University of Southern California Dissertations and Theses

Biochemical analysis of somatic mutations in steroid 5alpha-reductase type II in prostate cancer

(USC Thesis Other)

Biochemical analysis of somatic mutations in steroid 5alpha-reductase type II in prostate cancer

PDF

Download

Open document

Flip pages

Download a page range

Download transcript

Copy asset link

Request this asset

Transcript (if available)

Content BIOCHEMICAL ANALYSIS OF SOMATIC MUTATIONS IN
STEROID 5 a-REDUCTASE TYPE II IN
PROSTATE CANCER
by
Ya-hsuan Hsu
A Thesis Presented to the
FACULTY OF THE GRADUATE SCHOOL
UNIVERSITY OF SOUTHERN CALIFORNIA
In Partial Fulfillment of the
Requirements for the Degree
MASTER OF SCIENCE
(BIOCHEMISTRY AND MOLECULAR BIOLOGY)
December 2002
Copyright 2002 Ya-hsuan Hsu
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
UMI Number: 1414840
UMI
UMI Microform 1414840
Copyright 2003 by ProQuest Information and Learning Company.
All rights reserved. This microform edition is protected against
unauthorized copying under Title 17, United States Code.
ProQuest Information and Learning Company
300 North Zeeb Road
P.O. Box 1346
Ann Arbor, Ml 48106-1346
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
UNIVERSITY OF SOUTHERN CALIFORNIA
The Graduate School
University Park
LOS ANGELES, CALIFORNIA 900894695
This thesis, w ritten b y
Y a t-fspt______________________________
U nder th e directio n o f h&x... Thesis
Com m ittee, an d a p p ro ved b y a ll its m em bers,
has been p re sen ted to an d accepted b y The
G raduate School, in p a rtia l fulfillm en t o f
requirem ents fo r th e degree o f
December 18, 2002
Dean o f Graduate Studies
D ate
THESIS COMMi
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Dedication
This master’s thesis is dedicated to my parents, who love and support me
unconditionally always! And also to my little sister, who encourages me sometimes,
tolerates me most of the time, and bugs me all the time. All of you are my strength and
my joy, you make everything possible and worthwhile!
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Acknowledgements
I would like to thank my mentor, Dr. Juergen Reichardt, for welcoming me in the lab
and for his patience, encouragement and guidance.
Also thanks to my committee members, Dr. Zoltan Tokes and Dr. Gerry Coetzee, for
their time and efforts in helping me prepare this thesis.
Thanks to the coworkers in Reichardt’s lab, especially Claudia, Nick, Abebe, Dolly,
Troy, Eugene and Shih-chi Chen. Without your help and support, I couldn’t have done
this work.
Finally, thanks to all the friends who shared my tears and joy during the past two years.
You are my angels!
in
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Table of Contents
Dedication ii
Acknowledgements iii
List of Tables vi
List of Figures vii
Abstract ix
1 Prostate Cancer Introduction 1
1.1 Prostate cancer epidemiology 1
1.2 Androgens 1
1.3 Androgen receptor 4
1.4 Steroid 5 a -reductase 5
1.5 Somatic missense substitutions 8
1.6 Finasteride 9
2 Mutagenesis 11
2.1 Introduction 11
2.2 Methods & Materials 13
2.2.1 Primer design 13
2.2.2 Mutagenesis 14
2.2.3 Transformation 15
2.2.4 Restriction enzyme digestion 16
2.2.5 Sequencing 16
2.3 Results 18
2.3.1 Restriction enzyme digestion 18
2.3.2 Sequencing 19
3 Biochemistry and Molecular Characteristics 21
3.1 Introduction 21
3.2 Methods & Materials 22
3.2.1 Transfection 22
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
3.2.2 Harvesting and sonication 24
3.2.3 Protein assay 24
3.2.4 0 -galactosidase assay 25
3.2.5 5 a -Reductase assay 25
3.2.6 Western blot 26
3.3 Results 28
3.3.1 Wild type 28
3.3.2 A49T missense mutation 33
3.3.3 G183D missense mutation 38
3.3.4 Summary 38
4 Discussion 41
4.1 5 a -Reductase enzyme activity 41
4.2 Conclusion 43
4.2.1 SRD5A2 cDNA reconstruction 43
4.2.2 Enzyme activity assay 43
4.2.3 SRD5A2 in prostate cancer progression 44
4.2.4 A49T and G183D in SRD5A2 47
4.2.5 Future Directions 49
References 52
V
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
List of Tables
Table Title Page
1.1 Comparison of SRD5A1 and SRD5A2 7
2.1 Mutagenesis primers 14
2.2 Cycling parameters for mutagenesis 15
2.3 Sequencing primers 17
2.4 Cycling parameters for sequencing 17
3.1 Comparison of in vitro conditions for WT and A49T 39
3.2 Comparison of in vitro results for SRD5A2 wild type enzyme 39
3.3 Comparison of Vm a x and Km for all SRD5A2 enzymes 40
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
List of Figures
Figure Title Page
1.1 Androgens 2
1.2 Androgen Action 3
1.3 Chemical pathway of T and DHT 6
1.4 Polymorphisms in SRD5A2 gene 8
1.5 Chemical structure of finasteride 10
2.1 pS303 vector 12
2.2 Electrophoresis photo of PstI restriction enzyme digestion 18
2.3 A49T clone 3, 4,6 sequencing results with the forward primer 19
2.4 G183D clone 1,3, 6 sequencing results with the reverse primer 19
2.5 A49T/G183D double mutant sequencing results 20
3.1 5 a -Reductase activity curve as a function of pH for wild type 28
3.2 Time curve of reaction incubation period for wild type 29
3.3 Standard curve for protein amount determination of wild type 29
3.4 Vm a x curve of wild type 31
vii
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
3.5 Western blot of mock and wild type 32
3.6 5 a -Reductase activity curve as a function of pH for A49T 33
3.7 Time curve of reaction incubation period for A49T 34
3.8 Standard curve for protein amount determination of A49T 35
3.9 V m ax curve of A49T clone 3 36
3.10 Y m ax curve of A49T clone 4 37
3.11 5 a -Reductase activity curve as a function of pH for G183D clone 3 38
4.1 Proposed binding domains for substrate and cofactor in the 48
human type II steroid 5 a -reductase enzyme
viii
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Abstract
Human prostatic steroid 5a-reductase catalyzes the irreversible conversion of
testosterone to dihydrotestosterone with NADPH as cofactor. In this study, three
different mutant cDNAs were reconstructed: the A49T missense cDNA (a
constitutional mutation), G183D cDNA (a double somatic coexisting mutant that
occurs with A49T in prostate cancer) and A49T-G183D double mutant cDNA. To
optimize the in vitro experiments, several variables (pH, time, protein amount) were
examined before the substrate Vm a x value was measured. The Vm a x and substrate Km of
wild type SRD5A2 are 1.17 nmole/min*mg and 0.92 pM respectively; whereas those
of the A49T mutants are 2.62 nmole/min*mg and 7.13 pM, which seems to be an
inherent gain-of-function because of the higher Vm ax . These enzyme activities may
contribute to future studies of steroid 5a-reductase inhibitors in human patients treated
for prostatic conditions.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 1: Prostate Cancer Introduction
1.1 Prostate Cancer Epidemiology
Prostate cancer is a very common disease in more developed countries. In
the United States, it is predicted that as many as 189,000 cases will be newly
diagnosed, and 30,200 men will die of the disease in 2002 (Jemal et al., 2002).
Prostate cancer accounts for 30 percent of new cancer cases in men, which is the
highest incidence rate among all cancers (Jemal et al., 2002). Prostate cancer is
thought to be androgen dependent, and androgens were shown to play a
substantial role in predisposition to the disease (Huggins and Hodges, 1941).
1.2 Androgens
Cancer growth depends on the ratio of cells proliferating to those dying,
and androgens are the main regulators of this ratio by both stimulating
proliferation and inhibiting apoptosis (reviewed by Feldman and Feldman, 2001).
Therefore, prostate cancer depends on a crucial level of androgenic stimulation
for growth and survival, because the interactions of androgens and androgen
1
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
receptors induce/inhibit the target gene expression (Brinkmann et al., 1999).
Androgen ablation causes cancer regression because without androgens, cellular
proliferation is lower and the rate of cell death is increased, leading to extinction
of these cells (Denmeade et al., 1996).
OH
Androstenedlone Testosterone
OH
Xu
Dihydrotestosterone
Fig. 1.1 Androgens. Androgens include androstenedione, testosterone,
dihydrotestosterone. Dihydrotestosterone is the most potent among
them.
Androgens include androstenedione, testosterone, dihydrotestosterone (Fig.
1.1); dihydrotestosterone is the most potent among them. Testosterone, the main
circulating androgen, is secreted in men primarily by the testes, but is also formed
by peripheral conversion of adrenal steroids (reviewed by Grinffin and Wilson,
1998). Testosterone circulates in the blood, where it is bound to albumin and
sex-hormone-binding globulin (SHBG), with a small fraction dissolved freely in
