CHAPTER 2: MATERIALS AND METHODS

2.1 Cloning and construction of expression plasmids
Human SENP1 cDNA was amplified from testis

cDNA library (Clontech) and
cloned into EcoRI and EcoRV sites

of pCMV-HA vector, yielding hemagglutinin-SENP1.
Hemagglutinin

(HA)-SENP1C603S mutant was constructed from HA-SENP1 plasmid

by
QuikChange site-directed mutagenesis kit (Stratagene). Oligonucleotides

corresponding
to SENP1 nucleotide sequence
413
ACCATCACTGCCATGTATC
431
and
520
ACTCAGAGGCGACATGTTA
538
were inserted into pSuper vector

(Oligoengine) to
generate sh-SENP1-1 and sh-SENP1–2, respectively. Protein phosphatase inhibitor-2 (I-
2) was cloned into pCMV-Tag3A (Stratagene) by standard RT-PCR using cDNA reverse
transcribed from human total RNA, and amplified with I-2-specific primer pairs, 5’-
GGATCCAATGGCGGCCTCGACGGC-3’ (forward) and 5’-
GAATTCAACAAATCTCGTCTATGAACTTCG-3’ (reverse), encompassing BamHI
and EcoRI; respectively, to facilitate cloning. Human ring-finger protein 4 (RNF4) was
cloned into pCMV-Tag3B by standard RT-PCR using cDNA reverse transcribed from
human total RNA, and amplified with RNF4-specific primer pairs, 5’-
GACCGTGGATCCATGAGTACAAGAAAGCGT-3’ (forward) and 5’-
CCTGGAGAATTCTCATATATAAATGGGGTG-3’ (reverse), encompassing BamHI
and EcoRI; respectively, to facilitate cloning. The identity of a positive clone was further
verified by DNA sequencing analysis.

13
2.2 Site-directed mutagenesis of KAP1
FLAG-KAP1(S824A), FLAG-KAP1(S824D), FLAG-KAP1(S440A), FLAG-
KAP1(S440D), FLAG-KAP1(S501A), FLAG-KAP1(S501D), FLAG-KAP1(L306P),
FLAG-KAP1(K366G), FLAG-KAP1(I368G), and SUMO-1-KAP1(L306P) mutants

were
engineered using FLAG-KAP1 and SUMO-1-KAP1 as a template by site-directed
mutagenesis kit (Clontech). The mutagenesis oligonucleotides used were as follows: for
KAP1(S824A), 5’-GGTGCTGGCCTGAGTGCCCAGGAGCTGTCTGG-3’, for
KAP1(S824D), 5’-GGTGCTGGCCTGAGTGACCAGGAGCTGTCTGG-3’, for
KAP1(S440A), 5’-GGGCTCTGGCAGCGCCCAGCCCATGGAG-3’, for KAP1(S440D),
5’-GGGCTCTGGCAGCGACCAGCCCATGGAG-3’, for KAP1(S501A), 5’-
CCTCACAGCTGACGCCCAGCCACCCGTC-3’, for KAP1(S501D), 5’-
CCTCACAGCTGACGACCAGCCACCCGTC-3’, for KAP1(L306P), 5’-
CAGATCATGAAGGAGCCGAATAAGCGGGGCC-3’, for KAP1(K366G), 5’-
CTTTTGCTTTCTAAGGGGTTGATCTACTTCCAG-3’, for KAP1(I368G), 5’-
CTTTCTAAGAAGTTGGGCTACTTCCAGCTGCAC-3’.

2.3 Cell cultures
HEK293 cells were maintained in Dulbecco's

modified Eagle's medium (DMEM)
supplemented with 10% fetal bovine serum,

50 units/ml penicillin, and 50 µg/ml
streptomycin, and

MCF-7 cells were cultured in the same medium with an addition

of
0.01 mg/ml recombinant human insulin in a humidified atmosphere

of 37 °C and 5% CO
2
.
MCF-7/TR/sh-KAP1 was cultured in MCF-7 medium with Blasticidin (10 µg/ml) and
14
Zeocin (100 µg/ml). MCF-7/sh-KAP1, MCF-7/sh-PP1cA, MCF-7/sh-PP1cB, MCF-7/sh-
PP1-I-2 and MCF-7/sh-control were cultured in MCF-7 medium with Puromycin (2
µg/ml). The stable KAP1 knockdown cell line

K928-cI10 was grown as above with the
addition of 10 µg/ml

puromycin (87). Both ATM-deficient pEBS7 and ATM-proficient
YZ5

cells (117) were maintained in Eagle's Dulbecco's modified Eagle's

medium
supplemented with 15% fetal bovine serum, antibiotics,

2 nM glutamine, 100 µg/ml
hygromycin, and 1.25 units/ml

nystatin in a humidified atmosphere of 37 °C and 5% CO
2
.

GK41 cells, U2OS (human osteosarcoma) stably transfected with

a doxycycline-inducible
ATR-kd (kinase-dead) construct (66),

were maintained in Dulbecco's modified Eagle's
medium supplemented

with 10% fetal bovine serum plus 50 units/ml penicillin, 50

µg/ml
streptomycin, 50 µg/ml hygromycin, and 200 µg/ml Geneticin.

2.4 Western Analysis
Whole cell lysates were prepared by lysing

cells with radioimmune precipitation
assay buffer (RIPA buffer) (25 mM Tris, 125 mM NaCl, 1% Nonidet-P-40, 0.5% sodium
deoxycholate, 0.1% sodium dodecylsulfate (SDS), 0.004% sodium azide, pH 8.0, 10 mM
N-ethylmaleimide (NEM), 1 mM NaF and 2 mM Na
3
VO
4
and a Complete Protease
Inhibitor Cocktail (Roche)), and subjected to SDS-PAGE followed

by immunoblotting
with antibodies for FLAG-KAP1 (M2, Sigma-Aldrich), HA (COVANCE), tubulin (D-10)
and EGFP (Santa Cruz Biotechnologies), and phospho-Ser-824-KAP1, PP1cA, PP1cB,
PP1cC (BETHYL, TX). Blots were visualized with an enhanced chemiluminescence

detection kit (ECL-Plus, Amersham Biosciences) and a Versadoc

5000 Imaging System
15
(Bio-Rad). Densitometric data were obtained

and analyzed with Quantity One Software
(Bio-Rad). Results of

Western analyses shown in this report are representative of

two to
four independent experiments.

2.5 Luciferase Assays
The p21-Luc reporter construct was made

by subcloning a 2.3-kilobase p21
promoter into pGL3-Basic as

previously described (17). The Gadd45α-Luc reporter was
a gift

from Dr. Wen-Hwa Lee at the University of California, Irvine.

The luciferase
reporters were co-transfected with a firefly

control reporter, pRL-TK, for the purpose of
normalization. Luciferase assays were carried out with DualGlo Luciferase Assay Kit
(Promega). The desired luciferase activity was calculated by normalization against the
co-transfected firefly luciferase activity.

2.6 Production of lentivirus in HEK293-FT cells
Lentiviral vectors pLKO.1-shRNA (eg. sh-KAP1 and sh-RNF4), p ∆8.7, and
pVSV-G were constructed and used for lentiviral production in HEK 293FT cells as
previously described (67). HEK 293FT cells (60% confluence)

in 175-mm flasks were
cotransfected by Lipofectamin 2000

with 21 µg of pLKO.1-sh-KAP1 (obtained from
RNAi consortium at Academia Sinica), 14 µg of p 8.7 (for viral packaging),

and 7 µg of
pVSV-G (for VSV-G pseudotyping). Chloroquine

was added to a final concentration of
25 µmol/L, and cells

were incubated in a 5% CO
2
incubator at 37°C for 16 hours.

Chloroquine-containing medium was replaced with culture medium

containing 10
16
mmol/L sodium butyrate, and cells were incubated

for at least another 8 hours before the
addition of fresh culture

medium and then incubated for an additional 16 hours. Viral

supernatant was collected, centrifuged at 2500 rpm for 10 minutes,

and stored
immediately at 4°C. Supernatants were pooled

and concentrated using a Macrosep
Centrifuge Device with a 300-kd

molecular mass cut-off (Millipore, Billerica, MA) and a
0.45-µm

syringe filter. Aliquots of concentrated virus were stored at

–80°C.

2.7 Lentivirual transduction
For lentiviral infection, HEK293 or MCF-7 cells were plated 1 day before

infection and cultured overnight to reach ~70% confluence. The

culture medium was then
aspirated, and fresh medium containing

concentrated lentiviruses containing the empty
vector or short hairpin RNA (shRNA) against human KAP1, PP1cA, PP1cB and random
sequence (as a control) in lentivector pLKO.1 was added and incubated for 24 h in the
presence

of 8 µg/mL polybrene. These transduced cells were selected and maintained in
HEK293 or MCF-7 medium with Puromycin (2 µg/ml) and pools of stable cells were
used in studies reported herein.

2.8 Construction of inducible sh-KAP1 cell line MCF-7/TR/sh-KAP1
Tet-inducible sh-KAP1 against its 3’-UTR was constructed according to van de
Wetering et al. (100). The oligonucleotides used were as follows: for KAP1, 5’-
GATCCCCCAGCCAACCAGGGGAAATC-3’ and 5’-
AGCTTTTCCAAAAACCACCCAACCAG-3’; for the control, 5’-
17
GATCCCTCCTCTTTCTTATCCTCGTAT-3’ and 5’-
AGCTTTTCCAAAAATCCTCTTTCTTAT-3’. pTER
+
was cut with BglII and HindIII
and the pTER backbone was purified from the gel. Sense and anti-sense oligos (100
pmol of each) were annealed in 50 µl annealing buffer (10 mM KAc, 3 mM Hepes-KOH
(pH 7.4), and 0.2 mM MgAc). This oligos mixture (1 µl) and 100 ng purified pTER
+

backbone were used per ligation. Clones expressing pTER
+
-sh-KAP1 were selected with
ampicillin resistance. Subsequently, MCF-7/TR cell clones were established from stable
integration of pCDNA
6
/TR, which express the Tet repressor. Stable MCF-7/TR/sh-
KAP1 cells were established by transfecting MCF-7/TR cells with pTER
+
-sh-KAP1
followed by selection with Blasticidin (5 µg/ml) and Zeocin (100 µg/ml). To test the
effect of sh-KAP1 knockdown, MCF-7/TR/sh-KAP1 cells were co-transfected with p21-
Luc and pRL-TK. At 24 h post-transfection, cells were treated with doxycycline (1 or 2
µg/ml) for 4 h to 48 h to induce the expression of their respective shRNA. Luciferase
activity was measured and normalized against pRL-TK; pCDNA
4
-TO-Luc (Invitrogen)
was used as positive control for doxycycline induction.

2.9 In vivo SUMOylation assay
In vivo SUMOylation assays were carried out with co-transfection of FLAG-
KAP1 or its mutants and EGFP-SUMO-1 in a 1:4 ratio, and HA-PP1cA, or PP1cB into
HEK293 cells with Lipofactamin 2000 (Invitrogen). SUMOylated KAP1 was detected
by immunoblotting of whole cell lysates against FLAG or EGFP tag.

18
2.10 Immunoprecipitation (IP) of KAP1
Transfection of FLAG-KAP1

or FLAG-KAP1 with EGFP-SUMO-1 expression
constructs into HEK293

or MCF-7 cells was performed with Lipofectamine 2000
(Invitrogen)

according to the manufacturer's manual. Whole cell lysates were

prepared by
lysing cells with lysis buffer (50 mM Tris-HCL,

pH 6.8, 100 mM NaCl, 0.5 mM MgCl
2
,
1mM EDTA, 0.2% Nonidet P-40,

1 mM dithiothreitol, 1x protease inhibitor mixture
(Roche Applied

Science), 10 mM N-ethylmaleimide (Sigma-Aldrich). For each sample,

5
µl of anti-FLAG M2 antibody was mixed with 1 mg of whole

cell lysates and incubated
on ice for 2 h. Then Protein A/G

PLUS-agarose (Santa Cruz Biotechnology, CA) was
added, and the

sample was rotated at 4 °C overnight. The mixture was then

washed with
1 ml of 1x phosphate-buffered saline three times.

Immunoprecipitates were then eluted in
40 µl of 2x SDS

sample buffer, and half of the elution was subjected to immunoblotting

analyses.

2.11 Co-immunoprecipitation (Co-IP) assay
Whole cell lysates were prepared by lysing cells as described above. Anti-KAP1,
PP1cA, PP1cB, or PP1cC antibody (1 µl) was mixed with 1 mg of whole cell lysate and
samples were rotated (4°C for 2 h). Protein A/G PLUS-Agarose (Santa Cruz Biotech,
CA) was then added, and samples were rotated (4°C overnight), washed with 1 ml of 1 x
PBS three times and immunoprecipitates eluted in 40 µl of 2 x SDS sample buffer; the
elutes were subjected to immunoblotting analyses with appropriate antibodies.
Alternatively, transfection of FLAG-KAP1 or FLAG-KAP1 mutants with HA-PP1cA,
19
HA-PP1cB or HA-PP2cA expression construct into HEK293 or MCF-7 cells was
performed with Lipofactamin 2000 (Invitrogen) and followed by the above procedure
except using the antibody against the tag instead.

2.12 Total RNA extraction, reverse transcription, and real-time PCR
Total RNA from Dox-treated and control MCF-7 cells was extracted with TRIzol
reagent (Invitrogen) then treated with RNAase-free DNAase (Invitrogen) and extracted
again with phenol-chloroform, followed by ethanol precipitation. Reverse transcription
and quantitative PCR of p21, Bax, Puma and Noxa mRNA were performed with iTaq
SYBR Green Supermix (BioRad), a fraction of each total RNA sample, and specific pairs
of gene-specific primers (Table 1). PCR amplification and fluorescence detection were
done with MyIQ real-time PCR detection system, and threshold cycles determined by
iCycler program (default setting). Fold inductions were determined using the ∆∆Ct
method against 18S rRNA.

2.13 Chromatin Immunoprecipitation-Re-Immunoprecipitation Assay
(ChIP-ReIP)
MCF-7 cells were cross-linked

with 1% formaldehyde in growth medium (10
min). Cross-linking

was terminated by the addition of glycine to a final concentration

of
125 mM and incubation (10 min). Cells were rinsed with cold phosphate-buffered saline

buffer, harvested, swelled in 200 µl

of SDS lysis buffer supplemented with protease
20
inhibitor

mixture (Roche Applied Science) and 1 mM PMSF per 1 million cells, and
sonicated (500-bp or less) to shear DNA. Samples were then diluted with 9 volumes of
ChIP dilution buffer before being precleared (1 h) with 40 µl of protein A
agarose/Salmon Sperm DNA. Anti-FLAG M2-agarose (60 µl) was added to the
supernatant and incubated overnight. Bound proteins were eluted with 10 mM DTT (30
µl) and elutes diluted with 50 x volumes (approximate 1.5 ml) of ChIP dilution buffer
prior to second IP. Approximate 3 - 5 µg of antibodies against HA, acetylated histone
H3-K9/K14 or dimethylated

H3-K9 or mouse normal IgG (control IgG) were incubated
(overnight, 4°C) with post-clearance supernatant; protein A agarose/Salmon Sperm DNA
was added the following day and incubated

for an additional 4 h. Washes were
sequentially performed with low

salt buffer, high salt buffer, LiCl buffer and TE buffer
twice. Immunoprecipitates were eluted in elution buffer (500 µl, 1% SDS, 0.1 M
NaHCO
3
) followed by addition of NaCl (20 µl). Cross-linking was reversed

by
incubation (overnight, 65°C), treated with protease K (Sigma) (2 h, 45°C) and the
recovered DNA was

extracted with phenol/chloroform and ethanol-precipitated.
Quantifications were performed by real-time PCR using primer pairs against -3038, -713
and -20 amplicons of endogenous p21 gene, respectively, as previously described ((47),
Table 1) using the My IQ real-time PCR detection system

and an IQ SYBR Green
Supermix (Bio-Rad). Control IgG and input

DNA values were used to normalize values
from

ChIP-ReIP samples.

21
2.14 Flow cytometric cell cycle analysis and data analysis
Cells For the DNA content analysis, harvested cells were centrifuged (1,000 x g, 5
min), washed with PBS, fixed in 70% ethanol, then treated with RNase (10 µg/ml, 30 min,
37°C), washed with PBS, and stained (30 min) with 0.5 ml of propidium iodide (PI, 69
µmol/l) or DAPI (50 µmol/l) in sodium citrate (38 µmol/l). The cell cycle phase
distribution was determined by analytic DNA flow cytometry, as described by Keyomarsi
et al. (41). The percentage of cells in each phase of the cell cycle was analyzed using
Summit, Modfit and Flowjo software.

2.15 Flow cytometric Annexin-V/FITC apoptosis assay
Annexin-V-FITC assays were performed with Annexin-V-FITC Kit (BD
Pharmingen) followed manufacture’s protocol. Briefly, Wash cells twice with cold PBS
and then resuspend cells in 1x Binding Buffer at a concentration of 1 x 10
6
cells/ml. Then,
transfer 100 µl of the solution (1 x 10
5
cells) to a 5 ml culture tube. Add 5 µl of FITC
Annexin-V (BD Pharmingen) and 5 µl DAPI (0.05 µg/ml). Gently vortex the cells and
incubate for 15 min at RT (25°C) in the dark. After that, add 400 µl of 1x Binding Buffer
to each tube. Analyze by flow cytometry within 1 hr. The percentage of Annexin-V-
FITC or DAPI positive cells was analyzed using Summit and Flowjo software.

22
2.16 Flow cytometric H3/Ser10-FITC mitosis assay
For cell cycle profile and mitotic index, cells are incubate with 50 nM taxol for 0,
6, 12, 18, 24 and 36 hours. Cells were trypsinized and wash once with PBS, then fixed in
75% ethanol on ice and leave it at 4 ºC overnight. Then the cells were pelleted at a speed
of 500 g for 4 minutes, resupend in 500 µl of 2% BSA in PBS-T and transfer to a
microtube (for controls, C1: 2nd antibody only; C2: 1st and 2nd antibody, but no PI; C3:
2nd antibody and PI, but no 1st antibody), incubate at RT for 30 minutes. The cells were
pelleted and resuspended in 150 µl of primary antibody solution (phospho-Histone H3
S10 (UPSTATE) 1:150 in PBST), incubate at 37 ºC for 45 minutes. The cells were
pelleted and washed with PBS-T three times, then resuspended in 50 µl of 2nd antibody
solution (FITC-donkey anti rabbit, 1:150 in PBS-T), incubated at 37 ºC for 45 minutes.
After that, the cells were pelleted and washed with PBS-T three times and stained 30
minutes with 1 mg/ml RNase and 8 µg/ml PI mixture. The percentage of FITC or PI
positive cells was analyzed using Summit and Flowjo software.

2.17 Real-time cell growth assay
The principle of the ACEA RT-CES technology has been described previously
(54). One thousand cells were seeded in each well of 16-well E-plate in 100 ml of culture
media. Cell index (CI) is a quantitative measure of the number of cells attached to the
sensors in the E plate. CI was measured every 30 min for a period of 96 h.

23
2.18 MTT assay.
Cells were seeded into 24-well plates to reach 35-50% confluency on the day of
the experiment. The cells were treated with taxol or vehicle for 24-48 h followed by the
addition of 0.2 ml of 0.1 mg/ml 3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyltetrazolium
bromide (MTT; Sigma, MO) in Opti-MEM (Invitrogen, CA). After 3 hr incubation at
37
o
C, the MTT solution was aspirated, and 0.2 ml of isopropanol was added to each well
to dissolve the formazan crystals. Absorbance was read immediately at 540 nm in a
scanning multiwell spectrophotometer.

2.19 Statistical analysis
The error bar represents the S.D. of the mean. Statistical analyses were performed
using one-way ANOVA, followed by posthoc comparisons based on modified Newman-
Keuls-Student procedure with p<0.05 considered significant. Where appropriate,
unpaired Student’s t-tests were also performed to determine differences between two data
groups.

24
CHAPTER 3: ROLE FOR KAP1 SERINE 824 PHOSPHORYLATION
AND SUMOYLATION/DESUMOYLATION SWITH IN
REGULATING KAP1-MEDIATED TRANSCRIPTIONAL
REPRESSION

3.1 Introduction
Emerging evidence supports the idea that post-translational

modifications,
including phosphorylation and SUMOylation, play

a pivotal role in regulating
transcriptional control in response

to different extracellular milieu. However, the
crosstalk between different regulations remains unclear, especially phosphorylation and
SUMOylation. Recent studies revealed the phosphorylation can influence the
SUMOylation of proteins either

positively or negatively (95, 101). Our laboratory have
previously reported that SUMOylation plays a major role in

mediating KAP1
transcriptional co-repressor function and attenuating

doxorubicin induced p21
WAF1/CIP1

transcriptional activation

in breast cancer MCF-7 cells (47). Collectively, the KAP1
SUMOylation/deSUMOylation

switch suppresses KAP1 transcriptional co-repressor
function

by down-regulating histone H3-K9 dimethylation and

fostering H3-K9/-K14
acetylation. In this chapter,

we explored the signal responsible for regulating KAP1
SUMOylation/deSUMOylation

switch during Dox-induced DNA damage.

A major response to DNA damage insults, such as DNA double-strand

breaks
(DSBs) by x-ray irradiation or Dox-treatment, is the activation

of the nuclear protein
kinase ataxia telangiectasia mutated

(ATM) (83, 84). Upon the

occurrence of DSBs,
25
ATM is rapidly phosphorylated at Ser-1981,

and ATM's own kinase activity subsequently
phosphorylates a

number of substrates, including H2AX, TopBP1, NBS1, and BRCA1

etc., resulting in the activation of cell cycle checkpoint control

and DNA repair
machinery (78). ATM, a Ser/Thr protein kinase, belongs to a conserved protein

family
termed nuclear phosphatidylinositol 3-kinase protein-like

kinases (PIKK) (55). Besides
ATM, ataxia telangiectasia and Rad3-related (ATR),

hSMG-1, mTOR, and the catalytic
subunit of DNA-PK are the four

other protein kinases of PIKK family identified so far.

