University of Southern California Dissertations and Theses

A novel role for post-migratory neural crest cells in cardiac outflow tract alignment: insights into the molecular basis of concomitant congenital cardiac and cleft malformations

(USC Thesis Other)

A novel role for post-migratory neural crest cells in cardiac outflow tract alignment: insights into the molecular basis of concomitant congenital cardiac and cleft malformations

PDF

Download a page range

Download transcript

Copy asset link

Request this asset

Transcript (if available)

Content Copyright 2021 Omar Toubat
A NOVEL ROLE FOR POST-MIGRATORY NEURAL CREST
CELLS IN CARDIAC OUTFLOW TRACT ALIGNMENT:
INSIGHTS INTO THE MOLECULAR BASIS OF CONCOMITANT
CONGENITAL CARDIAC AND CLEFT MALFORMATIONS

by

Omar Toubat

A Dissertation Presented to the
FACULTY OF THE USC GRADUATE SCHOOL
UNIVERSITY OF SOUTHERN CALIFORNIA
In Partial Fulfillment of the
Requirements for the Degree
DOCTOR OF PHILOSOPHY
DEVELOPMENT, STEM CELLS, AND REGENERATIVE MEDICINE

August 2021
ii
ACKNOWLEDGEMENTS
It is rather fitting that the Acknowledgements section is positioned at the beginning of
graduate student dissertations. In this way, it serves as a critical reminder of what is undoubtedly
the most important part of any graduate student’s training experience – the cultivation of a
personal, academic, and professional “village” that is committed to the student’s success. I
consider myself incredibly fortunate to have received support, mentorship, and guidance from
many individuals since beginning my scientific training as an undergraduate volunteer. The
insights and advice received have been instrumental in helping me to navigate the laboratory
environment, the scientific research process, and the long and winding pathway that is physician-
scientist training. It would require at least a second dissertation worth of text to comprehensively
acknowledge each of those individuals who have helped me get to this point. Here, I will focus
on highlighting the contributions of only those individuals who have had the most direct impact
on my development as a scientist.
I would first like to thank Richard Kim, who served as my first mentor in the field of
congenital heart surgery. Rick, I began volunteering in your lab early in my undergraduate
training. You welcomed me into your lab and exposed me to all aspects of the congenital heart
surgeon-scientist training pathway and career. Despite my inexperience, you took my learning
potential seriously. You trusted me to take on my own projects and you struck that delicate
balance of push and pull that I needed to organically cultivate my own motivation and interest to
pursue this field. Your mentorship and words of encouragement have been invaluable to me.
They have helped me get through the most difficult times in my training, and I anticipate this
will be the case for many years to come. I sincerely thank you for starting me on this path toward
becoming a congenital heart surgeon-scientist, and I humbly and deeply appreciate your
commitment to seeing me through.
Next, I’d like to thank a few of the individuals I had the privilege of working with
throughout my time in the lab. Michael Krainock, working under your guidance throughout
undergraduate and medical school was an immensely instructive experience for me. You taught
me the importance of effective communication, building professional relationships, being
fearless in the pursuit of your career goals, and staying true to yourself along the way. We toiled
iii
through several late nights and early mornings in the lab, and shared countless laughs and stories
that I fondly carry with me to this day. I am excited for you as you begin the next chapter of your
career in industry. I look forward to what your future brings and I wish you the utmost success.
Soula Danopoulos, from the first day we met, I knew you had my back. I could tell immediately
that you were someone I could learn from, and more importantly, lean on when times were
tough. Your selflessness, unparalleled work ethic, and drive to perfect every experiment was
admirable and motivated me to become a better scientist. I wish you the best in your career and
look forward to the great contributions you will provide to the field of developmental pulmonary
biology. Prashan De Zoysa, we met at a critical juncture of my academic and professional career.
In hindsight, I don’t think our meeting was entirely a coincidence. I appreciate your infectious
optimism and the considerable time you spent helping me to learn new protocols and techniques
in the lab. You are a model graduate student scientist and an even better person. I am sincerely
happy to call you a dear friend and I wish you absolutely nothing but the best.
Next, I would like to thank my graduate school committee. Ellen Lien, I would like to
begin by thanking you for serving as the chair of my thesis committee and a consistent source of
mentorship since I began my volunteer experience at the Saban Research Institute. I have always
been struck by your kindness and complete willingness to share your expertise in cardiac
developmental biology and laboratory resources with trainees interested in pursuing this area of
study. I respect your courage and resilience leading the laboratory that has served as the
consistent face of the basic cardiovascular research community at our institution. It is my hope
that one day I can have the opportunity to impact the field of cardiac developmental biology as
you have. Jian Xu, we met when I started in graduate school and was introduced to the Prmt1
project. I, like many of the other graduate student scientists in our group, was immediately
impressed by the depth of your knowledge into a variety of scientific topics, ranging from Prmt1
biology to postnatal cardiovascular physiology and craniofacial development. Your perspective
on these topics raised the quality of discourse in our joint laboratory meetings and your feedback
consistently challenged us trainees think more deeply about our projects. I thank you for
introducing me to the complex and interesting world of Prmt1 and for guiding my work along
these past few years. Young-Kwon Hong, although I have only had the privilege of knowing you
since beginning my graduate training, your mentorship during this time has been invaluable to
me. You consistently brought an expert level of objectivity and critical appraisal to our research
iv
meetings. You provided several experimental suggestions, each of which drastically improved
critical areas of deficiency in my scientific projects. However, what stands out most to me is
your unparalleled commitment to mentoring the next generation of scientists at all levels, from
undergraduate to faculty. I am humbled by your willingness to consistently put trainees and their
interests at the forefront of your mind. It is this aspect of our own mentor-mentee relationship
that I have come to appreciate the most- thank you.
Next, I would like to thank my graduate school principal investigator and mentor, Ram
Kumar Subramanyan. Ram, I find it rather remarkable that I learn something new nearly every
time we speak. I still vividly recall our first conversation, when you clearly outlined the
pathways toward success as an academic congenital heart surgeon. This conversation gave me
the 30,000-foot perspective I needed to explore and define my own career goal of becoming an
academic congenital heart surgeon-scientist. Since then, I’ve been fortunate to learn from you
while you navigate that very same career. You have been an incredible professional role model
for me. Your work ethic, commitment to excellence, and steadfast pursuit of success have
motivated me to put forth my complete effort into everything I do. Thank you for giving me the
opportunity to pursue my graduate work in your lab and for the permission to fail. I leave your
lab ready to resume the journey that is training to become a congenital heart surgeon-scientist. I
look forward to the many career and life lessons that I will continue to learn from you each step
along the way.
Outside of my professional colleagues and mentors, I would like to thank several
members of my family. Dad, Mom, Rami, Kasem, and Uncle Rene, you have each in your own
way provided a strong foundation of support for me over the years. Collectively, you encouraged
me to pursue my academic interests with confidence, which initially led me to join the
Baccalaureate/MD program with hopes of becoming a physician. Each of you continued to
support me when this career goal evolved to becoming a congenital heart surgeon-scientist.
Despite being the first in our family to pursue a career in medicine or science, I never felt alone.
You each understood that the sacrifice and dedication required of me to pursue this career will in
many ways extend to you. Yet, you all accepted this without hesitation. From the long nights
studying for exams, to the weekends spent in the laboratory troubleshooting experiments, I
always knew that I could turn to you for words of encouragement and support at any hour of the
v
day. I am deeply appreciative and grateful to come from such a loving family and I aspire to
represent us and our values to my greatest ability.
Last, but certainly not least, Allison Hu. Allison, you are without question the most
important person in my life outside of my family. I could not have accomplished anything
contained in this thesis without your support. Despite the many unexpected twists and turns of
graduate school, you always ensured that I was set up for success every step along the way. You
have a tremendous heart that you relentlessly pour into everything you do. This, combined with
your intelligence, tenacity, and determination, have allowed you to reach enviable levels of
success in your career and in life. I am incredibly proud of everything you’ve accomplished. I
love you with all my heart and look forward to spending the rest of our lives together.

vi
TABLE OF CONTENTS
ACKNOWLEDGEMENTS ii
LIST OF TABLES viii
LIST OF FIGURES x
ABSTRACT xiii
CHAPTER 1: INTRODUCTION TO HEART DEVELOPMENT AND CONGENITAL HEART
DISEASE 1
1.0 ABSTRACT 1
2.0 INTRODUCTION 2
2.1 ORIGIN AND DERIVATIVES OF FIRST AND SECOND HEART FIELD
PROGENITOR CELLS 3
2.2 NEURAL CREST CELLS AND SECOND HEART FIELD CELLS COOPERATIVELY
ORCHESTRATE CARDIAC OUTFLOW TRACT MORPHOGENESIS 4
3.0 REFERENCES 7
CHAPTER 2: CONCOMITANT CONGENITAL CARDIAC AND CLEFT
MALFORMATIONS IN THE CLINIC 12
1.0 ABSTRACT 12
2.0 INTRODUCTION 14
3.0 RESULTS 14
4.0 DISCUSSION 17
5.0 MATERIALS AND METHODS 21
6.0 TABLES AND FIGURES 23
7.0 REFERENCES 32
CHAPTER 3: GENOMIC SEQUENCING IMPLICATES WNT/PLANAR CELL POLARITY
PATHWAY SIGNALING IN THE DEVELOPMENT OF CONCOMITANT CONGENITAL
CARDIAC AND CLEFT MALFORMATIONS IN HUMANS 35
1.0 ABSTRACT 35
2.0 INTRODUCTION 37
3.0 RESULTS 38
4.0 DISCUSSION 41
vii
5.0 MATERIALS AND METHODS 45
6.0 TABLES AND FIGURES 49
7.0 REFERENCES 56
CHAPTER 4: NEURAL CREST CELLS ARE A NOVEL SOURCE OF PLANAR CELL
POLARITY SIGNALS TO THE SECOND HEART FIELD DURING OUTFLOW TRACT
MORPHOGENESIS IN THE MOUSE 62
1.0 ABSTRACT 62
2.0 INTRODUCTION 64
3.0 RESULTS 65
4.0 DISCUSSION 71
5.0 MATERIALS AND METHODS 75
6.0 TABLES AND FIGURES 79
7.0 REFERENCES 99
CHAPTER 5: NEURAL CREST CELL-SPECIFIC LOSS OF HISTONE MODIFYING
ENZYME PROTEIN ARGININE METHYLTRANSFERASE-1 ESTABLISHES A
CLINICALLY RELEVANT MODEL FOR CONCOMITANT CONGENITAL CARDIAC
AND CLEFT DEFECTS 104
1.0 ABSTRACT 104
2.0 INTRODUCTION 107
3.0 RESULTS 109
4.0 DISCUSSION 114
5.0 MATERIALS AND METHODS 117
6.0 TABLES AND FIGURES 121
7.0 REFERENCES 139
CHAPTER 6: CONCLUSION AND FUTURE DIRECTIONS 145
1.0 CONCLUSION 145
2.0 FUTURE DIRECTIONS 146
REFERENCES 148

viii
LIST OF TABLES
Chapter 2:
Table 1. Demographic characteristics of CHD+CL/P patients……………...…………....23
Table 2. Sequence of surgical interventions for all CHD+CL/P patients………...…..…...24
Table 3. Operative characteristics and outcomes for CHD+CL/P patients undergoing
cardiac surgery at our institution…………………………………………………….........25
Table 4. Comparative data between CHD+CL/P patients and a cohort of lesion-matched
CHD patients without CL/P from our institution……………………….…………..….…26
Table 5. Longitudinal follow-up for CHD+CL/P patients that underwent cardiac surgery
at our institution…………………………………………………………………...…..….27
Supplemental Table 1. Table of abbreviations for demographic, clinical, and phenotypic
variables………………………………………………………………………...……..…31

Chapter 3:
Table 1. Demographic and cardiac phenotypic characteristics of CHD+CL/P
probands………………………………………………………………………………….49
Table 2. Select de novo variants identified in CHD+CL/P probands through comparative
trio sequencing of both unaffected parents…………………………………………...…..50
Supplemental Table 1. Select de novo variants identified in CHD+CL/P probands through
comparative sequencing of only one parent……………………...…………………...…..54
Supplemental Table 2. Primers used for gene expression analysis to validate siRNA
knockdown efficiency……………………………………………………………………55

Chapter 4:
Table 1. Summary of cardiovascular phenotypes in NCC- and SHF- conditional Wnt5a
mutant mice…………………………………………………………………………..…..79
Supplemental Table 1. Primers used for genotyping mice based on extracted genomic
DNA……………………………………………………………………….……………..96
ix
Supplemental Table 2. Antibodies, probes, and chemical reagents used for expression and
experimental analyses………………………….……………………………..………….97
Supplemental Table 3. Primers used for gene expression analysis by RT-PCR…........…98

Chapter 5:
Table 1. Cardiovascular phenotypes in NCC-Prmt1 control and mutant embryos……...121
Supplemental Table 1. Primers used for genotyping mice based on extracted genomic
DNA…………………………………………………………………………….………136
Supplemental Table 2. Antibodies, probes, and chemical reagents used for expression and
experimental analyses…………………………………………………………...……...137
Supplemental Table 3. Primers used for gene expression analysis by RT-PCR…...…...138

x
LIST OF FIGURES
Chapter 2:
Figure 1. Distribution of CHD phenotypes in CL/P patients as compared to the general
CHD population. ………………………….………………..……………………..……..28
Figure 2. Staged surgical management algorithm of CHD+CL/P patients.……………....29
Supplementary Figure 1. Complete clinical management algorithm for CHD+CL/P
patients. ………………………….………………………………………………..……..30

Chapter 3:
Figure 1. Gene ontology and pathway analysis of select de novo variant mutations
identified in CHD+CL/P patients.………………………….……………………..……...51
Figure 2. Functional assessment of Wnt/PCP-related genes CELSR3, SAPCD2, and
CCDC88C (DAPLE) by in vitro wound-healing assay.…………………………..……....52
Supplemental Figure 1. RT-PCR evaluating the relative expression of CELSR3,
SAPCD2, and CCDC88C (DAPLE) transcripts in C2C12 cells at various concentrations
of siRNA.………………………….……………………………..………………..……..53

Chapter 4:
Figure 1. Wnt5a transcripts expression in cardiac neural crest cells and anterior second
heart field progenitor cells at embryonic day E10.5 in the mouse.…………………..…....80
Figure 2. Cardiac phenotypes observed following Wnt5a deletion in cardiac neural crest
cells and second heart field cells during outflow tract maturation.……………………......81
Figure 3. Planar cell polarity signaling in second heart field cells following Wnt5a deletion
in the neural crest.………………………….…………………………………..................82
Figure 4. Pharyngeal second heart field progenitor cell migration and outflow tract
elongation in neural crest cell conditional Wnt5a mutants.……………………..…….…..83
Figure 5. Sema3c expression in second heart field cells fated to become pulmonary trunk
myocardium in conditional Wnt5a mutants.………………………….…………...….…..84
xi
Figure 6. Schematic model of co-culture assay to model paracrine planar cell polarity
signaling events between neural crest cells and myoblasts.…………………..…..……....85
Figure 7. Presence of neural crest cells increases myoblast migratory capacity in
vitro.………………………….…………………………………………………………..86
Figure 8. Neural crest cell-derived Wnt5a is necessary for myoblast migration in
vitro………………………………………………………………………………………87
Supplemental Figure 1. Conditional deletion of Wnt5a in neural crest cells causes double
outlet right ventricle with additional pulmonary artery specific abnormalities…………...88
Supplemental Figure 2. Planar cell polarity signaling abnormalities in second heart field
cells continue to be observed at E10.5 in conditional neural crest cell Wnt5a mutants…...89
Supplemental Figure 3. Second heart field progenitors retain the capacity to proliferate
following neural crest cell deletion of Wnt5a.……………………...……………..….…..90
Supplemental Figure 4. Deletion of Wnt5a in the neural crest does not adversely impact
neural crest cell migration or proliferation.…………………...…………………..……....91
Supplemental Figure 5. Mutant second heart field cells fail to migrate into the outflow
tract and remain within the cranial pharyngeal mesoderm.…………………………….....92
Supplemental Figure 6. Wnt5aCreER lineage tracing of Wnt5a expressing cells and their
derivatives.………………………….………………………………………..……..........93
Supplemental Figure 7. Lineage tracing of SHF progenitors demonstrates that SHF cells
within the splanchnic mesoderm fail to migrate into the outflow tract of Mef2C-Cre, Wnt5a
mutant embryos.…………………………….……………………………..……………..94
Supplemental Figure 8. Loss of SHF-derived Wnt5a leads to altered polarized migration
of SHF cells into the outflow tract.………………………………………………...……..95

Chapter 5:
Figure 1. Prmt1 expression in neural crest cells is required for cardiac outflow tract
maturation.………………………….……………………………..……………………122
Figure 2. Loss of neural crest cell derived Prmt1 leads to outflow tract shortening due to a
dysregulated planar cell polarity signaling and a failure of second heart field cellular
migration into the outflow tract.………………………….…………………………..…123
xii
Figure 3. Prmt1 expression is dispensable for cardiac neural crest cell migration into the
outflow tract, yet it is required to maintain the pool of post-migratory cardiac neural crest
cell progenitors.………………………….……………………….…………………..…124
Figure 4. Prmt1 depletion causes global reduction of asymmetric dimethylated histone H4
arginine 3 and subsequent transcriptomic changes in the neural crest.………………..…126
Figure 5. Double heterozygous mice for Prmt1 and Wnt5a develop outflow tract alignment
defects, confirming the genetic synergy between these pathways in regulating second heart
field biology in vivo.…………………….…………………………..………………..…127
Figure 6. Neural crest cell-derived Prmt1 is necessary for myoblast migration and planar
cell polarity signaling in vitro.………………………….……………………….………128
Supplemental Figure 1. Fluorescence in situ hybridization of Prmt1 transcript expression
in the developing heart.………………………….……………...……..……………..…129
Supplemental Figure 2. Prmt1 is robustly and uniformly expressed in endocardium,
myocardium, and other cardiovascular tissues throughout heart development.…..……..130
Supplemental Figure 3. Whole mount imaging and India ink injections confirm double
outlet right ventricle phenotype in Prmt1 mutants at post-natal day 0.….………..…...…131
Supplemental Figure 4. Second heart field cells display similar levels of proliferation in
Prmt1 control and mutant embryos.…………………………………...…………..….…132
Supplemental Figure 5. Neural crest cells maintain the capacity to differentiate into
smooth muscle cells of the aortic arch in Prmt1 mutants.……………….………..……...133
Supplemental Figure 6. Semaphorin3C expression is reduced in second heart field cells
fated to become pulmonary trunk myocardium in Prmt1 mutants at E12.0..……..…...…134
Supplemental Figure 7. Breeding strategy and preliminary results for planned in vivo
rescue experiments aimed at overexpressing Wnt5a in neural crest cells following Prmt1
depletion.………………………….…………………………………...…………..……135

