University of Southern California Dissertations and Theses

Characterization of Cxcr7 in zebrafish cardiac lymphatic vessel development

(USC Thesis Other)

Characterization of Cxcr7 in zebrafish cardiac lymphatic vessel development

PDF

Download

Open document

Flip pages

Download a page range

Download transcript

Copy asset link

Request this asset

Transcript (if available)

Content Characterization of Cxcr7 in zebrafish
cardiac lymphatic vessel development

By
Xidi Feng
1

Mentor: Ching-Ling Lien
1,2,3

A Thesis Presented to the
F ACUL TY OF THE USC GRADUA TE SCHOOL UNIVERSITY OF
SOUTHERN CALIFORNIA
In Partial Fulfillment of the Requirements for the Degree MASTER OF
SCIENCE
(Biochemistry and Molecular Medicine)
August 2017

1 Department of Biochemistry & Molecular Medicine, Keck School of Medicine, University
of Southern California, 90033 CA, USA
2 Heart Institute and Saban Research Institute and Program of Developmental Biology and
Regenerative Medicine,
3 Department of Surgery, Keck School of Medicine, University of Southern California

2
Acknowledgments

First of all, I would like to express my special appreciation to my parents for encouraging me to
study at USC. I was admitted by CUHK as a Master's student with scholarship as well, but my
parents strongly suggested me to take the offer from USC and decided to cover me all tuition and
living fee for studying abroad. Without their support, I would never have had a chance to study in
USC and have these amazing experience. I hope one day I can repay what they have done for me.

I would also like to thank Dr. Ching-Ling Lien and all other lab members for their help during my
research. It is my honor to be accepted as a member in Dr. Lien's lab. I would like to thank Dr. Lien
for all her guidance on my research and writing for project. She was always enthusiastic to give
advices to me when I encountered difficulties. I would also like to show my appreciation to Dr.
Michael Harrison. My project was set up based on his previous results and studies. Therefore, he
was the one who taught me all the experimental technologies. In addition, he also answered me the
questions with great patience and details. I would also like to thank all other lab members: Dr. Ying
Huang, Dr. Laurent Gamba, Chang Yin and Antonio Aguayo. Thank you all of you give me such a
wonderful experience and memory.

Finally, I would like to thank Dr. Young-Kwon Hong and Dr. Mark Frey to be committee members
for my thesis defense.
3
Abstract
Cardiac lymphatic vessel has been described for a long period of time, however its role in
cardiovascular diseases has not been well studied. Recently, cardiac lymphatics have been shown to
play a role in cardiovascular diseases, like myocardial infraction, and induction of
lymphagiogenesis has been shown to improve cardiac function for post-MI recovery. We found that
cardiac lymphatic vessels develop late in late juvenile state and in adult stage in zebrafish, while in
human and murine, cardiac lymphatic vessels have been shown to develop during embryonic stage.
The molecular mechanisms for cardiac lymphatic vessel development in zebrafish remain unknown.
We found that Cxcl12b-Cxcr4a chemokine signaling may participate in cardiac lymphatic vessel
development in zebrafish. The goal of my research is to investigate if another chemokine receptor,
Cxcr7, also regulates this process. I characterized the phenotypes of two homozygous cxc7a and
cxcr7b mutants using different transgenic marker. The cxcr7a mutant showed significantly
increased cardiac lymphatic vessel formation and cxcr7a expression level detected by RT-PCR
increased at late-adult stage. The expression analysis by RT-PCR and transgenic line indicated that
both Admb and Cxcl12b may be potential targets for Cxcr7a. My results suggest a potential role of
Cxcr7 in cardiac lymphatic development in zebrafish.

Key words: Cardiac lymphatic vessel, Cxcr7a, Cxcl12b, Admb
4
Table of Contents
Acknowledgments ....................................................................................................... 2
Abstract ........................................................................................................................ 3
List of Figures .............................................................................................................. 5
Chapter one: Introduction ......................................................................................... 6
General introduction about lymphatic system ............................................................................. 6
The role of cardiac lymphatic in diseases. ................................................................................... 8
Cardiac lymphatic development in mice .................................................................................... 10
Cardiac lymphatic development in zebrafish ............................................................................. 12
Chemokine signaling in zebrafish trunk lymphatic vessel development ................................... 14
The role of Cxcr7 in cardiac lymphatic development in mice ................................................... 17
Hypothesis for my research ....................................................................................................... 20
Chapter two: Material and Methods ....................................................................... 22
Reagent: ........................................................................................................................................ 22
Solution Formulation: ................................................................................................................. 23
Methods: ....................................................................................................................................... 25
Whole mount confocal Imaging of heart tissue ......................................................................... 25
Real-time PCR ........................................................................................................................... 25
Genotyping ................................................................................................................................. 27
Chapter three: Results .............................................................................................. 31
Genotyping cxcr7a and cxcr7b mutants .................................................................................... 31
Generation of cxcr7 mutant fish crossed with transgenic markers ............................................ 34
Characterizing cxcr7a mutant phenotype in cardiac lymphatic vessel development ................ 37
Characterizing cxcr7b mutant phenotype in cardiac lymphatic vessel development ................ 40
Examining the expression levels of cxcr7 and adm genes during cardiac lymphatic
development process .................................................................................................................. 42
Future direction ............................................................................................................................ 44
Chapter four: Discussion .......................................................................................... 46
Reference ................................................................................................................... 48

5
List of Figures
Figure 1 Signaling transduction during lymphatic vessel formation. 7
Figure 2 VEFG-C treatment improved cardiac function in post-MI mice. 9
Figure 3 Embryonic cardiac lymphatic vessel development in mice. 11
Figure 4 Cardiac lymphatic vessel development at adult stage in zebrafish. 13
Figure 5 Proposed model for trunk lymphatic network formation. 16
Figure 6 The CXCL12 signaling network. 18
Figure 7 CXCR7 acts as a decoy receptor for adrenomedullin
during cardiovascular development. 19
Figure 8 Potential model for Cxcr7 mediating cardiac lymphatic
formation in zebrafish. 21
Figure 9 Genotyping cxcr7a and cxcr7b. 33
Figure 10. Generating mutant fish with four transgenic markers. 36
Figure 11 cxcr7a mutant exhibited increased cardiac lymphatic vessel. 39
Figure 12 The function of Cxcr7b in cardiac lymphatic vessel
development remain unclear. 41
Figure 13 Gene expression at different stage during cardiac vessel
development. 43
Figure 14 Cxcl12b was expressed in pericytes lining specifically on
coronary arteries. 45
6
Chapter one: Introduction
General introduction about lymphatic system
The lymphatic system was identified in the 17th century
[1]
. It extends throughout the whole body
and is composed of capillaries, collecting vessels and lymph nodes
[1]
. The lymphatic vessels
function as a complement of circulatory system that reabsorbs extra interstitial fluid for body fluid
homeostasis and transports lymph as part of the immune system
[1]
. Lymphatic dysfunction leads to
diseases, such as lymphedema, lymphatic dysplasias and intestinal lymphangiectasis
[2]
. The origin
of lymphatic vessels is initiated from venous system, signified by a subset of endothelial cells
starting to express lymphatic markers
[3]
(Figure 1). Among them, the key factor is PROX1 which
controls lymphatic endothelial cells (LECs) specification from veins
[4]
. PROX1 directly induces the
expression of vascular endothelial growth factor receptor-3 (VEGFR-3 or FLT4) in LECs
[5]
, which
regulates the following budding, migration and proliferation of LECs under control of its ligand
VEGF-3
[6]
. LYVE1, Podoplanin and Forkhead Box C2 (FOXC2) are also essential factors for the
development and maintenance of lymphatic vessels
[2]
.
7