the serum (Brinkmann et al., 1999). When free testosterone diffuses across the
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
plasma membranes of prostate cells, 90% is reduced to dihydrotestosterone (DHT).
DHT exerts its function by activation of the androgen receptor (reviewed by
Feldman and Feldman, 2001) (Fig. 1.2).
O
Testosterone
Androgen-responsive ceil
Sareductase
o — ► O d h t _
Ligand - - 1
binding
S it# !*
Dimerization and
phosphorylation
AR
> P
Co ai t.vdtor
1 1 lurruilrtiiin!
D N A s..A R -k “
binding - y \ ^ L )
Androgen-respor
elem ent
Targe! gene actuation
— i — i
} PSA f G i nwth t Survival
Biological lesponses
Fig. 1.2 Androgen Action. Testosterone circulates in the blood bound to
albumin and sex-hormone binding globulin, and dissociation to give
free testosterone which enters prostate cells. (Reproduced from
Feldman and Feldman, 2001)
3
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
1.3 Androgen Receptor
The androgen receptor, a member of the steroid-thyroid-retinoid
nuclear-receptor superfamily (Brinkmann et al., 1999), is composed of an
amino-terminal activation domain, a carboxyl-terminal ligand-binding domain
and a DNA -binding domain in the mid-region that contains two zinc fingers
(reviewed by Feldman and Feldman, 2001).
In the basal state, the AR is bound to heat-shock proteins (HSPs) in a
conformation that prevents DNA binding (reviewed by Grinffin and Wilson,
1998). Binding to androgens induces a conformational change in the AR that
leads to dissociation from the HSPs and receptor auto-phosphorylation
(Brinkmann et al., 1999). The ligand-induced conformational change facilitates
the formation of AR homodimer complexes that can then bind to
androgen-response elements in the promoter regions of nuclear target genes
(Brinkmann et al., 1999) (Fig. 1.2).
The activated DNA-bound AR homodimer complex recruits co-regulatory
proteins, co-activators or co-repressors, to the AR complex (reviewed by
Feldman and Feldman, 2001). As in other nuclear receptors, the ligand-induced,
4
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
activated conformation involves a shift in the position of helix 12 of the
receptor to form a surface to which co-activators can bind (reviewed by
McKenna et al., 1999). The co-activators allow interaction of the AR complex
with the general transcription apparatus to stimulate or inhibit target gene
transcription (reviewed by Quigley et al., 1995).
1.4 Steroid 5a-Reductase
The enzyme steroid 5a-reductase is a microsomal protein that plays a
central role in human sexual differentiation and androgen physiology (reviewed
by Cheng et al., 1993). Steroid 5a-reductase, a membrane-bound enzyme,
catalyzes the reduction of testosterone to DHT with NADPH as its cofactor.
During fetal development, DHT leads to the development of the male external
genitalia (reviewed by Wilson, 1978). DHT, an essential compound in the initial
growth of prostate cancer, is synthesized from testosterone by the enzyme
steroid 5ct-reductase through the reduction of a double bond (Fig. 1.3).
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
O H PH
mOPH * H + NADP+
§» - Reduetes#
O'
Testosterone
HH
Dihydrotestasterone
Fig. 1.3 Chemical pathway of T and DHT. 5 a -reductase type II converts
testosterone to DHT with NADPH as a cofactor. (Reproduced from
Russell and Wilson, 1994)
Two known isozymes of steroid 5a-reductase exist. The type I enzyme is
expressed primarily in newborn scalp, skin and liver, whereas type II isozyme
is expressed primarily in genital skin, liver and the prostate (Thigpen et al.,
1992). The type I enzyme, encoded by the SRD5A1 gene, has an alkaline pH
optimum, and is resistant to finasteride inhibition; the type II isozyme,
encoded by the SRD5A2 gene, has an acidic pH optimum (Andersson and
Russell, 1990). The amino acid sequence of the type II is 45% identical to that
of the type I, and has a slightly higher affinity for the same steroid substrates
as compared with to the type I enzyme (Andersson et ah, 1991). The SRD5A2
gene mutations can cause a rare autosomal disorder, male
6
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
pseudohermaphroditism, with a phenotype that includes the absence of a
developed prostate (Andersson et al., 1991).
Table 1.1 Comparison of SRD5A1 and SRD5A2 gene
Exonl Exon2 Exon3 Exon4 Exon5 (bp)
SRD5A1 420 167 102 151 1370
SRD5A2 351 168 104 153 1685
Intronl Intron2 Intron3 Intron4 (Kb)
SRD5A1 18.3 4.0 6.6 5.2
SRD5A2 46.8 2.1 1.9 3.0
(Jenkins et al., 1991; Labrie et al., 1992)
The SRD5A1 gene is located in human chromosome band 5pl5, and the
SRD5 A2 gene is located in the short arm of human chromosome 2, between
bands 2p22 and 2p23 (reviewed by Russell and Wilson, 1994), both genes
contain 5 exons and 4 introns (Table 1.1). Within the SRD5A2 gene, many
somatic mutations are known from Abebe Akalu in Reichardt’s lab
(unpublished) (Fig. 1.4).
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
F1181 OAn O ^ < V A248V
Intron size (kb)
Fig. 1.4 Gene structure of SRD5A2 gene. Mutations found in tumor DNA of
prostate cancer patient, described in 1 letter amino acid code. Boxes
indicate exons, (unpublished data from Abebe Akalu)
1.5 Somatic Missense Substitutions
A constitutional missense substitution results in the replacement of an
alanine residue at amino acid codon 49 with threonine (A49T) was discovered in
SRD5A2 (Russell et al., 1994). The constitutional A49T was found both in
germline and somatic tissues. The A49T missense substitution was uncommon in
healthy African-American men (1.0%) and Hispanic men (2.3%) in Los Angeles,
but in African-American men with prostate cancer, the A49T allele frequency
increased to 4.0%. In Hispanic prostate cancer patients the allele frequency was
4.1% (Makridakis et al., 1999). The population attributable risk for prostate
cancer is about 8% in both populations. The A49T missense substitution in the
8
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
SRD5A2 gene results in increased enzymatic activity in vitro (Makridakis et al.,
1999).
A somatic missense substitution G183D (glycine to aspartate replacement
at amino acid position 183) was discovered to coexist with A49T in prostate
cancer patient tissues by Abebe Akalu in Reichardt’s lab (unpublished). Double
mutants exhibit alterations in biochemical properties, so the A49T-G183D
double mutant might have different biochemical properties than A49T or G183D
alone.
The identification of genetic variants in genes that control androgen
biosynthesis or metabolism has important implications for understanding of the
biology of prostate cancer, identification of at-risk men before symptoms arise,
development of chemopreventive strategies, and the treatment for prostate
cancer patients.
1.6 Finasteride
Several competitive inhibitors of prostatic steroid 5a-reductase exist, the
best known is finasteride (Rasmusson et al., 1986) (Fig. 1.5). Finasteride is a
9
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
potent and specific inhibitor of 5a-reductase, which inhibits the conversion of
testosterone to DHT (Stoner, 1996). The finding of a much lower in vitro effect
of finasteride on the A49T allele suggests that this drug may have less effect on
an A49T-genotype patient (Makridakis et al., 1999). This suggested that the
biochemical properties of genetic variants have to be taken into account when
finasteride is prescribed for the treatment of benign prostatic hyperplasia (BPH)
or for prostate cancer prevention.
o
CNHC(CH3)3
Fig. 1.5 Chemical structure of finasteride, a 4-azasteroid derivative.
(17 0 - (iV-/-butyl)carbamoyl-4-aza-5 a -androst- l-en-3-one)
10
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 2: Mutagenesis
2.1 Introduction
Testosterone is the principal male sex hormone secreted by the testis that
circulates in the blood bound to albumin and steroid-binding globulins (reviewed
by Feldman and Feldman, 2001). Only free testosterone is able to enter androgen
responsive cells. Inside the cell, more than 90% of testosterone is irreversibly
converted into DHT by 5 a-reductase (reviewed by Feldman and Feldman,
2001).
Despite the central role played by 5a-reductase in androgen action, further
insights into the biochemistry, pharmacology, regulation, and physiology of the
enzyme was limited by the extreme hydrophobic and unstable nature of this
integral membrane protein and its trace-level presence in most
androgen-dependent tissues (Russell et al., 1994). To examine the enzyme
activity, it is more feasible to obtain the 5a-reductase type II enzymes by
reconstructing the cDNA, than purifying the enzyme from tissues (Thigpen and
Davis, 1992).
1 1
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
The SRD5A2 cDNA was cloned into the pCMV7 vector (at the Sail/ Xbal