xiii
ABSTRACT
The overall goal of this thesis is to understand the role of post-migratory neural crest cells
(NCCs) in cardiac outflow tract (OFT) alignment. Our focus on studying outflow tract biology is
driven by the observation that OFT defects account for nearly 30% of all congenital heart disease
(CHD) and the mechanisms giving rise to these defects are largely unknown. In the developing
embryo, the OFT begins as a second heart field (SHF) derived vessel that connects the primitive
right ventricle to the bilaterally paired pharyngeal arch arteries. As embryogenesis progresses,
the OFT undergoes a series of morphologic changes that includes elongation/alignment,
septation, and rotation. It is well established that NCCs are necessary for OFT septation, as
several published studies have shown that genetic perturbation or surgical ablation of cardiac
NCCs results in a single OFT vessel morphology. Septation abnormalities during development
are reminiscent of the birth defect known as persistent truncus arteriosus, or common arterial
trunk. While it has been suggested that post-migratory NCCs also impact OFT alignment, there
is a relative paucity of studies focusing specifically on this aspect of NCC biology in the
literature. By combining clinical and genetic sequencing data from neurocristopathy patients
harboring OFT defects and cleft malformations with experimental data from phenotypically-
matched mouse models, my thesis research aims to provide a translational perspective on the
mechanisms of NCC-mediated OFT development.
This work began by evaluating the spectrum of CHD phenotypes in patients with cleft lip
and/or palate (CLP). We chose to deliberately focus on patients with concomitant CHD+CLP for
two reasons: (1) previous work by our group showed that the overall prevalence of CHD is
enriched in CLP patients, and (2) NCCs are the only cells that give rise to both the developing
palate and OFT, which suggests that the cardiac defects enriched in this population would likely
reflect NCC-related abnormalities. We began by surveying the cardiac phenotypes of 127
CHD+CLP patients, which is the largest series of such patients analyzed to date. We showed that
the overrepresentation of CHD in this cohort was primarily due to the enrichment of OFT
defects. Notably, we found that the most prevalent CHD lesion in cleft patients was the
malalignment phenotype tetralogy of Fallot/double outlet right ventricle (TOF/DORV),
underscoring the clinical relevance of the less well studied role of NCCs in OFT alignment. To
better understand the genetic and molecular basis of this CHD+CLP phenotype, we selected a
xiv
sample of probands and their phenotypically unaffected parents to undergo DNA sequencing.
Through this trio sequencing approach, we gained preliminary insights into the genomic
architecture of CHD+CLP patients. Our work showed that there was an enrichment of rare de
novo variants implicated in the Wnt/planar cell polarity (PCP) signaling pathway in CHD+CLP
patients, which suggests that this pathway may serve as a mechanism for NCC-mediated OFT
alignment.
Leveraging the insights gained from these human studies, we sought to develop mouse
models to study the mechanisms that give rise to CHD+CP phenotypes in the laboratory.
Previous studies identified Wnt5a and Wnt11 as putative ligands that drive PCP signaling during
cardiac outflow tract morphogenesis. While Wnt11 is known to be secreted from the SHF
lineage, no study to date has specifically evaluated the cellular sources of Wnt5a. Therefore, to
model the dominant genetic derangement observed in CHD+CLP patients, we generated a mouse
model whereby Wnt5a was conditionally deleted from the neural crest. We found that Wnt5a
conditional knockout mice exhibited OFT alignment defects with complete penetrance.
Mechanistically, we demonstrated that OFT malalignment in conditional NCC-Wnt5a mutants is
due to the failed polarized migration of SHF progenitors from the pharyngeal mesoderm into the
cardiac OFT. This indicates that post-migratory NCCs serve as a novel source of paracrine PCP
signals to the SHF during OFT maturation. Overall, the data from our conditional NCC-Wnt5a
mutant model support the hypothesis generated from our human sequencing analysis and
establishes the PCP signaling pathway as a critical mechanism of NCC-mediated OFT
alignment.
In addition to our work in the Wnt5a model, we sought to develop a second NCC genetic
model of CHD+CP through the deletion of protein arginine methyltransferase-1 (Prmt1) in the
neural crest. The decision to pursue this second model was made in collaboration with Dr. Jian
Xu’s group for four reasons: (1) Prmt1 maintains an important role as a histone modifying
enzyme, which is among the most prevalent classes of molecules mutated in patients with CHD;
(2) No study to date had investigated the role of Prmt1 in NCC-mediated heart development; (3)
Dr. Jian Xu’s team had already shown that 100% of NCC depleted Prmt1 mutants harbor cleft
palate phenotypes; (4) Depletion of Prmt1 results in downregulation of Wnt5a expression in
cranial NCC, which suggests that Prmt1 may act upstream of Wnt5a in the cardiac neural crest as
xv
well. For these reasons, we felt that the Prmt1 model would serve as a more clinically relevant
model to study the CHD+CP phenotype. We found that the conditional deletion of Prmt1 in the
neural crest faithfully phenocopied the most prevalent phenotype observed in our patient cohort
(DORV+CP). Given the phenotypic similarity between the Prmt1 and Wnt5a models in the
cardiac NCC, we evaluated the impact of NCC-derived Prmt1 on SHF biology. We confirmed
that NCC-derived Prmt1 is critically required for SHF migration into the OFT and its elongation,
paralleling the mechanism observed in Wnt5a mutants. Transcriptomic analysis of gene
expression changes in NCCs of Prmt1 mutants identified Wnt5a as a downregulated gene within
the cardiac NCC domain, as was previously shown in the cranial subpopulation. To assess the
genetic synergy between these two molecular pathways in vivo, we performed double
heterozygous knockouts and confirmed the presence of OFT alignment defects with ~75%
penetrance. While preliminary data support the notion that restoration of Wnt5a in the setting of
Prmt1 depletion can rescue SHF migratory and cytoarchitectural defects in vitro, our future work
is aimed at confirming this mechanism through an in vivo approach whereby Wnt5a is
genetically overexpressed in NCCs lacking Prmt1.
Overall, I believe the work presented in this thesis contributes to both the scientific and
clinical understanding of CHD in several important ways. First, we identified concomitant
outflow tract and cleft phenotypes as an associated disease entity with clinical and
developmental relevance. Second, we developed novel Wnt5a and Prmt1 mouse genetic models
that recapitulate the dominant phenotypes in CHD+CLP patients. Utilizing these mice, we
established paracrine PCP signaling as a fundamental mechanism of NCC-mediated OFT
alignment, advancing current perspectives on the role of post-migratory cardiac NCCs in OFT
biology. Finally, we showed that the integration of clinically relevant phenotyping, unbiased
gene sequencing in select probands, and reverse translational models of disease together provide
an important and synergistic methodologic approach for studying the molecular basis of CHD
with concomitant extra-cardiac developmental abnormalities.
1
C h a p t e r 1:
INTRODUCTION TO HEART DEVELOPMENT AND CONGENITAL
HEART DISEASE

1.0 ABSTRACT
The mammalian heart is a four-chambered organ assembled by both mesodermal and
ectodermal progenitor cell lineages. In its anatomically mature form, the heart is organized as
two functional pumps connected in series, with the systemic left ventricle predominately derived
from the first heart field and the pulmonary right ventricle from the second heart field. The
arterial vessels that receive outflow from each ventricle are entirely derived from the second
heart field, with supporting roles from the cardiac neural crest. After its initial assembly, the
outflow tract undergoes a complex maturation sequence coordinated by intricate and reciprocal
signaling events between second heart field and neural crest cell progenitor populations. Notably,
the inappropriate development of this outflow tract apparatus is responsible for nearly 30% of all
forms of congenital heart disease. As such, there is considerable interest in understanding the
molecular mechanisms governing second heart field and neural crest cell contributions to
outflow tract morphogenesis. Approaching the study of congenital heart disease from this
developmental perspective may not only serve to improve our understanding of disease
pathogenesis, but may also provide a framework to advance regenerative and molecular therapies
in this population.

2
2.0 INTRODUCTION
The heart is the first functional organ to develop during mammalian embryogenesis and
is responsible for supporting the subsequent growth and maturation of the embryo. The
development of the mammalian heart is a complex process that is directed by a core set of
evolutionarily conserved transcription factors.
1
These transcription factors drive the expression
of distinct gene programs required for multiple facets of heart development, including progenitor
cell specification, terminal cell differentiation, and intercellular signaling events.
1
At the cellular
level, precise coordination between multipotent progenitor cells that express these transcription
factors and the products of their downstream signaling events is required.
An additional fundamental characteristic of this process is that it is carefully
spatiotemporally controlled. Activation of gene regulatory networks, cell fate specification, and
assembly of the mammalian heart occur in a step-wise or modular fashion.
1
Morphologically,
heart development begins with a single spontaneously contracting heart tube at the embryonic
midline and ends with a four-chambered organ divided into synchronously contracting
pulmonary and systemic pumps connected in series. Appropriate specification and integration of
progenitor cell derivatives into the developing heart is not only highly time dependent, but is also
contingent upon signaling cues provided by locally positioned cardiac progenitor and extra-
cardiac sources.
2-6
These signals create diverse and spatially distinct microenvironments that
refine cardiac progenitor cell interactions and allow for patterning of different parts of the heart
to occur independently. Significant genetic, molecular, or environmental perturbations at any
point during cardiogenesis have the potential to cause lasting morphologic defects of the heart,
known as congenital heart disease (CHD). As a measure of the overall complexity associated
with heart formation in the embryo, CHD remains the most common classification of birth
defects observed in humans.
7
Therefore, efforts to understand the developmental principles
governing heart formation not only have intrinsic scientific merit, but also maintain significant
clinical relevance for characterizing the molecular basis of CHD and potentially identifying
novel therapeutic approaches to this population.

3
2.1 ORIGIN AND DERIVATIVES OF FIRST AND SECOND HEART FIELD
PROGENITOR CELLS
The first heart field (FHF) is the first cardiac mesodermal progenitor population that is
specified in the developing embryo. These cells are originally located within the epiblast in a
microenvironment established by a complex molecular network of Bmp, Fgf, Wnt, Notch, and
Shh signals secreted from adjacent endodermal and other extra-cardiac cell lineages.
8,9
From
here, FHF cells migrate to the anterior lateral plate mesoderm at embryonic day(E) 7.5 in the
mouse, where they express cardiogenic transcription factors Mesp1 and Nkx2.5 and form a
cardiac crescent.
9,10
FHF progenitors within the cardiac crescent converge at the embryonic
midline to form a single spontaneously contracting primitive heart tube that connects the sinus
venosus caudally to the dorsal aortae cranially.
11
In addition to serving as a functional connection
between the sinus venosus and dorsal aortae, the heart tube also adopts a topographical
organization along this axis. Shortly after formation, the elongating heart tube undergoes a
rightward looping event to establish the appropriate orientation of the heart within the thoracic
cavity. This process geometrically reconfigures the heart tube, such that the future atrial chamber
is located more cranially, while the ventricular chamber is repositioned more caudally.
12

After initial FHF specification and heart tube formation, a second population of
cardiogenic mesodermal progenitor cells known as the second heart field (SHF) become
specified in the pharyngeal and splanchnic mesoderm, dorsal to FHF structures.
13-15
Although
SHF and FHF both express a common set of cardiogenic transcription factors (Nkx2.5, Gata4,
and others), SHF cells are molecularly distinct from FHF progenitors in their expression of Islet-
1 (Isl-1) and Tbx-1.
9
Previous studies have demonstrated the importance of Isl-1 induction in the
establishment of the SHF, as genetic deletion of Isl-1 in mice has been shown to result in a
profound reduction in the size of SHF derivatives, with no effect on FHF derived structures.
16

While residing in the pharyngeal mesoderm, the SHF population delays differentiation and
instead undergoes marked proliferative expansion to generate a sufficient pool of progenitor cells
that will contribute to the developing heart. Additional specification events in the pharyngeal and
splanchnic mesoderm result in SHF lineage divergence into anterior and posterior
subpopulations. In the anterior SHF, Isl-1 activates a transcriptional network that includes
Mef2c, Fgf10, and Fgf8.
13
These anterior SHF cells migrate from their origin in the pharyngeal
4
and splanchnic mesoderm to the arterial (cranial) pole of the heart to contribute to outflow tract
morphogenesis.
17-20
A smaller proportion of anterior SHF cells have been shown to migrate to
the venous (caudal) pole of the heart. In contrast, the posterior SHF migrates exclusively to the
venous pole of the heart, where the activation of a Tbx5+-Osr1+ gene program facilitates atrial
and inflow tract development.
21,22
Ultimately, these molecular and morphologic patterning events
result in distinct progenitor cell-specific contributions to heart development, with FHF
progenitors giving rise to the left ventricle, SHF progenitors to the right ventricle and cardiac
outflow tract, and FHF and SHF providing shared contributions to the atria.

2.2 NEURAL CREST CELLS AND SECOND HEART FIELD CELLS
COOPERATIVELY ORCHESTRATE CARDIAC OUTFLOW TRACT
MORPHOGENESIS
Although the cardiac outflow tract begins as a rudimentary SHF-derived vessel that
connects the right ventricle to the bilaterally paired pharyngeal arch arteries, the maturation of
the outflow tract requires extensive and cooperative roles from both cardiac neural crest cells
(NCC) and SHF. Defective morphogenesis of the cardiac outflow tract is responsible for nearly
30% of all clinically encountered forms of CHD.
7
As such, there remains considerable scientific
and clinical interest in understanding the appropriate developmental mechanisms giving rise to
this structure.
As previously described, the outflow tract begins with the formation of a single SHF-
derived arterial vessel that connects the right ventricle to the pharyngeal arterial circulation.
Within the outflow tract, SHF cells differentiate into myocardial and endocardial components.
23

It is important to note that although the outflow tract is SHF-derived and initially emanates
entirely from the right ventricle, there is no FHF-derived structure of equivalence formed from
the left ventricle. Therefore, the initially asymmetrically positioned primitive outflow tract
undergoes a series of complex morphologic changes to ensure that its derivatives provide
functional communications with the left and right ventricular chambers. This maturation process
begins with outflow tract elongation, which is driven by the distal incorporation of migrating
anterior SHF progenitors from the pharyngeal and splanchnic mesoderm. As the outflow tract
5
lengthens it assumes a curved morphology and becomes medially displaced, such that it is
positioned above the developing interventricular septum. Several studies in preclinical animal
models have shown that disruptions in SHF accretion at the arterial pole result in a shortened
outflow tract and a spectrum of malalignment defects reminiscent of tetralogy of Fallot and
double outlet right ventricle phenotypes frequently encountered in children with CHD.
24-27
These
studies collectively highlight the interconnected and critical nature of outflow tract elongation
and alignment during cardiac development in mammalian systems.
In addition to alignment, septation (or division) of the outflow tract is recognized as a
crucially required step during mammalian outflow tract maturation. Septation of the outflow tract
is necessary for the formation of separate pulmonary and systemic arterial circulations. It is well
established that cardiac neural crest cells (NCCs) are the progenitor cell population principally
responsible for orchestrating aorticopulmonary septation in the embryo. Cardiac NCCs are a
multipotent neuroectodermal progenitor population that arise in the dorsal neural tube just caudal
to the cranial NCC domain.
28
Following specification, these cells undergo epithelial-to-
mesenchymal transition, delaminate from the neural tube, and migrate though the pharyngeal
arch system to the developing heart.
29-31
Fate mapping experiments performed in mouse embryos
demonstrate that post-migratory cardiac NCCs reside within the tunica media of pharyngeal arch
arteries, semilunar valves, subaortic mesenchyme, and interventricular septum.
32
Within the
outflow tract, cardiac NCCs can be observed in the subendocardial cushions, where they
ultimately divide the SHF-derived vessel into pulmonary and aortic arteries.
32
This process has
been exceptionally well studied in the context of mouse and avian embryonic development.
Experiments in these model systems have shown that both the selective ablation of cardiac NCCs
and the disruption of molecules critical for their migration consistently result in failure of
outflow tract septation.
33-36
Failure of outflow tract septation primarily manifests as the persistent
truncus arteriosus, or common arterial trunk (CAT) phenotype observed in humans.
While developmental biologists have traditionally understood SHF- and cardiac NCC-
mediated outflow tract biology in a relatively compartmentalized manner, recent perspectives
have evolved to understand outflow tract maturation as a culmination of distinct, yet highly
interdependent processes. This paradigm shift has emerged in large part due to advances in tools
used to genetically label and modify specific cardiogenic subpopulations during heart
6
development. Evidence from targeted lineage tracing and conditional genetic ablation
experiments indicate that SHF and cardiac NCCs engage in intricate paracrine signaling events
that reciprocally influence both alignment and septation processes.
37-40
This perspective is further
strengthened by clinical observations in humans, which demonstrate that children born with
CHD often display diverse patterns of morphologic abnormalities that span classical SHF and
NCC defined phenotypes. While multiple candidate genes and associated signaling pathways
connecting NCC and SHF populations have been proposed, relatively few mechanisms of
forward and reverse interactions between NCCs and SHF progenitors have been clearly
described in the literature.
37,38,41
As such, our group’s research primary research interests are to
understand outflow tract morphogenesis through the study of the interplay between cardiac
NCCs and SHF progenitor cells and their integrated molecular networks. Overall, we believe this
approach will expand our insights into the governing principles of heart development and
provide a refined and contemporary framework for understanding clinically relevant forms of
CHD.

7
3.0 REFERENCES
1. Olson EN. Gene regulatory networks in the evolution and development of the heart.
Science. 2006;313(5795):1922-7.
2. Cripps RM, Olson EN. Control of cardiac development by an evolutionarily conserved
transcriptional network. Dev Biol. 2002;246(1):14-28.
3. Icardo JM, Manasek FJ. An indirect immunofluorescence study of the distribution of
fibronectin during the formation of the cushion tissue mesenchyme in the embryonic
heart. Dev Biol. 1984;101(2):336-45.
4. Lu J, Kaestle K, Huang J, Liu Q, Zhang P, Gao L, Gardiner J, Thissen H, Yang HT.
Interactions of human embryonic stem cell-derived cardiovascular progenitor cells with
immobilized extracellular matrix proteins. J Biomed Mater Res A. 2017;105(4):1094-
1104.
5. Jackson TR, Kim HY, Balakrishnan UL, Stuckenholz C, Davidson LA. Spatiotemporally
Controlled Mechanical Cues Drive Progenitor Mesenchymal-to-Epithelial Transition
Enabling Proper Heart Formation and Function. Curr Biol. 2017;27(9):1326-1335.
6. Yuan X, Qi H, Li X, Wu F, Fang J, Bober E, Dobreva G, Zhou Y, Braun T. Disruption of
spatiotemporal hypoxic signaling causes congenital heart disease in mice. J Clin Invest.
2017;127(6):2235-2248.
7. Virani SS, Alonso A, Aparicio HJ, Benjamin EJ, Bittencourt MS, Callaway CW, Carson
AP, Chamberlain AM, Cheng S, Delling FN, Elkind MSV, Evenson KR, Ferguson JF,
Gupta DK, Khan SS, Kissela BM, Knutson KL, Lee CD, Lewis TT, Liu J, Loop MS,
Lutsey PL, Ma J, Mackey J, Martin SS, Matchar DB, Mussolino ME, Navaneethan SD,
Perak AM, Roth GA, Samad Z, Satou GM, Schroeder EB, Shah SH, Shay CM, Stokes A,
VanWagner LB, Wang NY, Tsao CW; American Heart Association Council on
Epidemiology and Prevention Statistics Committee and Stroke Statistics Subcommittee.
Heart Disease and Stroke Statistics-2021 Update: A Report From the American Heart
Association. Circulation. 2021;143(8):e254-e743.
8
8. Zaffran S, Frasch M. Early signals in cardiac development. Circ Res. 2002;91(6):457-69.
9. Herrmann F, Groß A, Zhou D, Kestler HA, Kühl M. A boolean model of the cardiac gene
regulatory network determining first and second heart field identity. PLoS One.
2012;7(10):e46798.
10. Tam PP, Parameswaran M, Kinder SJ, Weinberger RP. The allocation of epiblast cells to
the embryonic heart and other mesodermal lineages: the role of ingression and tissue
movement during gastrulation. Development. 1997;124(9):1631-42.
11. Abu-Issa R, Kirby ML. Heart field: from mesoderm to heart tube. Annu Rev Cell Dev
Biol. 2007;23:45-68.
12. Buckingham M, Meilhac S, Zaffran S. Building the mammalian heart from two sources
of myocardial cells. Nat Rev Genet. 2005;6(11):826-35.
13. Black BL. Transcriptional pathways in second heart field development. Semin Cell Dev
Biol. 2007;18(1):67-76.
14. Dyer LA, Kirby ML. The role of secondary heart field in cardiac development. Dev Biol.
2009;336(2):137-44.
15. Zaffran S, Kelly RG. New developments in the second heart field. Differentiation.
2012;84(1):17-24.
16. Cai CL, Liang X, Shi Y, Chu PH, Pfaff SL, Chen J, Evans S. Isl1 identifies a cardiac
progenitor population that proliferates prior to differentiation and contributes a majority
of cells to the heart. Dev Cell. 2003;5(6):877-89.
17. Kelly RG, Brown NA, Buckingham ME. The arterial pole of the mouse heart forms from
Fgf10-expressing cells in pharyngeal mesoderm. Dev Cell. 2001;1(3):435-40.
18. Watanabe Y, Miyagawa-Tomita S, Vincent SD, Kelly RG, Moon AM, Buckingham ME.
Role of mesodermal FGF8 and FGF10 overlaps in the development of the arterial pole of
the heart and pharyngeal arch arteries. Circ Res. 2010;106(3):495-503.
9
19. Waldo KL, Kumiski DH, Wallis KT, Stadt HA, Hutson MR, Platt DH, Kirby ML.
Conotruncal myocardium arises from a secondary heart field. Development.
2001;128(16):3179-88.
20. De Zoysa P, Liu J, Toubat O, Choi J, Moon A, Gill PS, Duarte A, Sucov HM, Kumar SR.
Delta-like ligand 4-mediated Notch signaling controls proliferation of second heart field
progenitor cells by regulating Fgf8 expression. Development. 2020;147(17):dev185249.
21. Xie L, Hoffmann AD, Burnicka-Turek O, Friedland-Little JM, Zhang K, Moskowitz IP.
Tbx5-hedgehog molecular networks are essential in the second heart field for atrial
septation. Dev Cell. 2012;23(2):280-91.
22. Zhang KK, Xiang M, Zhou L, Liu J, Curry N, Heine Suñer D, Garcia-Pavia P, Zhang X,
Wang Q, Xie L. Gene network and familial analyses uncover a gene network involving
Tbx5/Osr1/Pcsk6 interaction in the second heart field for atrial septation. Hum Mol
Genet. 2016;25(6):1140-51.
23. Lin CJ, Lin CY, Chen CH, Zhou B, Chang CP. Partitioning the heart: mechanisms of
cardiac septation and valve development. Development. 2012;139(18):3277-99.
24. Sinha T, Wang B, Evans S, Wynshaw-Boris A, Wang J. Disheveled mediated planar cell
polarity signaling is required in the second heart field lineage for outflow tract
morphogenesis. Dev Biol. 2012;370(1):135-44.
25. Li D, Angermeier A, Wang J. Planar cell polarity signaling regulates polarized second
heart field morphogenesis to promote both arterial and venous pole septation.
Development. 2019;146(20):dev181719.
26. Rochais F, Dandonneau M, Mesbah K, Jarry T, Mattei MG, Kelly RG. Hes1 is expressed
in the second heart field and is required for outflow tract development. PLoS One.
2009;4(7):e6267.
27. Ramsbottom SA, Sharma V, Rhee HJ, Eley L, Phillips HM, Rigby HF, Dean C,
Chaudhry B, Henderson DJ. Vangl2-regulated polarisation of second heart field-derived
10
cells is required for outflow tract lengthening during cardiac development. PLoS Genet.
2014;10(12):e1004871.
28. Sauka-Spengler T, Bronner-Fraser M. A gene regulatory network orchestrates neural
crest formation. Nat Rev Mol Cell Biol. 2008;9(7):557-68.
29. Scholl AM, Kirby ML. Signals controlling neural crest contributions to the heart. Wiley
Interdiscip Rev Syst Biol Med. 2009;1(2):220-7.
30. Bronner ME, Simões-Costa M. The Neural Crest Migrating into the Twenty-First
Century. Curr Top Dev Biol. 2016;116:115-34.
31. Kirby ML, Waldo KL. Neural crest and cardiovascular patterning. Circ Res.
1995;77(2):211-5.
32. Jiang X, Rowitch DH, Soriano P, McMahon AP, Sucov HM. Fate of the mammalian
cardiac neural crest. Development. 2000;127(8):1607-16.
33. Hutson MR, Kirby ML. Neural crest and cardiovascular development: a 20-year
perspective. Birth Defects Res C Embryo Today. 2003;69(1):2-13.
34. Wang J, Nagy A, Larsson J, Dudas M, Sucov HM, Kaartinen V. Defective ALK5
signaling in the neural crest leads to increased postmigratory neural crest cell apoptosis
and severe outflow tract defects. BMC Dev Biol. 2006;6:51.
35. Kaartinen V, Dudas M, Nagy A, Sridurongrit S, Lu MM, Epstein JA. Cardiac outflow
tract defects in mice lacking ALK2 in neural crest cells. Development.
2004;131(14):3481-90.
36. Todorovic V, Frendewey D, Gutstein DE, Chen Y, Freyer L, Finnegan E, Liu F, Murphy
A, Valenzuela D, Yancopoulos G, Rifkin DB. Long form of latent TGF-beta binding
protein 1 (Ltbp1L) is essential for cardiac outflow tract septation and remodeling.
Development. 2007;134(20):3723-32.
11
37. Rentschler S, Jain R, Epstein JA. Tissue-tissue interactions during morphogenesis of the
outflow tract. Pediatr Cardiol. 2010;31(3):408-13.
38. Kodo K, Shibata S, Miyagawa-Tomita S, Ong SG, Takahashi H, Kume T, Okano H,
Matsuoka R, Yamagishi H. Regulation of Sema3c and the Interaction between Cardiac
Neural Crest and Second Heart Field during Outflow Tract Development. Sci Rep.
2017;7(1):6771.
39. Yelbuz TM, Waldo KL, Kumiski DH, Stadt HA, Wolfe RR, Leatherbury L, Kirby ML.
Shortened outflow tract leads to altered cardiac looping after neural crest
ablation. Circulation. 2002;106:504–510.
40. Yelbuz TM, Waldo KL, Zhang X, Zdanowicz M, Parker J, Creazzo TL, Johnson GA,
Kirby ML. Myocardial volume and organization are changed by failure of addition of
secondary heart field myocardium to the cardiac outflow tract. Dev Dyn. 2003;228: 152–
160
41. Xiong H, Luo Y, Yue Y, Zhang J, Ai S, Li X, Wang X, Zhang YL, Wei Y, Li HH, Hu X,
Li C, He A. Single-Cell Transcriptomics Reveals Chemotaxis-Mediated Intraorgan
Crosstalk During Cardiogenesis. Circ Res. 2019;125(4):398-410.