Figure 1. Signaling transduction during lymphatic vessel formation. The expression of PROX1
is activated by COUPTF-II and SOX18 in a subset of endothelial cells that are then designated for
LEC specification. PROX1 activates VEGFR-3 expression and then initiates budding of LECs from
the common cardinal vein. LECs migrate towards the systemic venous sinus along the VEGF-C
gradient. NRP2 and a complex of CCBE1 and ADAMTS3 enhance VEGF-C signaling through
VEGFR-3. (Vuorio, T. et al. Trends Endocrinol Metab. 28(2017):285-296.)
8
The role of cardiac lymphatic in diseases.
The organ-specific lymphatic vessels, including in heart, were also identified for a long period in
both human and murine
[7]
. Recently, cardiac lymphatic vessels have been identified as a potential
novel therapeutic target for treating cardiovascular diseases
[2]
. Myocardial infarction (MI) causes
heart muscle damage and affects a wide range of people over the world
[8]
. The primary cause of MI
is coronary artery disease, where the blocked vessels fail to deliver oxygen and other essential
nutrients to surrounding tissue, leading to apoptosis and necrosis of heart muscle
[8].
A few studies
have shown that cardiac lymphatic vessels may paly a role in MI
[9][10][11]
. Lymphangiogenesis was
observed in postmortem human MI samples
[11]
and in rats
[10]
and mice
[9]
post-MI samples. Cardiac
edema is a feature of MI
[12]
, and lymphangiogenesis observed in post-MI hearts was supposed to
help absorbing extra interstitial fluid and clearing the inflammation at the tissue damage site.
Inducing lymphangiogenesis in post-MI hearts in mice by VEGF-C significantly improved left
ventricular ejection fraction
[9][10]
(Figure 2), which suggested that lymphangiogenesis induction may
be an effective treatment for post-MI patients.
9

Figure 2. VEFG-C treatment improved cardiac function in post-MI mice. Inducing
lymphangiogenesis in post-MI hearts in mice by VEGF-C significantly improved left ventricular
ejection fraction, which may be caused by helping absorption of extra interstitial fluid and clearing
the inflammation at tissue damage site. (Norman, S, et al. Clin Anat. 29(2016):305-15.)

10
Cardiac lymphatic development in mice
The process of the development of cardiac lymphatic vessels has been characterized in mouse
heart
[9]
(Figure 3). The LECs were marked by VEGFR-3 and Prox1 reporters. At embryonic day
(E10.5), the VEGFR-3+ Prox1+ LECs were emerged from the endomucin (Emcn)-positive
common cardinal vein and migrated towards the hearts along the venous sinus. At E12.5 and E14.5,
the double positive LECs appeared on the outflow tract on the ventral side and the sinus venosus on
the dorsal side respectively. They were proved to bud out from common cardinal vein and migrated
down to the heart. The identified LECs continuously migrated and spread towards apex of the heart
during the remaining embryonic development and after birth until postnatal day 15 (P15), and the
formation of the lymphatic vessels is closely associated with cardiac veins (Emcn+) network. At
this time, the lymphatic vessels covered the majority of both dorsal and ventral sides of hearts in
mice.
11

Figure 3. Embryonic cardiac lymphatic vessel development in mice. At E10.5, the VEGFR-3+
Prox1+ LECs were emerged from the endomucin (Emcn)-positive common cardinal vein and
migrated towards the hearts towards venous sinus. At E12.5 and E14.5, the double positive LECs
appeared on the outflow tract on the ventral side and the sinus venosus on the dorsal side
respectively. They were proved to bud out from common cardinal vein and migrate down to heart.
The identified LECs continuously migrated and spread towards apex of the heart during the
remaining embryonic development and after birth until postnatal day 15 (P15), and the formation of
the lymphatic vessels closely associated with cardiac veins (Emcn+) network. (Norman, S, et al.
Clin Anat. 29(2016):305-15.)
12
Cardiac lymphatic development in zebrafish
In the zebrafish, the lymphatic vessels were thought to be absent in the heart. Unlike in human and
murine, there is no lymphatic vessels found in the heart at embryonic and juvenal stages in
zebrafish. However, a significant spouting of lymphatic vessels at the adult stage was observed by
Dr. Michael Harrison in our lab. For zebrafish housed at optimal conditions, they enter adult stage
around 90 days post fertilization (dpf). In his study, a group of cells labeled by flt4:mCitrene was
found migrating down from the bulbus arteriosus towards the apex at 115dpf, and forming a vessel
structure which closely associated with the large coronary vessels (Figure 4A-C). Since Flt4 is
expressed in both venous and lymphatic vessels, the prox1:RFP transgenic line was used to confirm
the identity of those late emerging cardiac vessels. The co-expression of flt4 and prox1 proved that
the vessels developing at post-adult stage in zebrafish were cardiac lymphatic vessels (Figure 4D-F).
The large vessels associated by cardiac lymphatic vessels were then identified as coronary arteries
by flt1:tdTomato and kdrl:mTurquoise labeling (Figure 4G-I).
13