sites) and was renamed pS303 (Fig. 2.1) by D. Russell’s group (Andersson et al.,
1989). pS303 transcription is driven by a powerful cytomegalovirus (CMV)
promoter. The human growth hormone fragment (hGH) contains transcription
termination and polyadenylation signals. The SV40 promoter/enhancer region
can synergize with the CMV promoter/enhancer resulting in increased
expression (Gluzman, 1981). The presence of the SV40 origin of replication
allows for amplification of the plasmid DNA in simian COS cells.
f1 ori
C M V
SB05A2
cDNA
p S 303
5.72 K b
SV40 Ori
hGH
Fig 2.1 pS303 vector. The bacteriophage fl origin replicates production of
single stranded DNA and an ampicillin-resistance gene CMV is a
powerful promoter-regulatory region which expresses an intron,
IVS., and the SRD5A2 cDNA. (Constructed by David Russell group,
University of Texas)
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
To reconstruct the cDNA of A49T and G183D mutations, SRD5A2 wild
type cDNA was used for in vitro site-directed mutagenesis. This technique is
used to make point mutations, deletions, or insertions of single or multiple
nucleotides (Vandeyar et al., 1988). A supercoiled double strand DNA vector
was used with two synthetic oligonucleotide primers containing the desired
mutation. Incorporation of the oligonucleotide primers generates a mutated
plasmid containing staggered nicks, which enables the Dpnl endonuclease
(specific for methylated and hemimethylated DNA) to digest the parental DNA
template and select for clones containing mutant DNA (Vandeyar et al., 1988).
The vector DNA incorporating the desired mutations is then transformed into
supercompetent cells for further use.
2.2 Methods & Material
2.2.1 Primer design
The mutagenic primers were designed with the point mutation in the
center of the oligodeoxynucleotide, and the melting temperature (Tm ) was
greater than or equal to 78°C. The Tm estimations formula was as followed:
13
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Tm = 81.5 + 0.41 (%GC) - 675/N - % mismatch (QuickChange Site-Directed
Mutagenesis Kit, Stratagene, CA, USA), whereas N is the prim er length in
base pairs. Also, the primers optimally should have a minimum GC
content o f 40% and terminate in one or more G or C bases.
According to those criteria, the A49T and G183D primers used,
contained the mutation sites which are boxed (Table 2.1).
Table 2.1 Mutagenesis primers
Primer Sequence Tm (°C)
A49T-forward CCGCCTGCCA@CCCGCGCCGC 84.5
A49T-reverse
GCGGCGCGGGffjTGGCAGGCGG
84.5
G183D-forward CAGCTACAGGATTCCACAAG@TGGCTTGTTTACGTATGTTTC 83.0
G183D-reverse GAAACATACGTAAACAAGCCAffjCTTGTGGAATCCTGTAGCTG 83.0
2.2.2 Mutagenesis
Various amounts (e.g. 5, 10, 20 50 ng) of dsDNA templates were used in
a series of reactions, with 125 ng of both forward and reverse designed primers
(Invitrogen CA, USA), lOx reaction buffer, 1 |Jl of dNTP mix (25mM)
(Stratagene, CA, USA), with the difference to 50 pi in sterile H2O, 1 pi of
PfuTurbo DNA polymerase (2.5 U/pl) (Stratagene, CA, USA) was added
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
overlaid with 30jjl of mineral oil. Cycling parameters (Thermo Hybaid, MA,
USA) were set-up as shown in the Table 2.2.
To digest parental supercoiled dsDNA, Dpnl restriction enzyme (NEB,
MA, USA) was added to the reactions, and incubated at 37 °C for 1 hr.
Table 2.2 Cycling patameters for mutagenesis
Segment Cycles Temperature Time
1 1 95 °C 30 sec
2 16 95 °C 30 sec
55 °C 1 min
68 °C 12 min
2.2.3 Transformation
The mutated DNA was transformed into XL 1-Blue supercompetent cells
(Biocrest, TX, USA) for further use. One pi of mutagenic DNA and 50 pi of
XL 1-Blue supercompetent cells were placed into pre-cooled Falcon 2059
polypropylene tubes (Becton Dickinson Labware, NJ, USA). The reaction was
chilled on ice for 30 min, heat shocked at 42 °C for 45 sec, added to 1 ml NZY
broth, and incubated at 37 °C with shaking for 1 hr.
The reaction was transferred to a 1.5 ml eppendorf tube, and spun down
in a centrifuge (Thermo IEC, MA, USA) at 10,000 rpm for 1 min. The medium
15
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
was discarded and the pellet was resuspended with 200 pi LB broth. The cell
suspension was spread onto 10 cm agar plates (with ampicillin 100 pg/ml) and
incubated at 37 °C overnight.
2.2.4 Restriction enzyme digestion
250 ng of DNA treated with 0.7 pi (20U/ml) Pstl enzyme (NEB, MA,
USA) (target sequence: CTGCAG) in a total 20 pi reaction was incubated at
37 °C for 45 min. Ten pi of digested reactions were loaded on a 1% agarose
gel for electrophoresis.
2.2.5 Sequencing
250 ng of DNA was mixed with 8 pi of dye terminator (Applied
Biosystems, CA, USA), 4 pi (125 ng) of either forward or reverse primer in a
20 pi total volume. To respectively reconfirm the A49T and G183D site, Y3I
forward and A248Y reverse primers were used (Table 2.3).
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Table 2.3 Sequencing primers
Primer Sequence
V3I-forward GGCGCGATGCAGATTCAGTGCCAGCAG
Y89L-forward CGGCAGCCCCTCTCCCTC
V189L-reverse TGCGCTCCTGGAGGCCGG
A248V-reverse GATGAATGGAATAAGGACTTTCCGAGATTTGGGGTAG
Furthermore, V89L forward and V189L reverse primers were used to
make sure there was no other mutation in the cDNA. After 1 pi of Taq
polymerase was added, each reaction was overlaid with 30 pi of mineral oil.
Cycling parameters (Thermo Hybaid, MA, USA) were set up* as shown in the
Table 2.4.
Table 2.4 Cycling parameter for sequencing
Segment Cycles Temperature Time
1 1 96 °C 2 min
2 33 96 °C 1 min 30 sec
58 °C 15 sec
60 °C 4 min
The reactions were purified on Auto-Seq G-50 size-exclusion columns
(Amersham Pharmacia, NJ, USA), dried in DNA speed vacuum (Savant, NY,
USA) for 15 min and resuspended in 4 pi of loading buffer (1:5 ratio of
17
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
loading dye and deionized formamide). The reactions were loaded on the ABI
Prism 377 Semiautomatic DNA Sequencer and analyzed with Sequence
Navigator software (Applied Biosystems, CA, U S A ).
2.3 Results
2.3.1 Restriction Enzyme Digestion
There are two Pstl restriction sites in the pS303 vector (Fig. 2.1), which
give two 194 bp and 5.5 kb bands (Fig. 2.2).
V .< & -A©
6K
5K
3K
< -5.5 Kb
1636
500
|<— 194 bp
Fig 2.2 Electrophoresis photo of Pstl restriction enzyme digestion.
(AT/GD indicate A49T-G183 D double mutant)
18
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
2.3.2 Sequencing
A49T and G183D missense mutations were reconstructed from the wild
type SRD5A2 cDNA. Both sequences are G to A nucleotide replacements.
Three clones of A49T were checked by forward primer which shows G to A
transition (Fig. 2.3). Whereas three clones of G183D were checked by the
reverse primer resulted into a C to T transitions (Fig. 2.4).
micauccca: rasaac-cccc sosoueccoe
160* 50 * 16 40 * 15 ^ 1 6 4 0
A 4 il A4S?
G->A
(i) A49T clone 3
!|li!
(ii) A49T clone 4 (iii) A49T clone 6
Fig 2.3 A49T clone 3, 4, 6 sequencing results with the forward primer
A G C O n C 'S rer AGCC&TCTTGT S.SCCA'fClH'GT
230 21.04
T T
C x > ?
C-»T
l> ^
< 3 * ^ 0
C-»T
(i) G1S3D clone 1 (ii) G183D clone 3
M 5 1
->L
(iii) G183D clone 6
Fig. 2.4 G183D clone 1,3, 6 sequencing results with the reverse primer
19
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Two clones of double mutant cDNA were reconstructed from the A49T
mutation SRD5A2 cDNA with the G183D site mutation primer to make the
A49T-G183D double mutation. These two clones were confirmed via
sequencing to both have the A49T and G183D mutations, both of them are G
to A transitions, but a reverse primer was used in checking G183D sites, so a C
to T transition was shown (Fig. 2.5).
TifcCfcfCCCGC
17
ftOCCJWCTirar
T 1
A4ST
1 I A
II
.iL M - J S - J D i
(i) A49T site of clone 5
G 1 M B
C*i>T
(ii) G183D site of clone 5
Fig 2.5 A49T/G183D double mutant clone 5 sequencing results
(A49T site was checked by forward primer; G183D site was checked by
reverse primer)
20
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 3: Biochemistry and Molecular Characteristics
3.1 Introduction
Prostate cancer research has been hampered by difficulties in generating
permanent cell lines for in vitro studies (reviewed by Abate-Shen and Shen,
2000). This limitation is undoubtedly related to the inherently slow development
of most prostate tumors and the low proliferation rate of the normal prostatic
epithelium (Berges et ah, 1995). To express the 5a-reductase type II in the
experiments, a COS 7 cell line (African green monkey kidney fibroblast-like cell
line) was used. COS 7 cells were established from OV-1 cells transformed by an
origin-defective mutant of SV40, which expresses the wild-type T antigen
(Gluzman, 1981).
The human prostatic steroid 5a-reductase type II has never been purified.
Some mutations were found (Thigpen et al., 1992), which showed lower enzyme