12
C h a p t e r 2:
CONCOMITANT CONGENITAL CARDIAC AND CLEFT
MALFORMATIONS IN THE CLINIC

1.0 ABSTRACT
Background: Congenital heart disease (CHD) frequently occurs in conjunction with other non-
cardiac developmental anomalies. Understanding the impact of concomitant non-cardiac
developmental anomalies in the management of CHD is a critical step toward improving
prognostic and therapeutic approaches in this population. Despite a known association between
cleft malformations and CHD, the clinical impact of concomitant cleft disease on the surgical
management of CHD has not been studied. The aim of this study was to survey cardiac
phenotypes and evaluate cardiac surgical outcomes in patients with concomitant CHD and cleft
lip and/or palate (CL/P).
Methods: Patients with CHD+CL/P managed at our institution between January 2004 and
December 2018 were included. Demographic, operative, and follow-up data were retrospectively
collected and analyzed using SAS 9.4. Chi-square tests were used for categorical variables and t-
test or Wilcoxon rank-sum tests for continuous variables. Significance of p<0.05 was used.
Results: There were 127 CHD+CL/P patients, 63 (50%) were boys. Compared to the general
CHD population, CHD+CL/P patients demonstrated an enrichment of atrial septal defects
(10.5% vs 34%), Tetralogy of Fallot/double outlet right ventricle (6.4% vs 15.7%), arch defects
(4.5% vs 10.2%), truncus arteriosus (1.2% vs 3.1%), and total anomalous pulmonary venous
return (1.0% vs 2.4%). Of the 63 patients who underwent CHD repair, 58 (92%) did so prior to
CL/P repair at 21.5 (6-114) days of age. Compared to CHD lesion-matched patients undergoing
cardiac surgical repair at our institution, patients with CL/P had a 2 to 3.7-fold longer intensive
care stay, 1.8 to 2.6-fold longer hospital stay, and 6 to 13.5-fold increase in major morbidity,
without a significant difference in mortality.
13
Conclusions: Cardiac outflow tract defects are particularly overrepresented in CL/P patients,
suggesting that these two disease processes share a strong developmental basis. Clinically, the
presence of CL/P was found to increase the complexity of postoperative care after CHD surgery,
without a significant impact on mortality.

14
2.0 INTRODUCTION
Congenital heart disease (CHD) affects approximately 7-9 per 1,000 live births and is the
leading cause of birth defect associated infant mortality.
1
In the United States alone, nearly
40,000 newborns each year are diagnosed with a congenital cardiac malformation. Given the
improvements made in the surgical and medical management of CHD in the pediatric population,
rates of early mortality due to CHD have declined significantly in recent decades. Consequently,
in 2010, it was estimated that 2.4 million pediatric and adult patients live with CHD.
2
While the
majority of these patients has isolated cardiac defects, it is not uncommon for CHD patients to
harbor other non-cardiac developmental anomalies.
3–5

Cleft lip and/or cleft palate (CL/P) are frequently associated extra-cardiac anomalies in
syndromic and non-syndromic CHD patients. Recent reports have found that the prevalence of
CHD in cleft patients is up to 14-fold higher than that of the general population.
6–10
We have
shown that the presence of CHD impacts the management and outcomes of cleft care.
11
In
contrast, there are limited data concerning the clinical impact of cleft defects on care of CHD.
Therefore, the aim of this study is to characterize the phenotypic distribution of cardiac
malformations in CL/P patients and to evaluate the impact of concomitant CL/P on the surgical
management of CHD.

3.0 RESULTS
Demographics and patient characteristics
Demographic characteristics of the CHD+CL/P cohort are summarized in Table 1. Our
cohort comprised of a total of 127 patients. Six patients (4.7%) had a family history of CHD, two
Tetralogy of Fallot, one ventricular septal defect, and three unknown. Isolated cleft palate was
the most common cleft diagnosis and was observed in greater than half of the study cohort. In
addition, more than half of the CHD+CL/P patients were also diagnosed with an associated
genetic syndrome, most commonly 22q11 microdeletion (DiGeorge or Velocardiofacial
syndrome) (n=16, 12.6%), followed by Goldenhar (n=8, 6.3%), CHARGE (n=6, 4.7%), and
Trisomy 21 (Down’s syndrome, n=6, 4.7%). Almost half of the patients had at least one
15
additional extra-cardiac defect other than CL/P, confirming the frequently observed clustering of
birth defects.
Distribution of CHD in cleft patients
The breakdown of CHD phenotypes in this cohort of patients is shown in Figure 1. The
most commonly diagnosed cardiac lesion was atrial septal defects (ASD, n=43, 33.9%), followed
by ventricular septal defects (VSD, n=26, 20.5%), Tetralogy of Fallot/double outlet right
ventricle (TOF/DORV, n=20, 15.7%), and aortic arch hypoplasia/coarctation ± VSD (n=13,
10.2%). Using national estimates of CHD birth prevalence,
1
we compared the distribution of
CHD phenotypes in cleft patients to that observed in the general CHD population (Figure 1).
CHD phenotypes over-represented in cleft patients included ASD (CL/P 33.9% vs. general
population 10.5%), TOF/DORV (15.7% vs. 6.4%), arch hypoplasia/coarctation ± VSD (10.2%
vs. 4.5%), truncus arteriosus (Truncus) (3.1% vs. 1.2%) and total anomalous pulmonary venous
return (TAPVR) (2.4% vs. 1.0%). In contrast, isolated VSD (20.5% vs. 39.7%), and isolated
pulmonary (2.4% vs. 9.6%) or aortic valve stenosis/atresia (2.4% vs. 4.5%) appear to be less
frequently encountered.
Operative data
A total of 63 (49.6%) CHD+CL/P patients underwent cardiac surgery in our series
(Figure 2, Supplementary Figure 1). All but five (58, 92.0%) underwent cardiac surgery prior to
cleft repair at a median age of 21.5 days (IQR 6.3 - 113.8). Thirty-two (50.8%) patients
underwent cardiac surgery as a neonate (median 10.0 days, IQR 5.0 – 16.8) for arch hypoplasia
(n=13), Truncus (n=4), PDA (n=4), TAPVR (n=3), d-TGA (n=2), HLHS (n=1), and others
(n=5). Twenty-six (41.3%) patients underwent cardiac surgery prior to cleft repair in the post-
neonatal period (median 170 days, IQR 92 - 272.5) for TOF/DORV (n=13), VSD (n=12), and
PDA (n=1). The median time interval between CHD repair and CL repair in these patients was
199 days (IQR 117.8 - 238.3) and 499 days (IQR 367.0 – 1,526.0) between CHD and CP repairs
(Table 2). Five patients had cardiac surgery after initial cleft repair. The median age of this
cohort at CHD repair was nearly 5 years (1,753 days, IQR 1,703 - 3,241) and they underwent
cardiac surgery for ASD (n=3), vascular ring (n=1), and bicuspid aortic valve (n=1). The time
interval between CL/P repair and cardiac surgery was 976 days (IQR 632 - 3072).
16
Three patients underwent cardiac surgery at an outside hospital. Operative data for the
remaining 60 patients whose CHD was surgically managed at our institution are summarized in
Table 3. Two thirds of the patients underwent CHD intervention on cardiopulmonary bypass.
The remainder included patients who had PDA ligation, systemic to pulmonary shunt and
vascular ring repair. All patients who went on pump required cross-clamping and about a quarter
of the patients in the cohort required DHCA for their repair. Delayed sternal closure was
undertaken in 16 (26.7%). There were two operative deaths. One was a 1.4-kg premature baby
who had DORV and a large PDA with significant over-circulation. He underwent PDA ligation
but died of extreme prematurity-related complications. The second was a term neonate with
DORV/AV canal and pulmonary atresia who underwent systemic-pulmonary shunting. The child
developed sepsis-related multi-organ failure 22 days post-surgery. There were 40 (67%) patients
that experienced a major morbidity event. This was primarily driven by unplanned non-cardiac
re-intervention, in the form of feeding tube placement in more than half of the patients. There
was a 15% rate of unplanned cardiac re-intervention. Median post-operative ventilator days was
2.0 (IQR 1.0 – 4.0) and ICU stay of 6 (IQR 3.0 – 10.0) days, whereas median hospital stay was
17 days (IQR 8.0 – 35.0).
To assess the impact of CL/P on CHD management, we sought to compare surgical
outcomes between CHD+CL/P patients and CHD lesion-matched patients without CL/P,
managed surgically at our institution over the same time-period. This analysis included two CHD
procedures usually performed in the neonatal period (Truncus and d-TGA) and two during
infancy (VSD, TOF/DORV) (Table 4). The presence of CL/P did not impact the duration of
bypass or cross-clamp, as expected. There was also no significant difference in mortality.
However, median ICU stay was 2 to 3.7-fold longer in patients with CL/P (statistically
significant in all sub-types), and median hospital stay was 1.8 to 2.6-fold longer (statistically
significant in all but VSD). Major morbidity was 6 to 13.5-fold higher in CL/P group
(statistically significant in all but Truncus). The individual morbidity events in the CL/P cohort
included unplanned non-cardiac intervention (placement of surgical feeding tube 8 (22%),
airway evaluation/intervention 4 (11%)), post-operative mechanical support 2 (6%), and
diaphragm plication, pacemaker implantation, thoracic duct ligation and re-operation for
bleeding in 1 (3%) patient each. In contrast, in patients without CL/P, there were 102 morbidity
events in 60 (3.9%) patients. This included 47 (3%) unplanned non-cardiac interventions (37
17
(2.3%) surgical feeding tube placement), 26 (1.6%) unplanned cardiac interventions, 13 (0.8%)
re-operation for bleeding, 7 (0.4%) pacemaker implantation, and 9 others.
Follow-up data
The longitudinal outcome data following cardiac surgery in the CHD+CL/P cohort are
shown in Table 5. The median duration of follow-up was 1.8 years (IQR 0.2 – 4.9). There were
no deaths during follow-up. Overall, 10 (16.7%) patients underwent twelve surgical re-
interventions at a median 6.9 years (IQR 2.4 – 11.0) from initial intervention. These included
five RV-PA conduit exchanges, one pulmonary valve replacement, four RVOT reconstructions,
one valve sparing aortic root repair, and one Bentall procedure. No patient had significant
unplanned residual lesions at last follow-up.

4.0 DISCUSSION
CHD remains the most common birth defect in the United States. While CHD frequently
exists as an isolated lesion, it can occur in conjunction with other extra-cardiac abnormalities.
Recent studies have investigated the clinical impact of extra-cardiac malformations in CHD
patients. Collectively, these reports have shown that in addition to increasing the burden of
surgical interventions, extra-cardiac anomalies also elevate the risk for unplanned reoperation,
expanded resource utilization, and reduced overall survival following cardiac surgery.
13-14

Though informative, the inclusion of heterogeneous patient cohorts with variable non-cardiac
lesions has precluded the ability to evaluate the clinical impact of specific extra-cardiac
anomalies in CHD patients. Given the growing interest in developing more personalized
prognostic and therapeutic approaches to children with CHD, efforts to understand the influence
of specific extra-cardiac malformations on CHD management are of intrinsic scientific merit.
Our center has established expertise in the care of both pediatric cardiac and craniofacial
lesions, thus providing a relatively large cohort of patients with concomitant CHD and cleft
malformations. Cleft defects are seen in only a small proportion of CHD patients; conversely,
our analysis has revealed that the prevalence of CHD in cleft patients is about 14-fold greater
than that observed in the general population.
11
One potential explanation for the enrichment of
18
CHD in CL/P patients is that these disease processes manifest as part of a larger genetic
syndrome. In support of this notion, cleft and cardiac anomalies are described features in several
genetic disorders, including 22q11 deletion (DiGeorge/Velocardiofacial) and CHARGE
syndromes. In our own series, over half of the patients were diagnosed with a defined syndrome
or known genetic defect, and 48% of patients had at least one more congenital anatomic
abnormality, implicating a more global developmental derangement. That said, the causative
mechanisms for at least one half of this cohort of CHD+CL/P patients remain unexplained by
traditional genetic defects. With recent advancements in next generation and single cell
sequencing platforms, unbiased genomic analyses in non-syndromic CHD+CL/P cohorts may
help uncover novel genetic and molecular etiologies in these patients.
Another approach to understanding disease pathogenesis in CHD+CL/P patients is to
investigate molecular derangements in niche patient subsets. To specifically address this
approach, we began by characterizing the distribution of CHD phenotypes in patients with CL/P.
We found that the overrepresentation of CHD in this population is driven by selective
enrichment of a subset of cardiac lesions, resulting in a profile of cardiac phenotypes in cleft
patients that differs from that of the general CHD population (Figure 1). We interpret the higher
prevalence of ASD in this cohort to represent a screening bias. This broad diagnosis likely
includes a significant number of patent foramen ovale and lesions of limited hemodynamic
significance, as evidenced by the fact that a large proportion of patients with “ASD” have not
required any intervention to date. The next set of overrepresented cardiac lesions include
TOF/DORV, aortic arch abnormalities, and truncus arteriosus, all of which are outflow tract or
conotruncal anomalies. During cardiac development, both outflow tracts and the proximal aortic
arch develop from the same set of second heart field cardiac progenitor cells that arise in the
pharyngeal mesoderm.
15
These second heart field cells are known to interact with cardiac neural
crest cells during the patterning and morphogenesis of the outflow tract. Therefore, the selective
enrichment of various types of conotruncal anomalies suggests that common cellular or
molecular events concurrently orchestrate the maturation processes that govern craniofacial and
cardiac outflow tract development. TAPVR was also more prevalent in this cohort. Pulmonary
veins develop at the venous or inflow pole of the developing heart, and hence, it is conceivable
that a different set of overlapping molecular pathways are involved in craniofacial and
pulmonary venous development.
19
We then sought to analyze the clinical impact of these concomitant defects. As would be
expected, the presence of CHD increases the complexity of caring for patients with CL/P. Along
these lines, our previous work has shown that a significant additional resource burden is required
to care for CL/P patients who also harbor heart defects.
11
The current study adds additional
perspective to this finding. The overwhelming majority of patients who required surgical
intervention for their cardiac lesion underwent CHD repair roughly six months prior to cleft lip
repair or 1.4 years prior to cleft palate repair. This difference in time-interval represents
contemporary practice patterns to undertake cleft lip repair during infancy and cleft palate repair
during the second and third years of life. Patients who underwent neonatal cardiac repair had
lesions such as truncus arteriosus, HLHS, arch hypoplasia, etc. that would have generally
precluded survival without intervention. Patients with progressively cyanotic lesions (TOF) or
significant VSD causing failure to thrive underwent surgery within the first few months of life.
Thus, at least in the western world, by the time a child is being considered for cleft repair, it is
highly likely that complex and/or cyanotic CHD has been addressed. In contrast, when cleft care
is provided in areas of the world with more limited access to medical care, our data can be used
to direct examination to rule out the more complex heart defects of relevance in this patient
population.
Our data show that the majority of patients requiring surgical intervention for their CHD
will have unrepaired CL/P at the time of their cardiac surgery. In this regard, cleft disease differs
from other congenital anomalies, such as tracheoesophageal fistula or congenital diaphragmatic
hernia. The STS CHSD mortality risk model has traditionally included non-cardiac anatomic
abnormalities as a binary all-or-none variable, without regard to the exact nature of the defect.
16

A more recent analysis clearly demonstrated that the associated mortality risk varied based on
the individual non-cardiac abnormality, such that an enhanced model that utilized the individual
non-cardiac defects, as opposed to a generic binary variable, was more discriminatory.
17
Cleft
disease was not one of the seven defects analyzed in that study, and our current results would
concur that concomitant CL/P does not confer an additional mortality risk. However, compared
to contemporary lesion-matched patients undergoing cardiac surgery at our institution without
cleft malformations, the presence of concomitant CL/P was associated with longer intensive care
unit and hospital stay and increased morbidity. Cleft disease brings unique challenges to patient
care, without directly affecting cardiac physiology. The difficulty with securing and managing
20
the airway can be particularly problematic in these patients, forcing a deviation from routine
institutional practices with ventilator, and potentially inotropic, management. We speculate that
this underlies the longer intensive care unit stay observed in these patients. In addition, among
the neonates in our cohort, three patients required re-intubation and unplanned airway
intervention in the post-operative period, contributing to increased morbidity events. Similarly,
feeding issues are further complicated by cleft disease, especially in a neonate who has
undergone major cardiac surgery. Patients with cleft disease require specific alterations to
feeding approaches, including the need for modified nipples and duration and frequency of
feeding. Consequently, maintaining adequate nutrition is often more challenging in this patient
population. Given the additional difficulties with establishing and safely maintaining access with
nasoenteral tubes in these patients, our institutional preference favors early placement of enteral
feeding tubes. Our data reflect this practice, as over half of the CHD+CL/P patients in this series
underwent enteral feeding tube placement, another unplanned non-cardiac intervention. The
requirement for these focused additional efforts to ensure adequate nutrition is likely responsible
for the prolonged hospital stay noted in this cohort of patients. Stated differently, our work
suggests that the primary driver of increased morbidity and hospital stay in CL/P patients is the
need for unplanned non-cardiac interventions, including feeding tube placement and airway
interventions. As the STS CHSD transitions to a composite risk model that includes morbidity
and length of stay outcomes,
18
the impact of associated non-cardiac defects like CL/P will gather
greater relevance, and it is in this regard also that we believe work such as ours is significant.
The current study suffers from limitations inherent to any retrospective observational
analysis. First, all patients included in this study were managed at the same institution.
Therefore, the demographic findings presented here are subject to selection bias and would need
to be generalized with caution. The outcome measures described are also heavily influenced by
institutional process measures, such as duration of intubation, decision to place enteral feeding
tube, etc. While there is internal consistency between our comparison groups, direct
extrapolation to centers with different practice patterns may not be feasible. In addition, although
our cohort includes a relatively large series of patients with concomitant CHD+CL/P, the sample
size is still limited, particularly with respect to individual CHD lesions, and additional studies
across multiple centers are warranted. Finally, our short follow-up precludes evaluation of long-
term outcomes.
21
In conclusion, our work demonstrates that the overrepresentation of CHD in patients with
CL/P is primarily driven by enrichment of cardiac outflow tract defects. From a clinical
perspective, the presence of concomitant CL/P was found to increase the complexity of
postoperative care and length of stay in children undergoing surgery for CHD, without impacting
surgical mortality. Scientifically, the overrepresentation of cardiac outflow tract lesions in cleft
patients suggests that craniofacial and cardiac outflow tract morphogenesis share a common
developmental basis. Extrapolating from the evidence in the cardiac and craniofacial
developmental biology literature, one can infer that neural crest cells will likely occupy a central
role in the mechanism in the pathogenesis of these concomitant phenotypes. Additional genetic
sequencing analyses to identify candidate molecules and signaling pathways enriched in
CHD+CL/P patient cohorts will offer an important next step toward understanding the molecular
basis of these clinically relevant disease processes.