Figure 4. Cardiac lymphatic vessel development at adult stage in zebrafish. (A-C)
flt4:mCitrene (Red) expressing vessels migrate down from the bulbus arteriosus towards the apex at
adult stage. (D-F) flt4:mCitrene (Blue) and prox1: RFP (Red) co-expression confirm the lymphatic
identify of the vessel. (G-I) Cardiac lymphatic vessels labeled by flt4:mCitrene (Blue in G) and
prox1: RFP (Red in H, I) were associated with coronary vessels (arteries) labeled by flt1:tdTomato
(Red in G) and kdrl:mTurquoise (Blue in H, I).
14
Chemokine signaling in zebrafish trunk lymphatic vessel development
The molecular mechanisms for cardiac lymphatic vessel development in zebrafish remain unclear.
For zebrafish trunk lymphatic vessel development, chemokine signaling has been shown to be
required for this process
[13]
. Chemokines are a family of secreted proteins with chemoattractant
function mainly on regulating cell migration and activation
[15]
. Chemokines are classified into four
groups, C, CC, CXC and CX3C, according to cysteine on the N-terminus
[14]
. In zebrafish trunk
lymphatic vessel development, chemokine Cxcl12a and Cxcl12b with their receptor Cxcr4a, played
essential roles in this process
[13]
(Figure 5). Zebrafish trunk lymphatic progenitors were emerged
from the posterior cardinal vein (PCV) and migrated towards the horizontal myoseptum (HM) to
laterally align along the HM. HM is close to the lateral surface of the trunk where PCV-derived
lymphatic progenitors form parachordal line (PC), a source of all trunk lymphatic endothelial cells.
Then the lymphatic vessels branched bi-directly along trunk arterial intersegmental blood vessels
(aISVs) towards the dorsal longitudinal anastomotic blood vessels (DLAVs) and above the PCV,
forming the dorsal lymphatic lines (DLL) and the lymphatic thoracic duct (TD) respectively.
Cxcr4a was detected expressing in developing trunk LECs and its ligand Cxcl12a and Cxcl12b
were expressed on the path of the migrating LECs. The knockdown/deletion of cxcr4a, cxcl12a and
cxcl12b by morpholino and genetic engineering significantly disrupted the trunk lymphatic
development. The deletion of cxcr4a and cxcl12b resulted in the loss of the PC and TD, and the
deletion of cxcl2a resulted in the loss of TD. These results indicated that Cxcr4/Cxcl12 signaling
axis is required for the trunk lymphatic vessel developments. We hypothesized that for zebrafish
15
cardiac lymphatic vessel development, the same signaling pathway may be involved.
16

Figure 5. Proposed model for trunk lymphatic network formation. Zebrafish trunk lymphatic
progenitors were emerged from the posterior cardinal vein (PCV) and migrated towards the
horizontal myoseptum (HM) to laterally align along the HM. Then the lymphatic vessels branched
bi-directly along trunk arterial intersegmental blood vessels (aISVs) towards the dorsal longitudinal
anastomotic blood vessels (DLAVs) and above the PCV, forming the dorsal lymphatic lines (DLL)
and the lymphatic thoracic duct (TD) respectively. Cxcr4a was detected expressing in developing
trunk LECs and its ligand Cxcl12a and Cxcl12b were expressed on the path of the migrating LECs.
(Cha, T.R. et al. Dev Cell. 22(2012):824-36.)
17
The role of Cxcr7 in cardiac lymphatic development in mice
CXCR7 is another affinity receptor for CXCL12, and it is supposed to be a decoy receptor for
neutralizing CXCL12 due to the lack of the G-protein coupled domain
[16]
. CXCR7 also inhibits
CXCL12 signaling by dimerizing with CXCR4 and this can cause the internalization of the receptor.
Some studies suggested that CXCR7 might also activate the downstream signaling by dimerizing
with CXCR4
[17]
(Figure 6). As a result, CXCR7 may modulate CXCR4/CXCL12 signaling axis and
regulate cardiac lymphatic development in zebrafish. However, in mice, Cxcl12 and Cxcr4 mutant
mice were not reported to show any defects related to cardiac lymphatic development so far
[18]
.
Recent reports suggest that CXCR7 ligand repertoire has expanded beyond CXCL11 and
CXCL12
[18]
. Therefore, CXCR7 might have additional functions that was independent of
CXCL12-CXCR4 signaling. Indeed, Klein et al. have shown that CXCR7 was also a scavenge
receptor for another ligand, adrenomedullin (AM), which mediated the proliferation and migration
of the LECs
[18]
. In their studies, the authors detected that CXCR7 was dynamically expressed in
cardiac lymphatic endothelial vessels. The deletion of CXCR7 increased the lymphangiogenesis in
hearts by promoting the proliferation and migration of LECs, which led to a blood-filled, less
branched lymphatic-like vessel formation. The knockout phenotype of Cxcr7 could be rescued by
the decrease of AM level in Adm+/- mice, indicating that CXCR7 contributes to the development of
lymphatic vessel by responding to and mediating AM signaling (Figure 7).
18

Figure 6. The CXCL12 signaling network. CXCR7 is another affinity receptor for CXCL12, and
it is supposed to be a decoy receptor for neutralizing CXCL12 due to the lack of G-protein coupled
domain. CXCR7 also inhibits CXCL12 signaling by dimerizing with CXCR4 and this can cause the
internalization of the receptor. Some studies suggested that CXCR7 might also activate the
downstream signaling by dimerizing with CXCR4. (Döring Y. et al. Front Physiol. 5 (2014):212.)

19

Figure 7. CXCR7 acts as a decoy receptor for adrenomedullin during cardiovascular
development. Binding of AM by CXCR7 in the lymphatic vasculature of wild-type mice
effectively restricts the amount of AM available to bind cognate CLR/RAMP2 receptors and initiate
downstream signal transduction, an event that culminates in phosphorylation of ERK (pERK). In
Cxcr7
−/−
mice, more AM is available to bind CLR/RAMP2 receptors, resulting in elevated
downstream signaling that promotes lymphatic endothelial cell proliferation and migration, leading
to lymphatic vessel hyperplasia. (Betterman, K.L. et al. Dev Cell. 30(2014):490-1.)

20
Hypothesis for my research
Since CXCR7 affects the cardiac lymphatic development in mice, it is highly possible that it plays
the similar role in zebrafish. There are two homologous cxcr7 genes in zebrafish, cxcr7a and cxcr7b.
The Cxcr7a is consistent of 403 amino acids and the Cxcr7b is consistent of 362 amino acids. The
functions of those two gene in zebrafish have been poorly investigated. There are a few studies
showing that Cxcr7b participates in the posterior lateral line primordium development
[20]
. In this
process, similar to its functions described in mammals, it also modulates the Cxcl12a/Cxcr4b
signaling axis as a decoy receptor in trailing cells. These is no study revealing the role of Cxcr7a in
zebrafish so far. In my study, I characterized the functions of Cxcr7a and Cxcr7b in zebrafish
cardiac lymphatic vessel development. The mutants of cxcr7a and cxcr7b were first crossed to
multiple transgenic reporter lines labeling different endothelial cell populations, and the phenotypes
were then observed by whole mount confocal imaging. The signaling pathway regulated by Cxcr7
in cardiac lymphatic vessel developmental process was also investigated. According to previous
studies, both AM and Cxcl12/Cxcr4 signaling pathways are potential targets for Cxcr7 in zebrafish
cardiac lymphatic vessel developmental process (Figure 8). To study which signaling pathway
mediates the process, gene expression analysis was further performed in my study.
21

Figure 8. Potential model for Cxcr7 mediating cardiac lymphatic formation in zebrafish.
According to previous studies, both AM and Cxcl12 pathways are potential ligands for Cxcr7 in
zebrafish cardiac lymphatic vessel developmental process.
22
Chapter two: Material and Methods
Reagent:

GlycoBlue Ambion
KCl Sigma
NaCl Sigma
TRIzol
®
Ambion
Na
2
HPO4 Sigma
chloroform Sigma
Tricaine Fluka
16% paraformaldehyde Electron Microscopy Sciences
SuperScrip
®
III First-Strand kit invitrogen
LightCycle
®
480 Probes Master Roche
low melting point agarose Fisher Bioregents
agarose DENVILLE
Diethyl pyrocarbonate (DEPC) Sigma
Tris base Sigma
Ethylenediaminetetraacetic acid (EDTA) Sigma
Acetic Acid Sigma
23
Solution Formulation:
10x PBS:
NaCl 80g
KCl 2g
Na
2
HPO
4
14.4g

dH
2
O to 1L
pH=7.4

1x PBS:
10x PBS 100ml
dH
2
O to 1L

DEPC-H
2
O:
DEPC 1ml
dH
2
O 1L
Standing at room temperature overnight, autoclaved

1x PBS-DEPC:
10x PBS 100ml
dH
2
O to 1L

Tricaine:
Tricaine 4g
1M Tris-HCl(pH=9) 21ml
ddH
2
O to 1L
pH=7.4

4% PFA in PBS-DEPC:
16% paraformaldehyde (PFA) 10ml
1xPBS-DEPC to 40ml
store at 4°C

1% Agrose in PBS:
low melting point agarose 1g
1xPBS 100ml

24
75% ethanol:
100% ethanol 7.5ml
dH
2
O 2.5ml

50mM NaOH:
NaOH 0.2g
ddH
2
O 100ml

50x TAE:
Tris base 242g
Acetic Acid 57.1ml
EDTA 18.6g
dH
2
O to 1L
Adjust pH to 8.5

1x TAE:
50x TAE 200ml
dH
2
O to 10L

0.5M EDTA:
EDTA 18.61g
ddH
2
O to 100ml
Adjust pH to 8.0

5x TBE:
Tris base 54g
Boric acid 27.5g
0.5M EDTA (pH 8.0) 20ml
dH
2
O to 1L

1x TBE:
5x TBE 200ml
dH
2
O to 1L

25
Methods:
Whole mount confocal Imaging of heart tissue
Zebrafish were first anesthetized in tricaine until when the fish did not move. Whole hearts were
collected from terminally anesthetized fish and blood clots were removed from the surface of hearts
in PBS, followed by 5-minute fixation in 4% PFA. Hearts were mounted in 1% low melting point
agarose on a glass-bottom dish. Z-stacks image and maximum intensity projections were acquired
using Zeiss LSM710 confocal microscopes.

Real-time PCR
Zebrafish hearts were collected from anesthetized fish at 70dpf, 84dpf and 1.5ypf+, and 30 hearts
were collected for 70dpf, 20 hearts for 84dpf and 15 hearts for 1.5ypf+. Blood clots were removed
from surface of hearts in PBS-DEPC and only ventricles of hearts were transferred to 1.8ml
Eppendorf tube containing 1ml TRIzol reagent with 5mm beads. Homogenization was performed
followed by 5-minute incubation at room temperature.
Each tube was then added 0.2ml chloroform and vigorously shaken by hand for 15 seconds. After
2-minute incubation, samples were centrifuged at 12,000g for 15 minutes at 4°C. The upper
aqueous phase was transferred to a new Eppendorf tube containing 0.5ml isopropanol and 2.5ul
RNase-free glycogen (15mg/ml). After 10-minute incubation at room temperature, samples were
centrifuged at 12,000g for 10 minutes at 4°C. The supernatant was removed from the tube and the
26
pellet was washed by 1ml 75% ethanol. After centrifugation at 7500g for 5 minutes at 4°C, the
ethanol was discard. The RNA pellet was air dried for 5 minutes and dissolved in 25ul DEPC-H
2
O.
The concentration of RNA sample was measured by Scientific™ NanoDrop™ spectrophotometers.
The RNA was reverse-transcribed by SuperScrip
®
III First-Strand kit. Reaction mix was prepared as
following for each sample:
oligo (dT)
20
(50uM) 1ul
10mM dNTP Mix 1ul
10pg-5ug total RNA
ddH2O to 13ul
65°C, 5min followed by 1min on ice
5X First-Strand Buffer 4ul
0.1 M DTT 1ul
RNase Inhibitor (40 units/ul) 1ul
SuperScript™ III RT (200 units/ul) 1ul
Incubate at 50°C for 60 minutes, then 70°C for 15 minutes
The mRNA from samples finally was reverse-transcribed as cDNA at this step. The RT-PCR was
performed by LightCycle
®
480 system (Roche). For each sample, the reaction was repeated 3 times.
For each reaction, the reaction mix was as following:
LightCycle
®
480 probe master mix 5ul
cDNA 1ul
27
Probe 0.2ul
Forward Primer (10uM) 0.2ul
Reverse Primer (10uM) 0.2ul
ddH
2
O 3.4ul
Total 10ul
The sequence of primers and probes for each gene are listed in table 1.
The running program for RT-PCR was as following:
Program 1: 95°C 10min x1
Program 2: 95°C 10sec x45
60°C 30sec
Program 3: 37°C 30sec x1

Genotyping
A piece of zebrafish tail was cut from anesthetized fish and transferred to 50mNaOH to be lysed at
95°C, 30min for each genotyping. The DNA was extracted after the lysis step and was ready to use
for following PCR step. The reaction mix for genotyping cxcr7a, kdrl:mTurquoise, flt4:mCitrene
was as following:
DNA 2ul
5x buffer 5ul
MgCl
2
(25mM) 2ul
28
dNTP (10mM) 0.5ul
Forward Primer (100uM) 0.1ul
Reverse Primer (100uM) 0.1ul
GoTaq flexi DNA polymerase (Promega) 0.2ul
ddH
2
O 15.1ul
Total 25ul
The reaction mix for genotyping cxcr7b was as following:
DNA 2ul
5x buffer 5ul
MgCl
2
(25mM) 2ul
dNTP (10mM) 0.5ul
Outer Forward Primer (100uM) 0.1ul
Outer Reverse Primer (100uM) 0.1ul
Inner Forward Primer (100uM) 0.1ul
Inner Reverse Primer (100uM) 0.1ul
GoTaq flexi DNA polymerase (Promega) 0.2ul
ddH
2
O 14.9ul
Total 25ul
All primers used for genotyping are listed in Table 2. The PCR reaction was performed in a thermal
cycler (Applied Biosystems verity 96 well), and the program was as following:
29
Stage 1: 95°C for 5 minutes x1
Stage 2: 95°C for 30 seconds x35
55°C for 1 minute
72°C for 1 minute
Stage 3: 72°C for 10 minutes x1
Then the DNA product for genotyping cxcr7b, kdrl:mTurquoise, flt4:mCitrene was run on 1% TAE
gel at 100V, 20min. The DNA product for genotyping cxcr7a was run on 4% TBE gel at 25V,
overnight.