Numerous studies have established that the biological response

to genotoxic
stresses in mammalian cells is to trigger a complex

network of transcriptional activation
by the checkpoint signaling

kinases ATM and ATR and their effector kinases Chk2 and
Chk1,

respectively (40). One of the key consequences

is cell cycle arrest and apoptosis,
mediated by the induction

of proteins involved in cell cycle control (p21
WAF1/CIP1
and

Gadd45α) and proapoptosis (Bax, Puma, and Noxa) (17, 93, 103). The balance of the
combined induction of these genes leads to

either cell cycle arrest or apoptosis, depending
on the

severity of DNA damage. Moreover, KAP1 is demonstrated to

be phosphorylated
at Ser-824 by PIKK family members following DNA damage insults (106, 118). Despite
extensive literature investigating

KAP1 function, little is known regarding the
coordinated relieving

of KAP1-mediated repression on p21, Gadd45α and other ZBRK1-
binding

element-containing genes by its multiple post-translational

modifications, such as
SUMOylation and phosphorylation, in response

to DNA damaging stimuli. We were
intrigued by the possibility

that ATM functions upstream of KAP1 SUMO-1
conjugation/deconjugation

in response to DNA damage.

26
3.2 Results
3.2.1 Differential Activation of ATM and ATR in Response to Dox- and

UV-
treatment
Our laboratory have previously demonstrated that the transcription

of p21
WAF1/CIP1

is distinctly regulated by KAP1 SUMOylation

status; SUMOylation-mimetic KAP1
(SUMO-1-KAP1, Fig. 3.1, left

panel) enhances transcriptional repression by increasing
the

dimethylation of histone H3-K9 and decreasing the

acetylation of H3-K9/-K14,
whereas SUMOylation-defective

KAP1 (KAP1(3K/R), Fig. 3.1, left panel) relieves
transcriptional

repression in an opposite manner (47). Here, we find that Dox-treatment

also activated the transcription of the DNA damage response

gene Gadd45α (growth
arrest and DNA damage clone 45) in a way

similar to that of p21, whereas transfected
KAP1 repressed the

Dox-induced Gadd45 α transcription in MCF-7 cells (Fig. 3.1, right

panel, second lane 2 versus first lane). Consistent with our previous

report (47),
SUMOylation-mimetic SUMO-1-KAP1 abolished the ability

of Dox to induce Gadd45α
expression (Fig. 3.1, right panel, third

column). Notably, a L306P mutation of SUMO-1-
KAP1 (SUMO-1-KAP1(L306P);

Fig. 3.1, left panel), which disrupts the interaction
between

coil-coiled domain of SUMO-1-KAP1 and KRAB domain with ZBRK1, almost
completely relieved the repressive effect by SUMO-1-KAP1

(Fig. 3.1, right panel,
second lane). Our results support the

notion that SUMOylation of KAP1 enhances
KAP1's function as

a transcriptional co-repressor to attenuate Gadd45α transcription.
27

Figure 3.1. Functional domains of KAP1. KAP1 complexes with ZBRK1 to repress Gadd45 α
transcriptional de-repression. Schematic diagrams of KAP1(wt), SUMO-1-KAP1, KAP1(3K/R), and
SUMO-1-KAP1(L306P) are shown (left panel). A L306P point mutation on the second coiled-coil domain
of KAP1 disrupts SUMO-1-KAP1-mediated repression of Gadd45 α transcription in Dox-treated MCF-7
cells (right panel).

Because both ATM and ATR function as both the sensors for and

activators of
DNA break repair, we set to examine whether ATM,

ATR, or both are involved in
mediating Dox-induced relief of KAP1 transcriptional co-repressor function. ATM-
deficient fibroblast

cells (pEBS7) and their counterparts (YZ5, in which the expression

of
wild-type ATM is restored by stable transfection of ATM in

pEBS7 cells) were employed
to explore the mechanism underlying

KAP1/ZBRK1-mediated gene expression regulation
in response to

Dox-treatment. As shown in Fig. 3.2, ATM was rapidly and transiently

phosphorylated on Ser-1981 after Dox-treatment in MCF-7 cells

with comparable
kinetics to that observed in ATM-proficient

YZ5 cells. The ATM-deficient pEBS7 cells
served a control

to ensure the validity of the antibody against Ser-1981-phosphorylated

ATM (Fig. 3.2).
28

Figure 3.2. Activation of ATM by Dox-treatment. pEBS7, YZ5, and MCF-7 cells were treated with Dox
(2 µM) for the time period indicated. Cellular proteins were extracted, and Western analyses were
performed with antibodies indicated. Relative levels of pSer-1981-ATM are indicated as italic.

We next compared the inducibility of Gadd45α-Luc in response

to UV- and Dox-
treatment in pEBS7 and YZ5 cells. In ATM-deficient

pEBS7 cells, the Gadd45α
transcription was induced by UV radiation

(Fig. 3.3, left panel, lanes 5 to 7), consistent
with the idea that UV-induced

DNA damage responses are mainly not ATM-dependent.
Notably,

Dox-induced Gadd45α transcription in pEBS7 cells was modest (Fig. 3.3, left
panel,

lane 13), implying that ATM is required for Dox-mediated transcriptional

activation. By contrast, Dox-treatment induced Gadd45α-Luc activation

(Fig. 3.3, right
panel, lane 13 versus lane 5), which was compromised by the

expression of SUMO-1-
KAP1 in a dose-dependent manner (Fig. 3.3, right panel,

lanes 14 and 15 versus lane 13)
in ATM-proficient YZ5 cells.

Although UV radiation activated a comparable induction
in Gadd45α transcription (Fig. 3.3, right panel, lanes 1 and 5 versus lanes 9 and 13),
SUMO-1-KAP1 conferred a negligible effect on UV-induced Gadd45α promoter
activation in YZ5 cells (Fig. 3.3, right panel, lanes 6 and 7). Collectively,

our results
suggest that Dox and UV radiation induce Gadd45α transcription in distinct manners, and
29
the SUMOylation-mimetic

SUMO-1-KAP1 only represses ATM-mediated Gadd45α
transactivation.

Figure 3.3. ATM is required for the Dox-induced Gadd45 α transcriptional activation. ATM-
proficient YZ5 cells and ATM-deficient pEBS7 cells were co-transfected with a Gadd45 α-Luc reporter and
a combination of ZBRK1, KAP1, SUMO-1-KAP1, and SUMO-1-KAP1(L306P) and treated with UV
irradiation or Dox. The luciferase activity was measured as described previously. The results represent the
mean ± S.D. from three independent experiments after normalization for transfection efficiency.

GK41 cells, human osteosarcoma U2OS cells stably transfected

with doxycycline-
inducible ATR-kinasedead mutant (ATR-kd), were used to assess the role

of ATR in
KAP1-dependent Gadd45α transcriptional de-repression

by Dox exposure. As shown in
Fig. 3.4, Dox-treatment induced

Gadd45α transcription by 2.4-fold (lane 4 versus lane 1),
and

the expression of SUMO-1-KAP1 repressed both basal (lanes 2

and 3) and Dox-
inducible Gadd45α transcription (lanes 5 and 6)

in the absence of doxycycline (such that
the expression of ATR-kd

is negligible) in GK41 cells. The expression of ATR-kd (by
adding

doxycycline (1 µg/ml) to medium) did not affect the basal

and Dox-inducible
Gadd45α transcription under the same experimental

protocol (Fig. 3.4, lanes 7 and 10–12
30
versus lanes 1 and

4–6). Taken together, we conclude that Dox-treatment induces

Gadd45α transcriptional activation via an ATM-dependent pathway

to relieve KAP1-
mediated trans-repression. However, it appears

that SUMO-1-KAP1 had a lesser effect
in repressing Dox-induced

Gadd45α transcription in GK41 cells than in YZ5 cells. The
exact

mechanism underlying this discrepancy remains to be elucidated.

Figure 3.4. ATR is not required for the Dox-induced Gadd45 α transcriptional activation.
GK41 cells harboring a doxycycline-inducible kinase-dead form of ATR (ATR-kd) were transfected with
Gadd45 α-Luc reporter and a combination of ZBRK1, KAP1, and SUMO-1-KAP1. At 30 h post-
transcription, the transfected cells were treated with Dox (1 µM, 4 h) before harvest. The cells were treated
with doxycycline (1 µg/ml) starting from 12 h before the transfection and continuously throughout the
experiment. Results represent the mean ± S.D. from three independent experiments after normalization for
transfection efficiency. l, low concentration; and h, high concentration.

3.2.2 Dox-treatment Induces KAP1 Phosphorylation at Ser-824 via ATM
To

further examine the role of KAP1 Ser-824 phosphorylation in

governing KAP1
function, we next engineered KAP1 mutants containing

S824A or S824D substitutions.
The S824D mutant was expected

to mimic Ser-824-phosphorylated KAP1, whereas the
S824A mutant

reflected non-phosphorylated KAP1. By using KAP1(wt)-, KAP1(S/A)-,

or KAP1(S/D)-transiently transfected MCF-7 cells, we then confirmed

the specificity of
31
antibody for Dox-induced KAP1 Ser-824 phosphorylation

(Fig. 3.5, left panel, lanes 4
and 7). The anti-KAP1-Ser-824

antibody has been used by Ziv et al. (118) to
demonstrate that

ATM phosphorylates KAP1 at Ser-824 in response to double-strand

breaks. By using the level of tubulin to normalize for equal

loading and the level of
KAP1 to normalize for transfection

efficiency, the quantitative analysis of Dox-induced
KAP1 Ser-824

phosphorylation in MCF-7 cells was summarized in Fig. 3.5 (right

panel).
The phospho-Ser-824 signals detected in KAP1(S/A)- and

KAP1(S/D)-transfected cells
after treatment with Dox (1 µM, 3 h) might represented the Ser-824-phosphorylated
endogenous KAP1

(Fig. 3.5, left panel, lanes 8 and 9).

Figure 3.5. Dox-treatment induces KAP1 phosphorylation on Ser-824. MCF-7 cells were
transiently transfected with vector, KAP1(wt), KAP1(S824A), and KAP1(S824D). Twenty-four h after
transfections cells were treated with Dox (5 µM, 30 min) or (1 µM, 3 h). Western analyses on total cellular
proteins with indicated antibodies were performed. One representative Western blot from three
independent experiments is shown (left panel). The corresponding quantitative analyses on the relative
KAP1 Ser-824 phosphorylation levels in individual sample after normalizing with tubulin level are shown
(right panel).

Our previous data suggest that ATM may be the key PIKK that induces Gadd45α
transcriptional

de-repression in Dox-treated cells, as Dox-induced Gadd45α-Luc

activity
was significantly reduced in ATM-deficient pEBS7 cells as compared with that of ATM-
32
complemented YZ5 cells

(Fig. 3.3). The possible role of ATM in mediating Dox-induced

KAP1 Ser-824 phosphorylation was further analyzed in pEBS7 and

YZ5 cells. Western
analyses showed that Dox-induced endogenous

and transfected KAP1 phosphorylation at
Ser-824 was almost undetectable

in pEBS7 cells (Fig. 3.6, left panel, lanes 2 and 6) as
compared

with that of ATM-proficient YZ5 cells (Fig. 3.6, left panel,

lanes 4 and 8). The
quantitative analysis of normalized Ser-824

phosphorylation signals of transfected KAP1
in pEBS7 and YZ5

cells (Fig. 3.6, right panel) together with that in Fig. 3.2 indicated

that
Dox-induced KAP1 Ser-824 phosphorylation results exclusively

from ATM activation.

Figure 3.6. ATM is required for Dox-induced KAP1 phosphorylation at Ser-824. pEBS7 and
YZ5 cells were treated with Dox (1 µM) and harvested 3 h later. Total cellular extract underwent Western
analyses with the indicated antibodies (left panel). The corresponding quantitative analyses on the relative
KAP1 Ser-824 phosphorylation levels in lanes 5–8 shown in the left panel after normalizing with
endogenous KAP1 Ser-824phosphorylation levels (lanes 1–4) and tubulin levels for equal loading are
shown (right panel).

To investigate the relationship between

KAP1 Ser-824 phosphorylation status and
its transcriptional

co-repressor activity, transient transfection assays of p21-Luc

activation
with individual wild-type KAP1 or its engineered

mutants into MCF-7 cells were
performed. As shown in Fig. 3.7,

whereas KAP1(S/A) suppressed Dox-induced p21
promoter activation,

the mutation of S824D in KAP1 greatly enhanced the un-stimulated

p21 promoter activity.
33

Figure 3.7. KAP1 Ser-824 phosphorylation is essential for de-repressing its transcriptional
co-repressor activity. MCF-7 cells were individually transfected with p21-Luc and a combination of
ZBRK1 and wild-type KAP1 or its mutants. Twenty-four h after transfections cells were treated with Dox
(1 µM) for 3 h, and the luciferase activity was measured. Each bar represents the mean ± S.D. from three
independent experiments.

3.2.3 KAP1 Ser-824 phosphorylation regulates its SUMOylation status
To illustrate the possible relationship between KAP1 Ser-824

phosphorylation and
SUMOylation, in vivo sumoylation assays

were carried out by co-transfecting wild-type
KAP1 or its mutants

and SUMO-1 in HEK293 cells in the presence or absence of Dox-
treatment and followed by Western analyses. Consistent with

our previous report,
KAP1(wt) SUMOylation decreased by about

40% upon exposure to Dox (Fig. 3.8, upper
panel, lane 6 versus

lane 2). By contrast, KAP1(S824A) SUMOylation levels,
irrespective

of treatment with vehicle or Dox, remained at almost the same

level as that of
KAP1(wt) detected in vehicle-treated cells

(Fig. 3.8, upper panel, lanes 7 and 3 versus
lane 2). Moreover,

KAP1(S824D) exhibited a marked decrease of its SUMOylation
levels

in both vehicle- and Dox-treated cells (Fig. 3.8, upper panel,

lanes 4 and 8 versus
lane 2). After normalization with the level

of tubulin for equal loading and of KAP1 for
34
transfection efficiency,

the relative % SUMOylation of KAP1 and its mutants suggested

that Ser-824 phosphorylation plays a pivotal role in affecting

KAP1 SUMOylation status
(Fig. 3.8, lower panel).

Figure 3.8. S824A mutation represses KAP1 SUMOylation. MCF-7 cells were transfected with
FLAG-tagged wild-type (WT) KA-P1 or its mutants in the presence or absence of EGFP-SUMO-1 under
treatment with vehicle or Dox (1 µM, 3 h). Protein extracts were analyzed with an anti-FLAG, anti-EGFP,
anti-Ser(P)-824-KAP1 (pS824-KAP1), or anti-tubulin antibody by Western analyses. One representative
Western blot from three independent experiments is shown(left panel). The corresponding quantitative
analyses on the relative % of KAP1SUMOylation in each individual sample after normalizing with tubulin
level and transfection efficiency are shown (right panel).

To investigate whether KAP1 SUMOylation conversely inhibits

its Ser-824
phosphorylation in the absence or presence of Dox-treatment, we performed
immunoprecipitation followed by Western

analysis to probe both basal and Dox-induced
KAP1 Ser-824 phosphorylation

levels in cells with or without exogenous SUMO-1. As
shown in Fig. 3.9, KAP1 is SUMOylated by exogenous SUMO-1 (left panel,

lane 2).
The quantitative analysis (Fig. 3.9, right panel)

confirmed that there was no KAP1
species with both SUMOylated

and phosphorylated signals detected in vehicle- or Dox-
treated

cells (Fig. 3.9, left panel, lanes 5 and 6).
35

Figure 3.9. dynamic interaction between KAP1 phosphorylation and SUMOylation. HEK293
cells were transfected with FLAG-KAP1 with or without EGFP-SUMO-1. Transfected cells were treated
with Dox (1 µM, 3 h) at 24 h post-transfection before protein extraction. Equal amounts of individual
protein extracts were immunoprecipitated (IP) with an anti-FLAG antibody and visualized with an anti-
FLAG or an anti-Ser(P)-824-KAP1 antibody. The asterisk indicated SUMOylated KAP1. One
representative Western blot (WB) from three independent experiments is shown (left panel). The
corresponding quantitative analyses on the relative signal intensity for Ser(P)-824-KAP1 (indicated by an
arrowhead) in lanes 3 to 6 and for areas corresponding to SUMOylated KAP1 (indicated by the asterisk) in
lanes 3–6 shown in left panel after normalizing with total KAP1 level (lanes 1 and 2) are shown (right
panel).

Last, cells were

transfected with either KAP1(wt), SUMOylation-defective
KAP1(3K/R),

or SUMOylation-mimetic SUMO-1-KAP1 and subjected to vehicle

or
Dox-treatment to probe their respective phosphorylation profiles.

Consistent with Fig.
3.9, SUMO-1-KAP1 lacked a Ser(P)-824 (pS824)-SUMO-1-KAP1

signal comparable
with that observed for KAP1(wt) upon Dox exposure

(Fig. 3.10, left panel, lane 6,
indicated by an asterisk). Quantitative

analyses further confirmed that KAP1(3K/R), in
the absence of

Dox, exhibited an almost 2-fold Ser-824 phosphorylation signal

compared
with KAP1(wt) and that Dox-treatment failed to further

induce KAP1(3K/R) Ser-824
phosphorylation (Fig. 3.10, right panel,

lanes 2 and 5 versus lanes 1 and 4). Although the
basal KAP1

Ser-824 phosphorylation detected in anti-FLAG-immunoprecipitates

(Fig.
36
3.9, lane 3) may reflect endogenous ATM activation, we

noticed that exogenous SUMO-
1 reproducibly enhances basal KAP1

Ser-824 phosphorylation level by about 70% (Fig.
3.9, lane 4

versus lane 3). The exact reason underlying this stimulation

by enhanced
global SUMOylation is still unclear.

Figure 3.10. Dox-treatment fails to induce Ser-824 phosphorylation (p-) of SUMO-1-KAP1
fusion protein. HEK293 cells were transfected with KAP1, KAP1(3K/R), or SUMO-1-KAP1.
Transfected cells were treated with Dox (1 µM, 3 h) at 24 h post-transfection before protein extraction.
Equal amounts of individual protein extracts were immunoprecipitated with an anti-FLAG antibody and
visualized with an anti-FLAG or an anti-Ser(P)-824-KAP1 antibody (left panel). The corresponding
quantitative analyses on the relative basal (2nd left panel) and Dox-induced (1st left panel) KAP1 Ser-824
phosphorylation after normalizing KAP1 levels for transfection efficiency and tubulin levels for equal
loading are shown (right panel). The asterisk depicts Ser(P)-824-SUMO-1-KAP1. s, short exposure; l,
long exposure.

3.2.4 SENP1 Enhances Basal Ser-824 Phosphorylation of KAP1
To

test whether SUMO-specific protease regulates the ability of

KAP1 to repress
p21 transcription, SENP1 and SENP2 were each

co-transfected with p21-Luc and a
combination of KAP1 and ZBRK1

in MCF-7 cells. As shown in Fig. 3.11, p21-Luc
activity was induced

upon Dox-treatment in MCF-7 cells transfected with wild-type

ZBRK1 and KAP1 (lane 2 versus lane 1), whereas p21 transcription

was held nearly
unchanged by Dox-treatment in SUMO-1-KAP1-transfected

cells (lane 4). Yet MCF-7
37
cells transfected with SENP1 displayed

a 3.6-fold increase in the basal p21 transcription
(Fig. 3.11,

lane 5 versus lane 1). Importantly, the co-transfection of uncleavable

SUMO-
1-KAP1 with SENP1 suppressed the SENP1-mediated stimulation

(Fig. 3.11, lane 6
versus lane 5), suggesting that the potential

deSUMOylation of KAP1 by SENP1 could
have accounted for the

increased basal p21 transcription. By contrast, SENP2 conferred

almost no effect on the p21 transcription in the absence of

Dox (Fig. 3.11, lanes 7 and 8),
further implicating the specificity

of SENP1 in regulating KAP1 function in the absence
of Dox.

Figure 3.11. SENP1 activates p21 transcription. MCF-7 cells were transfected with p21-Luc
reporter along with a combination of ZBRK1, KAP1, SUMO-1-KAP1, SENP1, and SENP2, as indicated.
At 40 h post-transfection, the luciferase activity was measured and normalized against a firefly control
reporter (pRL-TK). Results represent the mean ± S.D. from three independent experiments.

To determine whether SENP1 action is mediated through deSUMOylating

KAP1,
293T cells were co-transfected with KAP1, SUMO-1, and

either SENP1 or SENP1C603S,
38
and the profile of SUMO-1-modified

KAP1 was determined. Co-transfection with wild-
type SENP1 led

to a reduction in the level of SUMOylated KAP1 (Fig. 3.12, lane

6
versus lane 4). As expected, the enzymatic activity of SENP1

was required for
deSUMOylating KAP1 since the SENP1C603S mutant

rendered an accumulation of high
molecular weight SUMOylated

KAP1 (Fig. 3.12, lane 7 versus lane 4).

Figure 3.12. SENP1 deSUMOylates SUMO-modified KAP1. HEK293T cells were transfected
with KAP1, EGFP-SUMO-1, and SENP1 or SENP1C603S (SENP1cs). SUMO conjugation of KAP1 was
analyzed by Western analyses using an anti-FLAG antibody.

We next determined whether

SENP1 could directly induce phosphorylation of
KAP1 at Ser-824.

As shown in Fig. 3.13 left panel, co-expression of SENP1 induced
basal KAP1

Ser-824 phosphorylation (left panel, lane 2 versus lane 1), whereas C603S

mutation of SENP1 attenuated such a function of SENP1 (left panel, lane

3 versus lane 2).
However, neither SENP1 nor SENP1C603S elicited

any stimulating or inhibitory effect
on KAP1 Ser-824 phosphorylation

in Dox-treated cells (left panel, lanes 5 and 6). Based
on these

results, we suggest that SENP1 only fine-tunes the basal, but

not Dox-modulated,
KAP1 co-repressor activity by regulating

its Ser-824 phosphorylation status. We then
39
wished to confirm

the possible link between SENP1 and KAP1 function by using short

hairpin RNA to knock down endogenous SENP1 levels. Although

expression of sh-
SENP1-1 or sh-SENP1-2 reduced KAP1 basal Ser-824

phosphorylation (Fig. 3.13, right
panel, lanes 2 and 3), both sh-SENP1-1 and

sh-SENP1-2elicited a very modest, if any,
effect on Dox-induced

KAP1 Ser-824 phosphorylation profiles (right panel, lanes 5 and

6).