5.0 MATERIALS AND METHODS
This study is a retrospective analysis of patients diagnosed with combined congenital
heart disease and cleft lip and/or palate (CHD+CL/P) who were managed at Children’s Hospital
Los Angeles between January 2004 and December 2018. The study protocol was approved by
the Children’s Hospital Los Angeles Institutional Review Board.
Data collection
Patient demographics, operative characteristics, and follow-up data were collected from
medical records. To calculate the estimated birth prevalence for cardiac phenotypes in the
general CHD population, lesion specific incidence values were abstracted from data presented in
a previous study by Hoffman and colleagues.
1
The comparison cohort comprised of a
contemporary group of patients with CHD, but without CL/P, who underwent surgery for
designated CHD lesions at our institution between 2004-2018. Society of Thoracic Surgeons’
(STS) Congenital Heart Surgery Database (CHSD) criteria were used to define cardiac
diagnoses, genetic syndromes, chromosomal anomalies, and major morbidity.
12
Statistical analyses
22
All statistical analyses were performed using SAS version 9.4 software (SAS Institute
Inc., Cary, NC). Categorical data were presented as frequency counts and percentages and
analyzed by chi-square or Fisher’s exact tests. Continuous data were presented as medians with
interquartile ranges (IQR). Non-normally distributed continuous variables were analyzed by
Wilcoxon rank-sum tests. All statistical tests were two-sided with significance defined as p <
0.05.

23
6.0 TABLES AND FIGURES
Table 1. Demographic characteristics of CHD+CL/P patients.
No. (%)
Characteristic Total Cohort (n=127)
Sex
Male 63 (49.6)
Female 64 (50.4)
Prematurity 25 (19.7)
Family history of CHD 6 (4.7)
Cleft diagnosis
iCL 7 (5.5)
iCP 65 (51.2)
Combined CL/P 55 (43.3)
Genetic syndrome 65 (51.2)
Non-cardiac anatomic abnormalities* 61 (48.0)
*Refers to non-cleft anatomic abnormalities. Abbreviations: iCL, isolated cleft lip; iCP, isolated
cleft palate

24
Table 2. Sequence of surgical interventions for all CHD+CL/P patients (n=127).

Surgical interventions
No. (%)
Total Cohort (n=127)
Type of surgery
CHD only 13 (10.2)
CL/P only 64 (50.4)
CHD and iCL 6 (4.7)
CHD and iCP 26 (20.5)
CHD and CL/P 18 (14.2)
First lesion repaired
CHD 58 (45.7)
CL 34 (26.8)
CP 35 (27.6)
Interval between CHD and CL repair, days* 199 (117.8 - 238.3)
Interval between CHD and CP repair, days* 499 (367.0 - 1,526.0)
Interval between CL/P and CHD repair, days* 976 (632.0 - 3,072.0)
Age at first repair, days*
CHD 21.5 (6.3 - 113.8)
CL 157 (119.8 - 214.5)
CP 608 (415.0 - 1,657.0)
*Data expressed as median (interquartile range). Remaining data are represented as number
(percentage).

25
Table 3. Operative characteristics and outcomes for CHD+CL/P patients undergoing cardiac
surgery at our institution (n=60).
No. (%)
Operative variable Total Cohort (n=60)
Cardiac surgery prior to cleft intervention 55 (91.7)
Cardiopulmonary bypass utilized 39 (65.0)
Bypass time (min)* 57 (40.5 - 78)
Cross-clamp time (min)* 41 (34.5 - 50.8)
DHCA utilized 14 (23.3)
DHCA (min)* 29 (22.0 - 33.5)
Days on ventilator* 2 (1.0 - 4.0)
30-day mortality 2 (3.3)
Major morbidity
ECMO
Unplanned cardiac re-intervention
Phrenic nerve palsy
Pacemaker implantation
Surgical feeding tube placement
40 (66.7)
3 (5.0)
9 (15.0)
2 (3.3)
1 (1.7)
31 (51.7)
Post-operative ICU stay (days)* 6 (3.0 - 10.0)
Post-operative hospital stay (days)* 17 (8.0 - 35.0)
*Data expressed as median (interquartile range). Remaining data are represented as number
(percentage).

26
Table 4. Comparative data between CHD+CL/P patients and a cohort of lesion-matched CHD
patients without CL/P from our institution.

*Data expressed as median (interquartile range). Rest of data are number (percentage).
Abbreviations: CPB, cardiopulmonary bypass; ICU, intensive care unit; LOS, length of stay
27
Table 5. Longitudinal follow-up for CHD+CL/P patients that underwent cardiac surgery at our
institution (n=60).
No. (%)
Outcomes Total Cohort (n=60)
Follow-up period (years)* 1.8 (0.2 - 4.9)
Post-discharge mortality 0 (0.0)
Surgical interventions 10 (16.7)
RV-PA conduit/pulmonary valve replacement 6
RVOT reconstruction 4
Aortic valve re-intervention 2
Time to intervention (years)* 6.9 (2.4 - 11.0)
*Data expressed as median (interquartile range). Remaining data are represented as number
(percentage).

28
Figure 1. Distribution of CHD phenotypes in CL/P patients as compared to the general CHD
population.

29
Figure 2. Staged surgical management algorithm of CHD+CL/P patients (n=127).

30
Supplementary Figure 1. Complete clinical management algorithm for CHD+CL/P patients.

Lesion No. (%)
• AoV lesion 3 (2.4%)
• Arch (+/- VSD) 13 (10.2%)
• ASD 43 (33.9%)
• HLHS 1 (0.8%)
• PV lesion 3 (2.4%)
• TAPVR 3 (2.4%)
• TGA 4 (3.1%)
• TOF/DORV 20 (15.7%)
• Truncus 4 (3.1%)
• VSD 26 (20.5%)
• Other 7 (5.5%)
Lesion No. (%)
• Arch (+/- VSD) 12 (92.3%)
• ASD 2 (4.7%)
• HLHS 1 (100.0%)
• PV lesion 1 (33.3%)
• TAPVR 3 (100.0%)
• TGA 4 (100.0%)
• TOF/DORV 18 (90.0%)
• Truncus 4 (100.0%)
• VSD 11 (42.3%)
• Other 2 (28.6%)
Lesion No. (%)
• AoV Lesion 1 (33.3%)
• Arch (vasc. ring) 1 (7.7%)
• ASD 3 (7.0%)
Underwent
cardiac repair
(n=63, 49.6%)
Have not
undergone
cardiac repair
(n=64, 50.4%)
Total CHD + CL/P cohort
(n=127)
Cardiac repair
before CL/P surgery
(n=58, 92.0%)
Cardiac repair
after CL/P surgery
(n=5, 8.0%)
Lesion No. (%)
• AoV lesion 1 (33.3%)
• Arch (+/- VSD) 13 (100.0%)
• ASD 5 (11.6%)
• HLHS 1 (100.0%)
• PV lesion 1 (33.3%)
• TAPVR 3 (100%)
• TGA 4 (100%)
• TOF/DORV 18 (90.0%)
• Truncus 4 (100.0%)
• VSD 11 (42.3%)
• Other 2 (28.6%)
Lesion No. (%)
• AoV lesion 2 (66.6%)
• ASD 38 (88.4%)
• PV lesion 2 (66.6%)
• TOF/DORV 2 (10.0%)
• VSD 15 (57.7%)
• Other 5 (71.4%)
31
Supplemental Table 1. Table of abbreviations for demographic, clinical, and phenotypic
variables.
Abbreviation Definition
AoV aortic valve
Arch aortic arch hypoplasia/coarctation
ASD atrial septal defect
CHD congenital heart disease
CL/P cleft lip and/or cleft palate
CPB cardiopulmonary bypass
d-TGA d-transposition of the great arteries
DHCA deep hypothermic circulatory arrest
HLHS hypoplastic left heart syndrome
iCL isolated cleft lip
iCP isolated cleft palate
ICU intensive care unit
LOS length of stay
PDA patent ductus arteriosus
PV pulmonary valve
RV-PA right ventricle to pulmonary artery
RVOT right ventricular outflow tract
STS CHSD Society of Thoracic Surgeons congenital heart surgery database
TAPVR total anomalous pulmonary venous return
TOF/DORV tetralogy of Fallot/double outlet right ventricle
Truncus truncus arteriosus
VSD ventricular septal defect

32
7.0 REFERENCES
1. Hoffman JIE, Kaplan S. The incidence of congenital heart disease. J Am Coll Cardiol.
2002. doi:10.1016/S0735-1097(02)01886-7
2. Gilboa SM, Devine OJ, Kucik JE, et al. Congenital Heart Defects in the United States:
Estimating the Magnitude of the Affected Population in 2010. Circulation.
2016;134(2):101-109. doi:10.1161/CIRCULATIONAHA.115.019307
3. Ferencz C, Rubin JD, McCarter RJ, et al. Cardiac and noncardiac malformations:
Observations in a population-based study. Teratology. 1987.
doi:10.1002/tera.1420350311
4. Greenwood RD. Cardiovascular Malformations Associated with Extracardiac Anomalies
and Malformation Syndromes: Patterns for Diagnosis. Clin Pediatr (Phila). 1984.
doi:10.1177/000992288402300303
5. Egbe A, Lee S, Ho D, Uppu S, Srivastava S. Prevalence of congenital anomalies in
newborns with congenital heart disease diagnosis. Ann Pediatr Cardiol. 2014.
doi:10.4103/0974-2069.132474
6. Geis N, Seto B, Bartoshesky L, Lewis MB, Pashayan HM. The prevalence of congenital
heart disease among the population of a metropolitan cleft lip and palate clinic. Cleft
Palate J. 1981.
7. Milerad J1, Larson O, PhD D, Hagberg C IM. Associated Malformations in Infants With
Cleft Lip and Palate A Prospective, Population-based Study. Pediactrics. 1997.
doi:10.1542/peds.100.2.180
8. Barbosa MM, Rocha CMG, Katina T, Caldas M, Codorniz A, Medeiros C. Prevalence of
congenital heart diseases in oral cleft patients. Pediatr Cardiol. 2003.
doi:10.1007/s00246-002-0335-9
9. Kasatwar A, Borle R, Bhola N, K R, Prasad GSV, Jadhav A. Prevalence of congenital
cardiac anomalies in patients with cleft lip and palate – Its implications in surgical
33
management. J Oral Biol Craniofacial Res. 2018;8(3):241-244.
doi:10.1016/j.jobcr.2017.09.009
10. Munabi NCO, Swanson J, Auslander A, Sanchez-Lara PA, Davidson Ward SL, Magee
WP. The Prevalence of Congenital Heart Disease in Nonsyndromic Cleft Lip and/or
Palate. Ann Plast Surg. 2017;79(2):214-220. doi:10.1097/SAP.0000000000001069
11. Azadgoli B, Munabi NCO, Fahradyan A, et al. Congenital Heart Disease in Patients with
Cleft Lip/Palate and its Impact on Cleft Management. The Cleft Palate-Craniofacial
Journal. 2020;57:957-66. doi:10.1177/1055665620924915.
12. Jacobs ML, O'Brien SM, Jacobs JP, et al. An empirically based tool for analyzing
morbidity associated with operations for congenital heart disease. J Thorac Cardiovasc
Surg. 2013;145:1046-57. doi:10.1016/j.jtcvs.2012.06.029.
13. Alsoufi B, McCracken C, Oster M, Shashidharan S, Kanter K. Genetic and Extracardiac
Anomalies are Associated with Inferior Single Ventricle Palliation Outcomes. Ann
Thorac Surg. 2018;106(4):1204-12. doi:10.1016/j.athoracsur.2018.04.043.
14. Patel A, Costello JM, Backer CL, et al. Prevalence of Noncardiac and Genetic
Abnormalities in Neonates Undergoing Cardiac Operations: Analysis of The Society of
Thoracic Surgeons Congenital Heart Surgery Database. Ann Thorac Surg.
2016;102(5):1607-14. doi:10.1016/j.athoracsur.2016.04.008.
15. Vincent S D, Buckingham ME. How to make a heart: the origin and regulation of cardiac
progenitor cells. Curr Top Dev Biol. 2010; 90:1-41. doi:10.1016/S0070-2153(10)90001-
X.
16. O'Brien SM, Jacobs JP, Pasquali SK, et al. The Society of Thoracic Surgeons Congenital
Heart Surgery Database Mortality Risk Model: Part 1-Statistical Methodology. Ann
Thorac Surg. 2015;100(3):1054-62. doi:10.1016/j.athoracsur.2015.07.014.
17. Jacobs JP, O'Brien SM, Hill KD, et al. Refining The Society of Thoracic Surgeons
Congenital Heart Surgery Database Mortality Risk Model With Enhanced Risk
Adjustment for Chromosomal Abnormalities, Syndromes, and Noncardiac Congenital
34
Anatomic Abnormalities. Ann Thorac Surg. 2019;108:558-66.
doi:10.1016/j.athoracsur.2019.01.069.
18. Pasquali SK, Shahian DM, O'Brien SM, et al. Development of a Congenital Heart
Surgery Composite Quality Metric: Part 1-Conceptual Framework. Ann Thorac Surg.
2019;107:583-9. doi:10.1016/j.athoracsur.2018.07.037.

35
C h a p t e r 3:
GENOMIC SEQUENCING IMPLICATES WNT/PLANAR CELL
POLARITY PATHWAY SIGNALING IN THE DEVELOPMENT OF
CONCOMITANT CONGENITAL CARDIAC AND CLEFT
MALFORMATIONS IN HUMANS

1.0 ABSTRACT
Background: We previously demonstrated that patients with cleft lip and/or palate (CL/P) are at
high risk for the development of concomitant congenital heart disease (CHD), particularly
defects of the cardiac outflow tract. Despite a strong phenotypic association between congenital
cardiac and cleft malformations, the molecular genetics underlying these concomitant disease
processes remains unclear. The aim of this study was to perform genomic sequencing to identify
pathogenic gene variants and associated signaling pathways enriched in patients with
concomitant CHD+CL/P.
Methods: Patients with CHD+CL/P managed at our institution between January 2004 and
December 2018 were evaluated by a multidisciplinary team comprised of a medical geneticist,
cardiothoracic surgeon, plastic surgeon, and craniofacial biologist. Patients with concomitant
outflow tract defects and CL/P, and no previously known genetic mutations or positive findings
on chromosomal microarray were identified. Whole blood specimens were collected from
patients and their unaffected (phenotypically normal) parents, DNA was extracted, and whole
genome sequencing was performed. Demographic and clinical data were retrospectively
collected from patient records. Gene ontology and pathway analysis was performed using
PANTHER and DAVID databases and was reinforced with a primary literature search.
Functional assessment of variants related to non-canonical Wnt signaling was performed through
siRNA-mediated knockdown and wound-healing assays in murine myoblasts.
Results: Of the 127 CHD+CL/P patients evaluated, 40 were found to meet inclusion criteria and
were contacted by our study team. A total of 20 proband-parent trios consented to be involved in
36
the study. Three parents were lost to contact or otherwise unable to provide a blood specimen for
sequencing, resulting in 17 trios and 3 dyads for final analysis. There was a high prevalence of
loss-of-function de novo gene mutations identified within the CHD+CL/P patient cohort,
including in genes previously shown to be important for heart development (CHD7, MYH6,
SMARCA4). Three genes were found to be mutated in more than one patient (CHD7, CELSR3,
SAPCD2). Gene ontology and pathway enrichment analysis demonstrated that mutated genes
were principally involved in regulating molecular and transcriptional function, binding, and Wnt-
signaling. siRNA-mediated knockdown of Wnt/planar cell polarity (PCP) signaling genes
SAPCD2, CELSR3, and CCDC88C in murine myoblasts resulted in disrupted cellular migration
by in vitro wound-healing assay, validating the biologic functionality of these gene candidates.
Conclusions: This study is the first to characterize the genomic profile of patients with
concomitant CHD+CL/P. The identification of an excess of de novo deleterious mutations in
genes involved in transcriptional regulation and Wnt-pathway signaling suggests that these
molecular processes play a crucial role in CHD+CL/P disease pathogenesis. Reverse
translational modeling of the dominant genetic or phenotypic defects described here may help
advance efforts to understand the molecular mechanisms underlying clinical CHD+CL/P.

37
2.0 INTRODUCTION
Cleft Lip and/or Palate (CL/P) is the most common congenital birth defect of the head
and neck, with an incidence of 1 in 700 live births.
1,2
While approximately 70% of CL/P patients
are not found to have an identifiable syndrome on genetic evaluation, cleft patients exhibit
considerably higher rates of coexisting congenital anomalies compared to the general
population.
3-5
Congenital heart disease (CHD) accounts for more than one-third of all associated
anomalies in cleft patients.
6-7
The strong correlation between congenital CL/P and CHD
phenotypes in the clinic reinforces the notion that these two phenotypes may share a common
developmental or molecular origin. Understanding the developmental events that result in
coexisting birth defects, such as CHD and CL/P, is not only important for accurately determining
the underlying mechanisms of disease, but it may also serve to improve prognostic and
therapeutic efforts in these niche populations.
The relationship between cleft and cardiac defects in the context of specific genetic
syndromes is well established. Some of the more prevalent genetic syndromes in which
concomitant congenital cleft and cardiac defects are a known feature include Apert syndrome,
Coloboma, Heart defects, Atresia of the choanae, Retardation of growth and development, and
Ear abnormalities and deafness (CHARGE syndrome), Pierre Robin sequence, and 22q11.2
deletion (DiGeorge syndrome).
8
In addition to the phenotypic association between cleft and
cardiac malformations in these select syndromic contexts, our previous work has described a
similar relationship between cardiac and cleft lesions in non-syndromic patients as well. We
previously showed that non-syndromic CL/P patients experienced a 14-fold greater birth
prevalence of CHD than observed in the general population.
9
We also demonstrated that the
presence of cleft and cardiac lesions adversely impacts the surgical management of the other.
9-10

However, despite a highly clinically relevant association, the molecular and genetic basis of
combined CHD and CL/P in patients without an identifiable genetic syndrome is largely
unknown.
Previous studies led by the Pediatric Cardiac Genomics Consortium (PCGC) have
demonstrated the utility of trio-based genomic sequencing as a validated method to gain insights
into the genetic etiology of CHD.
11
This approach of sequencing CHD patients and their
38
unaffected parents has led to the identification of multiple candidate genes and associated
pathways with implications in CHD pathogenesis.
12-15
Therefore, to better understand the
mechanisms underlying the development of concomitant non-syndromic CL/P+CHD, we
pursued a similar strategy of whole genome sequencing of patient-parent trios. The goal of this
effort was to identify rare de novo genetic mutations associated with patients with non-
syndromic CL/P and outflow tract defects. We focused our analysis to include only patients
diagnosed with outflow tract defects and cleft malformations, as these were the most
significantly correlated phenotypes in our CHD+CL/P cohort. We hypothesize that genomic
profiling of concomitant CL/P and outflow tract CHD patients will identify pathogenic gene
mutations in signaling pathways with overlapping importance in palatal and heart development,
reflecting the shared molecular basis for these phenotypes.