30
Table 1
Gene

Sequence Probe
cxcr7a F AACATTGCGCACTCAACAAG 9

R AGTTCGCTGGCACTTAAACC
cxcr7b F CGCACGGATATCTACAAGACTTT 80

R GGTCCGTCTTTGTTATCGTCA
adma F CCCAAGAGTACGTCAACACAG 84

R TCATGCTTCGCACTGTCC
admb F GCATGTTGACCGCACTTCT 9

R CCCTACTCTGGAGCCAAACA
flt4 F GFGAATACATGCTGGTCCTGAA 80

R CATGAATCTGAGGTGGAACG

Table 2

cxcr7a F AGTTGGGTTTAAGTGCCAGC

R GTGCGTCTCGTGGTAATGAC
cxcr7b outer F GGATGCACTGGGTGAACTGAACTTCTCA

outer R AGGTGTGTAATCTTGCACAGCACCAC

inner F AACGTGAGAGCCGAGAGGACACGTCAT

inner R GCTAGGTTGAGGATGTACAGGTGAGTCCCC
kdrl:mTurquoise F CATCCGAACGTGAAGTGACA

R GAACTTCAGGGTCAGCTTGC
flt4:mCitrene F TCGTGACCACCTTCGGCTAC

R GTCCTCCTTGAAGTCGATGC
31
Chapter three: Results
Genotyping cxcr7a and cxcr7b mutants
The cxcr7a mutant allele was generated by Dr. Laurent Gamba in our lab by CRISPR/Cas9 gene
editing system. The editing caused 8 nucleotides deletion at the 286th positon of the gene, which
resulted a nonsense mutation at N-terminal. The truncated Cxcr7a protein only contain 66 amino
acids, so the functional domain of Cxcr7a is supposed to be removed (Figure 9A). There was no
obvious gross defect presented in mutant fish, and similar number of mutants was identified
compared to the number of wide type (WT) siblings identified from heterozygote incrosses (data
not shown). The result indicated that the deletion of Cxcr7a did not cause serve defects or affect the
survival rate in zebrafish. The cxcr7a mutant fish were genotyped by PCR application followed by
separation on a 4%TBE gel running at 25V, overnight. By this method, DNA fragments differ from
several nucleotides can be identified. The mutant fish shown a single lower bands on the gel and
WT fish gave a single upper bands, while the heterozygotes shown both upper and lower bands
(Figure 9D).
The cxcr7b mutant fish was obtained from ZIRC and the mutant allele is sa16. There is a single
point mutation in the mutant allele which cause the nonsense mutation, resulting in a truncated
protein with 75 amino acids (Figure 9B). The mutant allele was genotyped by the amplification
refractory mutation system (ARMS)
[19]
, which can identify single point mutation in gene. Two
paired of primers are used in ARMS, and one pair identifies WT allele and another identifies the
mutant allele (Figure 9C). All genotypes gave a strong full length bands at the top. The mutant fish
32
gave one upper band in the middle and WT fish had one lower band at bottom, while heterozygotes
had both of two bands. (Figure 9E).

33
Figure 9. Genotyping cxcr7a and cxcr7b mutants. (A) The schematic for cxcr7a mutant. The
truncated Cxcr7a is resulted from 8nt deletion. (B) The schematic for cxcr7b mutant. The truncated
Cxcr7a is resulted from a single point mutation. (C) The schematic of using ARMS system to
genotype cxcr7b. Two pairs of primers were used to amplify mutant and WT allele respectively. (D)
Gel result for genotyping cxcr7a. DNA product was run in 4% TBE gel at 25V, overnight. (E) Gel
result for genotyping cxcr7b. DNA product was run in 1% TAE gel at 80V, 20min.
34
Generation of cxcr7 mutant fish crossed with transgenic markers
The mutant fish were then crossed with multiple transgenic reporter lines to label different
endothelial populations. To observe cardiac lymphatic vessel development in mutant fish, two
transgene lines, prox1:RFP and flt4:mCitrene, were crossed with mutant fish, since both transgenic
markers are not specific for the LEC population. The co-expression of prox1:RFP and
flt4:mCitrene markers could confirm the identify of LECs. The kdrl:mTurquoise transgenic line,
which labels the coronary arteries, was also crossed with mutants. In our previous studies, we found
that cardiac lymphatic vessels closely associated with coronary arteries. The kdrl:mTurquoise
transgenic line was used to examine if Cxcr7 may regulate the association of cardiac lymphatic
vessels with coronary arteries. The fli:GFP transgenic line was crossed to mutant to ensure normal
coronary vessel development in experimental fish.
To obtain mutant fish with four transgenic lines, the mutant fish was first crossed with transgenic
fish having four markers (Figure 10A). As a result, the heterozygote fish with four transgenic
markers may be obtained from this cross. The fli:GFP and prox1:RFP lines can be screened under
fluorescent microscopy at 5dpf. The fli:GFP labels all endothelial cells, making the whole embryo a
strong green color. The prox1:RFP can be selected by red fluorescence in eyes and notochords.
Only fish with both fli:GFP and prox1:RFP were kept for further selection. The fluorescence of
flt4:mCitrene and kdrl:mTurquoise was covered by strong GFP signal, so these two markers were
genotyped by traditional PCR method at juvenile stage. Fish with flt4:mCitrene and
kdrl:mTurquoise transgenic lines showed bands on gel (Figure 10B). The fish with both
35
flt4:mCitrene and kdrl:mTurquoise transgenic lines were kept. The heterozygotes with four
transgenic markers were obtained after screening and genotyping, and were incrossed to obtain
mutant fish with four transgenic markers. The mutant fish with four transgenic markers were
identified by screening and genotyping methods described above. Finally, mutant fish with four
transgenic lines were generated to observe cardiac lymphatic vessel formation.

36

Figure 10. Generating mutant fish with four transgenic markers. (A) Flowchart of generating
mutant fish with four markers. (B) Gel results for genotyping flt4:mCitrene and kdrl:mTurquoise.
Only fish with both two transgenic lines were kept (marked with red rectangle).