Figure 3.13. SENP1 induces basal KAP1 Ser-824 phosphorylation. Left panel, Lysates of
cells transfected with KAP1 and SENP1 or SENP1cs followed by vehicle or Dox (1 µM, 3 h) were
analyzed with anti-FLAG, anti-Ser(P)-824-KAP1 (pS824-KAP1), and anti-tubulin antibodies, respectively.
s: short exposure and l: long exposure. Right panel, Dox-induced Ser-824 phosphorylation of KAP1 is
SENP1-independent. Cells were transfected with pSUPER empty vector, sh-SENP1-1, or sh-SENP1-2
with KAP1 and followed by treatment with vehicle or Dox (1 µM, 3 h). The KAP1 Ser-824
phosphorylation level was measured with an anti-Ser(P)-824-KAP1 antibody. One representative Western
blot from three independent experiments is shown. s, short exposure; l, long exposure.

Consistently, knocking down SENP1 repressed basal expression

of both Gadd45 α
and p21 (Fig. 3.14) without affecting Dox-induced

activation. Taken together, our data
indicated

that compromising SENP1 by C603S mutation or by sh-SENP1/2 knockdown

abolished the ability of SENP1 to activate KAP1 basal Ser-824

phosphorylation and
render transcriptional de-repression of

Gadd45α and p21.
40

Figure 3.14. Knockdown of SENP1 inhibits p21 and Gadd45 α expression. MCF7 cells were
transfected with pSUPER empty vector, sh-SENP1-1of sh-SENP1-2with KAP1, p21-Luc or Gadd45 α-Luc.
At 40 h post-transfection the luciferase activity was measured and normalized against a firefly control
reporter (pRL-TK). * denotes p < 0.10; ** denotes p < 0.05.

3.2.5 KAP1 and KAP1 SUMOylation Are Essential for ZBRK1-mediated
Repression

of p21, Gadd45α, Bax, Puma, and Noxa
To investigate the

potential biological role of the KAP1 Ser-824 phosphorylation

and SUMOylation/deSUMOylation switch in regulating gene expression,

we first
determined whether KAP1 is expendable for DNA damage

response. There are several
genes involved in cell cycle control

and apoptosis, such as Bax, Puma, and Noxa, whose
transcriptions

are also reportedly induced by DNA damage in a p53-dependent

manner
(70, 103). We postulated that if these genes harbor ZBRK1-binding element(s), their
transcription might also be subjected

to repression by KAP1. To address this possibility,
we examined

whether these genes possess DNA binding elements for ZBRK1 through

41
both a literature search and motif scanning using the ScanProsite

program. The putative
ZBRK1-binding elements in Bax, Puma, and

Noxa are shown in Fig. 3.15.

Figure 3.15. The p53-responsive element and putative ZBRK1-binding elements at the
promoters of Bax, Puma, and Noxa genes. The positions of p53-responsive elements and the ZBRK1-
binding elements, according to previous reports or searched against the 15-bp consensus motif
GGGXXXCAGXXXTTT with the permission of mismatches less than two nucleotides by ScanProsite
program, are denoted. The transcription start site of each gene is defined as +1 position, and the
corresponding ATG translation initiator is also shown. The two ZBRK1-binding elements found in Noxa
partially overlap.

To confirm that ZBRK1-mediated repression is dependent upon

KAP1, the
steady-state levels of p21, Gadd45α, Bax, Puma, and

Noxa mRNA in vehicle- or Dox-
treated HEK293 and HEK293/sh-KAP1

(K928-cI10) cells were analyzed by quantitative
real-time RT-PCR

analyses. As HEK293 cells (ATCC CRC-1573) express adenoviral

E1B protein, which is known to impair the p53 pathway (115),

HEK293 and HEK293/sh-
KAP1 (K928-cI10) cells could also serve

as a useful model to examine the role of KAP1
in regulation

of the expression of these KAP1-targeted genes in the context

of attenuated
p53 function. As shown in Fig. 3.16 (left panel),

knockdown of KAP1 clearly induced
the basal expression of p21

and Noxa. Furthermore, although Dox-treatment had almost
42
no

effect on the expression of Bax, Gadd45α, Puma, and Noxa in HEK293

cells, KAP1
knock-down allowed the Dox to induce the expression

of Bax, Gadd45α, Puma, and Noxa
as well as p21. Next, we attempted

to transiently deplete KAP1 in MCF-7 cells by using
a doxycycline-inducible

sh-KAP1. As shown in Fig. 3.16 (right panel), a time-dependent

induction of p21-Luc by sh-KAP1, but not by sh-control, was

observed, whereas a
doxycycline-induced pCDNA4TO-Luc served

as a control. The lack of robust induction

of basal p21-Luc activity in MCF-7 cells transfected with sh-KAP1

compared with the
increase of basal p21 mRNA level by sh-KAP1

in HEK293 cells may reflect the low
KAP1 knockdown efficiency

by transient transfection in MCF-7 cells and/or additional
DNA

elements involved in the regulation of p21 expression.

Figure 3.16. sh-KAP1 de-represses the ZBRK1-mediated inhibition of p21, Gadd45 α, Bax,
Puma, and Noxa expression. Quantitative real-time RT-PCR analyses of p21, Gadd45 α, Bax, Puma, and
Noxa mRNA levels in HEK293 and stable KAP1 knockdown cell line K928-cI10 (left panel) are shown.
Cells were treated with Dox (1 µM, 3 h), and the total RNAs were extracted by TRIzol reagent. The
respective p21, Gadd45 α, Bax, Puma, and Noxa mRNA levels were then quantitated by one-step reverse
transcription and real-time PCR with gene-specific primers (Table. 1). The relative mRNA level for each
gene in a different context was calculated by ∆∆Ct method against 18 S rRNA, and the level of each gene
in vehicle-treated HEK293 cells was arbitrarily assigned as 1. Each bar represents the mean ± S.D. from
three independent experiments. MCF-7 cells were co-transfected with p21-Luc, Tet-repressor plasmid
pCDNA
6
/TR and pTER
+
-sh-KAP1 or pTER
+
-Control (right panel). At 24 h post-transfection, transfected
cells were treated with doxycycline (2 µM, 4 or 24 h). Then the luciferase activity was measured and
normalized against pRL-TK.
43

Table 1. Real-time PCR primer pairs

Primer Purpose Sequence (5’- to -3’)
18S rRNA FP Real-time RT-PCR CGGCGACGACCCATTCGAAC
18S rRNA RP Real-time RT-PCR GAATCGAACCCTGATTCCCCGTC
Gadd45α FP Real-time RT-PCR AGGAAGTGCTCAGCAAAGCC
Gadd45α RP Real-time RT-PCR GCACAACACCACGTTATCGG
p21 FP Real-time RT-PCR TTTCTCTCGGCTCCCCATGT
p21 RP Real-time RT-PCR GCTGTATATTCAGCATTGTGGG
Bax FP Real-time RT-PCR CCGATTCATCTACCCTGCTG
Bax RP Real-time RT-PCR CAATTCCAGAGGCAGTGGAG
Noxa FP Real-time RT-PCR ATTACCGCTGGCCTACTGTG
Noxa RP Real-time RT-PCR GTGCTGAGTTGGCACTGAAA
Puma FP Real-time RT-PCR CTGTGAATCCTGTGCTCTGC
Puma RP Real-time RT-PCR AATGAATGCCAGTGGTCACA
p21 -20 amplicon FP ChIP (real-time PCR) TATATCAGGGCCGCGCTG
p21 -20 amplicon RP ChIP (real-time PCR) CTTCGGCAGCTGCTCACACCT
p21 -713 amplicon FP ChIP (real-time PCR) TTTCCCTGGAGATCAGGTTG
p21 -713 amplicon RP ChIP (real-time PCR) GGAAGGAGGGAATTGGAGAG
p21 -3038 amplicon FP ChIP (real-time PCR) CAGGCTGGTCTCAAAACTCC
p21 -3038 amplicon RP ChIP (real-time PCR) GCCTGTAATCCCAGCACTTT
FP, forward primer; RP, reverse primer.

Lastly, to examine the role of differential SUMOylation of KAP1

in regulating the
expression of p21, Gadd45α, Bax, Puma, and

Noxa in response to DNA damage, MCF-7
cells were transfected

with either wild-type, SUMOylation-mimetic, or SUMOylation-
defective

KAP1 followed by treatment with Dox (1 µM, 4 h). As

shown in Fig. 3.17, the
steady-state levels of these five mRNAs

exhibited a general concordance of up-regulation
at 4 h post-treatment;

4.3-fold for p21, 3.0-fold for Gadd45α, 1.6-fold for Bax, 2.3-fold

for Puma, and 2.1-fold for Noxa. The introduction of SUMO-1-KAP1

suppressed the
induction of all these five mRNAs, whereas the

expression of KAP1(3K/R) enhanced the
mRNA levels of all these

five genes, although the extent of enhancement by KAP1(3K/R)

44
was more modest than the magnitude of suppression by SUMO-1-KAP1

(Fig. 3.17).
Together with Fig. 3.16, the up-regulation in the expression

of these five examined genes
by sh-KAP1 in the context of DNA

damage was more prominent in p21 than in Gadd45 α,
Bax, Puma,

and Noxa. Collectively, we conclude that both KAP1 and the KAP1

SUMOylation switch play critical roles in regulating the expression

of these five ZBRK1-
binding element-harboring genes, conceivably

contributing to the DNA damage response.

Figure 3.17. SUMO-1-KAP1 represses Dox-induced p21, Gadd45 α, Bax, Puma, and Noxa
expression in MCF-7 cells. MCF-7 cells transiently transfected with wild-type KAP1, SUMO-1-KAP1, or
KAP1(3K/R) were treated with Dox (1µM, 4 h). The total RNA isolation and quantitative RT-PCR
analyses were performed as described in Fig. 3.16. The -fold induction of each gene in response to Dox-
treatment was calculated by ∆∆Ct method against 18 S rRNA. The results represent the mean ± S.D. from
three independent experiments.

3.3 Discussion
ATM is one of major kinases involved in activating DNA damage

responses,
which span many signaling pathways including the

cell cycle checkpoints (84). Here, a
novel ATM-KAP1 signaling

pathway linking genome surveillance to a key
transcriptional

co-repressor to dynamically regulate the expression of a subset

of genes
45
involved in promoting cell cycle arrest and proapoptosis

is demonstrated. We present
evidence for the involvement of

ATM in transcriptional de-repression of Gadd45α (Figs.
3.1 to 3.4) and

a correlation between KAP1 Ser-824 phosphorylation, KAP1
deSUMOylation,

and a down-regulation of KAP1 transcriptional co-repressor function

(Figs. 3.5 to 3.10). Furthermore, SENP1-mediated KAP1 deSUMOylation

is critical for
the basal activation of Gadd45α and p21 by facilitating

Ser-824 phosphorylation (Figs.
3.11 to3.14). Our results further demonstrate

that Ala substitution at Ser-824
(KAP1(S/A)) and Asp substitution

at Ser-824 (KAP1(S/D)) gave opposite profiles of
SUMOylation

and stimulation of p21 basal expression (Figs. 3.5 to 3.10) and

that SUMO-
1-KAP1 resisted, at least in part, Dox-elicited Ser-824

phosphorylation (Fig. 3.10). We
postulate that Dox-mediated ATM

activation plays a critical role in the inhibition of
KAP1 SUMOylation

and the subsequent de-repression of five ZBRK1-binding element-
harboring,

cell cycle control and proapoptotic genes, including p21 and

Gadd45α, Bax,
Puma, and Noxa.
To our knowledge the current study reported herein is the first

one to suggest the
inhibition of KAP1 SUMOylation and its trans-repression

function by ATM-dependent
KAP1 Ser-824 phosphorylation. As shown

recently by Ziv et al. (118) and White et al.
(106), KAP1 is phosphorylated

at Ser-824 after DNA damage. Interestingly, DNA
damage-induced

KAP1 phosphorylation results in a dynamic co-localization of pSer-824-
KAP1 with numerous damage response factors at DNA lesions

and chromatin
decondensation (106, 118). Notably, Ziv et al. (118)

reported that no major changes were
detected in the interactions

between KAP1 and HP-1, SETDB1, and Mi-2 α proteins after
the induction

of DNA damage, suggesting the possibility that SUMOylated KAP1,

not
46
KAP1 per se, plays a functional role in modulating KAP1-dependent

chromatin
condensation and subsequent repression of gene expression.

Conceivably, the reported
KAP1 Ser-824 phosphorylation-mediated

inhibition of KAP1 SUMOylation could play
an essential role

in fine-tuning the biological function of KAP1.

The fold-of-activation on Gadd45α transcription by UV irradiation

and Dox
appeared to be comparable in ATM-proficient YZ5 and

ATM-deficient pEBS7 cells.
However, SUMO-1-KAP1 was able to

repress Dox-induced, but not UV-elicited,
Gadd45α transcription,

indicating that the mechanisms underlying transcriptional
induction

by Dox and UV are distinct. It was previously shown that ZBRK1

was
subjected to poly ubiquitination and proteasome-dependent

degradation upon UV
irradiation (113), and therefore, the exogenous

expression of SUMO-1-KAP1 would exert
no inhibitory effect on

UV-induced Gadd45α transcription. Although it has been
generally

accepted that ATM and ATR exhibit some redundancy in activating

Chk1 and
Chk2, a very modest, if any, reduction in the Dox-induced

Gadd45α transcription was
observed in the presence of ATR-kd. Hence, we conclude that ATM-KAP1 signaling is
mainly specific

for de-repression of ZBRK1-binding element-containing genes

in
response to Dox and perhaps other agents causing DNA double-stranded

breaks. The
observation that only about 39% of identified KAP1

target promoters were also occupied
by repressive di-methylated

H3-K9 or -K27 (68) further supported our notion

that the
dynamic Ser-824 phosphorylation-mediated SUMOylation/deSUMOylation

switch could
affect KAP1 transcriptional co-repressor function.
Knowledge about protein SUMOylation/deSUMOylation has increased

enormously in the past few years. However, the mechanism regulating

SUMO
47
conjugation or de-conjugation is far from understood. Various

stresses, including heat-
shock, hypoxia, osmotic shock, and

oxidative stress, are known to regulate the global
SUMO conjugation

pathway (5, 28, 38). One obvious means

to regulate SUMOylation
processes is to modulate the phosphorylation

status of targets. For example,
phosphorylation on Ser-303 of

HSF1 is demonstrated to enhance SUMOylation (31).
Notably, this

finding has been extended to many transcriptional regulators,

such as
GATA-1 and MEF2 (24, 32). By contrast, SUMOylation of

c-Jun and c-fos is negatively
regulated by their respective

phosphorylation via JNK (for c-Jun) and an unidentified,
Ras-activated

kinase (for c-fos) (3, 61). Moreover, phosphorylation is also

shown to
inhibit the SUMOylation of p53 and Elk-1 (52, 110). Meanwhile, because protein
SUMOylation is a dynamic and transient

process, our studies have been restricted to use
of SUMOylation mimetic

or SUMOylation-defective mutants to study the effect by
SUMOylation

on KAP1 Ser-824 phosphorylation. Whether Ser-824 phosphorylation

serves to recruit deSUMOylase, block access of Ubc9 or E3 ligases,

or prevent
sumoylation through some other mechanism is currently

under investigation.
We demonstrate herein that SENP1, not SENP2, is able to mimic

Dox-induced
down-regulation of KAP1 SUMOylation, thus activating

basal p21 transcription at a
magnitude comparable with that

of Dox-treatment. SENP1 is presumably a nuclear
SUMO-specific

protease based on the observations that transient expression

of SENP1
disrupts promyelocytic leukemia (PML) oncogenic domains

(PODs), a subnuclear
structure of SUMOylated PML, without affecting

the level of SUMOylated RanGAP-1,
which resides in the cytoplasmic

periphery of nuclear pore complex (65). Additionally,
SENP1

reportedly participates in androgen receptor-mediated signaling

and c-Jun-
48
dependent transcription (11, 12). It has been speculated

that the observed transcriptional
activation by SENP1 is mediated

by the deSUMOylation of androgen receptor/c-Jun-
interacting

partners, such as p300 and HDAC1 (11, 12), or of KAP1 (this

report), thus
relieving the repressive ability endowed by SUMO

conjugation. Last, our findings that
SENP1 alone is sufficient

to induce basal p21 expression is also consistent with our
previous

report that sumoylation-defective KAP1(3K/R) increases basal

p21 transcription
(47), suggesting that ATM preferentially phosphorylates/unSUMOylated KAP1.

As shown in Figs. 3.15~3.17, there are a number of other genes involved

in the
control of cell-cycle progression, DNA damage repair,

and apoptosis whose expressions
are also subjected to the repression

by KAP1. It is reasonable to assume that differential
KAP1 sumoylation

regulates the transcription of such genes as p21, Gadd45 α, Bax,

Puma,
and Noxa before or after the onset of DNA damage. Presumably,

the proposed
mechanism by which ATM, in collaboration with KAP1

SUMOylation switch, modulates
the transcription of these five

genes. Although the p53-mediated transcriptional
activation

of cell cycle arrest and proapoptotic genes has been well documented

(49, 102,
103), p53-null or -compromised cells are still sensitive

to genotoxic stresses (72, 105). In
fact, Dox-treatment induces

p21 expression, albeit at lower level, in p53
–/–
or -
compromised cells ((6) and this report), underscoring

the possibility of regulating cell
cycle arrest and apoptosis

by both p53-dependent and p53-independent pathways in
response

to genotoxic stresses. Although the role of KAP1 in repressing

the expression of
these five examined genes is less universal

in HEK293 cells, we propose that KAP1
phosphorylation/SUMOylation

switch or sh-KAP1 could complement p53 in activating
the expression

of a subset of DNA damage target genes. Current efforts are

aimed at
49
determining whether different cofactors or influences

are necessary for KAP1 to repress
the expression of target genes

in different p53 contexts.

Based on the data presented herein, we propose the following

model for the role
of SUMOylation and phosphorylation in regulating

KAP1 co-repressor activity; KAP1
exists in a balance between

SUMOylated KAP1 (active co-repressor) and Ser-824-
phosphorylated

KAP1 (inactive co-repressor) via ATM activation from endogenous

double-strand breaks during processes such as meiosis and DNA

replication (76). By
doing so KAP1 is able to set a basal transcription

level for a subset of KAP1-targeted cell
cycle checkpoint genes

and responds timely to exogenous genotoxic stresses. After Dox-
treatment, the robust ATM activation induces marked KAP1 Ser-824

phosphorylation, in
turn, de-repressing the transcription of

p21, Gadd45 α, Bax, Puma, and Noxa. In our
model we further predict

that SENP1 sets a threshold for basal KAP1 SUMOylation and
facilitates

KAP1 Ser-824 phosphorylation. It is imperative to note that

our proposed
model is simplistic, and we only provide evidence

that SUMO-1-KAP1 partially resists
Dox-induced Ser-824 phosphorylation

and KAP1(S/D) fails in part to be SUMOylated.
The molecular

mechanisms underlying the Dox-induced, KAP1 Ser-824 phosphorylation-
mediated

inhibition of SUMOylation and the failure of ATM to efficiently

phosphorylate
SUMOylated KAP1 remain to be established. Almost

certainly, the regulation of KAP1
Ser-824 phosphorylation involves

another kinase(s) and phosphatase(s) to provide a
dynamic, temporally

selective regulation of the KAP1 Ser-824 phosphorylation-
SUMOylation

switch. Likewise, the same Lys residue(s), the target(s) of

SUMOylation,
could be subjected to other post-translational

modifications, such as ubiquitination or
50
acetylation as suggested

by Bossis and Melchior (5), resulting in

distinct biochemical
functions.
In summary, mounting evidence continues to imply that KAP1 may

be an
important component of DNA damage signaling pathway, and from this part of study, we
demonstrate here that the Dox-induced, KAP1 Ser-824 phosphorylation

and KAP1
SUMOylation switch could be a central regulatory circuit

in mediating the de-repression
of a subset of KAP1-repressed

genes, such as p21, Gadd45α, Bax, Puma, and Noxa.
With this caveat,

the ATM-dependent inhibition of KAP1 SUMOylation may represent

a
novel strategy of gene regulation with implications for other

DNA damage agents, such
as irradiation and cisplatin, by which

ATM is also activated. The intricate interplay
between ATM activation

and the KAP1 SUMOylation switch and their connection to
stress

signaling pathways are likely to be critical for the dynamic

regulation of DNA
damage responses.

51
CHAPTER 4: SUMOYLATION OF KAP1 IS REGULATED BY
SER/THR PHOSPHOTASE PP1, WHICH SUBSEQUENTLY
REGULATES ITS CELLUAR FUNCTIONS

4.1 Introduction
KAP1 deSUMOylation is required for relieving the transcriptional co-repressor
function against a subset of genes involved in cell cycle arrest and pro-apoptosis, such as
p21, Bax, Puma and Noxa, during DNA damage response (DDR) (47, 51). In addition,
KAP1 is phosphorylated at Ser-824 by PIKK family members of kinases upon DSB
induction (47, 94, 106, 107, 118). Ser-824-phosphorylated KAP1 is reportedly co-
localized with numerous damage response factors at DNA lesions (94, 106, 107). As
shown in chapter 3, we further reported that KAP1 transcription co-repressor function,
mediated by SUMOylation, was inhibited by ATM kinase-dependent Ser-824
phosphorylation in response to DSB induction(47, 51). In support of ATM-mediated Ser-
824 phosphorylation mediating de-repression of KAP1-targeted genes, Goodarazi and
colleagues showed that KAP1 depletion restored DNA repair competence for compact
chromatin in ATM-deficient cells (23). However, how the ATM-mediated effect on
KAP1 function is negatively regulated remains ill-defined.
Protein serine/threonine phosphatases PP1 functions by reversing the
phosphorylation of key structural and regulatory proteins (8, 15). PP1 regulates a large
number of cellular activities, including neurotransmission, protein synthesis, muscle
contraction, DNA damage response and cell cycle progression (8, 15, 91). However, to
52
date, little is known about the role of the PP1 in KAP1 regulation. In this chapter, we
explored the possibility that PP1 is the phosphatase to negatively regulate ATM-induced
KAP1 Ser-824 phosphorylation and investigated the role of PP1 in regulating KAP1
SUMOylation.