3.0 RESULTS
CHD+CL/P proband characteristics
Demographic and phenotypic characteristics of the proband cohort are summarized in
Table 1. Our cohort comprised of a total of 20 probands and their unaffected parents. No parents
described a clinical history significant for the diagnosis or treatment of congenital cardiac or cleft
disease. There was a balanced representation of sex across probands, with 10 (50%) males and
10 (50%) females included in this analysis. The most commonly diagnosed outflow tract defect
among probands was Tetralogy of Fallot/Double outlet right ventricle (TOF/DORV, n=12, 60%).
This was followed by aortic arch defects +/- ventricular septal defects (Arch +/- VSD, n=7, 35%)
and persistent truncus arteriosus (TA, n=2, 5%). This phenotypic distribution of cardiac defects
is consistent with the profile of enriched CHD among cleft patients more generally.
In addition to the major cardiac outflow tract phenotypes, we observed additional cardiac
lesions of note in these patients. The most commonly associated cardiac lesion identified by
echocardiography in the proband cohort was atrial septal defect/patent foramen ovale
(ASD/PFO, n=6, 30%). As expected, most of these lesions were found to be clinically
insignificant and spontaneously closed without intervention. There was a total of 4 (33%)
TOF/DORV probands that were found to have associated pulmonary atresia, reflecting a severe
39
malalignment defect. In addition, three (43%) probands with Arch +/- VSD also exhibited
bicuspid aortic valve phenotypes, which is known to be associated with arch abnormalities.
These additional cardiac defects demonstrate that even among a niche cohort of CHD+CL/P
patients, significant phenotypic heterogeneity with respect to cardiac lesions may still be
observed.
Genetic variant analysis
For genetic variant analysis, we prioritized functionally impactful variants following a
known Mendelian disease model. We identified high confidence variants for additional analysis
by filtering SnpEff annotated Haplotype Caller VCFs for read quality, read depth, variant
functional effect, modes of inheritance across trios, and prevalence in population databases. We
classified de novo variants as those identified in probands and not their unaffected parents. We
defined rare variants as those found in less than one percent of the 1000 Genomes phase 3 or
gnomAD (version 2) populations or within the gnomAD, consistent with methodology applied in
previous studies. Variants with a quality score above 500 were investigated for significance and
pathogenicity leveraging dbNSFP and Clinvar databases.
With this approach, we identified a total of 28 rare de novo variants among CHD+CL/P
probands that were predicted to alter protein function of their respective genes. The gene
symbols, variants effects, and variant classes for these mutations are summarized in Table 2.
Overall, we identified 20 missense mutations, 6 nonsense mutations resulting in the generation of
a premature stop codon within the translated protein, 1 nonsense mutation in a predicted splice
site, and 1 nonsense mutation resulting in a frameshift event. Interestingly, four probands (20%)
were found to have a mutation in CHD7, which is known to be associated with CHARGE
syndrome. In addition to CHD7, two other genes were found to be mutated in more than one
proband. These include Cadherin EGF LAG Seven-Pass G-type Receptor 3 (CELSR3) and
Suppressor of APC Domain Containing 2 (SAPCD2), both known to be associated with the Wnt-
signaling pathway. Additional variants identified in dyads are listed in Supplemental Table 1.
Gene ontology and pathway enrichment analysis
40
To better understand the molecular function and signaling pathways associated with these
variants, we performed gene ontology and pathway enrichment analysis using Protein ANalysis
THrough Evolutionary Relationships (PANTHER) and Database for Annotation, Visualization,
and Integrated Discovery (DAVID) web-based software.

Predictive analysis of variant functions
demonstrated that the majority of variants were involved in binding (38.1%) or the regulation of
molecular function (28.6%). The most commonly described protein classifications among the
loss-of-function variants included gene-specific transcription (30.8%) and nucleic acid
metabolism (15.4%). The importance of appropriate gene-specific transcription and regulation of
gene expression has been consistently demonstrated in other studies of CHD pathogenesis. With
respect to cellular signaling pathways, non-canonical Wnt signaling was the most frequently
associated pathway among mapped variants. Other molecular functions, protein classifications,
and pathways of relevance are shown in Figure 1.
Functional assessment of Wnt/PCP genes by in vitro wound-healing assay
Previous studies have shown that the non-canonical Wnt/planar cell polarity signaling
pathway is critical for appropriate heart development. In particular, Wnt/PCP genes are known to
be important for cardiogenic progenitor migration and subsequent tissue morphogenesis. Wound
healing assays performed in cellular monolayers have served as a validated method of modeling
Wnt/PCP related cellular migration processes in vitro. Therefore, we decided to assess the
functionality of three of the Wnt/PCP genes identified in CHD+CLP probands by performing
siRNA-mediated knockdown and wound-healing assays in murine C2C12 myoblasts.
Genetic knockdown of SAPCD2, CELSR3, and CCDC88C (DAPLE) was performed in
C2C12 cells using 20nM of each respective siRNA. This concentration was determined to be the
optimal dose for gene knockdown in myoblasts via a dose-response analysis (Supplemental
Figure 1). Following knockdown, a scratch was made with a sterile p-10 pipette, generating a
wound of similar size in each condition (Figure 2). Fourteen hours following wound creation,
cellular migration and wound-repopulation area was found to be significantly reduced in each
knockdown condition. Staining for phalloidin actin proteins demonstrated that myoblasts in
Wnt/PCP knockdown conditions had significantly altered cytoachitecture, including a marked
absence of filopodia and lamellopodia observed in control myoblasts (Figure 2). Both the
41
migratory and cytological changes are consistent with expected phenotypes following altered
Wnt/PCP signaling.

4.0 DISCUSSION
Advances in next generation sequencing platforms have accelerated efforts to investigate
the genetic etiology of major congenital birth abnormalities. One methodologic approach has
been to identify de novo rare variant mutations overrepresented in patients with similar disease
processes through comparative whole exome sequencing of patient (cases) and their
phenotypically normal parents (controls). In contrast to conventional approaches aimed at
studying heritable elements of common and familial diseases, this methodology is based on the
rationale that the development of severe congenital birth abnormalities is attributable, at least in
part, to rare, sporadic mutations in genes largely intolerant to such events.
16,17
Moreover, until
recent decades, many children born with major congenital birth defects experienced considerably
high perinatal and infant mortality, limiting the ability to conduct these types of genetic studies.
18

Thus, it is not surprising that clinically driven improvements in overall survival for many forms
of complex congenital disease has accelerated interest in understanding the role that de novo
mutations play in their genetic etiology.
While trio-sequencing has been informative for exploring the genomic architecture
underlying different types of congenital defects, the yield of causative lesion-specific candidate
genes identified in this manner has been relatively small. For example, the work from multiple
large cohort, whole exome sequencing analyses indicate that de novo mutations serve as the
causative mechanism for about 10% of all comer CHD patients.
11
These findings have spurred
alternative approaches of performing genomic analyses in a pre-specified niche patient
populations, enriched either by homogeneous phenotypes or co-existing abnormalities. The
expectation is not only that the incidence of rare genetic defects would be higher in such a pre-
selected population, but also that the candidate pathways identified may be more likely to
provide insights into the molecular pathogenesis of disease. In support of this approach, when
CHD patients with concomitant neurodevelopmental abnormalities were selectively evaluated,
pathogenic de novo mutations were identified in almost one-third of patients.
19
More
42
importantly, the candidate genes identified in this cohort were found to be associated signaling
pathways of significant relevance to both brain and cardiac development.
19
Such work provides a
proof-of-concept that common genetic events may underlie correlated concomitant phenotypes in
the CHD population.
The aim of the present study was to apply this conceptual framework and experimental
methodology in the evaluation of gene mutations in patients with concomitant CHD and CL/P.
Our group was the first to show phenotypic enrichment of CHD in non-syndromic CL/P
patients.
7,9
We also previously reported that the high prevalence of CHD among cleft patients is
driven by the selective overrepresentation of cardiac OFT defects.
10
As a result, we hypothesized
that the enrichment of concomitant OFT CHD and CL/P phenotypes is likely a consequence of a
common molecular or developmental derangement. We therefore undertook the current analysis
to evaluate the prevalence of de novo genetic variants, and their associated pathways, in a small
inception cohort of patients with non-syndromic CL/P and outflow tract CHD. Prior to
sequencing, each of the twenty patients included in this study underwent evaluation by a clinical
geneticist. This evaluation process included a chromosomal microarray analysis to rule out
clinically verified genetic and syndromic causes of disease. Despite such stringent exclusion
criteria, all probands were found to harbor additional deleterious de novo mutations in genes, of
which most had predicted relevance in cardiac and/or palatal development. Therefore, despite the
small sample size included in this analysis, our work suggests that genomic sequencing of
targeted CHD patients in the clinical setting may have important diagnostic utility, particularly in
those with concomitant cleft disease.
One of the more interesting results of this analysis is the finding that four probands had
deleterious mutations in chromodomain helicase DNA binding protein 7 (CHD7). CHD7 is a
nuclear chromatin remodeler that modifies nucleosome positioning and chromatin architecture to
control downstream gene transcription.
20
Mutations in CHD7 are associated with Coloboma,
Heart defects, Atresia of the choanae, Retardation of growth and development, and Ear
abnormalities and deafness (CHARGE syndrome), which includes congenital heart defects
among its major diagnostic criteria.
21-23
In addition, sporadic CHD7 mutations have been
identified in other studies on CHD patients not known to have CHARGE syndrome,
underscoring the importance of CHD7 in heart development more broadly.
11
Preclinical studies
43
evaluating CHD7 mutations in the mouse have corroborated human sequencing data,
demonstrating that while global CHD7 deletion is embryonically lethal, heterozygous CHD7
mice exhibit a spectrum of cardiac defects.
24-27
Additional efforts to understand the tissue-
specific roles of CHD7 during heart development in the mouse have shown that the conditional
deletion of CHD7 in cardiogenic mesodermal progenitors (Mesp1-Cre) and neural crest cells
(Wnt1-Cre2) independently leads to outflow tract defects similar to those observed in our patient
cohort, including double outlet right ventricle (DORV), interrupted aortic arch, and common
arterial trunk (CAT).
28,29
In addition to heart development, both human and mouse studies have
also implicated CHD7 signaling mechanisms in craniofacial development and palatogenesis.
While cleft malformations are not among the major diagnostic criteria for CHARGE syndrome,
previous studies have identified pathogenic CHD7 mutations in cleft patient cohorts.
20,30
In the
mouse, both global heterozygous and neural crest cell-specific (Wnt1-Cre) CHD7 mutants
develop cleft palate with incomplete penetrance.
25,31
The evidence that CHD7 occupies an
important role in both cleft and cardiac development supports the causality of CHD7 mutations
in our cohort and suggests that concomitant CL/P and outflow tract CHD represent a variably
expressed phenotype of CHD7 mutations encountered in clinical practice.
In addition to CHD7, two additional genes (SAPCD2 and CELSR3) were found to be
mutated in multiple CHD+CL/P probands. To our knowledge, these genes have not yet been
described in other sequencing studies of CHD or cleft patient cohorts. Thus, to better understand
the biological role of these genes in embryonic development, we combined gene ontology and
pathway analysis with a primary literature search and found that these genes were predicted to be
associated with the Wnt-signaling pathway.
32,33
Other genes that have been implicated in
modifying the Wnt-signaling pathway include CCDC88C (DAPLE), VAX2, MED12,
SMARCA4, RNF213, ECEL1, NDST1, GIP3, and MTSS1.
34-40
Wnt-signaling is an
evolutionarily conserved pathway required for normal cardiac and palate development. While
canonical (beta-catenin dependent) Wnt signaling is necessary for the proliferative expansion
and differentiation of cardiac and palatal progenitor populations, non-canonical (beta-catenin
independent) Wnt signaling is required for polarized progenitor cell migration and tissue
morphogenesis in both systems.
41-43
We therefore sought to functionally validate the non-
canonical Wnt/PCP genes identified in this sample by assessing their impact on cellular
migration. We employed a wound-healing assay using cultured murine myoblasts, as this assay
44
has been used by others to model Wnt/PCP-related migratory defects in vitro.
44,45
Our data
demonstrate that siRNA-mediated knockdown of CELSR3, SAPCD2, and CCDC88C (DAPLE)
significantly inhibited myoblast migration. Moreover, in addition to perturbed migration,
knockdown myoblasts also exhibited altered cytological polarity and architecture, consistent
with primary Wnt/PCP defects. Taken together, the combined migratory, molecular, and
morphologic changes in myoblasts following CELSR3, SAPCD2, and CCDC88C (DAPLE)
knockdown provides preliminary functional evidence for some of the non-canonical Wnt
signaling genes identified in this sequencing analysis.
This study has many limitations related to its design and conduct. First, the small proband
sample size is a considerable limitation that precluded the ability to more rigorously study
different probability models of inheritance for variant calls. Expanding the sample size of
sequenced CHD+CL/P proband-parent cohorts is critical to validate the gene and pathway
candidates described here. In addition, despite strict inclusion criteria, the probands included in
this analysis maintained a significant degree of heterogeneity in outflow tract defects and
associated intra-cardiac lesions. It would be important to determine whether a greater level of
genetic or pathway concordance can be observed in cleft cohorts with more homogenous outflow
tract phenotypes (e.g. DORV+CL/P, CAT+CL/P, etc). Finally, because genomic variants were
identified through whole blood specimens it remains unclear whether specific genes or
downstream pathways were in fact aberrantly expressed in diseased cardiac or palatal tissues.
Future studies aimed at correlating genomic mutation events with tissue-specific transcriptomic
analyses will provide a more relevant assessment of the molecular consequences of these
mutations in target tissues.
In conclusion, this study reflects the first attempt to characterize the genetic profile of
patients with non-syndromic CHD+CL/P. Our genomic sequencing analysis of CHD+CL/P
patient-parent trios identified multiple de novo gene mutations in genes and associated pathways
with overlapping relevance in heart and palate development. This study affirms the utility of
performing unbiased genomic sequencing analyses in niche CHD patient cohorts with
concomitant developmental lesions and suggests that the pursuit of laboratory models of these
genetic events may provide additional insights into the molecular basis of concomitant
CHD+CL/P phenotypes.
45

5.0 MATERIALS AND METHODS
Patient selection
Retrospective review was performed of 575 patients who underwent surgery for CHD or
cleft lip and/or palate (CL/P) at Children’s Hospital Los Angeles between January 2004 and
December 2018. One hundred and twenty-seven (22.1%) were found to have a concomitant
diagnosis of CHD+CL/P. Patients underwent further review by a multidisciplinary team
including a medical geneticist, cardiothoracic surgeon, plastic surgeon, and craniofacial
biologist. Patients eligible for study inclusion had prior genetic testing with negative
chromosomal microarray analysis. Patients with a known genetic mutation or those without
outflow tract lesions were excluded. Of those with concomitant outflow tract CHD and CL/P,
forty patients (31.4%) were eligible and contacted for study participation.
Study design
Study design included a prospective trio sequencing analysis of patient cases (probands)
and unaffected biologic parents. Twenty patients with non-syndromic CL/P+CHD and their
unaffected parents agreed to participate and were consented for study participation. Patients
underwent a clinical facial examination and questionnaire interview. Whole blood samples were
collected for DNA and RNA extraction from patients and for DNA extraction from parents.
Three parents were unable to be contacted prior to sample collection, resulting in 17 trios and 3
dyads for final analysis. Additional demographic and clinical data were retrospectively collected
from patient records. IRB approval for this study was obtained from Children’s Hospital Los
Angeles and the University of Southern California.
Nucleic acid extractions and quality assessment
Whole blood was collected in PAXgene Blood DNA or RNA Tubes (Biosciences, La
Jolla, CA) and DNA was extracted using either PAXgene Blood DNA or RNA Kits (Qiagen,
Venlo, Netherlands) as appropriate and according to manufacturer recommendations. Both DNA
and RNA were assessed using the NanoDrop (Thermo Scientific, Waltham, MA), Qubit
46
(Invitrogen, Carlsbad, CA), and TapeStation (Agilent Technologies, Santa Clara, CA). Nucleic
acids had quality of DIN score >7.5 and RIN >6.
Whole genome library construction
500ng of DNA greater than 200bp was sheared in 130µL of nuclease-free water with the
Covaris E220 using the 96 microTUBE Plate (Covaris, Woburn, MA). DNA was quantified
using the High Sensitivity D1000 Screen Tape Assay (Agilent Technologies, Santa Clara, CA).
DNA libraries were prepared according to the KAPA Hyper Prep Kit (Roche, Basel,
Switzerland). Dual-indexed adapters were ligated to end-prepped and a-tailed DNA. The
prepared libraries were quantified using D1000 Screen Tape Assay (Agilent Technologies, Santa
Clara, CA).
RNA library construction
For RNA-sequencing, 200ng were heat fragmented to a target size of 180bp. Fragmented
molecules were used for library prep using the NEBNext® Ultra™ II Directional RNA Library
Prep Kit for Illumina (New England BioLabs, Inc., Ipswich, MA) NEBNext Poly(A) mRNA
Magnetic Isolation Module in accordance to manufacturer recommendations.
Whole genome sequencing
Each library was normalized to 5nM, pooled, and sequenced on NovaSeq 6000, using the
NovaSeq S4 300 cycles flow cell (Illumina, San Diego, CA) V1 chemistry. All sequencing reads
were converted using BCL2FASTQ v2.19.1.403. to generate industry standard FASTQs. High
resolution whole genome sequencing generated 207,681 Mb of data on average, 62.9x estimated
depth of coverage, and 95.1% of data above 20x. An average of 107.1 million uniquely mapped
RNA reads were generated of which 87.1% were assigned to mRNAs.
Data analysis
DNA sample FASTQs were aligned to GRCh37 (hs37d5) using BWA-MEM (v0.7.8).
Post-processing included base recalibration, duplicate read marking, and joint indel realignment
using GATK (v3.5.0). Germline variants and indels were obtained using GATK Haplotype
Caller, Samtools (v1.2) mpileup paired with BCFtools (v1.2). VCFs were annotated with SnpEff
47
(v3.5h), using a dbSNP (v137.b37) reference. Copy number analysis was completed using
tCoNuT (https://github.com/tgen/tCoNuT).
RNA sample FASTQs were aligned to GRCh37 (hs37d5) using STAR (v2.5.3a). Post-
processing included duplicate marking and splitting of N cigar reads with GATK Transcript
quantification was completed using Salmon (v0.7.2) with a GRCh37.74 hs37d5 GTF reference.
Cufflinks (v2.2.1) was used for isoform quantification. Sample alignment metrics for both DNA
and RNA were obtained using Picard Tools v(1.128) and Samtools stats. In addition, Picard
Tools GC coverage bias and hybrid-selection metrics were obtained for DNA.
During gene variant analysis, prioritization was given to functionally impactful variants
following a known Mendelian disease model. Briefly, to identify high confidence variants for
study, SnpEff annotated Haplotype Caller VCFs were filtered for read quality, read depth,
variant functional effect, modes of inheritance across trios, and prevalence in population
databases. Variants found in less than one percent of the 1000 Genomes phase 3 or gnomAD
(version 2) populations or within the gnomAD. Variants with a quality score above 500 were
investigated for significance and pathogenicity leveraging dbNSFP (version 3.2) and Clinvar
databases (04/2016). Protein ANalysis THrough Evolutionary Relationships (PANTHER)
classification system (http://www.pantherdb.org/), the Database for Annotation, Visualization,
and Integrated Discovery (DAVID) software (https://david.ncifcrf.gov/home.jsp), and a primary
literature review were all used to evaluate gene function, gene ontology, and associated
pathways.
In vitro wound-healing assay and immunocytochemistry
To evaluate the functionality of gene variants associated with Wnt/planar cell polarity
(PCP) signaling, a wound-healing assay was performed in C2C12 murine myoblast cell line
(ATCC Cat# CRL-1772). Cell monolayers were expanded in 75cm
2
Nunc
TM
EasYFlask cell
culture flasks (ThermoFisher Scientific, Cat# 156499) with standard media consisting of:
Dulbecco’s Modified Eagle’s Medium (DMEM), high glucose (4.5 g l−1), L-glutamine (2 mM)
(Corning, Cat# 10-017-CV), 10% Fetal bovine serum (FBS) (Fisher Scientific, Cat# W3381E),
and 1% penicillin-streptomycin (10,000 U ml−1 penicillin and 10,000 µg ml−1 streptomycin,
Fisher Scientific, Cat# W3470H).
48
Following expansion, C2C12 cells were added to 4-well Nunc
TM
Lab-Tek
TM
II Chamber Slide
TM

System (ThermoFisher Scientific, Cat# 154526). Cells were incubated for ~24-hour at 37
◦
C, 5%
CO
2
to allow for cellular attachment and appropriate cellular density. siRNAs targeting CELSR3,
SAPCD2, and CCDC88C (DAPLE) diluted to 20nM in lipofectamine RNAimax transfection
reagent (ThermoFisher Scientific, Cat# 13778075) were then added to each well containing cells
according to manufacturer protocols. Roughly 40-hours following transfection, C2C12 cells were
washed in 1xPBS and a wound was made using a sterile p-10 pipette tip. Immediately following
wound creation, warmed media was added into each well and bright field images were taken
(time 0). Following a 14-hours period for wound recovery, cells were again imaged (time =
14hrs). Cells were then rinsed in 1xPBS and underwent immunocytochemical staining for
phalloidin (Abcam, Cat# ab176753) using standard methods. For validation of gene knockdown
following siRNA transfection, total RNA was extracted using the Zymo Quick RNA Microprep
Kit (Zymo Research, Cat# R1050) and RT-PCR was performed using standard techniques. A list
of primers used to evaluate gene expression is shown in Supplemental Table 2.