37
Characterizing cxcr7a mutant phenotype in cardiac lymphatic vessel development
In order to investigate the role of Cxcr7 in cardiac lymphatic vessel development in zebrafish, the
phenotype of mutants was compared with that of WT animals. Since Cxcr7 mainly functions as
decoy receptor in regulating cell migration, the advanced or increased cardiac lymphatic vessel
formation was expected in mutant fish.
Zebrafish cardiac lymphatic vessels were found to form after adult stage, thus mutant hearts were
collected at post-adult stage at 168dpf. At this stage, zebrafish cardiac lymphatic development was
supposed to largely develop. After collection, the whole mount image was performed by confocal
microscope. Control hearts from fish with matched body length and date of birth to mutant fish
were also collected. As shown in Figure 8, the cardiac lymphatic vessel development in control
hearts was not initiated, while in cxcr7a mutants, cardiac lymphatic vessels largely extended
through the whole hearts from the bulbus arteriosus towards the apex. In addition, cardiac
lymphatic vessels in mutant fish closely associated with kdrl:mTurquoise expressing coronary
arteries, and for some part, both sides of arteries were surrounded by lymphatic vessels, which had
not been observed in WT fish (Figure 11B and Figure 4). In my study, no lymphatic vessel was
observed in control hearts at this stage, which was different from previous results obtained in Dr.
Harrison's studies (Figure 4). But this may due to individual variations and small experimental
numbers (n=3). More fish need to be observed in the future. While compared to previous WT fish
(Figure 4), cxcr7a mutant fish exhibited two lymphatic vessels at both sides of arteries and more
branches sprouting out from the main vessels (Figure 11). In summery, the deletion of Cxcr7a
38
significantly induced cardiac lymphatic vessel formation and vessel branching in zebrafich, which
was consistent with the results in mice
[18]
and my hypothesis.

39

Figure 11. cxcr7a mutant exhibited increased cardiac lymphatic vessel formation. (A)
Cardiovascular structure in sibling controls for cxcr7a mutant. No lymphatic vessel found in control
hearts at 168dpf. (B) Same image as in (A) without GFP channel. (C) Cardiac lymphatic vessels
were largely increased in cxcr7a mutant, with more branches as well. Cardiac lymphatic vessels
closely associated with coronary arteries. (D) Same image as in (C) without GFP channel. fli:GFP
labels endothelial cells; prox1:RFP and flt4:mCitrene coexpression labels LECs; kdrl: mTurquoies
labels arteries. (n=3)
40
Characterizing cxcr7b mutant phenotype in cardiac lymphatic vessel development
Similar experiment was done to characterize cxcr7b mutant phenotype as to cxcr7a mutant. Mutants
crossed with prox1:RFP and fli:GFP transgenic lines were obtained to examine cardiac lymphatic
vessel development. The vessels expressing prox1:RFP were supposed to be lymphatic vessels.
Zebrafish hearts were collected at 210dpf and whole mount image was performed by confocal
microscope. As shown in Figure 9, cxcr7b mutant exhibited more cardiac lymphatic vessels
compared to its sibling controls. However, in control hearts, only limited cardiac lymphatic vessel
development was found in my studies compared to previous results (Figure 4). But this may be due
to different zebrafish strain background. If comparing cardiac lymphatic vessel in cxcr7b mutant
fish (Figure 12) with that in WT in previous studies (Figure 4), no obvious difference can be
observed. From these results, no solid conclusion can be made about the role of Cxcr7b in cardiac
lymphatic vessel development in zebrafish. The gene may play a negative role in regulating the
cardiac lymphatic vessel formation in zebrafish, but more evidence need to be obtain from
experiments.

41

Figure 12. The function of Cxcr7b in cardiac lymphatic vessel development remain unclear.
(A) Cardiovascular structure in sibling controls for cxcr7b mutant. Limited lymphatic vessel
development in control hearts at 210dpf. (B) Same image as in (A) without GFP channel. (C)
cxcr7b mutant had slightly more cardiac lymphatic vessels compared to its sibling controls (D)
Same image as in (C) without GFP channel. fli:GFP labels endothelial cells; The vessel like
structure expressing prox1:RFP marker was supposed to be cardiac lymphatic vessel (n=9).
42
Examining the expression levels of cxcr7 and adm genes during cardiac lymphatic development
process
To further examine the role of Cxcr7 in cardiac lymphatic vessel development, the expressions of
cxc7a and cxcr7b were detected at different stages during zebrafish development by
real-time(RT)-PCR. In addition, investigating the signaling pathway mediated by Cxcr7 during
cardiac lymphatic vessel development is also essential. Therefore, the expressions of potential
candidates adma and admb were detected at the same time. The expression of flt4 was detected as
control to indicate normal cardiac lymphatic vessel development. Only the ventricles of hearts were
collected for RT-PCR, for it was the part where cardiac lymphatic vessels were found. The tissue
samples were collected at 70dpf, 84dpf and 1.5ypf+, which represent the stage without cardiac
lymphatic vessel, the stage cardiac lymphatic vessel development just starting and the stage with
fully developed cardiac lymphatic vessels respectively.
As shown in Figure 13, the expression level of cxcr7a increased 1-fold at 1.5ypf+ compared to
70dpf and 84dpf, and the expression level of cxcr7b decreased 1-fold at 84dpf and returned to the
similar level at 1.5ypf+ compared to 70dpf. These results indicated that Cxcr7b may regulate
cardiac lymphatic vessel development at initiation stage, such as the spouting out from bulbus
arteriosus, while Cxcr7a mediates the cardiac lymphatic vessel development at later stage, such as
the proliferation and migration of LECs. The expression of adma was not detectable at any stage in
zebrafish heart ventricles, while the expression levels of admb were increased 1-fold at 84 dpf and
1.5ypf+ compared to 70dpf. The result implied that Admb signaling may be regulated by Cxcr7 in
cardiac lymphatic vessel development in zebrafish.
43

Figure 13. Gene expressions at different stage during cardiac vessel development. The
expression levels of cxcr7a, cxc7b, adma, admb, flt4 were detected in cardiac ventricles at 70dpf,
84dpf and 1.5yfp+. The expression of cxc7a increased at 1.5ypf+, while the expression of cxc7b
decreased at 84dpf. The expression of adma was not detectable at any of stage, while the expression
of admb increased at 84dpf and 1.5yfp+. The expression of flt4 was used to measure cardiac
lymphatic development.
44
Future direction
Although the temporal expressions of cxcr7 and adm genes were analyzed by RT-PCR, the spatial
expressions of these genes also need to be examine. Whole mount in situ hybridization analysis will
be performed to obtain spatial expression information of these genes in zebrafish hearts. The
expressions of cxcr7a or cxcr7b will be expected in developing cardiac lymphatic vessels, while
admb gene in tissue that surround developing lymphatic vessels, such as in coronary arteries.
In addition, direct evidence is required to prove which signaling pathway is regulated by Cxcr7 in
cardiac lymphatic vessel development in zebrafish. Although RT-PCR analysis indicated that admb
gene may participate in the process, there is also evidence showing that Cxcr7 may interact with
Cxcl12b signaling pathway to regulate cardiac lymphatic vessel development. The expression of
cxcl12 was also analyzed by Dr. Harrison in our lab by cxcl12b:YFP transgenic line. As shown in
Figure 14, cxcl12b was expressed in pericytes lining specifically the coronary arteries, which
cardiac lymphatic vessels closely associate with. This suggests the possibility that Cxcr7 mediates
Cxcl12b signaling to control cardiac lymphatic vessel development in zebrafish. In order to
determine which hypothesis is correct, genetic titration of admb and cxcl12b will be performed in
cxcr7 mutant. The phenotype of cxcr7 mutant is supposed to be normalized by genetic reduction of
target ligand of Cxcr7. By this method, the signaling pathway regulated by Cxcr7 could be
revealed.