activities, often by destabilizing the steroid 5a-reductase protein (Wigley et al.,
1994). Based on these facts, we can predict that the mutations in the SRD5A2
gene may result in different enzyme activities.
21
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
In this study, I focused on the A49T and G183D mutations. Both of them
were found in somatic prostate cancer tissues by Abebe Akalu in Reichardt’s lab
(unpublished), and both mutations were once found to coexist together. The
somatic mutation in prostate cancer may be helpful in clinical practice, not only
for the early detection but also the implication of medical therapy. Different
mutations may occur in different stages of prostate cancer, and when a known
mutation was detected in the tumor cells of the patients, perhaps directed therapy
can be used. The biochemical characteristics of the mutation may affect substrate
binding, which might affect the pharmacological usage in medical therapy.
3.2 Methods & Material
3.2.1 Transfection
COS 7 cells (African green monkey kidney cells) (ATCC, VA, USA)
were cultured in Dulbecco modified Eagle medium (DMEM) (Invitrogen, CA,
USA) supplemented with 5% fetal bovine serum (Invitrogen, CA, USA) and
1% penicillin/streptomycin (Invitrogen, CA, USA). Prior to transfection, cells
were incubated in 10-cm-diameter plates (Coming Inc., NY, USA) (~4 x 105
22
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
cells/ plate) for 48 hr of growth (37 °C, 5% CO2) in a tissue culture incubator
(Forma, OH, USA). Each plate of cells was washed with 3 ml of phosphate
buffered saline (PBS) (pH 7.4) (Invitrogen, CA, USA), detached with 2 ml of
trypsin (Invitrogen, CA, USA) for 2 min at 37 °C, centrifuged at 2000 rpm for
5 min in a IEC micromax rotor (Thermo IEC, MA, USA), and the cell pellet
was washed once with cold PBS). The cell pellet (from 5 plates per reaction)
was resuspended in cold PBS (0.8 ml/ reaction), then the cells were
co-transfected with 5 pg of pCMV-(3 (expressing (3-galactosidase) and pS3Q3
(either wild type or mutants of interests) expression plasmid by using Bio-Rad
Gene Pulser II (Bio-Rad, CA, USA).
Electroporation was performed at 400 mV, 950 pF in a 0.4-cm
transfection cuvette (BioRad, CA, USA). Each reaction was reseeded into one
10-cm-diameter plate, and the medium was changed after 24 hr of growth at 37
°C in a tissue culture incubator.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
3.2.2 Harvesting and Sonication
After 48 hr growth post-transfection, cells were washed with 5 ml PBS 3
times, and 1 ml of cold PBS was used for harvesting with a cell scraper
(Fisherbrand, PA, USA). The cell extract was kept at -80 °C for storage
overnight, and sonicated by VirSonic60 (Virtis, NY, USA) the next day to
break the cells and release the protein. The cells were sonicated (3 watts, 10
sec for 4 times with 30 sec interval) on ice.
3.2.3 Protein Assay
Standard curves for protein assays were made with various amount (5,
10, 15, 20, 25 pg) of bovine serum albumin (BSA) (Sigma, MO, USA). 5 pi
of cell extract was incubated with 200 pi of BioRad protein assay dye reagent
(BioRad, CA, USA) in a final volume of 1000 pi at room temperature for 5
min. The reactions were measured at OD595.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
3.2.4 (3-galactosidase Assay
Five |Jg of cell extract was incubated with 201 pi of sodium phosphate
(0.1 M, pH 7.5), 66 pi of o-nitrophenyl-(3-D-galactopyranoside (ONPG) (4
mg/ml in 0.1 M sodium phosphate), and 3 pi of 100-fold Mg solution (0.1 M
MgCh, 4.5 M |3-mercaptoethanol) in a 300 pi total volume at 37°C for 30
min. The reactions were measured at OD420.
3.2.5 5a-Reductase Assay
Five pg of extracts were incubated at 37°C with 5 mM of NADPH, 0.2p
M of 14C-labeled testosterone, 100 mM of Tris/Citrate buffer (pH 5.5) for 10
min. The reactions were stopped with 500pl methylene chloride, vortexed,
centrifuged at 10,000 rpm for 2 min. The upper layer was discarded, whereas
the lower layer was dried by DNA speed vacuum (Savant, NY, USA) for 25
min. The substrate was redissolved in ethanol and applied on K6 silica
thin-layer chromatography plates (Whatman, Clifton, NJ, USA). The plates
were developed in methylene chloride and acetone (7.5 ml/100 ml) for 45 min.
The dried plates were exposed to Storage Phosphor Screen (Molecular
25
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Dynamics, CA, USA) overnight, scanned on a Storm phosphorimager
(Molecular Dynamics, CA, USA), and analyzed with ImageQuant v. 1.1.
Four different factors were tested:
(i) pH Curve: Instead of using pH 5.5 Tris/Citrate buffer, the Tris/Citrate
buffer was prepared at various pH values: 3.0, 4.0, 4.5, 5.0, 5.5,6.0,6.5, 7.0.
(ii) Time Curve: Instead of incubating the reactions for 10 min, they were
stopped after 5, 10, 20, 30, 45, 60, 90,120 min.
(iii) Protein Curve: Instead of using 5 pg of cell extract, various protein
amounts of 3, 5, 8, 10, 15, 20, 25 pg were used.
(iv) Vm a x Curve: Additional cold-testosterone was used in the reactions.
Various amounts of 18, 9, 4.5, 2.25, 1.125, 0.5625, OpM cold-testosterone
were used, dried for 2 min, to make the total testosterone amount of 18.2,
9.2, 4.7, 2.45, 1.325, 0.7625, 0.2 pM in final reactions.
3.2.6 Western Blot
Fifteen p g of protein was boiled with bromophenol blue dye
(Amersham Pharmacia, NJ, USA) for 5 min and loaded on a 10 % SDS
26
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
polyacrylamide gel (0.1 % acrylamide/bis mix, 375 mM Tris-HCl pH 8 .8 , 0.1
% SDS, 0.1 % ammonium persulfate, tetra-methyl-ethylenediamine) and run at
40 mA for 1 hr. The immuno-blot PVDF membrane (BioRad, CA, USA) was
activated with methanol for 3 sec, washed with water, soaked in transfer buffer
(2.5 mM Tris, 192 mM glycine) for preparation. The proteins were transferred
from the polyacrylamide gel to the PVDF membrane using the Trans-blot SD
Semi-dry Transfer Cell machine (BioRad, CA, USA) at 15 V, 100 mA for 30
min.
The membrane was treated with blocking buffer (5% w/v blocking agent
(Amersham Pharmacia, NJ, USA) in tris-buffered saline-tween (TBS-T)) for 1
hr, washed briefly, treated with B302-h5aR2 1st antibody (1:10,000) (from
David Russell, University of Texas) overnight, washed 3 times with
tris-buffered saline (TBS), treated with anti-rabbit 2n d antibody (1:10,000)
(Amersham Pharmacia, NJ, USA) for 1 hr, washed 3 times with TBS-T.
The membrane was incubated with ECF substrate (Amersham Parmacia,
NJ, USA) for 4 min at room temperature, and developed on the Storm
phosphorimager (Molecular Dynamics, CA, USA).
27
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
3.3 Results
3.3.1 Wild Type
The pH curve (Fig. 3.1) indicates that at the value of 5.5, wild type
SRD5A2 has the highest testosterone conversion ability in the range of pH 3 to 7.
9
8
7
6
5
4
3
2
0
2 3 4 5 6 7 8
pH value
Fig 3.1 5 a -Reductase activity curve as a function of pH for wild type.
The highest conversion occurred at pH 5.5.
The time curve (Fig. 3.2) is performed to determine the proper time
period for reaction incubation, and a linear range lies within the first 15 min.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
100
c
0
£
1
u
0 5 10 15 20 25 30 35 40 45
Time (min)
Fig. 3.2 Time curve of reaction incubation period for wild type.
The linear range lies within the first 15 min.
In the standard protein curve (Fig. 3.3), it shows a linear range between
0 to 5 pg.
100
g
5
< D
>
g
u
5 20 25 0 10 15
Protein amount (ug)
Fig. 3.3 Standard curve for protein amount determination of wild type.
The linear range lies between 0 to 5 jig.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
The enzyme kinetics was evaluated by substrate (testosterone) Vm a x
curve, and is also analyzed on a double reciprocal plot (Fig. 3.4). According to
the Lineweaver-Burk plot, the Vm a x and substrate Kra can be calculated by
applying the numbers into the equation ( 1/V = Km / Vm ax [S] + 1/Vm a x )
(Mathews and van Holde, 1995). The wild type has a Vm a x value as 1.174
nmole/min*mg, and a substrate Km of 0.915 |JM.
The published Vm a x and substrate Km of SRD5A2 are 1.9 nmole/min*mg,
0.9 pM (Makridakis et al., 1999). To compare the evaluated max with the 1.9
nmole/min*mg, there is a 58% difference, in other words, the evaluated Vm a x is
only about 63% of the published data. This phenomenon may be due to the
low expression efficiency of the protein, because of the low value of p
-galactosidase assay. The substrate Km is within 2% (= (0.915-0.9) / 0.915)
difference.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
0 0.5 1 1.5 2 2.5 3 3.5
Substrate (uM)
(i) Michaelis-Menten curve
5
4
3
y = 0.7787x + 0.8508
R2 = 0.9893
2
1
0
0 2 5 3 4 6
1/S (uM)
(ii) Lineweaver-Burk plot