49
6.0 TABLES AND FIGURES
Table 1. Demographic and cardiac phenotypic characteristics of CHD+CL/P probands.
Characteristic Total No. (%)
Sex
Male 10 (50)
Female 10 (50)
Cardiac outflow tract phenotype
Tetralogy of Fallot/double outlet right ventricle 12 (60)
Arch +/- ventricular septal defect 7 (35)
Truncus arteriosus 2 (5)
Additional cardiac defects
Atrial septal defect/patent foramen ovale 6 (30)
Atrioventricular valve insufficiency/stenosis 2 (10)
Bicuspid aortic valve 3 (15)
Patent ductus arteriosus 2 (10)
Pulmonary atresia 4 (20)
Right sided aortic arch 2 (10)

50
Table 2. Select de novo variants identified in CHD+CL/P probands through comparative trio
sequencing of both unaffected parents.
Gene name Variant effect Variant class
PLXNB1 p.E854K N-missense
CELSR3 p.M2630I C-missense
CHD7 p.Q1599X Nonsense (premature stop)
SLC32A1 p.Q331H N-missense
PLXND1 p.R1050S N-missense
SKIDA1 p.G17C C-missense
SIRT2 p.C44R N-missense
VAX2 p.S174Y N-missense
CCDC88C p.C4265T N-missense
GIP3 p.E2K N-missense
NECTIN1 p.A428D N-missense
CELSR3 p.L2190M C-missense
ZNF814 p.E297X Nonsense (premature stop)
ECEL1 p.R544C N-missense
CHD7 p.R1677X Nonsense (premature stop)
SAPCD2 p.R156G N-missense
CELF3 p.F71L C-missense
KCNK7 p.V137M C-missense
CHD7 p.W1966X Nonsense (premature stop)
GRHL2 p.Y566X Nonsense (premature stop)
TBC1D15 p.Q359K N-missense
SAPCD2 p.R156G N-missense
MTSS1L p.C615X Nonsense (premature stop)
FOXA2 p.P419T N-missense
NDST1 p.R745C N-missense
CHD7 p.G1857A Nonsense (splice site)
SMARCA4 p.R979Q N-missense
MED12 pC349fs Nonsense (frameshift)

51
Figure 1. Predicted (A) molecular functions, (B) protein classifications, and (C) associated
signaling pathways identified through gene ontology and pathway analysis of select de novo
variant mutations identified in CHD+CL/P patients.

50
16.7
16.7
16.7
Pathway
Wnt-cadherin signaling
Alzheimers Disease-presenilin
Axon guidance mediated by semaphorins
Endothelin signaling
30.8
15.4
7.7
7.7
7.7
7.7
7.7
7.7
7.7
Protein class
Gene-specific transcription
Nucleic acid metabolism
Cell adhesion molecule
Membrane traffic protein
Metabolite interconversion
Protein modifying enzyme
Protein-binding activity
38.1
28.6
14.3
9.5
9.5
Molecular function
Binding
Molecular function regulator
Catalytic activity
Molecular transducer activity
Transporter activity
a b
c
30.8
15.4
7.7
7.7
7.7
7.7
7.7
7.7
7.7
Protein class
Gene-specific transcription
Nucleic acid metabolism
Cell adhesion molecule
Membrane traffic protein
Metabolite interconversion
Protein modifying enzyme
Protein-binding activity
Scaffold/adaptor protein
Transporter
52
Figure 2. Functional assessment of Wnt/PCP-related genes CELSR3, SAPCD2, and CCDC88C
(DAPLE) by in vitro wound-healing assay. (A) Experimental timeline and design. (B)
Quantification of the repopulated area in control myoblasts and those with siRNA-mediated
knockdown of CELSR3, SAPCD2, CCDC88C (DAPLE) at 14-hours following wound creation.
(C) Bright field imaging of wound area showing limited repopulation in Wnt/PCP knockdown
conditions. (D) Immunocytochemical staining of phalloidin demonstrates absence of cytoplasmic
filopodia and lamellipodia and dysregulated cytoarchitecture of myoblasts following Wnt/PCP
gene knockdown.

53
Supplemental Figure 1. RT-PCR evaluating the relative expression of CELSR3, SAPCD2, and
CCDC88C (DAPLE) transcripts in C2C12 cells at various concentrations of siRNA. All cells
were treated with siRNA for a ~40-hour transfection period prior to RNA extraction. *Note that
the 5nM CCDC88C (DAPLE) siRNA sample was lost during processing and is not shown on the
graph.

0
0.2
0.4
0.6
0.8
1
1.2
CELSR3 SAPCD2 DAPLE
Relative mRNA expression
target siRNA knockdown efficiency
normalized to no siRNA
No siRNA
Target siRNA (5nM)
Target siRNA (20nM)
Target siRNA (100nM)
0
0.2
0.4
0.6
0.8
1
1.2
CELSR3 SAPCD2 DAPLE
Relative mRNA expression
siRNA knockdown normalized to no siRNA
No siRNA
Target siRNA (5nM)
Target siRNA (20nM)
Target siRNA (100nM)
*
54
Supplemental Table 1. Select de novo variants identified in CHD+CL/P probands through
comparative sequencing of only one parent.
Gene name Variant effect Variant class
RNF213 p.S738N C-missense
SETX p.D448G N-missense
JAG1 p.N1187S C-missense

55
Supplemental Table 2. Primers used for gene expression analysis to validate siRNA knockdown
efficiency.
Gene
name
Forward primer Reverse primer
GAPDH AGGTCGGTGTGAACGGATTTG TGTAGACCATGTAGTTGAGGTCA
CELSR3 CCCGGTACTACTGCTCCTTCT GACAAAGAGCTACGGCTCCA
SAPCD2 CCCGCTCCTAGTACAGAGGG CTACGAAACGCTCGAAGGTC
CCDC88C CGGCACCTCAGAGGGAGAT GCCCCTTTTGACATGGGGA

56
7.0 REFERENCES
1. Dixon MJ, Marazita ML, Beaty TH, Murray JC. Cleft lip and palate: understanding
genetic and environmental influences. Nat Rev Genet. 2011;12(3):167-78.
2. Mossey PA, Modell B. Epidemiology of oral clefts 2012: an international perspective.
Front Oral Biol. 2012;16:1-18.
3. Mossey, P. A. and Catilla, E. E. Global registry and database on craniofacial anomalies:
Report of a WHO Registry Meeting on Craniofacial Anomalies. 2003.
4. Kohli SS, Kohli VS. A comprehensive review of the genetic basis of cleft lip and palate.
J Oral Maxillofac Pathol. 2012;16(1):64-72.
5. Murthy J, Bhaskar L. Current concepts in genetics of nonsyndromic clefts. Indian J Plast
Surg. 2009;42(1):68-81.
6. Hoffman J. The global burden of congenital heart disease. Cardiovasc J Afr.
2013;24(4):141-5.
7. Munabi NCO, Swanson J, Auslander A, Sanchez-Lara PA, Davidson Ward SL, Magee
WP, 3rd. The Prevalence of Congenital Heart Disease in Nonsyndromic Cleft Lip and/or
Palate: A Systematic Review of the Literature. Ann Plast Surg. 2017;79(2):214-20.
8. Köhler S, Gargano M, Matentzoglu N, Carmody LC, Lewis-Smith D, Vasilevsky NA,
Danis D, Balagura G, Baynam G, Brower AM, Callahan TJ, Chute CG, Est JL, Galer PD,
Ganesan S, Griese M, Haimel M, Pazmandi J, Hanauer M, Harris NL, Hartnett MJ,
Hastreiter M, Hauck F, He Y, Jeske T, Kearney H, Kindle G, Klein C, Knoflach K,
Krause R, Lagorce D, McMurry JA, Miller JA, Munoz-Torres MC, Peters RL, Rapp CK,
Rath AM, Rind SA, Rosenberg AZ, Segal MM, Seidel MG, Smedley D, Talmy T,
Thomas Y, Wiafe SA, Xian J, Yüksel Z, Helbig I, Mungall CJ, Haendel MA, Robinson
PN. The Human Phenotype Ontology in 2021. Nucleic Acids Res. 2021;49(D1):D1207-
D1217.
57
9. Azadgoli B, Munabi NCO, Fahradyan A, Auslander A, McCullough M, Aflatooni N,
Davidson Ward SL, Kumar SR, Sanchez-Lara PA, Swanson J, Magee WP 3rd.
Congenital Heart Disease in Patients With Cleft Lip/Palate and Its Impact on Cleft
Management. Cleft Palate Craniofac J. 2020;57(8):957-966.
10. Toubat O, Mallios DN, Munabi NCO, Magee WP 3rd, Starnes VA, Kumar SR. Clinical
Importance of Concomitant Cleft Lip/Palate in the Surgical Management of Patients With
Congenital Heart Disease. World J Pediatr Congenit Heart Surg. 2021;12(1):35-42.
11. Zaidi S, Choi M, Wakimoto H, Ma L, Jiang J, Overton JD, Romano-Adesman A,
Bjornson RD, Breitbart RE, Brown KK, Carriero NJ, Cheung YH, Deanfield J, DePalma
S, Fakhro KA, Glessner J, Hakonarson H, Italia MJ, Kaltman JR, Kaski J, Kim R, Kline
JK, Lee T, Leipzig J, Lopez A, Mane SM, Mitchell LE, Newburger JW, Parfenov M,
Pe'er I, Porter G, Roberts AE, Sachidanandam R, Sanders SJ, Seiden HS, State MW,
Subramanian S, Tikhonova IR, Wang W, Warburton D, White PS, Williams IA, Zhao H,
Seidman JG, Brueckner M, Chung WK, Gelb BD, Goldmuntz E, Seidman CE, Lifton RP.
De novo mutations in histone-modifying genes in congenital heart disease. Nature.
2013;498(7453):220-3.
12. Jin SC, Homsy J, Zaidi S, Lu Q, Morton S, DePalma SR, Zeng X, Qi H, Chang W,
Sierant MC, Hung WC, Haider S, Zhang J, Knight J, Bjornson RD, Castaldi C, Tikhonoa
IR, Bilguvar K, Mane SM, Sanders SJ, Mital S, Russell MW, Gaynor JW, Deanfield J,
Giardini A, Porter GA Jr, Srivastava D, Lo CW, Shen Y, Watkins WS, Yandell M, Yost
HJ, Tristani-Firouzi M, Newburger JW, Roberts AE, Kim R, Zhao H, Kaltman JR,
Goldmuntz E, Chung WK, Seidman JG, Gelb BD, Seidman CE, Lifton RP, Brueckner M.
Contribution of rare inherited and de novo variants in 2,871 congenital heart disease
probands. Nat Genet. 2017;49(11):1593-1601.
13. Watkins WS, Hernandez EJ, Wesolowski S, Bisgrove BW, Sunderland RT, Lin E,
Lemmon G, Demarest BL, Miller TA, Bernstein D, Brueckner M, Chung WK, Gelb BD,
Goldmuntz E, Newburger JW, Seidman CE, Shen Y, Yost HJ, Yandell M, Tristani-
Firouzi M. De novo and recessive forms of congenital heart disease have distinct genetic
and phenotypic landscapes. Nat Commun. 2019;10(1):4722.
58
14. Glessner JT, Bick AG, Ito K, Homsy J, Rodriguez-Murillo L, Fromer M, Mazaika E,
Vardarajan B, Italia M, Leipzig J, DePalma SR, Golhar R, Sanders SJ, Yamrom B,
Ronemus M, Iossifov I, Willsey AJ, State MW, Kaltman JR, White PS, Shen Y,
Warburton D, Brueckner M, Seidman C, Goldmuntz E, Gelb BD, Lifton R, Seidman J,
Hakonarson H, Chung WK. Increased frequency of de novo copy number variants in
congenital heart disease by integrative analysis of single nucleotide polymorphism array
and exome sequence data. Circ Res. 2014;115(10):884-896.
15. Sevim Bayrak C, Zhang P, Tristani-Firouzi M, Gelb BD, Itan Y. De novo variants in
exomes of congenital heart disease patients identify risk genes and pathways. Genome
Med. 2020;12(1):9.
16. Veltman JA, Brunner HG. De novo mutations in human genetic disease. Nat Rev Genet.
2012;13(8):565-75.
17. Fuller ZL, Berg JJ, Mostafavi H, Sella G, Przeworski M. Measuring intolerance to
mutation in human genetics. Nat Genet. 2019;51(5):772-776.
18. Glinianaia SV, Morris JK, Best KE, et al. Long-term survival of children born with
congenital anomalies: A systematic review and meta-analysis of population-based
studies. PLoS Med. 2020;17(9):e1003356.
19. Homsy J, Zaidi S, Shen Y, Ware JS, Samocha KE, Karczewski KJ, DePalma SR,
McKean D, Wakimoto H, Gorham J, Jin SC, Deanfield J, Giardini A, Porter GA Jr, Kim
R, Bilguvar K, López-Giráldez F, Tikhonova I, Mane S, Romano-Adesman A, Qi H,
Vardarajan B, Ma L, Daly M, Roberts AE, Russell MW, Mital S, Newburger JW, Gaynor
JW, Breitbart RE, Iossifov I, Ronemus M, Sanders SJ, Kaltman JR, Seidman JG,
Brueckner M, Gelb BD, Goldmuntz E, Lifton RP, Seidman CE, Chung WK. De novo
mutations in congenital heart disease with neurodevelopmental and other congenital
anomalies. Science. 2015;350(6265):1262-6.
20. Zentner GE, Layman WS, Martin DM, Scacheri PC. Molecular and phenotypic aspects of
CHD7 mutation in CHARGE syndrome. Am J Med Genet A. 2010;152A(3):674-686.
59
21. Vissers LE, van Ravenswaaij CM, Admiraal R, Hurst JA, de Vries BB, Janssen IM, van
der Vliet WA, Huys EH, de Jong PJ, Hamel BC, Schoenmakers EF, Brunner HG,
Veltman JA, van Kessel AG. Mutations in a new member of the chromodomain gene
family cause CHARGE syndrome. Nat Genet. 2004;36(9):955-7.
22. Lalani SR, Safiullah AM, Fernbach SD, et al. Spectrum of CHD7 mutations in 110
individuals with CHARGE syndrome and genotype-phenotype correlation. Am J Hum
Genet. 2006;78(2):303-314.
23. Aramaki M, Udaka T, Kosaki R, Makita Y, Okamoto N, Yoshihashi H, Oki H, Nanao K,
Moriyama N, Oku S, Hasegawa T, Takahashi T, Fukushima Y, Kawame H, Kosaki K.
Phenotypic spectrum of CHARGE syndrome with CHD7 mutations. J Pediatr.
2006;148(3):410-4.
24. Van Nostrand JL, Brady CA, Jung H, Fuentes DR, Kozak MM, Johnson TM, Lin CY,
Lin CJ, Swiderski DL, Vogel H, Bernstein JA, Attié-Bitach T, Chang CP, Wysocka J,
Martin DM, Attardi LD. Inappropriate p53 activation during development induces
features of CHARGE syndrome. Nature. 2014;514(7521):228-32.
25. Bosman EA, Penn AC, Ambrose JC, Kettleborough R, Stemple DL, Steel KP. Multiple
mutations in mouse Chd7 provide models for CHARGE syndrome. Hum Mol Genet.
2005;14(22):3463-76.
26. Hurd EA, Capers PL, Blauwkamp MN, Adams ME, Raphael Y, Poucher HK, Martin
DM. Loss of Chd7 function in gene-trapped reporter mice is embryonic lethal and
associated with severe defects in multiple developing tissues. Mamm Genome.
2007;18(2):94-104.
27. Randall V, McCue K, Roberts C, et al. Great vessel development requires biallelic
expression of Chd7 and Tbx1 in pharyngeal ectoderm in mice. J Clin Invest.
2009;119(11):3301-3310.
60
28. Payne S, Burney MJ, McCue K, Popal N, Davidson SM, Anderson RH, Scambler PJ. A
critical role for the chromatin remodeller CHD7 in anterior mesoderm during
cardiovascular development. Dev Biol. 2015;405(1):82-95.
29. Yan S, Thienthanasit R, Chen D, Engelen E, Brühl J, Crossman DK, Kesterson R, Wang
Q, Bouazoune K, Jiao K. CHD7 regulates cardiovascular development through ATP-
dependent and -independent activities. Proc Natl Acad Sci U S A. 2020;117(46):28847-
28858.
30. Hughes SS, Welsh HI, Safina NP, Bejaoui K, Ardinger HH. Family history and clefting
as major criteria for CHARGE syndrome. Am J Med Genet A. 2014;164A(1):48-53.
31. Sperry ED, Hurd EA, Durham MA, Reamer EN, Stein AB, Martin DM. The chromatin
remodeling protein CHD7, mutated in CHARGE syndrome, is necessary for proper
craniofacial and tracheal development. Dev Dyn. 2014;243(9):1055-66.
32. Jiang J, Tang S, Xia J, Wen J, Chen S, Shu X, Huen MSY, Deng Y. C9orf140, a novel
Axin1-interacting protein, mediates the negative feedback loop of Wnt/β-catenin
signaling. Oncogene. 2018;37(22):2992-3005.
33. Goffinet AM, Tissir F. Seven pass Cadherins CELSR1-3. Semin Cell Dev Biol.
2017;69:102-110.
34. Aznar N, Sun N, Dunkel Y, Ear J, Buschman MD, Ghosh P. A Daple-Akt feed-forward
loop enhances noncanonical Wnt signals by compartmentalizing β-catenin. Mol Biol Cell.
2017;28(25):3709-3723.
35. Ishida-Takagishi M, Enomoto A, Asai N, Ushida K, Watanabe T, Hashimoto T, Kato T,
Weng L, Matsumoto S, Asai M, Murakumo Y, Kaibuchi K, Kikuchi A, Takahashi M.
The Dishevelled-associating protein Daple controls the non-canonical Wnt/Rac pathway
and cell motility. Nat Commun. 2012;3:859.
36. Vacik T, Stubbs JL, Lemke G. A novel mechanism for the transcriptional regulation of
Wnt signaling in development. Genes Dev. 2011;25(17):1783-95.
61
37. Liu W, Komiya Y, Mezzacappa C, Khadka DK, Runnels L, Habas R. MIM regulates
vertebrate neural tube closure. Development. 2011;138(10):2035-47.
38. Katoh M. GIPC gene family (Review). Int J Mol Med. 2002;9(6):585-9.
39. Griffin CT, Curtis CD, Davis RB, Muthukumar V, Magnuson T. The chromatin-
remodeling enzyme BRG1 modulates vascular Wnt signaling at two levels. Proc Natl
Acad Sci U S A. 2011;108(6):2282-7.
40. Scholz B, Korn C, Wojtarowicz J, Mogler C, Augustin I, Boutros M, Niehrs C, Augustin
HG. Endothelial RSPO3 Controls Vascular Stability and Pruning through Non-canonical
WNT/Ca(2+)/NFAT Signaling. Dev Cell. 2016;36(1):79-93.
41. Ho HYH, Susman MW, Bikoff JB, et al. Wnt5a-Ror-Dishevelled signaling constitutes a
core developmental pathway that controls tissue morphogenesis. Proc Natl Acad Sci U S
A. 2012;109(11):4044-4051.
42. Li D, Angermeier A, Wang J. Planar cell polarity signaling regulates polarized second
heart field morphogenesis to promote both arterial and venous pole septation. Dev.
2019;146(20).
43. Grigoryan T, Wend P, Klaus A, Birchmeier W. Deciphering the function of canonical
Wnt signals in development and disease: conditional loss- and gain-of-function mutations
of beta-catenin in mice. Genes Dev. 2008;22(17):2308-41.
44. Carvalho JR, Fortunato IC, Fonseca CG, et al. Non-canonical Wnt signaling regulates
junctional mechanocoupling during angiogenic collective cell migration. Elife.
2019;8:e45853.
45. Lutze G, Haarmann A, Demanou Toukam JA, Buttler K, Wilting J, Becker J. Non-
canonical WNT-signaling controls differentiation of lymphatics and extension
lymphangiogenesis via RAC and JNK signaling. Sci Rep. 2019;9(1):4739.