4.2 Results
4.2.1 KAP1 depletion impairs cell cycle progression
To investigate the role of KAP1 in DDR, we established MCF-7/TR/sh-KAP1
cells with doxycycline (Doxy)-inducible shRNA against 3’UTR of KAP1 mRNA to
deplete endogenous KAP1 (Fig. 4.1 left panel). As predicted, knockdown of KAP1
resulted in a slower proliferation rate of MCF-7/TR/sh-KAP1 cells, compared to parent
MCF-7 cells (Fig. 4.1 right panel).

Figure 4.1. Knockdown of KAP1 resulted in a slower proliferation rate of MCF-7/TR/sh-
KAP1 cells. KAP1 expression diminished in MCF-7/TR/sh-KAP1 cells upon induction with doxycycline
(1 µg/ml or 2 µg/ml) for 48 h. Relative levels (numbers in italic) of steady-state KAP1 normalized against
actin are shown (left panel). Proliferation rates of MCF-7 cells and KAP1-depleted MCF-7/TR/sh-KAP1
cells were compared by using Real-time Cell Growth Monitoring system (right panel).

53
To evaluate the effect of KAP1 knockdown on cell cycle progression, MCF-
7/TR/sh-KAP1 cells were synchronized at G
1
/S phases by treatment with hydroxyurea (1
µM, 16 h) and then released. Fluorescence-activated cell sorter (FACS) analysis revealed
that approximately 24.9% and 42.6% of synchronized KAP1-depleted cells were in the
G
1
fraction at 6 and 12 h, respectively, after re-entering cycling (Fig. 4.2, columns 7 and
8). In contrast, less than 16.4% and 21% of KAP1-competent cells were in the G
1

fraction at the same time points (Fig. 4.2, columns 3 and 4). Notably, the S-phase
population of MCF-7 cells with KAP1 knockdown decreased compared to that in the
vehicle-treated MCF-7/TR/sh-KAP1 cells (Fig. 4.2, columns 7 and 8 versus columns 3
and 4) accompanied by an accumulation of G
2
/M-phase among KAP1-depleted cells (Fig.
4.2, column 8 versus column 4). Taken together, the increase in the percentage of G
1

phase after 12 h of Doxy-treatment may have resulted from either a cohort of cells from
G
2
/M slowly entering next G
1
phase, or a defect in S phase entry after cells had entered
next cell cycle.

Figure 4.2. KAP1 is essential for genotoxicity-induced cell cycle arrest. MCF-7/TR/sh-KAP1
cells, synchronized at G
1
and S phases by hydroxyurea (1 µM, 16 h) with co-treatment of vehicle or
doxycycline (2 µg/ml), were released for indicated time periods and subjected to fluorescence-activated cell
sorter analysis (FACS).
54

The effect of KAP1 depletion on cell cycle progression was then tested in MCF-7
cells treated with doxorubicin (Dox). While unsynchronized MCF-7 cells were
increasingly arrested at the G
2
/M-phase of the cell cycle at 24 and 48 h post Dox-
treatment (Fig. 4.3, columns 7 and 8 versus columns 2 and 3), KAP1 knockdown resulted
in more MCF-7 cells arrested at the G
2
/M-phase at 48 h post-treatment (Fig. 4.3, column
10 versus column 8).
We also observed KAP1 knockdown caused increased apoptosis during prolonged
Dox-treatment (Fig. 4.4). Knocking down of KAP1 greatly increased Dox-induced cell
apoptosis.

Figure 4.3. The effect of KAP1 depletion on cell cycle progression. Unsynchronized MCF-
7/TR/sh-KAP1 cells were treated with a combination of doxycycline (Doxy, 2 µg/ml) and doxorubicin
(Dox, 1 µM) for different time periods, as indicated. KAP1-depleted MCF-7 cells were increasingly
arrested at the G
2
/M-phase of the cell cycle at 24 and 48 h post Dox-treatment.
55

Figure 4.4. KAP1 is essential for genotoxicity-induced cell apoptosis. Unsynchronized MCF-
7/TR/sh-KAP1 cells were treated with vehicle, doxorubicin (Dox, 1 µM), doxycycline (Doxy, 2 µg/ml) or a
combination of the two for 24, 48 and 72 h. Apoptosis was assessed by cells in sub-G1 fraction.

The effect of KAP1 knockdown on the time-dependent expression profiles of Bax,
Puma, Noxa and p21, in response to Dox-treatment, was then assessed in MCF-7/TR/sh-
KAP1 cells. Steady-state levels of these four mRNAs exhibited a notable concordance of
additional up-regulation starting at 6 h, reaching the maximum at 9 h post Dox-treatment
in KAP1-depleted MCF-7/TR/sh-KAP1 cells (Fig. 4.5). To confirm that KAP1-
knockdown leads to increased apoptosis, Annexin-V apoptosis assays were performed on
cells undergoing Dox-treatment for 9 h.
We then examined the apoptosis rate using Annexin-V/FITC apoptosis assay. In
line with the gene induction profile (Fig. 4.5), KAP1-depletion conferred greater increase
in Annexin-V positive cells compared to KAP1-competent cells (Fig. 4.6).

56

Figure 4.5. Knocking down of KAP1 affected mRNA level of genes related with cell apoptosis.
MCF-7/TR/sh-KAP1 cells were pretreated with Doxy overnight to knockdown endogenous KAP1 prior to
Dox-treatment for different time periods as indicated. The steady-state p21, Bax, Puma and Noxa mRNA
levels were quantified by real-time RT-PCR analyses using gene-specific primer pairs (Table 1). Results
represent the mean ± S.D. from three independent experiments.

Figure 4.6. Knocking down of KAP1 affected genotoxicity-induced cell apoptosis level.
Annexin-V positive cells in KAP1-depleted and -competent cells following Dox-treatment (9 h) were
compared by FACS analyses.

57
4.2.2 PP1cA physically interacts with KAP1 through PP1-docking motif
Because ATM-mediated Ser-824 phosphorylation lies at the node of regulating
KAP1 signaling in response to DSB induction (47, 94, 106, 107, 118), we sought to
identify the corresponding phosphatase(s) that polices the KAP1 Ser-824 phosphorylation
status. A putative PP1-docking motif was identified at 366KLIYF370 of KAP1 coiled-
coil region. Reciprocal co-immunoprecipitation (co-IP) experiments followed by
Western analyses were performed to show that endogenous KAP1 interacted with
endogenous PP1cA and PP1cC over PP1cB in HEK293 cells (Fig. 4.7, left panel).
Myosin phosphatase targeting subunit 1 (MYPT1) is one of the PP1 regulatory subunits
known to interact with PP1cB (71), and indeed we were able to co-immunoprecipitate
MYPT1 with either PP1cB or PP1cC (Fig. 4.7, right panel). An interaction of MYPT1
with KAP1 or PP1cA, albeit weak, was also noted (Fig. 4.7, right panel).
58

Figure 4.7. Physical interaction of endogenous PP1c with KAP1. Left panel) Reciprocal co-IP
experiments to demonstrate the interaction of endogenous KAP1 with endogenous PP1cA, PP1cB and
PP1cC. Whole cell extracts were IPed with an anti-KAP1 antibody and co-IPed PP1 was visualized with
an anti-PP1cA, -PP1cB or –PP1cC antibody; and with the reversed sequence. Right panel) Whole cell
extracts prepared from HA-MYPT1-transfected HEK293 cells were subjected to co-IP experiments with an
anti-HA antibody and visualized as described above.

Since PP2cA is known to inactivate ATM (22), we also tested whether PP2cA
interacted with KAP1. Overexpression of PP1cB and PP2cA, compared to PP1cA, failed
to force their respective interaction with KAP1 (Fig. 4.8), confirming that KAP1 favors
interaction with PP1cA over PP1cB and PP2cA in unstressed cells.
59

Figure 4.8. Overexpression PP1cB fails to force the interaction with KAP1. HEK293 cells
were cotransfected with FLAG-KAP1 with HA-PP1cA, HA-PP1cB or HA-PP2cA, as indicated. Anti-
FLAG and anti-HA antibodies were used in co-IP experiments as described in Fig, 4.7.

To further characterize the interaction of PP1cA with KAP1, KAP1(wt),
phosphorylation-defective mutant KAP1(S824A), or phosphorylated KAP1-mimetic
KAP1(S824D) was co-expressed with HA-PP1cA, HA-PP1cB or HA-PP2cA in the
absence or presence of Dox-treatment. Notably, Dox-treatment drastically stimulated
KAP1’s interaction with PP1cB and PP2cA (Fig. 4.9A,B, lanes 4 and 7). While PP1cA
was physically associated with KAP1(wt) over KAP1(S824A) and KAP1(S824D) prior
to Dox-treatment (Fig. 4.9, A), DSB induction facilitated the interaction of KAP1(S824A),
but not KAP1(S824D), with PP1cA and PP2cA (Fig. 4.9B, lanes 2 and 8). The lack of
detectable interaction of PP1cA with KAP1(S824D) was unexpected, and the underlying
reason is still unclear. Although ATM reportedly phosphorylates two additional sites,
Ser-440 and Ser-501, of KAP1 (56), the site-specific mutagenesis of Ser-440 and Ser-501
to Ala or Asp did not affect the interaction of PP1 with KAP1 (data not shown).
60
To confirm the direct interaction of PP1cA with KAP1, two KAP1 mutants were
engineered, containing either a K366G or I368G substitution at the PP1-binding motif of
KAP1. Co-IP experiments revealed that while K366G substitution abolished KAP1’s
ability to interact with PP1cA prior to, but not after Dox-treatment (Fig. 4.9C,D, lane 7),
KAP1(I368G) bound PP1cA much more avidly at both vehicle- and Dox-treated states
(Fig. 4.9C,D, lane 1).

Figure 4.9. Physical interaction of PP1c with KAP1 mutants. A,B) Dox-treatment
facilitated the PP1cB/KAP1 interaction. Individual transfected HEK293 cells, as indicated, were treated
with vehicle (A) or Dox (1 µM, 3 h) (B) and subjected to co-IP experiments, as described in Fig. 4.8.
A
B
61

Figure 4.9: Continued

Figure 4.9: Continued. Physical interaction of PP1c with KAP1 mutants. C,D) I368G
mutation favored the interaction of PP1cA with KAP1. Individual transfected HEK293 cells were treated
with vehicle or Dox (1 µM, 3 h) and analyzed as described in Fig.4.8.

As expected, KAP1(I368G), not KAP1(K366G), complemented KAP1
knockdown and efficiently suppressed basal p21-Luc activity in KAP1-depleted MCF-
7/TR/sh-KAP1 cells (Fig. 4.10), confirming the relevance of KAP1 binding with PP1cA
to its transcriptional

co-repressor activity.
C
D
62

Figure 4.10. KAP1(I368G), not KAP1(K366G), complements KAP1 knockdown and
efficiently suppressed basal p21-Luc activity in KAP1-depleted MCF-7/TR/sh-KAP1 cells. MCF-
7/TR/sh-KAP1 cells were transiently transfected with p21-Luc

and individual wild-type KAP1 or its
engineered

mutants. Following treatment with vehicle or doxycycline (1 µg/ml), transfected cells were
treated as indicated in Fig. 4.9 and luciferase activity of p21-Luc was measured and normalized against
firefly control reporter (pRL-TK) activity.

4.2.3 PP1cA/cB dephosphorylates KAP1 at Ser-824
Next, we assessed whether or not PP1cs affected DSB-included KAP1 Ser-824
phosphorylation. Since PP1cC had no effect on Dox-induced KAP1 Ser-824
phosphorylation in the absence or presence of exogenous MYPT1 (Fig. 4.11), in the
remaining studies, we focused on the effects of PP1cA and PP1cB.
63

Figure 4.11. The effect of PP1cA, PP1cB and PP1cC on endogenous KAP1 phosphorylation
level. The effect of PP1cA, PP1cB and PP1cC, in the absence and presence of exogenous MYPT1, on Dox
(5 µM, 30 min)-induced Ser-824 phosphorylation of endogenous KAP1. Relative levels (numbers in italic)
of Dox-induced pSer-824-KAP1 normalized against KAP1 are shown.

Because PP2cA dephosphorylates ATM post DSB breaks, we used PP2cA as the
positive control for KAP1 dephosphorylation assay. As expected, PP2cA decreased the
KAP1 Ser-824 phosphorylation post Dox-treatment (Fig. 4.12, left panel, lane 4 to lane
1), serving a control. Overexpression of PP1cB attenuated Dox-induced, but not basal
Ser-824 phosphorylation of endogenous KAP1 in MCF-7 cells (Fig. 4.12, left panel, lane
3 verses lane 1). By contrast, overexpression of PP1cA decreased basal KAP1 Ser-824
phosphorylation, and the effect of PP1cA on Dox-induced KAP1 Ser-824
phosphorylation seemed transient and more effective at an earlier phase post Dox-
treatment (Fig. 4.12, left panel, lane 2 versus lane 1). Together with results shown in
Figs 4.8 and 4.9, it is likely that while PP1cA associated with KAP1 for basal KAP1 Ser-
824 dephosphorylation, PP1cB was recruited to KAP1 to dephosphorylate DSB-induced
KAP1 Ser-824 phosphorylation. To further clarify the effect by PP1cA or PP1cB on
KAP1 Ser-824 phosphorylation, we established stable MCF-7 cells with specific
64
knockdown of PP1cA or PP1cB (Fig. 4.12, right upper panel). While both basal and
Dox (5 µM, 1 h)-induced KAP1 Ser-824 phosphorylation were greatly enhanced in MCF-
7/sh-PP1cA only (Fig. 4.12, right lower panel, lanes 2 and 5), the lack-of-PP1cB had,
unexpectedly, very limited effect on KAP1 Ser-824 phosphorylation (Fig. 4.12, right
lower panel, lanes 3 and 6). These results indicated that PP1cA’s role on basal KAP1
Ser-824 dephosphorylation was not fully compensated by PP1cB or PP1cC.

Figure 4.12. PP1cA dephosphorylates DSB-induced KAP1 Ser-824 phosphorylation.
Individual transfected MCF-7 cells (left panel) or MCF-7 cells with depleted PP1cA or PP1cB (right lower
panel), as indicated, were treated with vehicle or Dox (5 µM, 30 min or 1 h). Protein extracts were
analyzed with an anti-HA, anti-KAP1, anti-pSer-824-KAP1 or anti-tubulin antibody by Western analyses.
Relative levels (numbers in italic) of Dox-induced pSer-824-KAP1 normalized against KAP1 are shown.

As predicted, KAP1(I368G), a mutant with enhanced affinity with PP1cA,
exhibited a decreased basal and Dox-stimulated phosphorylation at Ser-824 after
normalization with expression level (Fig. 4.13, lane 3 versus lane 2), presumably
resulting from the increased association of KAP1(I368G) with PP1cA. Along the same
line, the overexpression of PP1cA markedly attenuated Dox-induced phosphorylation of
65
Ser-824 of KAP1(I368G) over KAP1 (Fig. 4.13, lower panel, lane 6 versus lane 4).
Consistently, the overexpression of PP1cA did not enforce Ser-824 hyper-
dephosphorylation of KAP1(K366G), a mutant with reduced affinity with PP1cA (Fig.
4.13, lane 5 versus lane 2). We postulated that PP1cA dephosphorylated KAP1 Ser-824
by physical association with KAP1 through its PP1-docking motif.

Figure 4.13. Phosphorylation status of KAP1(I368G) and KAP1(K366G). Transfected MCF-7
cells were treated as indicated and KAP1 Ser-824 phosphorylation profile was analyzed by Western
analyses (n=3 independent experiments). Relative levels (numbers in italic) of Dox-induced pSer-824-
KAP1 normalized against KAP1 are shown.

Treatment with proteasome inhibitor MG132 unexpectedly abrogated Dox-
induced KAP1 Ser-824 phosphorylation (Fig. 4.15). Moreover, since PP1’s inhibitor
protein I-2 negatively regulated PP1 activity in a variety of cellular events (50), it was
possible that the Dox-mediated modulation of KAP1 Ser-824 phosphorylation involved I-
2 or the stability of PP1/I-2. Co-IP experiments showed that I-2 exclusively complexed
with PP1cA among the three catalytic subunits examined (Fig. 4.14, lane 3 versus lanes 4
and 5). In addition, Dox-treatment did not alter the interaction between I-2 with PP1cA,
PP1cB and PP2cA (Fig. 4.14, lanes 6 to 8 versus lanes 3 to 5).
66

Figure 4.14. PP1/I-2 exclusively complexes with PP1cA among the three catalytic subunits
examined. Whole cell extracts from transfected HEK293 cells, as indicated, were IPed with an anti-HA
antibody. The co-IPed PP1-I-2 was visualized with an anti-Myc antibody.

To assess whether or not MG132 modulated the interaction of I-2 with PP1cA,
thereby affecting the endogenous KAP1 Ser-824 phosphorylation profile, MCF-7 cells
were transiently transfected with PP1cA or I-2, followed by vehicle- and Dox-treatment
in the presence and absence of proteasomal inhibitor MG132 or protease inhibitor E64d.
While PP1cA attenuated Dox-induced KAP1 Ser-824 phosphorylation (Fig. 4.15A, lane
4 versus lane 1), ectopic expression of I-2 further stimulated Dox-triggered endogenous
KAP1 Ser-824 phosphorylation (Fig. 4.15A, lane 7 versus lane 1). These data, in
conjunction with those from Fig. 4.14, lead us to reason that I-2 might sequester PP1cA
away from KAP1, rendering KAP1 Ser-824 hyper-phosphorylation. Significantly,
treatment with either MG132 or E64d markedly repressed Dox-induced Ser-824
phosphorylation of endogenous KAP1, in the absence and presence of I-2, in MCF-7
cells (Fig. 4.15B) and exogenous KAP1 in HEK293 cells (Fig. 4.15B).
67

Figure 4.15. PP1/I-2 might sequester PP1cA away from KAP1, rendering KAP1 Ser-824
hyper-phosphorylation while MG132 and E64d decrease KAP1 phosphorylation level. A) MCF-7
cells were transiently transfected with vector, HA-PP1cA or Myc-PP1-I-2. After recovery, cells were pre-
treated (1 h) with vehicle, MG132 (5 µM) or E64d (10 µM), then treated (30 min) with vehicle or Dox (5
µM). Protein extracts were analyzed by Western blot, with an anti-KAP1, anti-pSer-824-KAP1 or anti-
actin antibody. B) HEK293 cells were transiently transfected with vector, HA-PP1cA or Myc-PP1-I-2.
After recovery, cells were pre-treated (1 h) with vehicle, MG132 (5 µM) or E64d (10 µM), then treated (30
min) with vehicle or Dox (5 µM). Protein extracts were analyzed with an anti-KAP1, anti-pSer-824-KAP1
or anti-actin antibody by Western analyses.
A
B
68
To address the underlying mechanism that MG132 or E64d was capable of
repressing Dox-induced KAP1 Ser-824 phosphorylation, we assayed the steady-state
level of PP1cA in cells treated with MG132 or E64d. MG132- or E64d-treatment
increased the steady-state level of PP1cA and presumably ubiquitinated PP1cA of high
molecular weights (Fig. 4.16, lanes 5 and 8 versus lane 2). These results indicated that I-
2 and MG132/E64d had an opposite effect on regulating KAP1 Ser-824 phosphorylation
status by adjusting available PP1cA levels, supporting our contention that PP1cA is one
of the key molecules regulating KAP1 Ser-824 phosphorylation status.

Figure 4.16. MG132 and E64d block PP1cA degradation. Transfection in MCF-7 cells and cell
treatment were performed as described in Fig. 4.15. An anti-HA antibody was used to detect HA-PP1cA
level in MCF-7 cells (n=3 independent experiments).

4.2.4 PP1cA and PP1cB differentially regulate KAP1 SUMOylation
Next, experiments to differentiate the effect of PP1cA or PP1cB on KAP1
SUMOylation were performed. Consistent with our previous data, KAP1 SUMOylation
69
decreased following exposure to Dox in MCF-7/sh-control cells (Fig. 4.17, lane 4 versus
lane 1), serving as a control. Surprisingly, the knockdown of PP1cB markedly decreased
KAP1 SUMOylation levels in both vehicle- and Dox-treated cells (Fig. 4.17, lanes 3 and
6), and PP1cA depletion reproducibly had a modest, if any, effect on the overall KAP1
SUMOylation profile (Fig. 4.17, lanes 2 and 5).

Figure 4.17. Knocking down PP1cA/cB in MCF-7 cells regulates KAP1 SUMOylation status.
In vivo SUMOylation assays were carried out by co-transfecting cells with KAP1 and EGFP-SUMO-1 in
the absence and presence of Dox-treatment, as indicated, and visualized by Western analyses. Relative
levels (numbers in italic) of PP1cB-interacted KAP1 normalized against KAP1 input are shown.

In order to reconcile the discrepancy regarding the KAP1 SUMOylation profile in
MCF-7/sh-PP1cA and MCF-7/sh-PP1cB cells, we showed that the extent to which PP1cB
interacted with KAP1 increased, in an order of MCF-7/sh-PP1cA cells > MCF-7/sh-
control cells > MCF-7/sh-PP1-I-2 cells, with diminished levels of available PP1cA at the
ground state (Fig, 4.18). Consistently, Dox-treatment further enhanced the PP1cB/KAP1
interaction in the same order in these three cells (Fig, 4.18, lanes 4 to 6 versus lanes 1 to
70
3). These data lead us to conclude that PP1cA conceivably competes with PP1cB for
KAP1 and that Dox-treatment stimulates additional interaction of KAP1 with PP1cB.
To further explore the specific effects resulting from PP1cA or PP1cB on KAP1
SUMOylation, the KAP1 SUMOylation profile was examined with PP1-interaction
mutants. Consistent with our previous data, attenuated KAP1 Ser-824 phosphorylation
by ectopic expression of PP1cA or PP1cB stimulated KAP1 SUMOylation after Dox-
treatment (Fig, 4.18, lanes 5 and 6 versus lane 4). We further observed that PP1cA
overexpression markedly stimulated KAP1(I368G) SUMOylation in cells treated with
vehicle or Dox (Fig, 4.18, lanes 8 and 11 versus lanes 7 and 10), presumably by further
suppressing Ser-824 phosphorylation.