45

Figure 14. cxcl12b was expressed in pericytes lining specifically on coronary arteries. The
cxcl12b expression was analyzed by cxcl12b:YFP (blue). Endothelial cells was labeled by fli:GFP.
Cardiomyocytes were shown by cmlc:RFP

46
Chapter four: Discussion
For my research, I aim at exploring the role of Cxcr7 in cardiac lymphatic vessel development in
zebrafish. For this purpose, the phenotypes of both homozygous cxcr7a and cxcr7b mutants were
characterized with different lineage tracing lines. The cxcr7a mutant had significantly increased
cardiac lymphatic vessel with more branches, which suggests its negative role in regulating cardiac
lymphatic vessel development in zebrafish and the results were consistent with the results in
mice
[18]
. In mice studies, they also performed further experiments to investigate which aspects of
LECs were modulated by CXCR7. The results indicate that cardiac lymphatic vessel increase in
Cxcr7 mutant was caused by enhanced LEC migration and proliferation. Similar analysis could also
be performed in my project to study if Cxcr7a mediate the same cell activities of LECs in zebrafish.
In contrast, cxcr7b mutant only shown slight different phenotype compared to its control, thus more
experiments are required to further confirm its functions on cardiac lymphatic development.
The associations between cardiac lymphatic vessels and coronary arteries were not affected in both
cxcr7a and cxcr7b mutants, indicating that there is other signaling pathway participating in the
regulation of cardiac LECs migration direction.
The expression analysis was also performed for both cxcr7a and cxc7b. The results indicated that
Cxcr7b may participated at an early stage, while Cxcr7a functions in a later stage during cardiac
lymphatic vessel development process. More detailed analysis will be conducted in the future, such
as performing whole mount in situ hybridization analysis or conditional knockout at different time
points during cardiac lymphatic vessel development.
47
Investigating the signaling pathway regulated by Cxcr7 is also interesting for my project. There are
two potential signaling pathways that may be mediated by Cxcr7 during cardiac lymphatic vessel
development process in zebrafish according to previous studies
[13][18]
. The first one is Cxcr4/Cxcl12
signaling axis
[13]
, and the other is AM signaling pathway
[18]
. The expression analysis provided the
evidence for the participation of both cxcl12b and admb genes. Therefore, more direct results are
required to further confirm which signaling pathway is mediated by Cxcr7. One method is genetic
titration, since Cxcr7 was suggested to function as decoy receptor. After genetic titration of specific
ligand, the phenotype of cxcr7 mutant fish was supposed to be normalized.
In summary, my results suggest a potential role of Cxcr7a in zebrafish cardiac lymphatic vessel
development. However, more experiments are required to reveal the mechanism by which Cxcr7
regulates cardiac lymphatic vessel development in zebrafish.

48
Reference
[1] Alitalo, K., Tammela, T., Petrova, T.V. (2005). Lymphangiogenesis in devel- opment and
human disease. Nature. 438:946–953
[2] Vuorio, T., Tirronen, A., Ylä-Herttuala, S. (2017) Cardiac Lymphatics - A New Avenue for
Therapeutics? Trends Endocrinol Metab. 28:285-296.
[3] Ulvmar, M.H., Martinez-Corral, I., Stanczuk, L., Mäkinen, T. (2016) Pdgfrb-Cre targets
lymphatic endothelial cells of both venous and non-venous origins. Genesis. 54:350-8.
[4] Wigle, J.T., Oliver, G. (1999) Prox1 function is required for the development of the murine
lymphatic system. Cell. 98:769-78
[5] Srinivasan, R.S., Escobedo, N., Yang, Y., Interiano, A., Dillard, M.E., Finkelstein, D., Mukatira,
S., Gil, H.J., Nurmi, H., Alitalo, K., Oliver, G. (2014) The Prox1-Vegfr3 feedback loop maintains
the identity and the number of lymphatic endothelial cell progenitors. Genes Dev. 28:2175-87.
[6] Karkkainen, M.J., Haiko, P., Sainio, K., Partanen, J., Taipale, J., Petrova, T.V., Jeltsch, M.,
Jackson, D.G., Talikka, M., Rauvala, H., Betsholtz, C., Alitalo, K. (2004) Vascular endothelial
growth factor C is required for sprouting of the first lymphatic vessels from embryonic veins.
Nat Immunol. 5:74-80.
[7] Rudbeck, O. (1653) Nova exervitatio anatomia exhibens ductus hepatico aquosos et vasa
glandularum serosa, nune primum inventa, aenesisque figuris delineata. Euchar: Lauringerus.
[8] Thygesen, K., Alpert, J.S., Jaffe, A.S., Simoons, M.L., Chaitman, B.R., White, H.D.; Task Force
49
for the Universal Definition of Myocardial Infarction. (2012) Third universal definition of
myocardial infarction. Nat Rev Cardiol. 9:620-33.
[9] Klotz, L., Norman, S., Vieira, J.M., Masters, M., Rohling, M., Dubé, K.N., Bollini, S.,
Matsuzaki, F., Carr, C.A., Riley, P.R. (2015) Cardiac lymphatics are heterogeneous in origin
and respond to injury. Nature. 522:62-7.
[10] Henri, O., Pouehe, C., Houssari, M., Galas, L., Nicol, L., Edwards-Lévy, F., Henry, J.P.,
Dumesnil, A., Boukhalfa, I., Banquet, S., Schapman, D., Thuillez, C., Richard, V., Mulder, P.,
Brakenhielm, E. (2016) Selective Stimulation of Cardiac Lymphangiogenesis Reduces
Myocardial Edema and Fibrosis Leading to Improved Cardiac Function Following
Myocardial Infarction. Circulation. 133:1484-97
[11] Ishikawa, Y., Akishima-Fukasawa, Y., Ito, K., Akasaka, Y., Tanaka, M., Shimokawa, R.,
Kimura-Matsumoto, M., Morita, H., Sato, S., Kamata, I., Ishii, T. (2007) Lymphangiogenesis in
myocardial remodelling after infarction. Histopathology. 51:345-53.
[12] Dharmakumar, R. (2015) Building a unified mechanistic insight into the bimodal pattern of
edema in reperfused acute myocardial infarctions: Observations, interpretations, and outlook.
J Am Coll Cardiol 66:829–831.
[13] Cha, Y.R., Fujita, M., Butler, M., Isogai, S., Kochhan, E., Siekmann, A.F., Weinstein, B.M.
(2012) Chemokine signaling directs trunk lymphatic network formation along the preexisting
blood vasculature. Dev Cell. 22:824-36.
[14] Murphy, P. M., Baggiolini, M., Charo, I. F., Hebert, C. A., Horuk, K., Matsushima, R., et al.
50
(2000). International union of pharmacology. XXII. Nomenclature for chemokine receptors.
Pharmacol Rev. 52, 145–176.
[15] Rot, A., von Andrian, U.H. (2014) Chemokines in innate and adaptive host defense: Basic
chemokinese grammar for immune cells. Annu Rev Immunol. 22:891–928.
[16] Graham, G.J., Locati, M., Mantovani, A., Rot, A., Thelen, M. (2012) The biochemistry and
biology of the atypical chemokine receptors. Immunol Lett. 145:30-8.
[17] Döring, Y., Pawig, L., Weber, C., Noels, H. (2014) The CXCL12/CXCR4 chemokine
ligand/receptor axis in cardiovascular disease. Front Physiol. 5:212.
[18] Klein, K.R., Karpinich, N.O., Espenschied, S.T., Willcockson, H.H., Dunworth, W.P., Hoopes,
S.L., Kushner, E.J., Bautch, V.L., Caron, K.M. (2014) Decoy receptor CXCR7 modulates
adrenomedullin-mediated cardiac and lymphatic vascular development. Dev Cell. 30:528-40.
[19] Newton, C.R., Graham, A., Heptinstall, L.E., Powell, S.J., Summers, C., Kalsheker, N., Smith,
J.C., Markham, A.F. (1989) Analysis of any point mutation in DNA. The amplification
refractory mutation system (ARMS). Nucleic Acids Res. 17:2503-16.
[20] Dalle, Nogare, D., Somers, K., Rao, S., Matsuda, M., Reichman-Fried, M., Raz, E., Chitnis,
A.B. (2014) Leading and trailing cells cooperate in collective migration of the zebrafish
posterior lateral line primordium. Development. 141:3188-96.