Fig. 3.4 Vm ax curve of wild type. The wild type has a Vm a x of 1.174
nmole/min*mg and a substrate Km of 0.915 j± M.
31
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
In the western blot experiment, the antibody recognizes the SRD5A2
protein, which has a predicted size of 28.4 KD. The immunoblotting image of
mock and wild type shows no expression in mock, but an expected 28KD band
in wild type (Fig. 3.5).
* *
I P 49.9
h b h b m h u m
36.2
Fig. 3.5 Western blot of mock and wild type.
The expected band should express at about 28 KD.
32
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
3.3.2 A49T missense mutation
The pH curve of A49T (Fig. 3.5) shows the highest conversion
percentage at pH 5.5, indicating the optimum pH value is 5.5 in vitro
experiments.
6
5
4
3
2
1
0
2 3 5 6 7 8 4
pH value
Fig. 3.6 5 a -Reductase activity curve as a function of pH for
A49T. The highest conversion occurred at pH 5.5.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
The time curve (Fig. 3.7) is performed to modify the incubation period
of A49T mutation. In theory, the 0 min point should be 0% conversion, but in
reality, the reactions were prepared from tubes 1 to 9, and the first reaction was
stopped after the last reaction was prepared, so some time elapsed. Even
though the initial data point is not at (0,0), the remaining data points appear to
remain linear for 10 min past the first point.
100
90
80
70
60
50
40
30
20
1 0
0
0 20 40 60 80 100 120 140
Time (min)
Fig. 3.7 Time curve of reaction incubation period for A49T.
The linear range lies within the first 10 min.
34
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
In the standard protein curve (Fig. 3.8), A49T clone 3 shows a linear
range within 20 pg, and clone 4 shows a linear range within 10 pg.
50
40
30
20
10
0
0 20 25 5 10 15
Protein am ount (ug)
(i) A49T clone 3
50 T
! 40--
u
>
£
O
O
30 -•
20 --
10 --
0 20 5 10 15 25
Protein amount (ug)
(ii) A49T clone 4
Fig. 3.8 Standard curve for protein amount determination of A49T clone 3,4.
The linear range lies within 20 and 10 fig respectively.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
The substrate (testosterone) Ym a x curves of two clones (Fig. 3.9, 3.10)
are analyzed by Lineweaver-Burk plot. The predicted Vm a x of A49T mutation
is 2.261 nmole/min*mg for clone 3, 2.986 nmole/min*mg for clone 4, and a
respective substrate Km of 6.991 pM and 7.277 pM. The average Vm a x and
substrate Km of these two clones is 2.624 nmole/min*mg and 7.134 pM.
2.5
2
1.5
0.5
0
0 5 10 15 20
Substrate(uM)
(i) Michaelis-Menten curve
3
2.5
SO
2
1.5
y = 3.0918x + 0.4422
R2 = 0.9834 1
0.5
0
0 0.2 0.4 0.6 0.8
1/S (1/uM )
(ii) Lineweaver-Burk plot
Fig. 3.9 Vm ax curve of A49T clone 3. The A49T #3 has a Vm a x of 2.26
nmole/min*mg and a substrate Km of 6.99 ji M.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
3
2.5
2
1.5
0.5
0
0 5 1 0 15 20
Substrate(uM )
(i) Michaelis-Menten curve
2.5
2
1.5
y = 2.437 lx + 0.3349
R2 = 0.9894
0.5
0
0 0.2 0.4 0.6 0.8
1/S (uM)
(ii) Lineweaver-Burk plot
Fig. 3.10 Vm ax curve of A49T clone 4. The A49T#4 has a Vm a x of 2.98
nmole/min*mg and a substrate Km of 7.2 i± M.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
3.3.3 G183D missense mutation
The pH curve (Fig. 3.11) of G183D clone 3 indicates that at the value of
5.5, G183D mutation has the highest testosterone conversion ability in the
range of pH 3 to 7.
20
18
16
14
12
10
8
6
4
2
0
3 5 7 8 2 4 6
pH value
Fig. 3.11 5 a -Reductase activity curve as a function of pH for G183D
clone 3. The highest conversion occurred at pH 5.5.
3.3.4 Summary
The optimized conditions (pH, time, protein amount) to determine the
Vm a x and substrate Km are summarized for the wild type and the mutant
38
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
SRD5A2 enzymes (Table. 3.1).
Table 3.1 Comparison of in vitro conditions for SRD5A2 enzymes
Wild type A49T G183D A49T-G183D
pH value 5.5 5.5 5.5 N/A
Time (min) 10 10 N/A N/A
' 5 5 N/A
Protein (|jg)
N/A
N/A in the table indicates that the conditions had not been tested.
The evaluated pH, Vm a x and substrate Km are compared with published
data from both David Russell (Russell and Wilson, 1994) and Nick Makridakis
(Makridakis et al., 1999) (Table 3.2).
Table 3.2 Comparison of in vitro results for SRD5A2 wild type enzyme
D. Russell N. Makridakis Evaluated data
pH value 6.0 5.0 5.5
Vm a x (nmole/min*mg) 2-5 1.9 1.17
0.5-1.0 0.9
Km (pmole/L)
0.92
In comparison of the Vm a x and substrate Km value with wild type, A49T
shows both higher Vm a x and a substrate Km , which fit in the general conclusion
of the published paper (Makridakis et al., 1999). The comparison is shown
39
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
below (Table 3.3). The Vm a x and substrate Km for G183D mutant and the
double mutant had not been done because the conditions for in vitro
experiments had not been tested yet.
Table 3.3 Comparison of Vm a x and Km for WT and A49T
WT A49T
Published1 Vm ax (nmole/min*mg) 1.9 9.9
Kra {fj. mole/L) 0.9 2.7
Evaluated2 Vm ax (nmole/min*mg) 1.17 ± 0.1 2.62
Kr a ( ii mole/L) 0.92 ± 0.2 7.13
1. Data from Nick Makridakis et al., 1999.
2. The deviation of evaluated Vm a x and substrate Km was based on 3 times
experiments.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Chapter 4: Discussion
4.1 5a-Reductase Enzyme Activity
The evaluated Vm a x is calculated per unit of total protein amount, not
specifically to SRD5A2 protein. To confirm the presence of the reductase,
Western blots were done in parallel with mock extracts (Fig. 3.5). The expected
band was found at about size 28KD, but was absent in the mock sample. When
the mock extract was tested for 5 a-reductase activity with various protein
amounts, there was no conversion of testosterone to DHT in all reactions. So it is
reasonable to conclude that the enzyme activity is caused by the overexpressed 5
a-reductase type II enzyme.
The under-evaluated Km and Vm a x for wild type and A49T mutation might
be for at least three reasons: (i) the low expression efficiency of my cell extracts
(the average p-galaetosidase assay value is 0.171); (ii) the technical broke with
5 a-reductase enzyme assays; and (iii) the small fraction of SRD5A2 gene
product in total protein. Because the SRD5A2 gene purity may be low in total
protein, the evaluated Vm a x is possibly under-evaluated. The higher evaluated Km
41
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
might due to competitive inhibitors, such as NADP+, in the reaction that results
in a flattered Michaelis-Menten curve.
Comparing of the Vm a x and substrate Km values to the wild type, the A49T
mutation shows both higher enzyme activity and substrate Km , which fits with
the general conclusions in the literature (Makridakis et ah, 1999). But the
variance between the published data and predicted data might be also caused by
some unavoidable technical difficulties. During the sonication, the lysosome
may be broken at the same time, and release degradative enzymes that reduced
the amount of 5 a-reductase enzyme. To prevent 5a-reductase enzyme from
degradation, protease inhibitor can be added in the reactions to destroy
lysosomal enzyme. Other complications may arise for the following reasons: (i)
the substrate concentration is minute, and is difficult to prepare precisely; (ii)
when the reactions were transferred from tubes to chromatography plates, part of
the reactions would remain in the tube or on the tip; (iii) the energy emissions
from 1 4 C only have an efficiency of about 80% (Fersht, 1985), so the minute
amount of 1 4 C-labeled testosterone may not be precise. But the 1 4 C amount
42
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
cannot be increased because the signal will be too strong for the reaction
containing the highest substrate concentration.
4.2 Conclusion
4.2.1 SRD5A2 cDNA Reconstruction
All three clones of A49T and G183D were reconstructed from wild type
clones (a generous gift from David Russell, Univ. of Texas), and two clones of
A49T-G183D double mutant were reconstructed from A49T mutant. The
mutants were reconstructed by site-directed mutagenesis, reconfirmed by Pstl
restriction enzyme digestion and sequence analysis. Those confirmed clones
were used for further experiments of 5a-reductase activity.
4.2.2 Enzyme Activity Assay
To optimize the in vitro conditions, several parameters were tested before
enzyme activity assays were performed, such as (i) pH value of Tris/Citrate
buffer, (ii) time period of reaction incubation, and (iii) a standard curve for
43
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
protein amount determination. The optimized conditions are compared with all
clones. (Table. 3.1)
By comparing the Vm a x and substrate Km value with wild type, A49T