Figure 4.18. Diminish of PP1cA in MCF-7 cells allows PP1cB bind to KAP1 more rigidly. To
assess the extent of PP1cB interaction with KAP1, cells were transfected with FLAG-KAP1 and PP1cB,
as indicated. After treatment with vehicle or Dox (1 µM, 3 h), whole cell extracts from transfected MCF-
7 cells with distinct PP1cA, PP1cB or I-2 context were IPed with an anti-HA antibody. The co-IPed
KAP1 was visualized with an anti-FLAG antibody (right panel).

71
By contrast, PP1cB overexpression had a very modest stimulatory effect on the
mono- and tri-SUMOylation of KAP1(I368G) post Dox-treatment (Fig. 4.19, lane 12
versus lane 10; indicated by *). Lastly, overexpression PP1cA or PP1cB enhanced
KAP1(K366G) SUMOylation (Fig. 4.19, lanes 14 and 15 verses lane 13), and Dox-
treatment failed to render a decrease in PP1cA/PP1cB-stimulated KAP1(K366G)
SUMOylation (Fig. 4.19, lanes 17 and 18 versus lanes 14 and 15). The increased
KAP1(K366G) SUMOylation upon PP1cA overexpression (Fig. 4.19, lane 14) could
have resulted from the excess of PP1cA to overcome the low affinity of KAP1(K366G)
with PP1cA to dampen Ser-824 phosphorylation.

Figure 4.19. PP1cA and PP1cB differentially regulate KAP1 mutants SUMOylation. In vivo
SUMOylation assays of KAP1(wt), KAP1(I368G) and KAP1(K366G), in the absence or presence of Dox-
treatment, were analyzed by Western analyses (n=3 independent experiments).

To address whether PP1 stimulates SUMOylation beyond KAP1, we observed
that PP1cB, but not PP1cA, stimulated SUMOylation of endogenous RanGAP1, one of
the known SUMOylated cellular proteins (Fig. 4.20, left panel, lane 3 versus lane 1).
Conversely, only PP1cB knockdown abolished the SUMOylation of RanGAP1 (Fig. 4.20,
72
right panel, lane 6 versus lane 4), suggesting that PP1cB stimulated SUMOylation
beyond KAP1. Taken together, these results indicated that PP1cA augmented KAP1
SUMOylation after Dox-treatment mainly via the KAP1 PP1-docking motif to
dephosphorylate Ser-824 phosphorylation, and PP1cB stimulated KAP1 SUMOylation
by a more general means using both Ser-824 dephosphorylation-dependent and -
independent manners. The observed discrepancy in the inverse-coregulation of KAP1
Ser-824 phosphorylation (Fig. 4.7, lower panel) and SUMOylation (Fig. 4.17) in MCF-
7/sh-PP1cA compared to MCF-7/sh-control cells could have resulted from the effects of
increased PP1cB bound to KAP1 in the absence of PP1cA.

Figure 4.20. PP1cB, but not PP1cA, stimulates SUMOylation of endogenous RanGAP1.
Endogenous RanGAP1 SUMOylation was assessed by Western blots in PP1cA- or PP1cB-overexpressing
cells (upper panel) and underexpressing cells (lower panel) (n=3 independent experiments).

4.2.5 PP1cA/cB knockdown promotes de-repression of KAP1-targeted gene in
DNA damaged MCF-7 cells
Since PP1cA and PP1cB differentially regulate KAP1 SUMOylation status, and
our previous research proved KAP1 SUMOylation is critical for its function in DNA
damage responses, we wondered if PP1cA/cB regulate KAP1-targeted genes under
genotoxic stresses. Real-time Cell Growth Monitoring system and Annexin-V apoptosis
73
assays were used to monitor the effects of sh-PP1cA and sh-PP1cB on cell proliferation.
Both MCF-7/sh-PP1cA and MCF-7/sh-PP1cB cells showed relatively slower cell growth
rates compared to MCF-7/sh-control cells (Fig. 4.21).

Figure 4.21. MCF-7/sh-PP1cA and MCF-7/sh-PP1cB cells show relatively slower cell growth
rates compared to MCF-7/sh-control cells. Growth rates of MCF-7/sh-PP1cA, MCF-7/sh-PP1cB and
MCF-7/sh-Control cells were compared utilizing Real-time Cell Growth Monitoring system.

Consistent with Fig. 4.6, knockdown of KAP1 resulted in an increase in Annexin-
V positive MCF-7 cells (Fig. 4.22, left panel). While PP1cA depletion rendered a similar
phenotype as KAP1 knockdown (Fig. 4.22, left panel), knockdown of PP1cB resulted in
substantially more apoptotic cells than PP1cA depletion in Dox-treated MCF-7 cells (Fig.
4.22). Notably, introduction of unphosphorylatable KAP1(S824A) decreased Annexin-V
positive signals in unstressed MCF-7/sh-PP1cA cells (Fig. 4.22, right panel, lane 4
versus lane 3) and Dox-treated MCF-7/sh-PP1cB cells (Fig. 4.22, right panel, lane 12
versus lane 11), supporting the proposed role of PP1cA and PP1cB in modulating KAP1
Ser-824 phosphorylation.
74

Figure 4.22. PP1cA governs KAP1-mediated regulation of cell cycle. Annexin-V apoptosis
assays Mock and KAP1(S824A)-transfected MCF-7/sh-control, MCF-7/sh-PP1cA and MCF-7/sh-PP1cB
cells were treated with vehicle or Dox (1 µM) for 72 h and subjected to Annexin-V analysis (left panel) and
summarized (right panel).

Lastly, we examined the effect of PP1cA and PP1cB knockdown on Dox-induced
expression of KAP1-targeted genes and compared it to the effect of KAP1 depletion.
Based on the results in Fig. 4.6, p21, Bax, Puma and Noxa mRNA levels were compared
in MCF-7, MCF-7/sh-KAP1, MCF-7/sh-PP1cA and MCF-7/sh-PP1cB cells, prior to and
at 9 h post Dox-treatment. PP1cA knockdown significantly stimulated Dox-induced p21,
Bax and Noxa expression, mimicking the effect from KAP1 depletion (Fig. 4.23). The
induction of basal Bax expression in MCF-7/sh-PP1cA cells (Fig. 4.23) was consistent
with the observed increase in Annexin-V positive MCF-7/sh-PP1cA cells under
unstressed conditions (Fig. 4.22, right panel, lane 3 versus lanes 1 and 5). The lack of
effect from PP1cB-depletion on the induced expression of pro-arrest and pro-apoptotic
KAP1-targeted genes could be due to the fact that PP1cB functions at a latter time point
following DSB induction.
75

Figure 4.23. PP1cA governs KAP1-mediated regulation of gene expression. MCF-7 cells with
distinct KAP1, PP1cA or PP1cB context were treated and the steady-state p21, Bax, Puma and Noxa
mRNA levels were analyzed as described in Fig. 4.6. Results represent mean ± S.D., n=3 independent
experiments, p<0.05 considered significant.

4.2.6 PP1cA and PP1cB complex with KAP1 at the p21 proximal promoter
Since PP1cA and PP1cB interact with KAP1 with different modes (Fig. 4.9), we
speculated whether distinct complexes of KAP1 with PP1cA and PP1cB at the p21
proximal promoter affected H3-K9/K14 acetylation and H3-K9 dimethylation profiles.
First, we tested whether PP1cA or PP1cB was recruited to KAP1 at the p21 promoter
complex. Notably, PP1cA, not PP1cB, was detected constitutively bound at the p21
76
proximal promoter region (Fig. 4.24) and Dox-treatment increased the occupancy of both
PP1cA and PP1cB with KAP1 at the -20 region of p21 proximal promoter (Fig. 4.24).

Figure 4.24. PP1cA and PP1cB differentially bind at the p21 proximal promoter. ChIP-ReIP
experiments were performed on vehicle- or Dox (1 µM, 9 h)-treated MCF-7 cells with anti-FLAG-M2
beads (against KAP1) followed by ReIP with an anti-HA (against PP1cA or PP1cB) antibody or control
IgG. Quantification was performed by real-time PCR using primer pairs against -20 amplicons of
endogenous p21 gene (Table 1).

In addition, no co-linear chromatin regions of -713 or -3038 in p21 were IPed by
an anti-HA (against PP1cA or PP1cB) antibody in the same ChIP-ReIP experiments (Fig.
4.25). These results, in conjunction with those in Fig. 4.9, suggested that while PP1cA
constitutively formed a functional unit with KAP1 at the p21 proximal promoter, Dox-
treatment rendered the recruitment of additional PP1cA and PP1cB to KAP1 occupied at
the same region.
77

Figure 4.25. PP1cA and PP1cB do not bind at the p21 distal promoter. ChIP-ReIP experiments
were performed as described in Fig. 4.24. Quantification was performed by real-time PCR using primer
pairs against -3038 and -713 amplicons of endogenous p21 gene (Table 1).

Lastly, to test the importance of PP1cA or PP1cB for KAP1-associated chromatin
remodeling, CHIP-ReIP experiments performed in PP1cA or PP1cB over- and under-
expressing MCF-7 cell lines showed that PP1cA knockdown increased the accessibility
to KAP1-associated H3-K9/K14 acetylation prior to Dox-treatment, and overexpression
of PP1cB decreased the co-occupancy of K9/K14-acetylated H3 with KAP1 post Dox-
treatment at the p21 proximal promoter (Fig. 4.26, left panel). Conversely,
78
overexpression of PP1cA or PP1cB stimulated an increase in the co-occupancy of
dimethylated H3-K9 with KAP1 at the p21 proximal promoter post Dox-treatment (Fig.
4.26, right panel). In addition, overexpression of PP1cB resulted in a significant increase
in the occupancy of KAP1-associated dimethylated H3-K9 prior to Dox-treatment (Fig.
4.26, right panel).

Figure 4.26. PP1cA and PP1cB differentially regulate histone H3 K9/K14 acetylation

and H3-K9
dimethylation at the p21 proximal promoter. ChIP-ReIP experiments were performed and analyzed as described in
Fig. 4.24, with ReIP with an anti-acetylated H3-K9/K14, anti-dimethylated H3-K9 or control antibody.
79

Figure 4.27. PP1cA and PP1cB do not affect histone H3 K9/K14 acetylation

and H3-K9
dimethylation at the p21 distal promoter. ChIP-ReIP experiments were performed as described in Fig.
4.26. Quantification was performed by real-time PCR using primer pairs against -3038 amplicons of
endogenous p21 gene (Table 1). Results represent mean ± S.D., n=3 independent experiments; p<0.05
considered significant.

4.3 Discussion
Knowing when KAP1 is SUMOylated or phosphorylated, and how it is regulated,
in vivo will be required to fully appreciate the biological effects of this key transcriptional
co-repressor. Our results suggest a surprising role for PP1 in regulating the dynamic
function of KAP1 and indicate a molecular framework for PP1 function in unstressed and
DNA damaged cells (Fig. 4.28).
Recent studies have indicated that PP1 is involved in DDR (91), including
checkpoint activation (25), DNA repair (30, 112) and recovery from DNA damage
80
checkpoint arrest (16). SUMOylation has also been established as one of the critical
events in cellular responses to a wide range of DNA-damaging reagents (63). However,
there is no previous experimental evidence for PP1’s role in regulating SUMOylation in
response to DNA damage. In this chapter, detailed experimental analyses were
performed on the role of PP1cA and PP1cB in regulating KAP1 SUMOylation as a
means to regulate key KAP1-targeted gene expression during DDR. We showed for the
first time that PP1cA physically bound to KAP1 and that the interaction of PP1cA with
KAP1 was essential to establish the minimal level of Ser-824 phosphorylation required
for KAP1’s co-repressor function in unstressed cells. Site-specific mutagenesis studies
further revealed that PP1cA interacted with K366G- and I368G-substituted KAP1 with
different affinity, which in turn displayed differential SUMOylation and Ser-824
phosphorylation profiles. In contrast, PP1cB was recruited to KAP1 post Dox-treatment
(Figs. 4.9 (lower left panel) and 4.24), and its stimulatory effect on SUMOylation was
expanded from KAP1 (Fig. 4.17) to RanGAP1 (Fig. 4.20). Together with our
observations that the co-repressor and chromatin remodeling functions of KAP1 are
under the regulation of ATM following DSB induction (47, 51, 106, 118), we propose
that PP1 serves a key role in both unstressed and DNA damaged cells by coordinating
KAP1 Ser-824 phosphorylation and SUMOylation switch.
A pertinent and intriguing question is how PP1 stimulates KAP1 SUMOylation.
Our observation that PP1cB was necessary for proper SUMOylation of both KAP1 and
RanGAP1 points out a more general function for PP1 as an enhancer of SUMOylation.
Global effects on SUMOylation could be achieved by targeting E1 or E2 enzymes, as
they are both unique and required for all SUMOylation processes. For example, a small
81
RWD-containing protein was shown to interact with Ubc9 to increase the noncovalent
binding of SUMO-1 to Ubc9 (7). Very recently, Ivanov et al. reported that the KAP1
PHD finger was an E3 SUMO ligase for itself by demonstrating that the KAP1 PHD
finger physically interacted with Ubc9 and directed SUMOylation of the KAP1
bromodomain (36). One possibility is that PP1 stimulates KAP1 self-SUMOylation by
enhancing Ubc9 binding to KAP1 or KAP1’s own E3 ligase activity. The second
possibility is that PP1 mediates the interplay of phosphorylation and SUMOylation at the
level of target proteins. It has become evident from published examples that the target
phosphorylation may serve both as a positive and a negative signal for SUMOylation in a
context-dependent manner (4). For example, phosphorylation enhances the binding of
SUMO and PIAS1 (88). By contrast, we observed that phosphorylation of KAP1 at Ser-
824 impairs its SUMOylation in the chapter 3 (Fig. 3.8). In this scenario,
dephosphorylation could lead to structural changes, which facilitate the binding of Ubc9
or E3 ligase to the target protein. Since PP1cA and PP1cB interact with KAP1 and
suppress Ser-824 phosphorylation with different mechanisms, PP1 could favor KAP1
SUMOylation by inducing KAP1 conformational change via dephosphorylating Ser-824
and/or protein-protein interactions to facilitate additional interaction with Ubc9.
Analogously, SUMOylation of Ubc9 is also involved in target discrimination between
Sp100 and RanGAP1 (44). It is possible that PP1cA complexes with KAP1 to maintain
the Ser-824-unphosphorylated status, facilitating a “pro-KAP1 SUMOylation”
environment, while PP1cB may stimulate the SUMOylation machinery in addition to
attenuating ATM-activated Ser-824 phosphorylation.
82
Based on our data, we propose the following model for the role of PP1 in
regulating KAP1 co-repressor activity (Fig. 4.28): KAP1 exists in a dynamic balance
between Ser-824-phosphorylated/unSUMOylated KAP1 (inactive co-repressor) and
dephosphorylated /SUMOylated KAP1 (active co-repressor) in unstressed cells. PP1cA
constitutively binds to KAP1 and sets a basal transcription rate for a subset of pro-arrest
and pro-apoptotic KAP1-targeted genes. Following DSB induction, the already bound
PP1cA dephosphorylates ATM-induced KAP1 Ser-824 phosphorylation and newly
recruited PP1cA and PP1cB timely restore KAP1 SUMOylation, which in turn resumes
the co-repressor function. In our model, we further predict that the magnitude of PP1cA
bound to KAP1 sets the threshold for ATM activation required to overcome PP1cA-
mediated Ser-824 dephosphorylation. In contrast, PP1cB interacts with KAP1 in a spatio
(lack of PP1cA)-temporal (post DSB induction) manner to promote KAP1 SUMOylation.
Since both PP2A and PP4C directly dephosphorylate γ-H2AX to differentially regulate γ-
H2AX levels that originate from different stressors and/or from different degrees of DNA
damage (13, 14), it is not surprising that both PP1cA and PP1cB are involved in timely
regulating KAP1 Ser-824 dephosphorylation and SUMOylation. With this caveat, PP1-
dependent stimulation of KAP1 SUMOylation may represent an emerging paradigm to
interconnect the interplay of post-translational modifications and gene regulation
networks.
Yamashiro et al. recently reported that PP1 antagonizes the function of polo-like
kinase 1 (PLK1) through the interaction with MYPT1 during mitosis (108). In addition,
PP1 was also reported to repress Nur77 expression by dephosphorylating HDAC7
through MYPT1, thereby inhibiting apoptosis in thymocytes (71). We reported herein
83
that MYPT1 is involved in the interaction of PP1cB, but not PP1cA, with KAP1,
presumably regulating KAP1 Ser-824 phosphorylation. In addition to functioning as a
transcriptional co-repressor, Ser-824 phosphorylated KAP1, an ATM-dependent event
upon DNA DSB damage, also promoted chromatin relaxation (118). Furthermore, KAP1
knockdown was very recently shown to increase chromatin accessibility in
heterochromatin and to restore DNA repair competence in ATM-deficient cells (22).
These authors further showed that phosphorylation of KAP1 at Ser-824 only perturbed
interaction with silencing factors, such as HDAC1, without attenuating the binding of
KAP1 to its target. In light of the multifunction of KAP1 (9, 22, 36, 39, 46, 68, 69, 79,
80, 87, 97, 98, 104, 106) it is tempting to speculate that PP1 might serve a global role in
regulating many biological events through KAP1.
In summary, our results presented herein provide novel mechanistic insights into
how PP1 impacts on DDR, influencing not only KAP1 Ser-824 dephosphorylation, but
also its SUMOylation and targeted gene expression. Strikingly, our findings highlight
that PP1 confers effects through crosstalk between different post-translational
modifications. Considering the number of transcription factors, associated activators and
repressor complexes, which are SUMOylated, it is likely that the regulation of each
SUMOylation is essential for allowing appropriate cell responses. Our work expands the
concept of how SUMOylation is regulated, whether global and/or target-specific, and
how it participates in cellular responses to DNA damage.
84

Figure 4.28. Model depicting the regulation of KAP1 SUMOylation and transcriptional repression
85

CHAPTER 5: THE ROLE OF SUMOYLATION,
PHOSPHORYLATION AND UBIQUITINATION CROSSTALK IN
REGULATING KAP1 DEGRADATION UPON GENOTOXIC
STRESS

5.1 Introduction
Based on results from studies presented in the chapters 3 and 4, we concluded that
Dox-induced KAP1 Ser-824 phosphorylation antagonizes its SUMOylation. However,
the underlying mechanism still remains unclear. There are three possibilities. First, it is
possible that Ser-824 phosphorylation of KAP1 blocks KAP1 SUMOylation by affecting
the binding of KAP1 with either SUMO-1 or E2-Ubc9. The second possibility is that
phosphorylation of SUMOylated KAP1 leads to its rapid degradation. Lastly,
genotoxicity could activate deSUMOylase SENP-1/-2; however, which has been partially
ruled out by us in the chapter 3 (Fig. 3.11).
To explore the molecular mechanism(s) underlying genotoxicity-mediated
reversal of KAP1 SUMOylation profiles, we performed in vitro SUMOylation assay
using KAP1(WT), KAP1(S824A) and KAP1(S824D). In addition, we have repeatedly
observed a decreased intensity of detected KAP1(S824D) signal in response to prolonged
Dox-treatment during our studies. Hence, we hypothesized that KAP1 is subjected to
ubiquitination/proteasome-dependent degradation during genotoxic stresses. Given that
several recent studies have linked SUMOylation with ubiquitin/proteasome-mediated
86
protein degradation, we thus sought to examine this possibility. RNF4, RING (really
interesting new gene) finger protein 4 (a.k.a. small nuclear RING finger protein
(SNURF)), has been reported to mediate the degradation of promyelocytic leukemia
(PML) proteins via SUMOylation-dependent ubiquitination (26, 45, 92). Endogenous
RNF4 reportedly localizes to the nuclear bodies (NBs) that overlap with or are adjacent to
the domains containing PML proteins and SUMO-1. RNF4 non-covalently binds to
SUMO-1 efficiently through its SUMO-interacting motif (SIM) (86) and is also
SUMOylated at nonconsensus attachment sites (26). Ectopic expression of SUMO-1
markedly enhances the interaction between PML3 (PML IV) and RNF4, but covalent
attachment of SUMO-1 to either protein is not required (26). An evolutionarily
conserved family of SIM-containing RING-finger proteins that regulate eukaryotic
genome stability through linking SUMO:SIM-mediated protein-protein interaction with
ubiquitin conjugation has recently been documented in yeasts and mammalian cells.
Among them, RNF4 is identified as the orthologue of SUMO-targeted ubiquitin ligase in
mammalian cells (89). However, the signaling for RNF4-medited, SUMO-dependent
ubiquitination/degradation of targeted protein is not yet established. To date, PML is the
only known protein reportedly to be efficiently degraded by RNF4 (45, 92).
Herein, we explored the possibility that RNF4 mediates SUMO-dependent
degradation of KAP1. Our hypothesis is that while SUMOylated KAP1 is stable as a
transcriptional co-repressor under unstressed condition, SUMOylated KAP1 is
phosphorylated by ATM at Ser-824 and targeted for degradation, allowing for a rapid
adaptive response to genotoxic stresses, such as DSB induction by Dox-treatment. We
propose that ATM-mediated phosphorylation of KAP1 at Ser-824 somehow facilitates
87
the recruitment of RNF4 to SUMOylated KAP1 or that ATM activates RNF4 directly,
resulting in the poly-ubiquitination and degradation of SUMOylated KAP1 and the
transcriptional de-repression of KAP1 downstream genes.

5.2 Results
5.2.1 Phosphorylation affects KAP1 SUMOylation in vitro.
To dissect the mechanism underlying the antagonism between genotoxicity-
induced KAP1 Ser-824 phosphorylation and KAP1 SUMOylation, we performed in vitro
SUMOylation assay to measure the capacity of KAP1(WT), KAP1(S824A) and
KAP1(S824D) being SUMOylated by SUMO-1. As shown in Fig. 5.1, KAP1(S824D)
exhibited a slower SUMOylation pattern than KAP1(WT) and KAP1(S824A), suggesting
that phosphorylation status of KAP1 affects its SUMOylation.
KAP1 in vitro SUMOylation
0
0.5
1
1.5
2
2.5
3
3.5
4
4.5
5
0 h 2 h 16 h
Relative SUMOylation level
KAP1(WT)
KAP1(S824A)
KAP1(S824D)

Figure 5.1. Ser-824 phosphorylation affects KAP1 SUMOylation. in vitro SUMOylation assay
using Flag-KAP1(WT), -KAP1(S824A) or -KAP1(S824D) protein with SUMO-1, SUMO E1, SUMO E2
and ATP. After incubation at 30 °C for 0, 2, and 16 h, equal amount of reaction mixture was analyzed with
an anti-Flag, anti-SUMO or anti-actin antibody by Western analyses. Relative levels of SUMOylated
KAP1 are normalized with each of the starting SUMOylation level, as indicated.