62
C h a p t e r 4:
NEURAL CREST CELLS ARE A NOVEL SOURCE OF PLANAR CELL
POLARITY SIGNALS TO THE SECOND HEART FIELD DURING
OUTFLOW TRACT MORPHOGENESIS IN THE MOUSE

1.0 ABSTRACT
Background: We previously showed that patients with concomitant congenital heart disease and
cleft palate (CHD+CP) harbor an excess of de novo mutations associated with the Wnt/planar
cell polarity (PCP) signaling pathway. Wnt5a is a primary ligand of Wnt/PCP signaling during
embryogenesis. While previous studies have shown that the global loss of Wnt5a results in
cardiac outflow tract and cleft malformations in the mouse, the exact identity of Wnt5a signal-
sending cells during heart development has not been fully elucidated. Therefore, to determine
whether neural crest cells (NCCs) serve as a developmentally relevant source of Wnt5a during
outflow tract morphogenesis, we evaluated the impact of NCC-specific conditional knock out of
Wnt5a in the mouse.
Methods: Wnt5a expression was assessed by situ hybridization (RNAscope) and lineage tracing
using Wnt5a-CreER mice. Conditional NCC- and SHF-specific knockout mice were generated
using Wnt1-Cre and Mef2c-Cre recombinase mouse lines, respectively. Cardiovascular
phenotypes were evaluated in control and mutant littermates by standard paraffin processing and
hematoxylin and eosin staining at embryonic day (E)14.5. To determine the effect that loss of
NCC-derived Wnt5a had on outflow tract length, India ink micropipette injections were
performed and outflow tract length was measured in control and mutant littermates at E10.5.
NCC and SHF progenitor cell migration and proliferation was assessed by immunofluorescence
staining at relevant time points. A transwell co-culture assay was developed to functionally and
molecularly model paracrine signaling interactions between NCCs and SHF cells in vitro. All
data were quantified using ImageJ software. Independent student t-tests or one-factor analysis of
variance (ANOVA) test for independent measures were used to statistically compare differences
between groups. All tests were two-sided and p<0.05 was considered statistically significant.
63
Results: Our results demonstrate that Wnt5a is expressed in post-migratory cardiac NCCs at
biologically relevant time points during outflow tract maturation. Conditional deletion of Wnt5a
from NCCs resulted in craniofacial defects and a fully penetrant double outlet right ventricle
(DORV) phenotype at E14.5. While NCC proliferation and migration was preserved in Wnt1-
Cre, Wnt5a conditional mutants, cranial pharyngeal SHF progenitor cells demonstrated reduced
migratory capacity into the outflow tract, a reduction in PCP markers, and poor overall cellular
organization. SHF migratory defects resulted in a 40% reduction in outflow tract length at E10.5
in NCC-mutants. Loss of NCC-derived Wnt5a did not impact SHF progenitor migration into the
inflow tract or the cranio-caudal extent of the splanchnic mesoderm, suggesting that NCC-
derived Wnt5a is not necessary for caudal SHF subpopulations contributing to inflow tract
morphogenesis. To confirm that NCCs provide paracrine PCP signals to SHF cardiomyoblasts,
we modeled this paracrine signaling event in a transwell, co-culture system using O9-1 NCCs
and C2C12 myoblasts. Small interfering RNA (siRNA)-mediated knockdown of Wnt5a in NCCs
significantly reduced myoblast migratory capacity and disrupted myoblast cytoplasmic
polarization and cytoarchitecture, consistent with PCP abnormalities observed in vivo.
Exogenous supplementation with recombinant Wnt5a (rWnt5a) rescued migratory and
morphologic defects in myoblasts in this co-culture system.
Conclusions: Our results demonstrate that NCC- and SHF-derived Wnt5a is critically required
for PCP signaling in SHF cells. While loss of NCC-derived Wnt5a reduces the polarized
migratory capacity of the cranial pharyngeal subpopulation of SHF cells that preferentially
contributes to the pulmonary outflow tract, loss of SHF-derived Wnt5a reduces migratory
capacity of more caudal splanchnic SHF cells. Our data not only provide novel insights into the
tissue-specific sources of Wnt5a during heart development, but also are the first to define a
paracrine role for post-migratory NCCs in regulating PCP in SHF cells. Future studies aimed at
understanding the mechanisms that regulate Wnt5a in neural crest cells are warranted.

64
2.0 INTRODUCTION
During embryonic development, the heart initially forms from cardiogenic progenitor
cells that originate in the lateral plate mesoderm.
1
These first heart field (FHF) cells migrate to
the embryonic midline and fuse to form a primitive linear heart tube.
1
Subsequently, a second
heart field (SHF) progenitor population is specified dorsal to the heart tube in the pharyngeal and
splanchnic mesoderm.
2,3
Elongation and looping of the heart tube is driven by the addition of
SHF progenitor cells to the arterial and venous poles of the heart.
2,3
At the arterial pole, anterior
SHF progenitors give rise to the right ventricle and cardiac outflow tract (OFT). The OFT begins
as a single arterial vessel that connects the right ventricle to bilaterally paired pharyngeal arch
arteries. Continued accretion of SHF progenitor cells into the OFT facilitates its elongation and
alignment, such that it is positioned above both the left and right ventricular chambers. At the
same time, cardiac neural crest cells (NCCs) migrating from the dorsal neural tube enter the
SHF-derived OFT and divide it into aortic and pulmonary arteries.
4,5
These coordinated
interactions between SHF cells and NCCs ultimately anatomically configure the aorta and
pulmonary artery to receive outflow from the left and right ventricles, respectively. As an
indication of the developmental complexity associated with SHF and NCC signaling events
during OFT maturation, epidemiologic analyses estimate that OFT defects comprise nearly one-
third of all congenital heart disease (CHD).
6

The Wnt signaling pathway is an evolutionarily conserved pathway with established
relevance in cardiac development. This pathway involves a diverse molecular network that
includes up to 19 ligands and multiple receptors, co-receptors, and downstream signal
transduction effectors.
7
While the canonical (beta-catenin dependent) branch of the Wnt
signaling pathway has been shown to promote proliferative expansion of cardiogenic progenitor
cell populations, non-canonical planar cell polarity (PCP) signaling has been predominately
implicated in orchestrating polarized migration of cardiogenic progenitors and tissue
morphogenesis.
8-11
Previous mouse studies have identified Wnt5a as a key ligand of the PCP
signaling pathway during OFT development. Global knock-out of Wnt5a has been shown to
result in a common arterial trunk (CAT) phenotype, with near complete penetrance.
12

Mechanistically, it is well described that Wnt5a-mediated PCP signaling is required for SHF
progenitor cell deployment into the developing OFT.
13
Whereas it has been shown that the SHF
65
cells are the primary responders to Wnt5a signals, the exact cellular sources of Wnt5a in the
mouse have not been formally evaluated.
In this study, we investigated the tissue-specific sources of Wnt5a during cardiac
development. Utilizing NCC- and SHF-specific Cre recombinase mice, we conditionally deleted
Wnt5a in NCCs and SHF progenitors. We show that while both NCC- and SHF-derived Wnt5a
are required for the polarized migration of SHF progenitor cells into the developing OFT, the
subpopulations of SHF cells responsive to these cellular sources differ. Loss of NCC-derived
Wnt5a led to the development of fully penetrant double outlet right ventricle (DORV)
phenotypes in mutants, without impacting inflow tract morphogenesis. In addition to DORV,
conditional Wnt5a mutants exhibited a series of pulmonary track specific abnormalities, ranging
in severity from pulmonary valve dysplasia to complete pulmonary atresia. Outflow tract
malalignment in NCC-mutants was found to be caused by a failure of SHF migration into the
arterial pole of the outflow tract, resulting in a foreshortened outflow tract that remained
positioned above the right ventricle. Migration of pharyngeal SHF cells was found to be most
significantly perturbed in NCC-mutants, consistent with a model whereby NCC-derived Wnt5a
is required for paracrine PCP signaling to these cranial-most SHF cells in closest spatial
proximity to NCCs. Loss of SHF-derived Wnt5a reduced migration of more caudal splanchnic
SHF cells and resulted in both DORV and common arterial trunk (CAT) phenotypes. Taken
together, these data provide novel insights into the cellular sources of Wnt5a during heart
development, and are the first to demonstrate a role for NCC in regulating paracrine PCP
signaling in SHF cells during OFT maturation.

3.0 RESULTS
Wnt5a is expressed in cardiac NCC and SHF progenitor cells during OFT maturation
We began by evaluating Wnt5a expression in cardiac NCC and SHF progenitor cells in
sagittal sections of embryonic day (E) 10.5 embryos. This time point was selected because it
allowed for evaluation of Wnt5a expression in both cardiac NCC and SHF progenitor cells
occupying the OFT and surrounding structures (Figure 1A). Using Wnt1Cre, R26R-tdTomato
reporter mice, we show that cardiac NCC can be observed migrating through the pharyngeal
66
mesodermal region and into the sub-endocardial cushions of the OFT (Figure 1B). Fluorescence
in situ hybridization of contiguous sister sections demonstrates that Wnt5a transcript expression
can be observed in similar domains occupied by cardiac NCC within the OFT (Figure 1C).
Similarly, Mef2c-Cre, R26R-td-Tomato mice were used to lineage trace SHF progenitor cells
and their derivatives in the E10.5 heart. As expected, there was a pronounced td-Tomato signal
in the right ventricle (RV), myocardial and endocardial compartments of the OFT, and in the
splanchnic mesoderm (SpM) continuous with the caudal arm of the distal OFT (Figure 1D).
Although Wnt5a transcripts were robustly expressed in SHF cells within the caudal SpM region,
their expression appeared to decrease in areas occupied by more cranial SHF derivatives,
including SHF cells within the myocardial and endocardial compartments of the OFT (Figure
1E). This spatial difference in Wnt5a expression by SHF progenitor cells within the caudal SpM
region has been described previously
13
and suggests that Wnt5a expression is downregulated as
SHF cells migrate cranially into the OFT.
To further corroborate our in situ hybridization data, we evaluated patterns of Wnt5a
protein expression using genetic lineage tracing modalities. We utilized a Wnt5a-CreER
transgenic mouse kindly provided by Dr. Jianbo Wang. Tamoxifen was injected at E8.5 and
embryos were dissected at E9.5 and E10.5 to evaluate Wnt5a-expressing cells and their
derivatives at these time points. Consistent with our in situ hybridization data, we found Wnt5a
lineage traced cells in the area of the caudal SpM region, where SHF progenitor cells originate
(Supplemental Figure 6). We also observed a less robust yet detectable signal of Wnt5a
expression in areas of the outflow tract and adjacent pharyngeal mesoderm occupied by cardiac
NCCs (Supplemental Figure 6). This expression data confirms that while Wnt5a is expressed in
areas occupied by both SHF and NCC progenitors, there are spatial differences in the Wnt5a
expression signature between these two populations. Whereas SHF cells appear to most strongly
express Wnt5a in the SpM prior to entering the OFT, NCCs appear to express Wnt5a in the
pharyngeal arches and as they enter the distal OFT.
Conditional deletion of Wnt5a in NCC or SHF progenitor cells results in a spectrum of OFT
defects
67
We conditionally deleted Wnt5a in NCCs and SHF cells, the two progenitor cell
populations that give rise to the OFT. In NCC mutants, there was no evidence of early embryonic
lethality and 100% of embryos evaluated at E14.5 had DORV with an obligatory ventricular
septal defect (VSD) (Figure 2A-B’). In addition to misaligned OFT, 62% NCC mutants also
harbored a range of pulmonary valve and trunk abnormalities. These pulmonary-specific defects
ranged from a thickened and dysplastic pulmonary valve in 23% to overt pulmonary atresia in
38% (Figure 2C-C’’, Supplemental 1A-D’’’’). To confirm that these embryos exhibited DORV
with an atretic pulmonary trunk and not CAT, we performed whole mount imaging and
histologic analyses in post-natal day (P) 0 pups. In each P0 mutant, a thin-walled and narrowly
patent communication was observed between the RV and the branch pulmonary arteries.
Immunofluorescence staining with CD31 and SMA demonstrates that this atretic vessel lacked
the normal arterial histologic architecture observed in control pulmonary trunk segments
(Supplemental 1E-F’). Whereas the endothelial layer of the smaller lumen vessel was well
developed, the smooth muscle medial layer was completely absent. In contrast, the aorta was
normally developed in mutants with pulmonary trunk atresia. Venous pole structures were also
found to develop normally in NCC mutants more generally. Thus, these data indicate that NCC-
derived Wnt5a is required for the appropriate alignment of the OFT, yet is dispensable for OFT
septation and inflow tract development.
To evaluate the role of SHF-derived Wnt5a during OFT development, we then
conditionally deleted Wnt5a in the SHF lineage using the Mef2c-Cre line. The loss of anterior
SHF-derived Wnt5a also did not result in embryonic lethality. However, in contrast to what was
observed in NCC mutants, we found that the loss of SHF-specific Wnt5a resulted in OFT defects
with an approximate 50% penetrance (Figure 2D-E). Given the incomplete penetrance of OFT
defects in the Mef2C-Cre, Wnt5a mutants, we histologically analyzed cardiac phenotypes in
thirty-nine mutant embryos at various time points between E14.5-E18.5. Amongst the mutant
embryos, CAT (23%) and DORV (28%) malformations were observed in roughly similar
numbers (Table 1). However, in each of the SHF mutants with CAT, we observed that the single
truncus arteriosus emanated completely from the RV, indicating that OFT was misaligned and
unseptated.
68
Planar cell polarity signaling in SHF progenitor cells is perturbed in both NCC and SHF
conditional mutants
The pattern of OFT malformations observed in NCC- and SHF-specific mutants is
consistent with a downstream SHF defect and suggests that SHF cells serve as the signal
receiving cells from both sources of Wnt5a. To test this hypothesis, we evaluated PCP signaling
and cellular organization in SHF progenitors within and around the mouth of the developing
OFT at E9.5-10.5 (Figure 3A). Islet1 (Isl-1) immunostaining was used to label SHF cells at these
time points. In NCC mutants, Islet1+ SHF cells entering the caudal OFT appeared highly
disorganized with aberrant polarization and cytoarchitecture (Figure 3A-C’). Actin
polymerization and cellular polar morphology was also assessed by co-staining for Islet1 and
phalloidin, which showed perturbed phalloidin expression in SHF cells near the distal OFT
(Figure 3D-E’’’). Consistent with the disorganized appearance of Isl-1+ cells in the distal OFT of
NCC mutants, there was also a reduction in laminin expression and disrupted apicobasal polarity
(Figure 3F-G’’’). SHF cellular and morphologic perturbations observed at E9.5 continued to
persist at E10.5 (Supplemental Figure 2). To ensure that NCC-derived Wnt5a was impacting
PCP signaling in the SHF and not inducing proliferative changes as has been described in
canonical Wnt signaling mechanisms, we assessed SHF proliferation by co-staining for Isl-1 and
m-phase cell cycle marker phosphorylated histone H3 (pHH3). We found comparable numbers
of Isl-1 and pHH3 double-positive cells, indicating that the rate of SHF proliferation was
unchanged following the deletion of NCC derived Wnt5a at E9.5 (Supplemental Figure 3).
For Mef2c-Cre, Wnt5a embryos, we used the R26R-td-Tomato reporter to lineage trace
and label SHF progenitors. As expected, td-Tomato+ SHF derivatives could be observed in the
caudal SpM and in the myocardium and endocardium of the OFT. In SHF-mutants, highly
disorganized SHF cells were found in the SpM (Supplemental Figure 7). Consistent with this
cellular disorganization, phalloidin staining demonstrated that these cells also display abnormal
cytoarchitectural and morphologic features (Supplemental Figure 8).
Loss of polarized migration of SHF progenitors into developing heart leads to foreshortened
OFT
69
Polarized migration of SHF progenitors into the developing OFT is required to elongate
the OFT to ensure appropriate rotation and alignment over the developing ventricles. Previous
studies have demonstrated that loss of Wnt5a in SHF causes shortening of the OFT and trachea
13
,
though no study to date has evaluated OFT length in mice with Wnt5a deleted from the neural
crest. To assess this, we performed micropipette-guided India ink injections into the developing
heart, OFT, and pharyngeal arch arteries at E10.5 in control and NCC-mutant embryos. Lateral
views of whole mount embryos showed that the OFT in mutants was roughly half the length of
that in littermate controls (Figure 4 I’-K). Consistent with this foreshortening of the OFT, frontal
examination showed that the OFT lacked the characteristic medial bend seen in controls that
indicates appropriate alignment over the developing right and left ventricles. Rather the OFT
remained largely committed to the right side of the heart in NCC mutants (Figure 4 I, J). These
data would indicate that lack of PCP signaling leads to loss of incorporation of SHF progenitors,
and consequently, a failure of elongation of the developing OFT.
To confirm that the foreshortening of the OFT observed in mutant mice was a result of
lack of SHF migration, we evaluated the distribution of SHF progenitor cells in the adjacent
mesoderm at E9.5, the time-period when these cells are being actively incorporated into the
developing heart. Our data demonstrate that the OFT length occupied by Isl-1+ SHF cells is
reduced by nearly 47% in both NCC and SHF mutants compared to their respective littermate
controls (Figure 4 A, D). However, the subpopulation of SHF progenitor population that failed to
migrate differed between NCC and SHF mutants. In the NCC mutants, there was accumulation
of Isl-1+ SHF progenitor cells in the cranial pharyngeal mesodermal region compared to
controls, but there was no difference in the number of Islet1+ SHF progenitors within the SpM or
in the cranio-caudal length of SpM (Figure 4 A-H, Supplemental Figure 5). The opposite pattern
was observed in Mef2c-Cre mutants, which showed a reduction in cranio-caudal length of SpM
but no accumulation of cells seen in the pharyngeal mesodermal area (Supplemental Figure 7).
Importantly, in both NCC (Supplemental Figure 4) and SHF conditional mutants (data not
shown), NCC (labeled by Ap2a) were found to migrate appropriately into the OFT at E9.5,
confirming that NCCs are not Wnt5a signal-receiving cells and loss of NCC migration does not
play a role in the observed OFT defects. Our data would indicate that NCC-derived Wnt5a
preferentially signals to a subpopulation of cranial pharyngeal SHF cells, whereas SHF-derived
Wnt5a acts on the caudally distributed SHF cells residing within the SpM.
70
Loss of NCC-derived Wnt5a disrupts Sema3c expression in SHF progenitor cells that primarily
contribute to the pulmonary trunk
Given the frequency of pulmonary-specific abnormalities observed in concert with
DORV in conditional NCC mutants, we attempted to evaluate the morphologic and molecular
characteristics of the subpopulation of SHF progenitor cells that gives rise to the pulmonary
trunk. Previous work has shown that during OFT maturation, guidance molecule Semaphorin 3c
(Sema3c) is expressed in the subset of SHF cells that are fated to contribute to the pulmonary
trunk.
14,15
Therefore, we histologically evaluated the orientation of the OFT of E11.5 embryos
using Sema3c expression in transverse sections. Our data demonstrate that at the level of both the
middle and distal OFT, Sema3c expression was significantly reduced in the myocardium of NCC
mutants on the anterior and rightward aspect of the OFT that forms the pulmonary trunk (Figure
5). There was no difference in the low basal level expression of Sema3c in the aortic posterior
and leftward side of the OFT. In addition, the distal OFT of mutant embryos was not
appropriately rotated, such that the pulmonary side of the OFT stayed rightward and posteriorly
oriented in mutants compared to its more anterior orientation in littermate controls. These results
would indicate that the SHF cells from the posterior pharyngeal mesoderm receiving NCC-
derived Wnt5a primarily contribute to the pulmonary aspect of the OFT and their incorporation
and consequent elongation of the OFT is required for the appropriate rotation of the distal OFT.
NCC-derived Wnt5a is necessary for polarized migration of murine myoblasts in vitro
We developed a transwell, co-culture system with O9-1 neural crest cells and C2C12
myoblasts to model the paracrine signaling relationship between NCC and SHF cells observed in
our in vivo genetic data. Figure 6 outlines the schematic model of the assay. We first validated
this model by testing whether the presence of NCC influences myoblast migratory capacity.
Following a 9-hour migration period, we found that the presence of NCCs significantly increased
the migratory capacity of myoblasts compared to myoblasts assayed in the absence of neural
crest cell inserts (72.6% wound repopulated area vs 59.1% wound repopulated area) (Figure 7A-
B). As expected, the addition of exogenous recombinant Wnt5a (rWnt5a) to co-culture wells
accelerated myoblast migration, with some wound areas demonstrating complete recovery by the
9-hour time point as shown in Figure 7A-B. Migratory myoblasts in all three conditions
71
exhibited normal migratory cellular morphology, including well-formed and protruding filapodia
and lamellopodia and asymmetric polarization of actin cytoplasmic projections (Figure 7C).
To evaluate the paracrine effect of NCC-derived Wnt5a on myoblast migration, we
performed wound-healing assays in myoblasts following the siRNA-mediated knockdown of
Wnt5a in NCCs. We confirmed Wnt5a knockdown efficiency by real time-quantitative
polymerase chain reaction (RT-PCR). We found that treatment with 50nM siRNA against Wnt5a
reduced Wnt5a gene expression by 68% compared to negative control (scrambled) siRNA
(Figure 8A). Using this concentration, we transfected O9-1 cell inserts with either negative
control siRNA or Wnt5a siRNA 48-hours prior to assembling the co-culture. After a 10-hour
migratory period, we found that knockdown of Wnt5a in NCCs significantly reduced underlying
myoblast migratory capacity compared to myoblasts assayed with control NCCs (39.1% wound
repopulated area vs 74.8% wound repopulated area) (Figure 8B-C). Moreover, myoblasts
assayed in the absence of NCC-derived Wnt5a displayed abnormal cytological morphology by
immunostaining, including fewer actin cytoskeletal lamellipodia and filopodia (Figure 8D). We
then attempted to rescue myoblast migration by exogenous supplementation of 500ng/mL of
rWnt5a to 50% of co-culture wells containing NCC-Wnt5a knockdown inserts. The addition of
exogenous rWnt5a completely rescued migratory and morphologic defects observed in these
myoblasts (Figure 8C-D).