mutation shows both higher Vm a x and a substrate Km , which fits the general
conclusion of the published paper (Makridakis et al., 1999). The comparison is
shown in Table 3.3.
4.2.3 SRD5A2 in Prostate Cancer Progression
In the blood, most testosterone is bound to sex-hormone-binding
globulin with only a small portion of total testosterone being free (Brinkmann
et al., 1999). Free testosterone can passively diffuse into androgen-responsive
cells, where 90% of the testosterone will be reduced into DHT by the 5 a
-reductase enzyme(s) (reviewed by Feldman and Feldman, 2001). In this study,
the point mutation A49T in SRD5A2 gene resulted in different enzyme
catalytic kinetics compared to the wild type enzyme, and this variant enzyme
may lead to altered androgen flex in the prostate, thus altering cell division.
44
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
The relatively variant DHT amount influences the following cascades in
androgen action pathway (Fig 1.2). DHT is the more active hormone, having a
five-fold higher affinity for the androgen receptor than does testosterone
(reviewed by Feldman and Feldman, 2001). In the basal state, the androgen
receptor is bound to heat-shock protein and other proteins in a conformation
that prevents DNA binding (reviewed by Grinffin and Wilson, 1998). The
androgens induce a conformational change in the androgen receptor that leads
to dissociation from the heat-shock protein and receptor auto-phosphorylation
(Brinkmann et al., 1999). The ligand-induced conformational change
facilitates the formation of androgen receptor homodimer complexes that can
then bind to androgen-response elements in the promoter regions of multiple
target genes (Brinkmann et al., 1999). The activated homodimer complex
recruits co-regulatory proteins, either co-activators or corepressors. The
co-regulatory proteins allow interaction of the androgen receptor complex with
the general transcription apparatus to stimulate or inhibit target gene
transcription (reviewed by Feldman and Feldman, 2001).
45
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
In urology studies, higher androgens concentration stimulates prostate
enlargement (reviewed by Isaacs, 1999). In the prostate, luminal cells secret
components of prostatic fluid, express the androgen receptor, and secrete
prostate-specific antigen in an androgen-dependent manner. Some stroma cells
are androgen responsive and produce growth factors that act in a paracrine
fashion on the epithelial cells. This stromal-epithelial crosstalk is an important
regulator of the growth, development and hormonal response of the prostate
(Chung, 1995; Kurita et al., 2001).
Combining urological and molecular studies (Isaacs, 1999; Feldman and
Feldman, 2001), the prostate growth factors produced by stromal cells might
be caused by the target gene activation, and the activation might be caused by
higher ratio of DHT/T in androgen-responsive cells. Furthermore, the
expression of the 5 a-reductase during development has been most closely
examined in human. Early studies indicated that the expression of 5 a
-reductase in the urogenital sinus and urogenital tubercle of the embryonic
urogenital tract preceded formation of the external genitalia and prostate
(Siiteri and Wilson, 1974), suggesting a cause and effect relationship for the
46
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
involvement of DHT in phenotypic sexual differentiation. Immunoblotting
experiments indicate that most of this enzyme activity in the early embryo can
be attributed to the type 2 isozyme (Thigpen et al., 1993). From these finding
and from the phenotype of the genetic disease, it would appear that 5-reductase
type 2 is responsible for embryonic virilization of the external genitalia and
prostate in men (Russell and Wilson, 1994).
4.2.4 A49T and G183D in SRD5A2
The substrate (i.e. testosterone) and inhibitor binding site for finasteride
in steroid 5 a-reductase appears to be bipartite (Makridakis et al., 2000). There
are distinct amino and carboxy-terminal domains (Fig. 4.1), and white boxes
indicate the proposed binding domains for testosterone and finasteride, and the
binding domain for cofactor (i.e. NADPH) is indicated by gray box.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
100 200
I ' I Substrate (testosterone) >............ * 1
1 1 Finasteride L 1" 1
Cofactor (N A D PH ) I' ' 1
Fig. 4.1 Proposed binding domains for substrate and cofactor in the
human type II steroid 5 a -reductase enzyme. The positions of
amino acids 100 and 200 are indicated as reference points.
(Reproduced from Makridakis et al., 2000)
Amino acids 49 and 183 lie in the proposed substrate binding domains,
and 183 also lies in the proposed cofactor binding domain. The alanine to
threonine amino change at the 49 position increases the substrate Km to the 5a
-reductase enzyme. The hydroxyl side chain of threonine may increase its
hydrophilic characteristics of the protein, and may change the interaction of
substrate and enzyme. The amino acid position 183 is proposed as both
substrate binding domain and cofactor binding domain, so the replacement
from glycine to aspartic acid may change both the interaction of substrate and
cofactor to 5a-reductase enzyme.
48
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
4.2.5 Future Directions
To know more about the biochemical characteristics of somatic
mutations (G183D and A49T-G183D double mutation) in steroid 5a-reductase
type II gene, the in vitro experiment conditions for 5a-reductase assay should
be modified, such as the pH value(s) of Tirs/Citrate buffer, the time period for
the reaction incubation, and the standard curve for protein amount
determination. After the substrate Vm a x and substrate Km are evaluated for
G183D and A49T-G183D double mutation, the Vm a x , cofactor (NAJDPH) Km
and Ki (finasteride) should be done with all clones.
Once the substrate Vm a x and substrate Km values of the mutants are
determined, we can estimate the enzyme activity (the ability of converting
testosterone to dihydrotestosterone) and predict whether the mutation results in
a gain- or loss-of- function. These predictions can tell whether the patients will
have higher or lower risk for prostate cancer, and whether the mutation
contributes in the early diagnosis and further treatment at the disease. The
evaluated Kj (finasteride) of all clones can estimate the pharmacological usage
for prostate cancer patients, because the mutated 5 a-reductase enzyme of the
49
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
patients might be less sensitive to the finasteride or react in an opposite way.
The finasteride dose should be tested in animal experiments, and further
tested in clinical practice. The animal experiments can be done with modified
TRAMP (transgenic adenocarcinoma of the mouse prostate) models. The
TRAMP model is a specific transgenic mouse model of prostate cancer, which
was described by Dr. Norman Greenberg (Baylor College of Medicine,
Houston, USA). The TRAMP model expresses the SV40 early genes (T and t
antigens; Tag) to inactivate the anti-oncogenes p53 and Rb (Greenberg et al.,
1995). Expression is directed by a prostate-specific promoter sequence derived
from the rat probasin gene, which is activated by the androgen receptor
(Greenberg et al., 1995). But mice are not good models for human disease.
Some of the human diseases (ex: prostate cancer) are ethnic relevant but can
not be created in mice models. To test the endocrine effects of finasteride, the
short-term (2 months) and long-term (36 months) clinical studies should be
done (Stoner, 1996).
In summary, somatic mutations may be contributable to early diagnosis,
and the enzyme assays may contribute to future understanding of the
50
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
significant consequences for the pharmacological usage of steroid
-reductase inhibitors in patients being treated for prostatic conditions.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
References:
Abate-Shen C. and Shen M.M.; Molecular genetics of prostate cancer; Gene &
Development 14: 2410-2434,2000
Akalu A., Elmajian D.A., Highshaw R.A., Nichols P.W. and Reichardt J.K.V.;
Somatic mutations at the SRD5A2 locus encoding prostatic steroid 5 a -reductase
during prostate cancer progression; J. Urol. 161: 1355-1358,1999
Andersson S. and Russell D.W.; Structural and biochemical properties of cloned and
expressed human and rat steroid 5 a -reductases; Proc. Natl. Acad. Sci. U.S.A. 87:
3640-3644, 1990
Andersson S., Davis D.N., Dahlback H., Jomvall H. and Russell D.W.; Cloning,
structure, and expression of the mitochondrial cytochrome p-450 sterol
26-hydroxylase, a bile acid biosynthetic enzyme; J. Biol. Chem. 264: 8222-8229,
1989