88
5.2.2 Overexpression of SUMO-1 accelerates KAP1(S824D) degradation in vivo.
Next, we overexpressed SUMO-1 to evaluate the steady-state levels of
KAP1(WT), KAP1(S824A; to mimic Ser-824-unphosphorylatable KAP1) or
KAP1(S824D; to mimic Ser-824-phosphorylated KAP1) and its corresponding
SUMOylated forms. While overexpression of EGFP-SUMO-1 only modestly decreased
the signal intensities from parental KAP1(WT) and KAP1(S824A) (Fig. 5.2, lanes 2 and
4 versus lanes 1 and 3), a marked decrease in the level of unSUMOylated KAP1(S824D)
upon EGFP-SUMO-1 overexpression was noticed (Fig. 5.2, lane 6 versus lane 4),
suggesting that overexpression of SUMO-1 induced KAP1 degradation when Ser-824 is
phosphorylated.

Figure 5.2. Overexpression of SUMO-1 accelerates the degradation of KAP1(S824D).
HEK293 cells were transfected with Flag-KAP1(WT), Flag-KAP1(S824A), Flag-KAP1(S824D) or with
EGFP-SUMO-1. Equal amount of whole cell extract was analyzed with an anti-Flag, anti-EGFP or anti-
actin antibody by Western analyses.

89

5.2.3 E3 ligase RNF4 induces poly-ubiquitination and degradation of KAP1.
To evaluate the effect by RNF4 knockdown on KAP1 SUMOylation and its
degradation, HEK293/sh-RNF4 cells were engineered with lenti-sh-RNF4. A similar
transfection, as described in Fig. 5.2, was performed in both HEK293 and HEK293/sh-
RNF4 cells. As expected, we observed that knockdown of RNF4 in HEK293 cells
resulted in an accumulation of SUMOylated KAP1(WT), KAP1(S824A) and
KAP1(S824D) as well as unmodified KAP1(S824D) (Fig. 5.3, lanes 4, 5 and 6 versus
lanes 1, 2 and 3), supporting the involvement of RNF4 in the degradation of
SUMOylated KAP1.

Figure 5.3. Knockdown of RNF4 partially reverses degradation of SUMOylated KAP1.
HEK293 and HEK293/sh-RNF4 cells were transfected with Flag-KAP1(WT), Flag-KAP1(S824A), Flag-
KAP1(S824D) or with EGFP-SUMO-1. Equal amount of whole cell extract was analyzed with an anti-
Flag, anti-EGFP or anti-actin antibody by Western analyses.

From our previous studies, there were at least 3 major SUMOylation sites, K554,
K779 and K804 (47) with 2 minor SUMOylation sites, K676 and K575, in KAP1 (36).
90
To determine the involvement of a specific SUMOylation site(s) in the observed
degradation of SUMOylated KAP1, we utilized constructs with specific K/R substitutions
on desired SUMOylation sites of KAP1(WT) and KAP1(S824D) to examine which K/R
mutation blocks the degradation of KAP1. Among all mutants examined, it appeared that
K554R mutation prevented KAP1(S824D) from its SUMO-dependent degradation (Fig.
5.4, lane 6 versus lane 5), and K676R partially reversed it (Fig. 5.4, lane 7 versus lane 5),
indicating that Lys-554 plays a critical role in promoting the degradation of
phosphorylated/SUMOylated KAP1.

Figure 5.4. K554R and K676R mutations block SUMO induced KAP1(S824D) degradation.
HEK293 cells were transfected with Flag-KAP1(WT) or its mutants, as indicated, with EGFP-SUMO-1.
Equal amount of whole cell extract was analyzed with an anti-Flag, anti-EGFP or anti-actin antibody by
Western analyses.

Albeit with a reduced level after normalization against transfection efficiency,
KAP1(S824D) exhibited much higher level in the absence of exogenous EGFP-SUMO-1
than that in the presence of EGFP-SUMO-1(Fig. 5.5, lane 5 versus Fig. 5.4, lane 5). In
91
the absence of exogenous EGFP-SUMO-1, the reduced steady-state KAP1(S824D) level
compared to that for KAP1(WT), after normalizing with actin level, was probably due to
KAP1(S824D) SUMOylation with endogenous SUMO-1/-2/-3 and the following
degradation.

Figure 5.5. K554R and K676R mutations block SUMO-1 induced KAP1(S824D) degradation.
HEK293 cells were transfected with Flag-KAP1(WT) or its mutants, as indicated. Equal amount of whole
cell extract was analyzed with an anti-Flag or anti-actin antibody by Western analyses.

5.2.4 Mono-ubiquitination blocks KAP1 SUMOylation, which further blocks
KAP1 degradation under cellular stress.
SUMO-2/3 were demonstrated to be more efficiently than SUMO-1 for their
ability to recruit RNF4 to SUMOylated PML, yielding the poly-SUMOylation-dependent
ubiquitination and promoting subsequent degradation of SUMOylated PML (92).
Therefore, we examined whether SUMO-2 promotes the degradation of KAP1(S824D)
more efficiently than SUMO-1. As shown in Fig. 5.6, overexpression of SUMO-2
further accelerated the degradation of KAP1(S824D) (lane 2 versus lane 1), while K554R
or K676R mutation reversed it (lanes 3 and 4 versus lane 1). Notably, we observed that
the first slow-migrating KAP1(K554R/S824D) species moved faster than those of
KAP1(WT) and KAP1(K676R, S824D) (indicated by
*
), and the second slow-migrating
92
KAP1(K554R/S824D) species traveled slower than those derived from KAP1(WT) and
KAP1(K676R, S824D) (indicated by +) (Fig. 5.6, lane 3 versus lanes 1 and 4). This
observation suggested that KAP1(S824D) was differentially poly-SUMOylated or
ubiquitinated when K554 was not available.

Figure 5.6. K554R and K676R mutations block SUMO-2-induced KAP1(S824D) degradation.
HEK293 cells were transfected with Flag-KAP1(WT) or its mutants, as indicated. Equal amount of whole
cell extract was analyzed with an anti-Flag or Anti-actin antibody by Western analyses.
*
and +

depict the
species with differential migration as discussed in the text.

To test the possibility that Ser-824 phosphorylation affects KAP1 ubiquitination,
we co-transfected KAP1(WT) or KAP1(S824D) with Myc-SUMO-2 and/or HA-ubiquitin
(Ub) in HEK293, HEK293/sh-RNF4 or HEK293/sh-PP1cA cells. In this set of
experiment (Figs. 5.7, 5.8 and 5.9), the amount of KAP1(WT) transfected was adjusted to
1/5 amount of the KAP1(S824D) used. Surprisingly, overexpression of Ub caused an
increase in the steady-state level of KAP1(WT) (Fig. 5.7, upper panel, lane 2 versus lane
1), but not KAP1(S824D) (Fig. 5.7, upper panel, lane 6 versus lane 5). Consistent with
93
our previous results in Fig 5.3, RNF4 knockdown stabilized KAP1(WT) in unstressed
condition (Fig. 5.7, middle panel, lanes 1 and 3 versus upper panel, lanes 1 and 3) and
upon SUMO-2-overexpression (Fig. 5.7, middle panel, lanes 3 and 4 versus upper panel,
lanes 3 and 4). Furthermore, overexpression of SUMO-2 accelerated the degradation of
KAP1(S824D) (Fig. 5.7, upper panel, lane 7 versus lane 5), but with a modest effect on
KAP1(WT) (Fig. 5.7, upper panel, lane 3 versus lane 1). Moreover, knockdown of
RNF4 dampened SUMO-2-induced KAP1(S824D) degradation (Fig. 5.7, middle panel,
lane 7 versus upper panel, lane 7). These data together suggested that RNF4 played a
central role in KAP1 degradation, and that both Ub and SUMO-2 were involved in this
process. We further postulated that KAP1 was subjected to different types of
ubiquitination, i.e., mono-ubiquitination versus poly-ubiquitination. Moreover, a lack of
marked effect by depletion of PP1cA on KAP1(WT) level (Fig. 5.7, lower panel, lanes 1
to 4 versus upper panel, lanes 1 to 4) suggested that sh-PP1cA had limited effect on
KAP1(WT) steady-state level.
94

Figure 5.7. RNF4 plays a central role on SUMO-2 induced KAP1 degradation. HEK293,
HEK293/shRNF4 and HEK293/sh-PP1cA cells were co-transfected with Flag-KAP1(WT) or Flag-
KAP1(S824D) with Myc-SUMO-2 and/or HA-Ub, as indicated. Equal amount of whole cell extract was
analyzed with an anti-Flag or Anti-actin antibody by Western analyses.

95
To further ascertain RNF4’s role in promoting KAP1 ubiquitination/degradation,
we co-transfected KAP1(WT) or KAP1(S824D) with HA-Ub in HEK293, HEK293/sh-
RNF4 and HEK293/sh-PP1cA cells. We observed that overexpression of Ub stabilized
KAP1(WT), but not KAP1(S824D) (Fig. 5.8, upper panel versus lower panel).
Moreover, while knockdown of RNF4 stabilized KAP1(WT) in the absence and presence
of exogenous Ub (Fig. 5.8, upper panel, lanes 2 and 5 versus lanes 1 and 4), it had
almost no effect on the steady-state level of KAP1(S824D) in the absence of exogenous
Ub (Fig. 5.8, lower panel, lane 2 versus lanes 1).

Figure 5.8. Overexpression of Ub stabilizes KAP1(WT) more efficiently than KAP1(S824D)
and knockdown of RNF4 stabilizes KAP1(WT) in the absence and presence of Ub. HEK293,
HEK293/shRNF4 and HEK293/sh-PP1cA cells were co-transfected with Flag-KAP1(WT) or Flag-
KAP1(S824D) with HA-Ub, as indicated. Equal amount of whole cell extract was analyzed with an anti-
Flag or Anti-actin antibody by Western analyses.

To extrapolate the results shown in Fig. 5.8, we performed a similar co-
transfection experiment with overexpression of SUMO-2. As expected, while
knockdown of RNF4 had limited effect on KAP1(WT) level upon SUMO-2
96
overexpression (Fig. 5.9, upper panel, lane 2 versus lane 1), it greatly stabilized
KAP1(S824D) in the presence of SUMO-2 (Fig. 5.9, lower panel, lane 2 versus lane 1),
supporting our hypothesis that RNF4 is required for SUMO-2-induced KAP1 degradation.
By contrast, RNF4 knockdown, in the presence of exogenous SUMO-2 and Ub, elicited a
more noticeable on the steady-state level of KAP1(WT) (Fig. 5.9, upper panel, lane 5
versus lane 2) than on KAP1(S824D) (Fig. 5.9, lower panel, lane 5 versus lane 2). This
observation suggested that when KAP1 is constitutively phosphorylated (S824D mutation
to mimic its phosphorylation), RNF4’s role could be compensated by other to-be-
identified E3 ligase with SUMO-targeted ubiquitination function. Moreover,
overexpression of Ub, in the absence of exogenous SUMO-2, stabilized KAP1(WT) in
HEK293/sh-PP1cA cells (Fig. 5.9, upper panel, lane 6 versus lane 3). It is possible that
while more PP1cB was recruited to KAP1 in the absence of PP1cA (Fig. 4.18), thus
stimulating KAP1 SUMOylation (Fig. 4.19), overexpression of Ub competed with
SUMO-2 for the same Lys-residue(s) and attenuated subsequent SUMO-dependent
KAP1 degradation.

97

Figure 5.9. Knockdown of RNF4 stabilizes KAP1(WT) in the presence of SUMO-2 and Ub.
HEK293, HEK293/shRNF4 and HEK293/sh-PP1cA cells were co-transfected with Flag-KAP1(WT) or
Flag-KAP1(S824D) with Myc-SUMO-2 and/or HA-Ub, as indicated. Equal amount of whole cell extract
was analyzed with an anti-Flag or Anti-actin antibody by Western analyses. The image for KAP1(S824D)
was exposed longer to due to its accelerated degradation nature in the presence of SUMO-2 and Ub.

5.2.5 KAP1 is mono-ubiquitinated at K554, which blocks the SUMOylation and
poly-ubiquitination/degradation.
Taken together from results shown in Figs. 5.7, 5.8 and 5.9, it is possible that
while KAP1 poly-ubiquitination is enhanced by SUMO-2, leading to its degradation, the
98
mono-ubiquitination on a specific KAP1 SUMOylation site competes with its
SUMOylation, therefore preventing KAP1 degradation. To test this possibility, we
performed co-IP assays to profile KAP1 ubiquitination in the absence or presence of
Myc-SUMO-2. Whole cell extracts were IPed with an anti-Flag-M2 antibody and the
IPed-KAP1 was analyzed with an anti-Flag, -HA or -Myc antibody. As expected, KAP1
was, albeit at lower levels in the absence of Myc-SUMO-2, mono- and poly-ubiquitinated,
and overexpression of SUMO-2 greatly enhanced KAP1 ubiquitination (Fig. 5.10, left
panel, lane 4 versus lane 3). Notably, the mono-ubiquitinated KAP1 in the unstressed
condition was the major ubiquitinated KAP1 species (Fig. 5.10, left panel, lane 3,
Indicated by h ). In addition, we observed a species with similar migration when we used
anti-Flag, anti-HA and anti-Myc (Fig. 5.10, left upper panel, lanes 2,4 and 6, indicated
by
*
), which could contain both Ub- and SUMO-2-modified KAP1. To confirm that
Dox-induced KAP1 degradation depends on both SUMO-2 and Ub, HEK293 cells were
co-transfected with a combination of Flag-KAP1(WT), 6xHis-Ub and Myc-SUMO-2 and
subjected to Dox-treatment (1 µM, 3 h). Clearly, while overexpression of Ub alone
stabilized KAP1 (Fig. 5.10, right panel, lane 2 versus lane 1), overexpression of Ub and
SUMO-2 accelerated KAP1 degradation (Fig. 5.10, right panel, lane 4 versus lane 3),
supporting our hypothesis that Dox-treatment leads to a SUMO-dependent,
ubiquitination-mediated KAP1 degradation.
99

Figure 5.10. SUMO-2 greatly induced KAP1 ubiquitination. HEK293 cells were co-transfected
with Flag-KAP1(WT), HA-Ub and Myc-SUMO-2. Equal amount of whole cell extract was IPed with an
anti-Flag-M2 antibody and the level of IPed-KAP1 was visualized with an anti-Flag, -HA or -Myc antibody.
h indicates mono-ubiquitinated KAP1 and
*
indicates the species with a similar slow migration that we
observed when we used anti-Flag, anti-HA and anti-Myc antibodies (left panel). HEK293 cells were co-
transfected with a combination of Flag-KAP1(WT), 6xHis-Ub and Myc-SUMO-2. Cells were treated
with Dox (1 µM) for 3 h at 30 h post transfection. Equal amount of whole cell extract was analyzed with
an anti-Flag, -6xHis, -Myc or -actin antibody by Western analyses. (right panel)

To assure the involvement of K554 in KAP1 degradation, we co-transfected Flag-
KAP1(WT), Flag-KAP1(S824D), Flag-KAP1(K554R), Flag-KAP1(K676R) with 6xHis-
Ub and/or Myc-SUMO-2 and performed the co-IP assays using an anti-Flag-M2 antibody.
We observed a decrease of ubiquitinated KAP1 in KAP1(K554R)-transfected cells (Fig.
5.11, lane 1 versus lane 5) and a partial decrease in KAP1(K676R)-transfected cells (Fig.
5.11, lane 3 versus lane 5). Importantly, there was an inverse correlation between Ub-
modified KAP1(K554R), KAP1(K676R), KAP1(WT) and KAP1(S824D) levels and
levels of their corresponding unmodified KAP1 (Fig. 5.11, lanes 2 4, 6 and 8).
100

Figure 5.11. KAP1 is ubiquitinated on K554 and 676, which related with SUMO-dependent
degradation. HEK293 cells were co-transfected with Flag-KAP1(WT) or its mutants with 6xHis-Ub and
Myc-SUMO-2. Equal amount of whole cell extract was IPed with an anti-Flag-M2 antibody and the level
of IPed-KAP1 was visualized with an anti-Flag, -6xHis or -Myc antibody.

Lastly, we used co-IP assays to test whether KAP1 K554 or K676 ubiquitination
is required for its SUMOylation-dependent and S824-phosphorylation-induced
degradation. HEK293 cells were co-transfected with a combination of Flag-
KAP1(K554R), -KAP1(K676R), -KAP1(K554R/S824D), -KAP1(K676R/S824D),
6xHis-Ub and Myc-SUMO-2 as indicated. Equal amount of whole cell extract was IPed
with an anti-Flag-M2 antibody and the IPed-KAP1 was analyzed with an anti-Flag, anti-
6xHis or anti-Myc antibody. Consistent with our previous data, K554R mutation
attenuated KAP1 overall ubiquitination and blocked SUMOylation-induced
KAP1(S824D) degradation (Fig, 5.12, lanes 3 and 4 versus lanes 1 and 2). We also
101
observed an increased ubiquitination accompanied with a concurrent decrease of the
corresponding KAP1 signal in KAP1(K676R/S824D)-transfected cells (Fig, 5.12, lane 4
versus lane 3, 1
st
and 3
rd
panels).

Figure 5.12. KAP1 K554 ubiquitination is required for its SUMO-dependent phosphorylation
induced degradation. HEK293 cells were co-transfected with Flag-KAP1(K554R), -KAP1(K676R), -
KAP1(K554R/S824D) or -KAP1(K676R/S824D) with 6xHis-Ub and Myc-SUMO-2. Equal amount of
whole cell extract was IPed with an anti-Flag-M2 antibody and the level of IPed-KAP1 and whole cell
lysates were visualized with an anti-Flag, -6xHis or -Myc antibody.

5.3 Discussion
As a multifunctional protein, KAP1 regulates the transcription of thousands of
genes. In the chapter 3, we concluded that post-translational modifications are essential
102
for KAP1 to properly regulate the expression of KAP1-target genes, including p21,
Gadd45α, Bax, Puma and Noxa. We have further shown that the crosstalk between
SUMOylation and Ser-824 phosphorylation/dephosphorylation dictates chromatin-
remodeling activities towards KAP1-occupied sites through modulating histone H3-K14
acetylation and H3-K9/K14 dimethylation status in the chapter 4. Our results presented
in this chapter suggested that KAP1 Ser-824 phosphorylation not only affects its
SUMOylation potential (Fig. 5.1), but also leads to the degradation of already
SUMOylated KAP1 (Fig. 5.2).
Recent studies have indicated an important role of SUMO-targeting ubiquitination
E3 ligase RNF4 in degrading SUMOylated PML (26, 45, 92). However, there was no
previous experimental evidence for RNF4’s role in regulating SUMOylated protein
degradation in response to DNA damage-induced ATM activation. Although RNF4 was
demonstrated to be associated better with SUMO-2/-3 than with SUMO-1 (92), we
demonstrated herein that knockdown of RNF4 in HEK293 cells also resulted in an
accumulation of SUMO-1-modified KAP1 (Fig. 5.3). Site-specific mutagenesis studies
further revealed that K554R mutation effectively blocked KAP1(S824D) degradation
upon SUMO-1 (Fig. 5.4) and SUMO-2 (Fig. 5.9) overexpression, indicating that Lys-554
plays a critical role in the degradation of phosphorylated-SUMOylated KAP1.
Notably, we observed a marked reduction of the high molecular weight slow-
migrating SUMO-2-modified KAP1(K554R) (Fig. 5.4) and KAP1(K554R/S824D) (Fig.
5.6), confirming the important role in of K554 in KAP1 SUMOylation. Intriguingly,
knockdown of RNF4 or overexpression of Ub elicited a similar stabilizing effect on
unmodified KAP1 (Figs. 5.7~5.9). Our co-IP assays further provided evidence that
103
KAP1 is mono- and poly-ubiquitinated, potentially, at K554. Based on the result shown
in Fig. 5.10 together with the shift of apparent MW of a presumable SUMO-2-modified
KAP1(K554R/S824D) species observed in Fig. 5.6 (lane 3), we proposed the following
model for the role of RNF4 in regulating KAP1 ubiquitination/degradation: KAP1 is
subjected to SUMOylation as well as both mono-ubiquitination and SUMO-dependent
poly-ubiquitination. Ub competes with SUMO-2 for K554 to increase the steady-state
level of KAP1 by mono-ubiquitination. When K554 is SUMOylated, the K554-(SUMO-
2)
n
will be poly-ubiquitinated by RNF4, leading to a rapid degradation under stress.
KAP1 Ser-824 phosphorylation is the signal for RNF4-mediated, SUMO-dependent
KAP-1 degradation. Together with the results from in vitro SUMOylation assay, we
identified the molecular mechanisms underlying why and how KAP1 Ser-824
phosphorylation antagonizes its SUMOylation. When KAP1 is phosphorylated at Ser-
824, its SUMOylation process is deterred. At the same time, it sends signals to recruit
RNF4, which poly-ubiquitinates SUMOylated KAP1 and leads to its degradation. While
mono-ubiquitination of KAP1 at K554 blocks its SUMOylation, SUMO-dependent poly-
ubiquitination of KAP1 leads to KAP1 degradation. Through this, KAP1 is quickly
phosphorylated/deSUMOylated and de-represses a subset of genes during genotoxic
stresses.
We postulate that the signal to switch from mono-ubiquitinated/unSUMOylated
KAP1 to SUMOylated/poly-ubiquitinated KAP1 post Dox-treatment is ATM-mediated
Ser-824 phosphorylation. A possible scenario is that mono-ubiquitination and poly-
ubiquitination of KAP1 utilize different E3 ligases. After DSB induction, the mono-Ub
E3 ligase for KAP1 is inhibited, allowing KAP1 for being SUMOylated. We searched
104
the STRING database and found out that MDM-2, a well characterized mono-Ub E3
ligase, interacted with KAP1 (104, 109, 114). The KAP1:MDM2 interaction is through
the N-terminal coiled-coil domain of KAP1 and the central acidic domain of MDM2
(104). Moreover, Maya et al. reported that ATM, upon DNA damage, quickly
phosphorylates MDM2 on Ser-395, which partially inactivates its Ub-E3 ligase activity
(57). Conceivably, MDM2 could be the KAP1 mono-Ub E3 ligase. Alternatively, ATM
could promote deubiquitination on mono-ubiquitinated-K554 to facilitate subsequent
SUMOylation. Taken together, we propose the following model: under unstressed state,
KAP1 is mono-ubiquitinated by MDM2 at K554, which blocks the SUMOylation on the
same site and stabilizes KAP1. After Dox-treatment, ATM simultaneously
phosphorylates MDM2 on Ser-395 and dissociates MDM2 from KAP1 (which leads to an
inhibition of mono-ubiquitination on K554) and promotes the RNF4-mediated poly-
ubiquitination on already SUMOylated KAP1, leading to its degradation.
In summary, our results presented herein provide novel mechanistic insights into
how RNF4 ubiquitinates SUMOylated KAP1 during the exposure of genotoxic stresses
and the signaling crosstalk among phosphorylation, SUMOylation and ubiquitination,
affecting not only the steady-state level of KAP1 and SUMOylated KAP1, but potentially
its targeted gene expression. Importantly, we found a potential role for mono-
ubiquitination and phosphorylation-mediated, SUMO-dependent poly-ubiquitination
switch in regulating genotoxic response.
105