Abstract (if available)

Abstract Cardiac lymphatic vessel has been described for a long period of time, however its role in cardiovascular diseases has not been well studied. Recently, cardiac lymphatics have been shown to play a role in cardiovascular diseases, like myocardial infraction, and induction of lymphagiogenesis has been shown to improve cardiac function for post-MI recovery. We found that cardiac lymphatic vessels develop late in late juvenile state and in adult stage in zebrafish, while in human and murine, cardiac lymphatic vessels have been shown to develop during embryonic stage. The molecular mechanisms for cardiac lymphatic vessel development in zebrafish remain unknown. We found that Cxcl12b-Cxcr4a chemokine signaling may participate in cardiac lymphatic vessel development in zebrafish. The goal of my research is to investigate if another chemokine receptor, Cxcr7, also regulates this process. I characterized the phenotypes of two homozygous cxc7a and cxcr7b mutants using different transgenic marker. The cxcr7a mutant showed significantly increased cardiac lymphatic vessel formation and cxcr7a expression level detected by RT-PCR increased at late-adult stage. The expression analysis by RT-PCR and transgenic line indicated that both Admb and Cxcl12b may be potential targets for Cxcr7a. My results suggest a potential role of Cxcr7 in cardiac lymphatic development in zebrafish.

Linked assets

University of Southern California Dissertations and Theses

Conceptually similar

PDF

Expression pattern analysis of coronary and lymphatic vessel genes in zebrafish and mice

PDF

Development of the lymphatics in the eye

PDF

Identification and characterization of the enhancer elements for lymphatic-specific expression of Prox1

PDF

Characterization of transgenic zebrafish lines for studying role of platelet derived growth factor (PDGF) signaling on coronary vessel formation in regenerating zebrafish heart after cryoinjury

PDF

Zebrafish as a blueprint for cardiac regeneration

PDF

Characterization of zebrafish phf6 CRISPR mutant phenotypes

PDF

Role of Notch and hyaluronan in modulating the expression of lymphatic vessel endothelial hyaluronan receptor1 (LYVE1)

PDF

Opposing function of chd7 and phf6 in zebrafish craniofacial development

PDF

Visualization and characterization of rat lymphatic vasculature in a Prox1-EGFP bacterial artificial chromosome (BAC) transgenic rat: a novel animal model for physiological and pathological lymph...

PDF

Investigating the role of cardiac fibroblasts in modulating angiogenesis during heart injury

PDF

TNNI3K expression affects nucleation of cardiomyocytes and skeletal myoblasts

PDF

Proliferation and maturation events in second heart field cells during cardiovascular development activated by the Delta like ligand-4 mediated notch signaling

PDF

PRMT1 controls subcellular localization of p53 via PARP1

PDF

A novel role for post-migratory neural crest cells in cardiac outflow tract alignment: insights into the molecular basis of concomitant congenital cardiac and cleft malformations

PDF

The roles of Tnni3k in heart regeneration, cardiac conduction system defects and cardiomyopathy

PDF

Retinoic acid and TGFβ signaling regulate cardiovascular development

PDF

Developmental biology of epicardial adipose tissue

PDF

Characterization of midkine-a function in zebrafish heart regeneration

PDF

Endothelial-specific knockout of Krüppel like factor 2 and 4 induces glaucoma-like phenotype in adult mice

PDF

Tools to study the epicardium's response during cardiac regeneration

Asset Metadata

Creator Feng, Xidi (author)

Core Title Characterization of Cxcr7 in zebrafish cardiac lymphatic vessel development

School Keck School of Medicine

Degree Master of Science

Degree Program Biochemistry and Molecular Medicine

Publication Date 07/17/2019

Defense Date 06/21/2017

Publisher University of Southern California (original), University of Southern California. Libraries (digital)

Tag admb,cardiac lymphatic vessel,Cxcl12b,Cxcr7a,OAI-PMH Harvest

Language English

Contributor Electronically uploaded by the author (provenance)

Advisor Lien, Ching-Ling (committee chair), Frey, Mark (committee member), Hong, Young-Kwon (committee member)

Creator Email fengxidi@163.com,xidifeng@usc.edu

Permanent Link (DOI) https://doi.org/10.25549/usctheses-c40-405031

Unique identifier UC11264121

Identifier etd-FengXidi-5566.pdf (filename),usctheses-c40-405031 (legacy record id)

Legacy Identifier etd-FengXidi-5566.pdf

Dmrecord 405031

Document Type Thesis

Rights Feng, Xidi

Type texts

Source University of Southern California (contributing entity), University of Southern California Dissertations and Theses (collection)

Access Conditions The author retains rights to his/her dissertation, thesis or other graduate work according to U.S. copyright law. Electronic access is being provided by the USC Libraries in agreement with the a...

Repository Name University of Southern California Digital Library

Repository Location USC Digital Library, University of Southern California, University Park Campus MC 2810, 3434 South Grand Avenue, 2nd Floor, Los Angeles, California 90089-2810, USA