Andersson S., Berman D.M., Jenkins E.P. and Russell D.W.; Deletion of steroid 5 a
-reductase 2 gene in male pseudohermaphroditism; Nature (London) 354: 159-161,
1991
Andriole GL. and Catalona W. J.; The diagnosis and treatment of prostate cancer;
Annu. Rev. Med. 42: 9-15, 1991
Brinkmann A.O., Blok L.J., de Ruiter P.E., Doesburg P., Steketee K., Berrevoets C.A.
and Trapman J.; Mechanisms of androgen receptor activation and function; J Steroid
Biochem. Mol. Biol. 69: 307-313, 1999
Berges R.R., Vukanovic J., Epstein J.I., CarMichel M., Cisek L., Johnson D.E., Veltri
R.W., Walsh P.C. and Isaacs J.T.; Implication of cell kinetic changes during the
progression of human prostatic cancer; Clin. Cancer Res. 1: 473-480, 1995
52
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Cheng E., Lee C. and Grayhack J.; Endocrinology of the prostate In: Lepor H,
Lawson R.K., eds.; Prostate disease. Philadelphia, PA: Saunders: 57-59,1993
Chung L.W.; The role of stromal-epithelial interaction in normal and malignant
growth; Cancer Surv. 23: 33-42, 1995
Coffey D.S.; The molecular biology of the prostate. In: Prostate Disease. Edited by
Lepor H., Lawson R.K., and Saunders W.B., Philadelphia, 28-56,1993
Crundwell M.C., Arkell D.G., Gearty J. and Phillips S. M.; Genetic alterations in
incidentally diagnosed, transitional zone prostate cancer: a seven year follow-up; J.
Urol., 158(4): 1568-1575, 1997
Davis D.L. and Russell D.W.; Unusual length polymorphism in human steroid 5 a
-reductase type 2 gene (SRD5A2); Hum Mol Genet 8: 820, 1993
Denmeade S.R., Lin X.S. and Isaacs J.T.; Role of programmed (apoptotic) cell death
during the progression and therapy for prostate cancer; Prostate 28: 251-265, 1996
Feldman B.J. and Feldman D.; The development of androgen-independent prostate
cancer; Nature Oct (1): 34-45, 2001
Fersht A.; Enzyme structure and mechanism 2n d edition; 176-192, 1985
Greenberg N.M., DeMayo F., Finegold M.J., Medina D., Tilley W.D., Aspinall J.O.,
Chuha G.R., Donjacour A.A., Matusik R.J. and Rosen J.M.; Prostate cancer in a
transgenic mouse; Proc. Natl. Acad. Sci. 92: 3439-3443, 1995
Gluzman Y; SV40-transformed simian cells support the replication of early S40
mutants; Cell 23: 175-182,1981
Grinffin J.E. and Wilson J.D.; Williams textbook of Endocrinoloby 9th edition;
819-876, 1998
53
with permission of the copyright owner. Further reproduction prohibited without permission.
Henderson B.E., Ross R. K., Pike M.C. and Casagrande J. T.; Endogenous hormones
as a major factor n human cnacer; Cancer Res. 42: 3232-3239,1982
Huggins C. and Hodges C.V.; Studies on prostate cancer; Cancer Res. 1:293-297,
1941
Huggins C., Endocrine-induced regression of cancers; Cancer Res. 27: 1925-1930,
1967
Hsing A.W., Chen C., Chokkalingam A.P., Gao Y.T., Dightman D.A., Nguyen H.T.,
Deng J., Cheng J., Sesterhenn I.A., Mostofi F.K., Stanczyk F.Z. and Reichardt J.K.;
Polymorphic markers in the SRD5A2 gene and prostate cancer risk: a
population-based case-control study; Cancer Epidemiol Biomarkers Prev 10(10):
1077-1082,2001
Isaacs J.T.; The biology of hormone refractory prostate cancer. Why does it develop?
Urol. Clin. North Am. 26: 263-273, 1999
Jemal A., Thomas A., Murray T. and Thun M.; Cancer statistics, 2002; CA Cancer J
Clin, 52: 23-47, 2002
Jenkins E.P., Hsieh C.L., Milatovich A., Normington K., Berman D.M., Francke U.
and Russell D.W.; Characterization and chromosomal mapping of a human steroid 5
a -reductase gene and pseudogene and mapping of the mouse homologue; Genomics
11(4): 1102-1112, 1991
Kantoff P.W., Febbo P.G., Giovannucci E., Krithivas K., Dahl D.M., Chang G.,
Hennekens C.H., Brown M. and Stampfer M.J; A polymorphism of the 5 a -reductase
gene and its association with prostate cancer: a case-control analysis; Cancer Epidem.
Biomark Prev. 6: 189-192, 1997
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Kurita T., Wang Y.Z., Doujacour A.A., Zhao C., Lydon J.P., O’Malley B.W., Isaacs
J.T., Dahiya R. and Cunha G.R.; Paracrine regulation of apoptosis by steroid hormones
in the male and female reproductive system; Cell Death Differ. 8: 192-200, 2001
Labrie F., Sugimoto Y., Luu-The V., Simard J., Lachance Y., Bachvarov D., Leblanc
G, Durocher F., and Paque N.; Structure of human type II 5 a -reductase gene;
Endocrinology 131(3): 1571-1573,1992
Latil A.G., Azzouzi R., Cancel G.S., Guillaume E.C., Cochan-Priollet B., Berthon P.L.,
Cussenot O.; Prostate carcinoma risk and allelic variants of genes involved in
androgen biosynthesis and metabolism pathways; Cancer 92(5): 1130-1137, 2001
Makridakis N.M., Ross R.K., Pike M.C., Chang L., Stanczyk F.Z., Kolonel L.N., Shi
C.Y., Yu M.C., Henderson B.E., and Reichardt J.K.V.; A prevalent missense
substitution that modulates activity of prostatic steroid 5 a -reductase; Cancer Res. 57:
1020-1022,1997
Makridakis N.M., Ross R.K., Pike M.C., Crocitto L.E., Kolonel L.N., Pearce C.L.,
Henderson B.E. and Reichardt J.K.V.; Association of mis-sense substitution in
SRD5A2 gene with prostate cancer in African-American and Hispanic men in Los
Angeles, USA; The Lancet 354(18): 975-978, 1999
Makridakis N.M., di Salle E. and Reichardt J.K.V.; Biochemical and
pharmacogenetic dissection of human steroid 5 a -reductase type II; Pharmacogenetics
10:407-413,2000
Makridakis N.M. and Reichardt J.K.V.; Molecular epedemiology of hormaone
metabolic loci n prostate cancer; Epidemiol. Rev. 23 (1): 24-29, 2001
Mathews C.K. and van Holde K.E.; textbook of Biochemistry 2n d edition, 360-388,
1995
55
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
McKenna N.J., Lanz R.B., and O’Malley B.W.; Nuclear receptor coregulators:
cellular and molecular biology; Endocr. Rev. 20: 321-344,1999
Pilat M.J., Kamradt J.M., and Pienta K.J.; Hormone resistance in prostate cancer;
Cancer Metastasis Rev. 17: 373-381,1998
Quigley C.A., Beilis A.D, Marschke K.B., el-Awady M.K., Wilson E.M., and French
F.S.; Androgen receptor defects: historical, clinical, and molecular perspectives;
Endocr. Rev. 16: 271-321,1995
Rasmusson GH., Reynolds G.F., Steinberg N.G., Walton E., Patel G.F., Liang, T.,
Cascieri M.A., Cheung, A.H., Brooks J.R. and Berman C.; Azasteroids:
structure-activity relationships for inhibition of 5 a -reductase and of androgen
receptor binding; J. Med. Chem 29: 2298-2315, 1986
Reichardt J.K.Y.; Prostatic steroid 5 a -reductase, an androgen metabolic gene; Mayo
ClinProc. 75: S36-S39,2000
Ross R.K., Pike M.C., Coetzee G.A., Reichardt J.K.V., Yu M.C., Feigelson H„
Stanczyk F.Z., Kolonel L.N. and Henderson B.E.; Androgen metabolism and prostate
cancer: establishing a model of genetic susceptibility; Cancer Res. 58 (20): 4497-4504,
1998
Russell D.W., Berman D.M., Bryant J.T., Cala K.M., Davis D.L., Landrum C.P.,
Prihoda J.S., Silver R.I., Thigpen A.E., and Wigley W.C.; The molecular genetics of
steroid 5 a -reductases; Recent Progress in Hormone Research 49: 275-284, 1994
Russell D.W. and Wilson J.D.; Steroid 5 a -reductase: two genes/two enzymes; Annu.
Rev. Biochem 63: 25-61, 1994
Sakr W.A., Hass G.P., Cassin B.F., Pontes J.E. and Crissman J.D.; The frequency of
carcinoma and intraepithelial neoplasia of the prostate in young male patients; J. Urol.
150: 379-385, 1993
56
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
Shibata A., Stamey T.A., McNeal J.E., Cheng I. and Peehl D.M.; Genetic
polymorphisms in the androgen receptor and type II 5 a -reductase genes in prostate
enlargement; J. Urol 166(4): 1560-1564,2001
Siiteri P.K. and Wilson J.D.; Testosterone formation and metabolism during male
sexual differentiation in the human embryo; J. Clin. Endocrinol. Metab. 38: 113-125,
1974
Soderstrom T., Wadelius M., Andersson S.O., Johansson J.E., Johansson S. and
Granath F., Rane A.; 5 a -Reductase 2 polymorphisms as risk factors in prostate
cancer; Pharmacogenetics 12(4): 307-12. 2002
Steers W. D.; 5 a -Reductase activity in the prostate; Urology 58: 17-24, 2001
Stoner E., Finasteride study group: three year safety and efficacy data on the use of
finasteride in the treatment of benign prostatic hyperplasia; Urology 43:284-294, 1994
Stoner E.; 5a-Reductase inhibitors/fmasteride; Prostate 6: 82-87, 1996
Thigpen A.E., Davis D.L., Milatovich A., Mendonca B.B., Imperato-Mcginley J.,
Griffin J.E., Francke A., Wilson J.D. and Russell D.W.; Molecular genetics of steroid
5 a -reductase II deficiency; J Clin. Invest. 90: 799, 1992
Wigley W.C., Prihoda J.S, Mowszowicz I., Mendonca B.B., New M.I., Wilson J.D.
and Russell D.W.; Natural mutagenesis study of the human steroid 5 a -reductase 2
isozyme; Biochemistry 33:1265-1267, 1994
Wilson, J. D.; Annu. Rev. Physiol. 40: 279-306, 1978
Vandeyar M., Weiner M.P., Hutton C., and Batt C.; A simple and rapid method for the
selection of oligodeoxynucleotide-directed mutants; Gene 65: 129-133, 1988
57
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.