CHAPTER 6: OVERALL DISCUSSION AND FURURE DIRECTION

6.1 Overall discussion
Based on the results obtained so-far, we propose the following model (Fig. 6.1):
KAP1 exists in a dynamic balance between Ser-824-phosphorylated/unSUMOylated
KAP1 (inactive co-repressor) and dephosphorylated/SUMOylated KAP1 (active co-
repressor) in unstressed cells, and efficiently represses the expression from its
downstream genes, including p21, Bax, Puma and Noxa. PP1cA constitutively binds to
KAP1 and sets a basal transcription rate for a subset of pro-arrest and pro-apoptotic
KAP1-targeted genes, allowing normal cell cycle transition. Following DSB induction,
ATM is activated, and quickly phosphorylates KAP1 on Ser-824. The Ser-824
phosphorylation of KAP1 blocks its SUMOylation if KAP1 is unSUMOylated. If KAP1
is already SUMOylated, Ser-824-phosphorylation facilitates the recruitment of RNF4 or
activates RNF4 to achieve poly-ubiquitination, in turn promoting the degradation of
SUMOylated KAP1. Therefore, the majority of KAP1 is phosphorylated and
unSUMOylated post DSB induction, leading to the de-repression of its downstream target
genes and cell cycle arrest.
With prolonged DNA damage insult, ATM starts to be inactivated to attenuate
KAP1 Ser-824 phosphorylation. At the same time, already bound PP1cA
dephosphorylates ATM-induced KAP1 Ser-824 phosphorylation and cooperates with
newly recruited PP1cA and PP1cB to timely restore KAP1 SUMOylation, which in turn
resumes the co-repressor function. In our model, we further predict that the magnitude of
106
PP1cA bound to KAP1 sets the threshold for ATM activation required to overcome
PP1cA-mediated Ser-824 dephosphorylation. In contrast, PP1cB interacts with KAP1 in
a spatio (lack of PP1cA)-temporal (post DSB induction) manner to promote KAP1
SUMOylation. Finally, the SUMOylation of KAP1 is restored; the cells go back to the
regular cell cycle. In summary, our findings suggested a central role for the crosstalk of
different post-translational modifications of KAP1 in the context of ATM-mediated DNA
damage response.

107

Figure 6.1. Model depicting the cross talk between KAP1 phosphorylation, SUMOylation and
ubiquitination

108
6.2 Future direction
There are several questions regarding the crosstalk among various post-
translational modifications of KAP1 during genotoxic stresses have not been completely
addressed. For example, what is the E3 ligase for KAP1 mono-ubiquitination? Is
SUMO:SIM interaction sufficient for the recruitment of RNF4 to SUMOylated KAP1?
How is KAP1 K554 mono-ubiquitination versus SUMOylation regulated in unstressed
condition? What is the deubiquitinase for mono-ubiquitinated-K554 KAP1? What is the
molecular role of Ser-824-phosphorylation in ATM-promoted KAP1 degradation?
First, to prove that RNF4 binds to KAP1 through (SUMO-2)
n
and degrades
SUMOylated KAP1, a binding assay is essential. We will co-transfect Flag-KAP1(WT)
or Flag-KAP1(S824D) with Myc-RNF4 and SUMO-2. Whole cell extracts will be IPed
with an anti-Flag-M2 antibody and the co-IPed KAP1 and RNF4 will be confirmed by
using an anti-Flag and anti-Myc antibody, respectively. A direct interaction of RNF4
with KAP1 would predict that RNF4 will be detected in the IPed-KAP1 complex.
Detailed mapping experiments will be performed to dissect the region in KAP1
responsible for the recruitment of RNF4. Alternatively, SUMO:SIM interaction will be
the driving force for the recruitment of RNF4 to SUMOylated KAP1. Along this line of
thinking, we could observe more RNF4 in the in IPed-KAP1 complex when SUMO-2 is
overexpressed. However, this model fails to explain the role of KAP1 Ser-824
phosphorylation in promoting SUMOylated KAP1 degradation.
To confirm that K554 is the key KAP1 mono-ubiquitination site(s), proteomics
approach could be utilized. A number of studies have demonstrated that precise
ubiquitination sites can be identified using LC-MS/MS by taking advantage of the fact
109
that isopeptide-linked ubiquitin is cleaved by trypsin at the junction between Arg-74 and
Gly-75, producing a -GG signature peptide (43). By doing this analysis, we could not
only confirm that K554 is the ubiquitination site, but also may find additional
ubiquitination sites on KAP1.
In our pilot experiments, MG132 or E64d/Pepstatin A failed to markedly block
the degradation of KAP1(S824D) in the presence of SUMO-1 (data not shown). As we
propose that SUMOylated KAP1 is degraded by RNF4-mediated poly-ubiquitination, we
expect an accumulation of both unmodified and ubiquitinated KAP1 following MG132-
treatment. We reason that we failed to detect a marked effect by MG132 in our pilot
experiments because the promiscuous role for SUMO-1 in RNF4-mediated
ubiquitination/degradation. To support this possibility, it has been proposed that SUMO-
1, instead of inducing degradation, actually binds to the end of the SUMO-2/-3 of poly-
SUMOylation chain and blocks RNF4-mediated degradation. Hence, cells will be co-
transfect Flag-KAP1(WT) or Flag-KAP1(S824D) with 6xHis-Ub and Myc-SUMO-2, and
then be treated with vehicle or MG132 (5 µM) for 0, 1, 2, 4 h at 30 h post transfection.
We expect to observe an accumulation of both unmodified and ubiquitinated KAP1 and
KAP1(S824D) in MG132-treated cells, and the effect of MG132 will be more notable in
KAP1(S824D)-transfected cells.
Since the SUMOylation E3 ligase for KAP1 is still controversial, is it possible
that RNF4 also is the E3 ligase for KAP1 SUMOylation? We will perform in vitro
SUMOylation assays of KAP1 with purified RNF4 to see whether RNF4 stimulates
KAP1 SUMOylation. In addition, in vitro ubiquitination assay will be performed on
KAP1 and SUMO-2-modified KAP to further confirm that RNF4 is the E3 ligase for
110
SUMOylated KAP1 only. If RNF4 is both KAP1’s SUMOylation and SUMO-targeted
ubiquitination E3 ligase, it will open a new direction to study the crosstalk between
different post-translational modifications.
Results shown in Fig. 5.9 suggested that when KAP1 is phosphorylated, RNF4’s
role could be compensated by other E3 ligase(s) with similar function. So if there is
another KAP1 SUMO-targeted ubiquitination E3 ligase(s), what could it be? By
searching the possible ubiquitin E3 ligase which binds to KAP1 using IntAct database,
we found an interaction between KAP1 and RNF85 (TNF receptor-associated factor 6),
which is an Ub E3 ligase (18). To test this possibility, we will perform the similar
experiments using RNF85 instead of RNF4 to examine whether RNF85 has a similar
effect to promote the degradation of Ser-824-phosphorylated KAP1.
si-ATM would be utilized to further confirm the triggering role for ATM in
promoting KAP1 degradation upon the exposure of genotoxic stresses. We will use si-
RNA against ATM to knockdown ATM in both HEK293 and HEK293/shRNF4 cells,
and then monitor the KAP1 degradation profile. Flag-KAP1(WT) or Flag-KAP1(S824D)
will be transfected with 6xHis-Ub and/or Myc-SUMO-2. Cells will be treated with
vehicle or Dox (1 µM, 3 h) at 30 h post transfection. Whole cell extracts will be IPed
with an anti-Flag-M2 antibody and the level of the IPed-KAP1 will be analyzed with an
anti-Flag, anti-6xHis or anti-Myc antibody. In our hypothesis, ATM activation is the
critical signal for the degradation of SUMOylated KAP1 as well as KAP1. If our
assumption is correct, we expect to observe an accumulation of SUMO-2-modified KAP1
in HEK293/si-ATM even in the presence of RNF4 following Dox-treatment. Moreover,
an increased degradation of KAP1(WT) and an accompanied decrease of mono-
111
ubiquitinated KAP1(WT) following Dox-treatment in HEK293, but not in HEK293/si-
ATM cells are expected. By contrast, si-ATM will not affect the steady-state level of
KAP1(S824D).
Next, we will perform co-IP assays in HEK293/si-ATM cells. We will co-
transfect Flag-KAP1(WT) or Flag-KAP1(S824D) with Myc-RNF4 and SUMO-2. Whole
cell extracts will be IPed with an anti-Flag-M2 antibody and the level of KAP1 and co-
IPed-RNF4 will be evaluated with an anti-Flag or -Myc antibody. If we observe a
decrease in KAP1(WT):RNF4 interaction in HEK293/si-ATM cells compared to that in
HEK293/si-control cells, it will further support the “triggering” role for KAP1 Ser-824
phosphorylation. Along the same line, we expect that ATM-knockdown will not affect
the interaction between KAP1(S824D) and RNF4.
To evaluate the effect of RNF4-induced degradation of SUMOylated KAP1, the
time-dependent expression profiles of Bax, Puma, Noxa and p21 in response to Dox-
treatment will be examined in MCF-7/sh-control and MCF-7/sh-RNF4 cells. According
to our previous results, the steady-state levels of these four mRNAs exhibited a notable
concordance of additional up-regulation starting at 6 h, reaching the maximum at 9 h post
Dox-treatment in KAP1-depleted MCF-7/TR/sh-KAP1 cells (Fig. 4.5). We will monitor
the levels of these four mRNAs at 0, 3, 6, 9, 12, 15 and 24 h post Dox-treatment in both
MCF-7/sh-control and MCF-7/sh-RNF4 cells. Based on our hypothesis, we anticipate
that the induction of Bax, Puma, Noxa and p21 expression will be slower and/or reach a
lower peak level in MCF-7/sh-RNF4 cells compared to those in MCF-7/sh-control cells
upon Dox-treatment.
112
Lastly, we anticipate a decrease in Dox-induced apoptosis in MCF-7/sh-RNF4
cells due to a blocked degradation of SUMOylated-KAP1 by sh-RNF4. Annexin-V/FITC
apoptosis assay will be utilized to measure the apoptosis level in MCF-7/sh-control and
MCF-7/shRNF4 cells undergoing Dox-treatment for 9 h. RNF4-depletion will confer a
lesser increase in Annexin-V positive cells compared to RNF4-competent cells. We also
expect that additional post-translational modification, such as acetylation or arginine-
methylation also could modulate KAP1 function during different cellular stresses.
113
BIBLIOGRAPHY
1. Andreassen, P. R., F. B. Lacroix, E. Villa-Moruzzi, and R. L. Margolis. 1998.
Differential subcellular localization of protein phosphatase-1 alpha, gamma1, and
delta isoforms during both interphase and mitosis in mammalian cells. J Cell Biol
141:1207-15.
2. Bayer, P., A. Arndt, S. Metzger, R. Mahajan, F. Melchior, R. Jaenicke, and J.
Becker. 1998. Structure determination of the small ubiquitin-related modifier
SUMO-1. J Mol Biol 280:275-86.
3. Bossis, G., C. E. Malnou, R. Farras, E. Andermarcher, R. Hipskind, M.
Rodriguez, D. Schmidt, S. Muller, I. Jariel-Encontre, and M. Piechaczyk.
2005. Down-regulation of c-Fos/c-Jun AP-1 dimer activity by sumoylation. Mol
Cell Biol 25:6964-79.
4. Bossis, G., and F. Melchior. 2006. Regulation of SUMOylation by reversible
oxidation of SUMO conjugating enzymes. Mol Cell 21:349-57.
5. Bossis, G., and F. Melchior. 2006. SUMO: regulating the regulator. Cell Div
1:13.
6. Broude, E. V., M. E. Swift, C. Vivo, B. D. Chang, B. M. Davis, S. Kalurupalle,
M. V. Blagosklonny, and I. B. Roninson. 2007. p21(Waf1/Cip1/Sdi1) mediates
retinoblastoma protein degradation. Oncogene 26:6954-8.
7. Carbia-Nagashima, A., J. Gerez, C. Perez-Castro, M. Paez-Pereda, S.
Silberstein, G. K. Stalla, F. Holsboer, and E. Arzt. 2007. RSUME, a small
RWD-containing protein, enhances SUMO conjugation and stabilizes HIF-1alpha
during hypoxia. Cell 131:309-23.
8. Ceulemans, H., and M. Bollen. 2004. Functional diversity of protein
phosphatase-1, a cellular economizer and reset button. Physiol Rev 84:1-39.
9. Chang, C. W., H. Y. Chou, Y. S. Lin, K. H. Huang, C. J. Chang, T. C. Hsu,
and S. C. Lee. 2008. Phosphorylation at Ser473 regulates heterochromatin
protein 1 binding and corepressor function of TIF1beta/KAP1. BMC Mol Biol
9:61.
10. Chen, C. F., S. Li, Y. Chen, P. L. Chen, Z. D. Sharp, and W. H. Lee. 1996.
The nuclear localization sequences of the BRCA1 protein interact with the
importin-alpha subunit of the nuclear transport signal receptor. J Biol Chem
271:32863-8.
114
11. Cheng, J., N. D. Perkins, and E. T. Yeh. 2005. Differential regulation of c-Jun-
dependent transcription by SUMO-specific proteases. J Biol Chem 280:14492-8.
12. Cheng, J., D. Wang, Z. Wang, and E. T. Yeh. 2004. SENP1 enhances androgen
receptor-dependent transcription through desumoylation of histone deacetylase 1.
Mol Cell Biol 24:6021-8.
13. Chowdhury, D., M. C. Keogh, H. Ishii, C. L. Peterson, S. Buratowski, and J.
Lieberman. 2005. gamma-H2AX dephosphorylation by protein phosphatase 2A
facilitates DNA double-strand break repair. Mol Cell 20:801-9.
14. Chowdhury, D., X. Xu, X. Zhong, F. Ahmed, J. Zhong, J. Liao, D. M.
Dykxhoorn, D. M. Weinstock, G. P. Pfeifer, and J. Lieberman. 2008. A PP4-
phosphatase complex dephosphorylates gamma-H2AX generated during DNA
replication. Mol Cell 31:33-46.
15. Cohen, P. T. 2002. Protein phosphatase 1--targeted in many directions. J Cell Sci
115:241-56.
16. den Elzen, N. R., and M. J. O'Connell. 2004. Recovery from DNA damage
checkpoint arrest by PP1-mediated inhibition of Chk1. Embo J 23:908-18.
17. el-Deiry, W. S., T. Tokino, V. E. Velculescu, D. B. Levy, R. Parsons, J. M.
Trent, D. Lin, W. E. Mercer, K. W. Kinzler, and B. Vogelstein. 1993. WAF1,
a potential mediator of p53 tumor suppression. Cell 75:817-25.
18. Ewing, R. M., P. Chu, F. Elisma, H. Li, P. Taylor, S. Climie, L. McBroom-
Cerajewski, M. D. Robinson, L. O'Connor, M. Li, R. Taylor, M. Dharsee, Y.
Ho, A. Heilbut, L. Moore, S. Zhang, O. Ornatsky, Y. V. Bukhman, M. Ethier,
Y. Sheng, J. Vasilescu, M. Abu-Farha, J. P. Lambert, H. S. Duewel, Stewart,
II, B. Kuehl, K. Hogue, K. Colwill, K. Gladwish, B. Muskat, R. Kinach, S. L.
Adams, M. F. Moran, G. B. Morin, T. Topaloglou, and D. Figeys. 2007.
Large-scale mapping of human protein-protein interactions by mass spectrometry.
Mol Syst Biol 3:89.
19. Fornari, F. A., J. K. Randolph, J. C. Yalowich, M. K. Ritke, and D. A.
Gewirtz. 1994. Interference by doxorubicin with DNA unwinding in MCF-7
breast tumor cells. Mol Pharmacol 45:649-56.
20. Friedman, J. R., W. J. Fredericks, D. E. Jensen, D. W. Speicher, X. P. Huang,
E. G. Neilson, and F. J. Rauscher, 3rd. 1996. KAP-1, a novel corepressor for
the highly conserved KRAB repression domain. Genes Dev 10:2067-78.
21. Gill, G. 2004. SUMO and ubiquitin in the nucleus: different functions, similar
mechanisms? Genes Dev 18:2046-59.
115
22. Goodarzi, A. A., J. C. Jonnalagadda, P. Douglas, D. Young, R. Ye, G. B.
Moorhead, S. P. Lees-Miller, and K. K. Khanna. 2004. Autophosphorylation of
ataxia-telangiectasia mutated is regulated by protein phosphatase 2A. Embo J
23:4451-61.
23. Goodarzi, A. A., A. T. Noon, D. Deckbar, Y. Ziv, Y. Shiloh, M. Lobrich, and
P. A. Jeggo. 2008. ATM signaling facilitates repair of DNA double-strand breaks
associated with heterochromatin. Mol Cell 31:167-77.
24. Gregoire, S., A. M. Tremblay, L. Xiao, Q. Yang, K. Ma, J. Nie, Z. Mao, Z.
Wu, V. Giguere, and X. J. Yang. 2006. Control of MEF2 transcriptional activity
by coordinated phosphorylation and sumoylation. J Biol Chem 281:4423-33.
25. Guo, C. Y., D. L. Brautigan, and J. M. Larner. 2002. Ionizing radiation
activates nuclear protein phosphatase-1 by ATM-dependent dephosphorylation. J
Biol Chem 277:41756-61.
26. Hakli, M., U. Karvonen, O. A. Janne, and J. J. Palvimo. 2005. SUMO-1
promotes association of SNURF (RNF4) with PML nuclear bodies. Exp Cell Res
304:224-33.
27. Hannich, J. T., A. Lewis, M. B. Kroetz, S. J. Li, H. Heide, A. Emili, and M.
Hochstrasser. 2005. Defining the SUMO-modified proteome by multiple
approaches in Saccharomyces cerevisiae. J Biol Chem 280:4102-10.
28. Hay, R. T. 2005. SUMO: a history of modification. Mol Cell 18:1-12.
29. Hendrickx, A., M. Beullens, H. Ceulemans, T. D. Abt, A. Van Eynde, E.
Nicolaescu, B. Lesage, and M. Bollen. 2009. Docking motif-guided mapping of
the interactome of protein phosphatase-1. Chem Biol 16:365-71.
30. Herman, M., Y. Ori, A. Chagnac, T. Weinstein, A. Korzets, D. Zevin, T.
Malachi, and U. Gafter. 2002. DNA repair in mononuclear cells: role of
serine/threonine phosphatases. J Lab Clin Med 140:255-62.
31. Hietakangas, V., J. K. Ahlskog, A. M. Jakobsson, M. Hellesuo, N. M.
Sahlberg, C. I. Holmberg, A. Mikhailov, J. J. Palvimo, L. Pirkkala, and L.
Sistonen. 2003. Phosphorylation of serine 303 is a prerequisite for the stress-
inducible SUMO modification of heat shock factor 1. Mol Cell Biol 23:2953-68.
32. Hietakangas, V., J. Anckar, H. A. Blomster, M. Fujimoto, J. J. Palvimo, A.
Nakai, and L. Sistonen. 2006. PDSM, a motif for phosphorylation-dependent
SUMO modification. Proc Natl Acad Sci U S A 103:45-50.
33. Huang, D. T., H. Walden, D. Duda, and B. A. Schulman. 2004. Ubiquitin-like
protein activation. Oncogene 23:1958-71.
116
34. Huang, W. C., T. P. Ko, S. S. Li, and A. H. Wang. 2004. Crystal structures of
the human SUMO-2 protein at 1.6 A and 1.2 A resolution: implication on the
functional differences of SUMO proteins. Eur J Biochem 271:4114-22.
35. Hunter, T., and H. Sun. 2008. Crosstalk between the SUMO and ubiquitin
pathways. Ernst Schering Found Symp Proc:1-16.
36. Ivanov, A. V., H. Peng, V. Yurchenko, K. L. Yap, D. G. Negorev, D. C.
Schultz, E. Psulkowski, W. J. Fredericks, D. E. White, G. G. Maul, M. J.
Sadofsky, M. M. Zhou, and F. J. Rauscher, 3rd. 2007. PHD domain-mediated
E3 ligase activity directs intramolecular sumoylation of an adjacent bromodomain
required for gene silencing. Mol Cell 28:823-37.
37. Jackson, P. K. 2001. A new RING for SUMO: wrestling transcriptional
responses into nuclear bodies with PIAS family E3 SUMO ligases. Genes Dev
15:3053-8.
38. Johnson, E. S. 2004. Protein modification by SUMO. Annu Rev Biochem
73:355-82.
39. Kamitani, S., N. Ohbayashi, O. Ikeda, S. Togi, R. Muromoto, Y. Sekine, K.
Ohta, H. Ishiyama, and T. Matsuda. 2008. KAP1 regulates type I
interferon/STAT1-mediated IRF-1 gene expression. Biochem Biophys Res
Commun 370:366-70.
40. Kastan, M. B., and J. Bartek. 2004. Cell-cycle checkpoints and cancer. Nature
432:316-23.
41. Keyomarsi, K., D. Conte, Jr., W. Toyofuku, and M. P. Fox. 1995.
Deregulation of cyclin E in breast cancer. Oncogene 11:941-50.
42. Kim, S. S., Y. M. Chen, E. O'Leary, R. Witzgall, M. Vidal, and J. V.
Bonventre. 1996. A novel member of the RING finger family, KRIP-1,
associates with the KRAB-A transcriptional repressor domain of zinc finger
proteins. Proc Natl Acad Sci U S A 93:15299-304.
43. Kirkpatrick, D. S., C. Denison, and S. P. Gygi. 2005. Weighing in on ubiquitin:
the expanding role of mass-spectrometry-based proteomics. Nat Cell Biol 7:750-7.
44. Knipscheer, P., A. Flotho, H. Klug, J. V. Olsen, W. J. van Dijk, A. Fish, E. S.
Johnson, M. Mann, T. K. Sixma, and A. Pichler. 2008. Ubc9 sumoylation
regulates SUMO target discrimination. Mol Cell 31:371-82.
45. Lallemand-Breitenbach, V., M. Jeanne, S. Benhenda, R. Nasr, M. Lei, L.
Peres, J. Zhou, J. Zhu, B. Raught, and H. de The. 2008. Arsenic degrades
PML or PML-RARalpha through a SUMO-triggered RNF4/ubiquitin-mediated
pathway. Nat Cell Biol 10:547-55.
117
46. Lechner, M. S., G. E. Begg, D. W. Speicher, and F. J. Rauscher, 3rd. 2000.
Molecular determinants for targeting heterochromatin protein 1-mediated gene
silencing: direct chromoshadow domain-KAP-1 corepressor interaction is
essential. Mol Cell Biol 20:6449-65.
47. Lee, Y. K., S. N. Thomas, A. J. Yang, and D. K. Ann. 2007. Doxorubicin
down-regulates Kruppel-associated box domain-associated protein 1 sumoylation
that relieves its transcription repression on p21WAF1/CIP1 in breast cancer MCF-
7 cells. J Biol Chem 282:1595-606.
48. Lesage, B., M. Beullens, H. Ceulemans, B. Himpens, and M. Bollen. 2005.
Determinants of the nucleolar targeting of protein phosphatase-1. FEBS Lett
579:5626-30.
49. Levine, A. J. 1997. p53, the cellular gatekeeper for growth and division. Cell
88:323-31.
50. Li, M., D. L. Satinover, and D. L. Brautigan. 2007. Phosphorylation and
functions of inhibitor-2 family of proteins. Biochemistry 46:2380-9.
51. Li, X., Y. K. Lee, J. C. Jeng, Y. Yen, D. C. Schultz, H. M. Shih, and D. K.
Ann. 2007. Role for KAP1 serine 824 phosphorylation and
sumoylation/desumoylation switch in regulating KAP1-mediated transcriptional
repression. J Biol Chem 282:36177-89.
52. Lin, J. Y., T. Ohshima, and K. Shimotohno. 2004. Association of Ubc9, an E2
ligase for SUMO conjugation, with p53 is regulated by phosphorylation of p53.
FEBS Lett 573:15-8.
53. Linke, K., P. D. Mace, C. A. Smith, D. L. Vaux, J. Silke, and C. L. Day. 2008.
Structure of the MDM2/MDMX RING domain heterodimer reveals dimerization
is required for their ubiquitylation in trans. Cell Death Differ 15:841-8.
54. Liu, X., B. Zhou, L. Xue, J. Shih, K. Tye, C. Qi, and Y. Yen. 2005. The
ribonucleotide reductase subunit M2B subcellular localization and functional
importance for DNA replication in physiological growth of KB cells. Biochem
Pharmacol 70:1288-97.
55. Manning, G., D. B. Whyte, R. Martinez, T. Hunter, and S. Sudarsanam. 2002.
The protein kinase complement of the human genome. Science 298:1912-34.
56. Matsuoka, S., B. A. Ballif, A. Smogorzewska, E. R. McDonald, 3rd, K. E.
Hurov, J. Luo, C. E. Bakalarski, Z. Zhao, N. Solimini, Y. Lerenthal, Y.
Shiloh, S. P. Gygi, and S. J. Elledge. 2007. ATM and ATR substrate analysis
reveals extensive protein networks responsive to DNA damage. Science
316:1160-6.
118
57. Maya, R., M. Balass, S. T. Kim, D. Shkedy, J. F. Leal, O. Shifman, M. Moas,
T. Buschmann, Z. Ronai, Y. Shiloh, M. B. Kastan, E. Katzir, and M. Oren.
2001. ATM-dependent phosphorylation of Mdm2 on serine 395: role in p53
activation by DNA damage. Genes Dev 15:1067-77.
58. Meiselbach, H., H. Sticht, and R. Enz. 2006. Structural analysis of the protein
phosphatase 1 docking motif: molecular description of binding specificities
identifies interacting proteins. Chem Biol 13:49-59.
59. Momparler, R. L., M. Karon, S. E. Siegel, and F. Avila. 1976. Effect of
adriamycin on DNA, RNA, and protein synthesis in cell-free systems and intact
cells. Cancer Res 36:2891-5.
60. Moosmann, P., O. Georgiev, B. Le Douarin, J. P. Bourquin, and W.
Schaffner. 1996. Transcriptional repression by RING finger protein TIF1 beta
that interacts with the KRAB repressor domain of KOX1. Nucleic Acids Res
24:4859-67.
61. Muller, S., M. Berger, F. Lehembre, J. S. Seeler, Y. Haupt, and A. Dejean.
2000. c-Jun and p53 activity is modulated by SUMO-1 modification. J Biol Chem
275:13321-9.
62. Muller, S., C. Hoege, G. Pyrowolakis, and S. Jentsch. 2001. SUMO, ubiquitin's
mysterious cousin. Nat Rev Mol Cell Biol 2:202-10.
63. Muller, S., A. Ledl, and D. Schmidt. 2004. SUMO: a regulator of gene
expression and genome integrity. Oncogene 23:1998-2008.
64. Nagai, S., K. Dubrana, M. Tsai-Pflugfelder, M. B. Davidson, T. M. Roberts,
G. W. Brown, E. Varela, F. Hediger, S. M. Gasser, and N. J. Krogan. 2008.
Functional targeting of DNA damage to a nuclear pore-associated SUMO-
dependent ubiquitin ligase. Science 322:597-602.
65. Nefkens, I., D. G. Negorev, A. M. Ishov, J. S. Michaelson, E. T. Yeh, R. M.
Tanguay, W. E. Muller, and G. G. Maul. 2003. Heat shock and Cd2+ exposure
regulate PML and Daxx release from ND10 by independent mechanisms that
modify the induction of heat-shock proteins 70 and 25 differently. J Cell Sci
116:513-24.
66. Nghiem, P., P. K. Park, Y. Kim, C. Vaziri, and S. L. Schreiber. 2001. ATR
inhibition selectively sensitizes G1 checkpoint-deficient cells to lethal premature
chromatin condensation. Proc Natl Acad Sci U S A 98:9092-7.
67. Nguyen, H. V., J. L. Chen, J. Zhong, K. J. Kim, E. D. Crandall, Z. Borok, Y.
Chen, and D. K. Ann. 2006. SUMOylation attenuates sensitivity toward
hypoxia- or desferroxamine-induced injury by modulating adaptive responses in
salivary epithelial cells. Am J Pathol 168:1452-63.
119
68. O'Geen, H., S. L. Squazzo, S. Iyengar, K. Blahnik, J. L. Rinn, H. Y. Chang, R.
Green, and P. J. Farnham. 2007. Genome-wide analysis of KAP1 binding
suggests autoregulation of KRAB-ZNFs. PLoS Genet 3:e89.
69. Okamoto, K., I. Kitabayashi, and Y. Taya. 2006. KAP1 dictates p53 response
induced by chemotherapeutic agents via Mdm2 interaction. Biochem Biophys Res
Commun 351:216-22.
70. Oren, M. 2003. Decision making by p53: life, death and cancer. Cell Death
Differ 10:431-42.
71. Parra, M., T. Mahmoudi, and E. Verdin. 2007. Myosin phosphatase
dephosphorylates HDAC7, controls its nucleocytoplasmic shuttling, and inhibits
apoptosis in thymocytes. Genes Dev 21:638-43.
72. Passalaris, T. M., J. A. Benanti, L. Gewin, T. Kiyono, and D. A. Galloway.
1999. The G(2) checkpoint is maintained by redundant pathways. Mol Cell Biol
19:5872-81.
73. Peng, H., G. E. Begg, S. L. Harper, J. R. Friedman, D. W. Speicher, and F. J.
Rauscher, 3rd. 2000. Biochemical analysis of the Kruppel-associated box
(KRAB) transcriptional repression domain. J Biol Chem 275:18000-10.
74. Perry, J. J., J. A. Tainer, and M. N. Boddy. 2008. A SIM-ultaneous role for
SUMO and ubiquitin. Trends Biochem Sci 33:201-8.
75. Poukka, H., P. Aarnisalo, H. Santti, O. A. Janne, and J. J. Palvimo. 2000.
Coregulator small nuclear RING finger protein (SNURF) enhances Sp1- and
steroid receptor-mediated transcription by different mechanisms. J Biol Chem
275:571-9.
76. Riballo, E., M. Kuhne, N. Rief, A. Doherty, G. C. Smith, M. J. Recio, C. Reis,
K. Dahm, A. Fricke, A. Krempler, A. R. Parker, S. P. Jackson, A. Gennery, P.
A. Jeggo, and M. Lobrich. 2004. A pathway of double-strand break rejoining
dependent upon ATM, Artemis, and proteins locating to gamma-H2AX foci. Mol
Cell 16:715-24.
77. Sacher, M., B. Pfander, C. Hoege, and S. Jentsch. 2006. Control of Rad52
recombination activity by double-strand break-induced SUMO modification. Nat
Cell Biol 8:1284-90.
78. Sancar, A., L. A. Lindsey-Boltz, K. Unsal-Kacmaz, and S. Linn. 2004.
Molecular mechanisms of mammalian DNA repair and the DNA damage
checkpoints. Annu Rev Biochem 73:39-85.

120
79. Schultz, D. C., K. Ayyanathan, D. Negorev, G. G. Maul, and F. J. Rauscher,
3rd. 2002. SETDB1: a novel KAP-1-associated histone H3, lysine 9-specific
methyltransferase that contributes to HP1-mediated silencing of euchromatic
genes by KRAB zinc-finger proteins. Genes Dev 16:919-32.
80. Schultz, D. C., J. R. Friedman, and F. J. Rauscher, 3rd. 2001. Targeting
histone deacetylase complexes via KRAB-zinc finger proteins: the PHD and
bromodomains of KAP-1 form a cooperative unit that recruits a novel isoform of
the Mi-2alpha subunit of NuRD. Genes Dev 15:428-43.
81. Seeler, J. S., and A. Dejean. 2003. Nuclear and unclear functions of SUMO. Nat
Rev Mol Cell Biol 4:690-9.
82. Shiio, Y., and R. N. Eisenman. 2003. Histone sumoylation is associated with
transcriptional repression. Proc Natl Acad Sci U S A 100:13225-30.
83. Shiloh, Y. 1997. Ataxia-telangiectasia and the Nijmegen breakage syndrome:
related disorders but genes apart. Annu Rev Genet 31:635-62.
84. Shiloh, Y. 2006. The ATM-mediated DNA-damage response: taking shape.
Trends Biochem Sci 31:402-10.
85. Song, J., L. K. Durrin, T. A. Wilkinson, T. G. Krontiris, and Y. Chen. 2004.
Identification of a SUMO-binding motif that recognizes SUMO-modified proteins.
Proc Natl Acad Sci U S A 101:14373-8.
86. Song, J., Z. Zhang, W. Hu, and Y. Chen. 2005. Small ubiquitin-like modifier
(SUMO) recognition of a SUMO binding motif: a reversal of the bound
orientation. J Biol Chem 280:40122-9.
87. Sripathy, S. P., J. Stevens, and D. C. Schultz. 2006. The KAP1 corepressor
functions to coordinate the assembly of de novo HP1-demarcated
microenvironments of heterochromatin required for KRAB zinc finger protein-
mediated transcriptional repression. Mol Cell Biol 26:8623-38.
88. Stehmeier, P., and S. Muller. 2009. Phospho-regulated SUMO interaction
modules connect the SUMO system to CK2 signaling. Mol Cell 33:400-9.
89. Sun, H., J. D. Leverson, and T. Hunter. 2007. Conserved function of RNF4
family proteins in eukaryotes: targeting a ubiquitin ligase to SUMOylated proteins.
Embo J 26:4102-12.
90. Takahashi, H., S. Hatakeyama, H. Saitoh, and K. I. Nakayama. 2005.
Noncovalent SUMO-1 binding activity of thymine DNA glycosylase (TDG) is
required for its SUMO-1 modification and colocalization with the promyelocytic
leukemia protein. J Biol Chem 280:5611-21.
121
91. Tang, X., Z. G. Hui, X. L. Cui, R. Garg, M. B. Kastan, and B. Xu. 2008. A
novel ATM-dependent pathway regulates protein phosphatase 1 in response to
DNA damage. Mol Cell Biol 28:2559-66.
92. Tatham, M. H., M. C. Geoffroy, L. Shen, A. Plechanovova, N. Hattersley, E.
G. Jaffray, J. J. Palvimo, and R. T. Hay. 2008. RNF4 is a poly-SUMO-specific
E3 ubiquitin ligase required for arsenic-induced PML degradation. Nat Cell Biol
10:538-46.
93. Taylor, W. R., and G. R. Stark. 2001. Regulation of the G2/M transition by p53.
Oncogene 20:1803-15.
94. Tomimatsu, N., B. Mukherjee, and S. Burma. 2009. Distinct roles of ATR and
DNA-PKcs in triggering DNA damage responses in ATM-deficient cells. EMBO
Rep 10:629-35.
95. Tremblay, A. M., B. J. Wilson, X. J. Yang, and V. Giguere. 2008.
Phosphorylation-dependent sumoylation regulates estrogen-related receptor-alpha
and -gamma transcriptional activity through a synergy control motif. Mol
Endocrinol 22:570-84.
96. Trinkle-Mulcahy, L., J. E. Sleeman, and A. I. Lamond. 2001. Dynamic
targeting of protein phosphatase 1 within the nuclei of living mammalian cells. J
Cell Sci 114:4219-28.
97. Tsuruma, R., N. Ohbayashi, S. Kamitani, O. Ikeda, N. Sato, R. Muromoto, Y.
Sekine, K. Oritani, and T. Matsuda. 2008. Physical and functional interactions
between STAT3 and KAP1. Oncogene 27:3054-9.
98. Underhill, C., M. S. Qutob, S. P. Yee, and J. Torchia. 2000. A novel nuclear
receptor corepressor complex, N-CoR, contains components of the mammalian
SWI/SNF complex and the corepressor KAP-1. J Biol Chem 275:40463-70.
99. Urrutia, R. 2003. KRAB-containing zinc-finger repressor proteins. Genome Biol
4:231.
100. van de Wetering, M., I. Oving, V. Muncan, M. T. Pon Fong, H. Brantjes, D.
van Leenen, F. C. Holstege, T. R. Brummelkamp, R. Agami, and H. Clevers.
2003. Specific inhibition of gene expression using a stably integrated, inducible
small-interfering-RNA vector. EMBO Rep 4:609-15.
101. Vanhatupa, S., D. Ungureanu, M. Paakkunainen, and O. Silvennoinen. 2008.
MAPK-induced Ser727 phosphorylation promotes SUMOylation of STAT1.
Biochem J 409:179-85.
102. Vogelstein, B., D. Lane, and A. J. Levine. 2000. Surfing the p53 network.
Nature 408:307-10.
122
103. Vousden, K. H., and X. Lu. 2002. Live or let die: the cell's response to p53. Nat
Rev Cancer 2:594-604.
104. Wang, C., A. Ivanov, L. Chen, W. J. Fredericks, E. Seto, F. J. Rauscher, 3rd,
and J. Chen. 2005. MDM2 interaction with nuclear corepressor KAP1
contributes to p53 inactivation. Embo J 24:3279-90.
105. Wang, Q., S. Fan, A. Eastman, P. J. Worland, E. A. Sausville, and P. M.
O'Connor. 1996. UCN-01: a potent abrogator of G2 checkpoint function in
cancer cells with disrupted p53. J Natl Cancer Inst 88:956-65.
106. White, D. E., D. Negorev, H. Peng, A. V. Ivanov, G. G. Maul, and F. J.
Rauscher, 3rd. 2006. KAP1, a novel substrate for PIKK family members,
colocalizes with numerous damage response factors at DNA lesions. Cancer Res
66:11594-9.
107. Yajima, H., K. J. Lee, S. Zhang, J. Kobayashi, and B. P. Chen. 2009. DNA
double-strand break formation upon UV-induced replication stress activates ATM
and DNA-PKcs kinases. J Mol Biol 385:800-10.
108. Yamashiro, S., Y. Yamakita, G. Totsukawa, H. Goto, K. Kaibuchi, M. Ito, D.
J. Hartshorne, and F. Matsumura. 2008. Myosin phosphatase-targeting subunit
1 regulates mitosis by antagonizing polo-like kinase 1. Dev Cell 14:787-97.
109. Yang, D., Y. Jiang, and F. C. He. 2007. [KAP-1, a scaffold protein in
transcription regulation]. Yi Chuan 29:131-6.
110. Yang, S. H., E. Jaffray, R. T. Hay, and A. D. Sharrocks. 2003. Dynamic
interplay of the SUMO and ERK pathways in regulating Elk-1 transcriptional
activity. Mol Cell 12:63-74.
111. Yang, S. H., and A. D. Sharrocks. 2004. SUMO promotes HDAC-mediated
transcriptional repression. Mol Cell 13:611-7.
112. Yu, Y. M., S. M. Pace, S. R. Allen, C. X. Deng, and L. C. Hsu. 2008. A PP1-
binding motif present in BRCA1 plays a role in its DNA repair function. Int J Biol
Sci 4:352-61.
113. Yun, J., and W. H. Lee. 2003. Degradation of transcription repressor ZBRK1
through the ubiquitin-proteasome pathway relieves repression of Gadd45a upon
DNA damage. Mol Cell Biol 23:7305-14.
114. Zeng, L., K. L. Yap, A. V. Ivanov, X. Wang, S. Mujtaba, O. Plotnikova, F. J.
Rauscher, 3rd, and M. M. Zhou. 2008. Structural insights into human KAP1
PHD finger-bromodomain and its role in gene silencing. Nat Struct Mol Biol
15:626-33.
123
115. Zhao, L. Y., A. L. Colosimo, Y. Liu, Y. Wan, and D. Liao. 2003. Adenovirus
E1B 55-kilodalton oncoprotein binds to Daxx and eliminates enhancement of
p53-dependent transcription by Daxx. J Virol 77:11809-21.
116. Zheng, L., H. Pan, S. Li, A. Flesken-Nikitin, P. L. Chen, T. G. Boyer, and W.
H. Lee. 2000. Sequence-specific transcriptional corepressor function for BRCA1
through a novel zinc finger protein, ZBRK1. Mol Cell 6:757-68.
117. Ziv, Y., A. Bar-Shira, I. Pecker, P. Russell, T. J. Jorgensen, I. Tsarfati, and Y.
Shiloh. 1997. Recombinant ATM protein complements the cellular A-T
phenotype. Oncogene 15:159-67.
118. Ziv, Y., D. Bielopolski, Y. Galanty, C. Lukas, Y. Taya, D. C. Schultz, J.
Lukas, S. Bekker-Jensen, J. Bartek, and Y. Shiloh. 2006. Chromatin relaxation
in response to DNA double-strand breaks is modulated by a novel ATM- and
KAP-1 dependent pathway. Nat Cell Biol 8:870-6.

Abstract (if available)

Abstract As a multifunctional protein, KRAB domain-associated protein 1 (KAP1) is reportedly subjected to multiple protein post-translational modifications, including phosphorylation and SUMOylation. However, gaps exist in our knowledge of how KAP1 phosphorylation crosstalks with KAP1 SUMOylation, how those post-translational modifications are regulated and what the biological consequence is.

Linked assets

University of Southern California Dissertations and Theses

Conceptually similar

PDF

A regulatory transcription module of ZBRK1/KAP1 complex and its signaling network in regulating DNA damage-responsive genes expression

PDF

Protein post-translational modifications in the cell's redox and energy states

PDF

NO mediated neurotoxicity: redox changes and energy failure in a neuroinflammatory model

PDF

The structure and function of membrane curving proteins on different membrane shapes and their regulation by post-translational modifications

PDF

Impacts of post-translational modifications on interactions between G9a and its N-terminus binding partners

Asset Metadata

Creator Li, Xu (author)

Core Title Post-translational modification crosstalk regulates KAP1 co-repressor functions in response to DNA damages

School School of Pharmacy

Degree Doctor of Philosophy

Degree Program Molecular Pharmacology

Publication Date 11/28/2009

Defense Date 10/20/2009

Publisher University of Southern California (original), University of Southern California. Libraries (digital)

Tag DNA damage responses,Doxorubicin,KAP1,OAI-PMH Harvest,phosphorylation,post-translational modifications crosstalk,PP1,RNF4,SUMOylation,ubiquitination

Language English

Contributor Electronically uploaded by the author (provenance)

Advisor Ann, David K. (committee chair), Shen, Wei-Chiang (committee chair), Okamoto, Curtis Toshio (committee member), Stallcup, Michael R. (committee member), Stiles, Bangyan L. (committee member)

Creator Email xl@coh.org,xuli@usc.edu

Permanent Link (DOI) https://doi.org/10.25549/usctheses-m2774

Unique identifier UC1216643

Identifier etd-LI-3376 (filename),usctheses-m40 (legacy collection record id),usctheses-c127-279861 (legacy record id),usctheses-m2774 (legacy record id)

Legacy Identifier etd-LI-3376.pdf

Dmrecord 279861

Document Type Dissertation

Rights Li, Xu

Type texts

Source University of Southern California (contributing entity), University of Southern California Dissertations and Theses (collection)

Repository Name Libraries, University of Southern California

Repository Location Los Angeles, California

Repository Email cisadmin@lib.usc.edu