Linked assets

University of Southern California Dissertations and Theses

Conceptually similar

PDF

Analysis of the HSD3B2 gene in prostate cancer

PDF

Association between single nucleotide polymorphisms in the 3'untranslated region of the SRD5A2 gene and prostate cancer risk

PDF

Analysis of the ALOX5 gene in atherosclerosis

PDF

Functional analysis of single nucleotide polymorphisms (SNPs) in the 5' regulatory region on the SRD5A2 gene

PDF

A model for the mechanism of agonism and antagonism in steroid receptors

PDF

Expression of matrix metalloproteinases and their inhibitors in the muscles of amyotrophic lateral sclerosis and control patients

PDF

A TNF alpha-responsive kinase activity may play a key role in IKK activation

PDF

Clathrin associated protein (AP) binding motifs in AD5 penton

PDF

Construction and characterization of RRP6 deletion in Saccharomyces cerevisiae

PDF

Generation of mutant tissue inhibitor of metalloproteinases-2 (TIMP-2) in the baculovirus expression system

PDF

Cyclophilin C is a candidate protein to interact with saposin B using the yeast two-hybrid system

PDF

Establishment and properties of a stable transfected epicardial cell line expressing a dominant negative retinoic acid receptor

PDF

Development and secretions of salivary glands using mouse models

PDF

Glucocorticoids modify signal transducers of bone morphogenetic proteins in osteoblasts: Stimulation of the inhibitory Smad 6 and suppression of the stimulatory Smad 8

PDF

Investigation of the role of epigenetic modification of DNA and chromatin in aberrant gene silencing in cancer cells

PDF

A review of molecular conjugates and their use in gene therapy with the presentation of a model experiment: Gene therapy with novel fusion proteins that target breast cancer cells

PDF

Detection of anti-Hu antibodies, a possible key to early diagnosis of small cell lung cancer

PDF

Amelogenin domains in a self-assembly process

PDF

A transgenic mouse model for small cell lung cancer

PDF

Dual functions of Vav in Ras-related small GTPases signaling regulation

Asset Metadata

Creator Hsu, Ya-hsuan (author)

Core Title Biochemical analysis of somatic mutations in steroid 5alpha-reductase type II in prostate cancer

School Graduate School

Degree Master of Science

Degree Program Biochemistry and Molecular Biology

Publisher University of Southern California (original), University of Southern California. Libraries (digital)

Tag biology, molecular,chemistry, biochemistry,health sciences, oncology,OAI-PMH Harvest

Language English

Contributor Digitized by ProQuest (provenance)

Advisor Reichardt, Juergen (committee chair), Coetzee, Gerhard (committee member), Tokes, Zoltan A. (committee member)

Permanent Link (DOI) https://doi.org/10.25549/usctheses-c16-298141

Unique identifier UC11337119

Identifier 1414840.pdf (filename),usctheses-c16-298141 (legacy record id)

Legacy Identifier 1414840.pdf

Dmrecord 298141

Document Type Thesis

Rights Hsu, Ya-hsuan

Type texts

Source University of Southern California (contributing entity), University of Southern California Dissertations and Theses (collection)

Access Conditions The author retains rights to his/her dissertation, thesis or other graduate work according to U.S. copyright law. Electronic access is being provided by the USC Libraries in agreement with the au...

Repository Name University of Southern California Digital Library

Repository Location USC Digital Library, University of Southern California, University Park Campus, Los Angeles, California 90089, USA