4.0 DISCUSSION
PCP signaling is part of the non-canonical, beta-catenin independent branch of the Wnt
signaling pathway. Initially discovered as a mechanism to orient actin-based trichomes in
Drosophila melanogaster, this pathway has since been shown to maintain a fundamental and
evolutionarily conserved role in tissue morphogenic processes across several higher order
organisms.
16-20
During mammalian development, PCP signals orchestrate the polarized migration
of progenitor cell populations necessary for convergent extension movements in the
establishment of multiple tissue types, including neural tube, cochlea, limb, and intestine.
20-24
In
the context of heart development, prior work has demonstrated that this pathway is required for
progenitor cell organization and patterning during OFT maturation. PCP signaling leads to
72
polarized orientation of the SHF progenitors and their subsequent ‘push’ into the developing
OFT, such that deletion of PCP pathway ligands and core effector molecules consistently leads
to OFT malformations.
25

Wnt5a and Wnt11 serve as the primary ligands that drive PCP signaling during OFT
morphogenesis in the mouse. These ligands activate PCP signals by binding to surface
ROR/Frizzled receptor complexes and stimulating downstream signaling cascades involving
effector molecules Dishevelled1/2, Daam1, Rho-family GTPases, and others. Despite similar
mechanisms of action, Wnt5a and Wnt11 pathways do not appear to be functionally redundant in
OFT development. Germline deletion of Wnt11 results in fully penetrant OFT malformations,
including CAT, DORV, and TGA.
12, 25-28
Wnt11 appears to be uniquely derived from the SHF
cells and signals to SHF cells, as conditional deletion of Wnt11 in SHF-specific Cre lines
recapitulates global knockout phenotypes.
29
Further, NCC-specific knockout of Wnt11 in mice
does not result in defective OFT morphogenesis.
29
Similarly, global knockout of Wnt5a also
results in fully penetrant OFT defects, primarily CAT. Other OFT phenotypes, including double
outlet right ventricle (DORV) and transposition of the great arteries (TGA), have been described
at a much lower frequency, but the mechanistic etiology of these defects is yet unknown.
12
By
extrapolation from Wnt11 results, it has been suggested that Wnt5a is also derived exclusively
from the SHF. Yet, conditional deletion of Wnt5a using SHF-specific Cre lines does not fully
recapitulate global knockout phenotypes. In this study, we show that unlike Wnt11, Wnt5a is
secreted both by SHF and NCCs, and both cell lineages work co-operatively to regulate
polarized entry of SHF cells into the OFT. Thus, our results are the first demonstration of NCC
as a novel source of Wnt5a in OFT development.
Our data indicate that SHF cells receive Wnt5a signals from both SHF and NCC cell
sources. NCC migrate and proliferate normally in both conditional mutants (data not shown),
implying that Wnt5a is not required for these aspects of NCC function. Interestingly, the two
sources of Wnt5a appear to regulate the biology of spatiotemporally different subsets of SHF
progenitors. Early in OFT development (E7.5-9), prior to the arrival of NCC, anterior SHF cells
are specified in the SpM and migrate to the arterial and venous poles of the linear heart tube.
Fate mapping analysis demonstrates that these early migrating SHF cells at the anterior pole
contribute to the RV myocardium and proximal OFT. During this time, SHF progenitor
73
deployment from the SpM is driven by Wnt5a from the SHF. SHF-derived Wnt5a leads to
polarized SHF cellular orientation elongating the SpM in a cranio-caudal direction and inducing
migration of SHF cells into the developing heart. A previous study by Li et al. used Isl-1 Cre to
ablate Wnt5a expression.
13
Their work demonstrated that SHF-derived Wnt5a is necessary for
appropriate formation of the outflow tract. However, because the Isl-1 Cre recombinase line is a
knock-in line, from a genotypic perspective, these mice represent a functional Isl-1
heterozygote.
30
Thus, it is plausible that this heterozygous Isl-1 genetic background compounds
conditional Wnt5a deletion, causing an oligogenic impact on SHF function and resultant outflow
tract phenotypes. Further, previous studies have also demonstrated that Isl-1 Cre also recombines
in NCCs, suggesting that the use of this Cre mouse line may lead to the conditionally deletion of
floxed alleles in both SHF and NCC populations.
31
Given these considerations, we sought to use
the Mef2c-cre line to delete Wnt5a expression in the SHF in this study.
Mef2c is expressed only within the anterior subset of SHF cells, and its expression is
most robust as these cells approach the developing heart.
32
We believe that this expression
prolife and potential variations in Cre expression underlie the biological phenotypic variability
observed in mutant embryos. Conditional deletion of Wnt5a within the Mef2c-Cre lineage results
in shortening of the cranio-caudal extent of the SpM, and aberrant retention of SHF progenitors
within this region. Failure of these SHF cells to migrate into the OFT leads to its foreshortening
and misalignment. In a quarter of the embryos, this results in the classic malalignment defect,
DORV. In another quarter of embryos, a CAT is seen to exit exclusively from the RV. Given the
lack of gross NCC defects in these mutants, we speculate that the CAT in this model is not due to
a primary NCC abnormality. Rather, CAT following SHF deletion of Wnt5a is likely due to a
more significant reduction in SHF cell incorporation early in OFT development, such that this
OFT remains aligned only to the RV and there is inadequate substrate for septation by
appropriately migrating NCC. In previous studies using retinoic acid receptor (RAR) mutant
mice, our group has described a similar mechanism whereby a misaligned CAT phenotype is due
to SHF-abnormalities. In such mutants, CAT phenotypes were due to misexpression of
transforming growth factor-beta (TGF-b ) signals in SHF-derived OFT and not primary
migratory or functional defects in the neural crest.
33
We hypothesize that a similar SHF-driven
mechanism may explain the presence of CAT in 25% of Mef2c-Cre, Wnt5a mutants observed in
this study. That 50% of SHF-Wnt5a mutants have no discernable cardiac phenotypes suggest that
74
factors such as biologic variability or compensatory PCP signals from the neural crest may
modify the penetrance of loss of SHF-derived Wnt5a during outflow tract morphogenesis.
At E9.5, cardiac NCC can be observed migrating through the pharyngeal mesoderm and
into the distal OFT. These NCCs now supply a second source of Wnt5a and primarily regulate
the biology of the more posterior and cranial pharyngeal mesodermal SHF cells. NCC-derived
Wnt5a induces polarized migration of these cranial SHF cells into the developing OFT. With
loss of NCC-derived Wnt5a, SHF cells in the posterior pharyngeal arches are retained, whereas
there is appropriate cranio-caudal lengthening of the SpM. Because these SHF cells only enter
the OFT at the same time as NCC, we infer that early OFT assembly proceeds normally and
there is adequate OFT substrate for NCC septation. Hence, CAT was never observed in NCC-
specific knock out of Wnt5a. To the contrary, these later entering cells elongate the OFT by
primarily adding to the portion of the OFT that is destined to become the pulmonary trunk. Cell
accretion and OFT elongation allows the OFT to also rotate along a cranio-caudal axis that
ultimately brings the pulmonary artery anterior to the aorta. Thus, our in vivo data demonstrate
that in addition to septating the OFT, post-migratory cardiac NCCs also independently impact a
different aspect of SHF biology and OFT maturation.
To model the intercellular paracrine signaling relationship observed between NCC and
SHF cells in our in vivo mouse models, we developed a non-contact, co-culture assay utilizing
O9-1 NCC and C2C12 myoblasts. In this system, signal-sending NCCs are grown on porous
transwell inserts, and wound-healing assays and immunocytochemical techniques are
sequentially applied to evaluate key functional and molecular PCP characteristics in the same
population of signal-receiving myoblasts.
34-36
Using this model, we demonstrated that co-culture
with NCCs improves myoblast migratory capacity and is associated with increased phalloidin
positive cytoplasmic filopodia and lamellipodia by immunofluorescence. Consistent with our in
vivo data, we showed that loss of NCC-derived Wnt5a significantly perturbs myoblast migration
and PCP-related cytoarchitectural changes in this co-culture system. We believe this in vitro
assay provides strong corroborating evidence of the paracrine signaling mechanism proposed by
our in vivo studies. Future experiments with this model will seek to further elucidate the
mechanisms governing paracrine NCC-SHF PCP signaling by testing for relevant signal
receiving molecules in myoblasts.
75
In addition to providing insights into the tissue-specific sources of Wnt5a and novel
NCC-SHF interactions, our work also has important implications for understanding the
molecular basis of clinically relevant CHD. While OFT defects are known to represent nearly
30% of all CHD, we recently showed that these lesions are strongly enriched in patients with
concomitant cleft malformations.
37-39
In particular, we found that OFT alignment defects such as
DORV and TOF were the most overrepresented phenotypes in patients with cleft palate,
suggesting that a common molecular mechanism underlies these two lesions.
39
Given that NCCs
are common to palatal and cardiac development, we speculate that combined cleft and heart
defects reflect NCC-derived phenotypes.
40
Our current data would indicate that NCC-driven PCP
signaling events within the elongating palatal shelves and cardiac OFT offer one potential
mechanism to describe these concomitant lesions.
In summary, using tissue-specific conditional knockout of Wnt5a, we show that NCCs
and SHF cells act as sources of Wnt5a ligand. SHF-derived Wnt5a supports polarized migration
of SpM SHF cells early in OFT assembly, whereas NCC-derived Wnt5a is critically required for
later cranial pharyngeal SHF cells to subsequently elongate the OFT by adding to the pulmonary
trunk. Apart from providing unique insights into the source of PCP ligands in OFT development
and a novel role for NCC in regulating SHF cell directional migration, our data may also have
relevance in understanding mechanisms of clinical CHD.

5.0 MATERIALS AND METHODS
Mouse strains and genotyping
All animal experiments were carried out under protocols approved by the Institutional
Animal Care and Use Committee of the University of Southern California. Wnt1-Cre
4
and
Mef2c-AHF-Cre
32
mice used in this study have been previously described. During the breeding
and experimental crosses, the Cre gene was maintained on the paternal side to eliminate risk of
germline transmission. Wnt5a F/F mice were originally generated in the Yamaguchi lab and
were previously reported.
27
All mice were genotyped using genomic DNA extracted from tail tip
tissues collected at time of weaning. A complete list of primers used for polymerase chain
reaction (PCR) genotyping is shown in Supplemental Table 1.
76
To lineage trace the Wnt5a expressing cells during heart development, Wnt5a-CreER
mice were crossed with Rosa26-td-Tomato reporter mice to obtain Wnt5a-CreER; Rosa26-td-
Tomato embryos. Female were observed daily for the presence of vaginal plugs. Pregnant dams
were administered tamoxifen at 2-4 mg/40 g body weight orally between 10am and 11am on the
desired day(s) according to previously published protocols.
13
Lineage tracing was also used to
track SHF progenitors and their derivatives in conditional SHF knockout mice. For these
experiments, Mef2c-Cre mice were crossed with Rosa26-td-Tomato. Embryos were collected on
appropriate days and fixed in 4% PFA at 4°C overnight. After fixation, embryos underwent two
10-minute 1x PBS rinses followed by bright field and fluorescence whole-mount imaging.
Tissue histology and phenotypic analysis
Embryos were dissected in cold 1x PBS at appropriate time-points and genotypes were
confirmed using genomic DNA extracted from embryonic tail tips. For phenotypic analyses,
embryos underwent fixation with 10% formalin at 4°C overnight, followed by an ethanol/xylene
dehydration series and paraffin embedding. Paraffin embedded embryos were sectioned at 10µM
and underwent hematoxylin and eosin staining using standard protocols. For
immunofluorescence staining experiments, embryos were dissected in cold 1x PBS and
immediately placed in 4% paraformaldehyde and incubated at 4°C overnight. Embryos then
underwent cryopreservation through a sucrose dehydration sequence followed by OCT
embedding. Cryosections were made at 10µM. Antibodies used for immunofluorescence are
listed in Supplemental Table 2. Standard validation techniques included deletion of primary or
secondary antibody or use of blocking peptide to validate antibody specificity. Fluorescence in
situ hybridization for Wnt5a transcript expression in embryonic tissue sections was undertaken
using the commercially available RNAscope probe and manufacturer’s protocol (Advanced Cell
Diagnostics). Unless specifically mentioned, all phenotypic evaluations and immunofluorescence
stains performed in mutants were compared to Wnt1-Cre or Mef2C-Cre, Wnt5a F/+ littermate
controls.
In NCC genetic models, immunostaining with Islet1 antibody was used to identify and
label SHF cells in tissue sections. Immunostaining with Ap2a was used to label neural crest
cells in both NCC and SHF-deletion models. To assess migration of SHF cells, the area of Islet1
77
labeled SHF cells (or td-Tomato lineage traced cells) in these respective domains was quantified
using ImageJ and compared between littermate control and mutant sections. In all cases,
experiments were repeated in multiple sections of multiple embryos from different litters with
littermate controls and all quantification was normalized to controls. Primary data was exported
from ImageJ into SPSS for statistical analysis.
India ink injections and whole mount imaging
Pregnant dams were euthanized and embryos were harvested at embryonic day (E)10.5.
Tail tips were dissected from embryos for genotyping. In each embryo, the thoracic cavity and
pericardium was dissected to expose the heart. Glass micropipettes were used to inject india ink
diluted in 1x PBS into the heart and pharyngeal arch arteries. Following injection, embryos were
fixed in 4% paraformaldehyde and incubated at 4°C overnight. After overnight fixation, embryos
underwent two 10-minute rinses with 1x PBS. Whole mount imaging was performed and sagittal
and frontal pictures were taken to evaluate cardiac outflow tract length and looping morphology,
respectively. To measure the length of the outflow tract, the area of ink filled outflow tract in the
sagittal plane was measured using ImageJ and normalized to that of control embryos. Primary
data was exported from ImageJ into SPSS for statistical analysis.
O9-1 and C2C12 co-culture migratory assay
To model the paracrine signaling relationship between NCC and C2C12 cells, a transwell
co-culture system was assembled. O9-1 cells and C2C12 cells were expanded and passaged
according to previously established protocols.
41
After reaching appropriate confluency, O9-1
cells were trypsinized and plated on Falcon permeable support inserts with 0.4µM transparent
PET membrane (Corning, Cat# 353095) and C2C12 cells were trypsinized and plated on 4-well
Nunc
TM
Lab-Tek
TM
II Chamber Slide
TM
System (ThermoFisher Scientific, Cat# 154526). After
~40-48 hours, myoblasts underwent wound generation using a sterile p-10 pipette tip and O9-1
containing inserts were placed within chamber wells. Myoblasts were allowed to migrate for 9-
12 hours with the exact time depending on initial seeding and experimental co-culture
conditions. After this point, co-culture wells were disassembled and myoblasts underwent
immunocytochemical staining for Phalloidin-iFluor 488 (Abcam, Cat# ab176753). To model the
loss of NCC-derived Wnt5a on myoblast migration, NCC inserts were incubated with 50nM of
78
negative control (scrambled) or Wnt5a siRNA prior to co-culture assembly. Wnt5a knockdown
was confirmed by RT-PCR using primers listed in Supplemental Table 3. To rescue this signal
sending cell derangement, supplementation with exogenous recombinant Wnt5a (rWnt5a, R&D
Systems, Cat# 645-WN-010) was performed in 50% of Wnt5a siRNA knockdown co-culture
wells.
Statistical analyses
For all experiments requiring comparative statistics, cell counts and measurements were
performed in ImageJ using primary image files. Data were exported from ImageJ into IBM SPSS
software v26 (IBM-SPSS Inc., Armonk, NY) and parametric descriptive statistics were
calculated. To compare differences between control and mutant datasets, two-tailed independent
Student’s t-tests were performed in each experiment as appropriate. Statistical significance was
defined as p<0.05.

79
6.0 TABLES AND FIGURES
Table 1. Summary of cardiovascular phenotypes in NCC- and SHF- conditional Wnt5a mutant
mice.
Phenotypes
Wnt1-Cre,
Wnt5a
F/+

(N=12)
Wnt1-Cre,
Wnt5a
F/F

(N=13)
Mef2c-Cre,
Wnt5a
F/+

(N=9)
Mef2c-Cre,
Wnt5a
F/F

(N=39)
Normal 12 (100) 0 (0) 9 (100) 19 (49)
Double outlet right
ventricle
0 (0) 8 (62) 0 (0) 11 (28)
Double outlet right
ventricle + pulmonary
atresia
0 (0) 5 (38) 0 (0) 0 (0)
Common arterial trunk 0 (0) 0 (0) 0 (0) 9 (23)

80
Figure 1. Wnt5a transcripts are expressed in cardiac neural crest cells and anterior second heart
field progenitor cells at embryonic day E10.5 in the mouse.

B
Wnt1-Cre, R26R-tdT
E10.5 sagittal histology
DAPItdT DAPIWnt5a
DAPIWnt5a
C
A
OFT
RV
SpM
PA II
Atrium
E10.5 Control
D E
Mef2c-Cre, R26R-tdT
DAPItdT
DAPI
81
Figure 2. Wnt5a is required in both cardiac neural crest cells (B-C’’) and second heart field cells
(D-E’’) during outflow tract maturation.

Control Wnt1-Cre, Wnt5a
F/F
E14.5 transverse histology
A A’ A’’
C C’ C’’
B B’ B’’
Wnt1-Cre, Wnt5a
F/F
Mef2c-Cre, Wnt5a
F/F
Mef2c-Cre, Wnt5a
F/F
D D’ D’’
E E’ E’’
82
Figure 3. Loss of Wnt5a in the neural crest leads to dysregulated planar cell polarity expression
in the second heart field cells contributing to the outflow tract.

83
Figure 4. Pharyngeal second heart field progenitor cells fail to migrate into and elongate the
cardiac outflow tract following depletion of Wnt5a from the neural crest.

84
Figure 5. Loss of neural crest cell Wnt5a is associated with a downregulation of Sema3c
expression in second heart field cells fated to become pulmonary trunk myocardium.

85
Figure 6. Schematic model of co-culture assay to model paracrine planar cell polarity signaling
events between neural crest cells and myoblasts. This figure was originally made in
biorender.com.

86
Figure 7. Presence of neural crest cells increases myoblast migratory capacity. (A) The presence
of neural crest cell (NCC) inserts at the time of wound generation leads to improved myoblast
migration. The addition of exogenous recombinant Wnt5a (rWnt5a) to NCC-C2C12 co-cultures
has the strongest positive effect on myoblast migration. (B) Quantification of myoblast
repopulated area at 9-hours following wound generation. (C) Phalloidin staining of myoblasts at
the wound border 9-hours following wound generation.

No insert O9-1 cell insert
0-hr post scratch 9-hr post scratch
a.
c.
No insert O9-1 cell insert
9-hr post scratch
b. O9-1 cell insert +
500ng/mL rWnt5a
O9-1 cell insert +
500ng/mL rWnt5a
0
20
40
60
80
100
0-hr 9-hrs
No insert
O9-1 insert
O9-1 insert + rWnt5a
Time since scratch
Repopulated area (%)
P=0.4111
P=0.0002
0
20
40
60
80
100
0-hr 9-hrs
No insert
O9-1 insert
O9-1 insert + rWnt5a
87
Figure 8. Neural crest cell-derived Wnt5a is necessary for myoblast migration. (A) Relative
mRNA expression of Wnt5a to validate siRNA-mediated knockdown in neural crest cells
(NCC); (B) Migration of C2C12 myoblasts is significantly reduced following Wnt5a knockdown
in NCC. Addition of exogenous rWnt5a is sufficient to rescue this migratory deficit in
myoblasts. (C) Quantification of myoblast repopulated area at 10-hours following wound
generation. (D) Phalloidin staining of myoblasts at the wound border 10-hours following wound
generation.

a.
d.
b.
Negative control siRNA insert Wnt5a siRNA insert
Wnt5a siRNA insert +
500ng/mL rWnt5a
0-hr post scratch 10-hr post scratch
Negative control siRNA insert Wnt5a siRNA insert
Wnt5a siRNA insert +
500ng/mL rWnt5a
c.
0
20
40
60
80
100
0-hr 10-hrs
NC siRNA
Wnt5a siRNA
Wnt5a siRNA + rWnt5a
Time since scratch
Repopulated area (%)
P=0.2150
P<0.0001
0
20
40
60
80
100
0-hr 10-hrs
NC siRNA
Wnt5a siRNA
Wnt5a siRNA + rWnt5a
10-hr post scratch
0
0.5
1
1.5
Wnt5a
Relative mRNA expression
Scrambled siRNA (50nM)
Wnt5a siRNA (50nM)
88
Supplemental Figure 1. Conditional deletion of Wnt5a in neural crest cells causes double outlet
right ventricle with additional pulmonary artery specific abnormalities.

89
Supplemental Figure 2. Planar cell polarity signaling abnormalities in second heart field cells
continue to be observed at E10.5 in conditional neural crest cell Wnt5a mutants.

90
Supplemental Figure 3. Second heart field progenitors retain the capacity to proliferate
following neural crest cell deletion of Wnt5a.

91
Supplemental Figure 4. Deletion of Wnt5a in the neural crest does not adversely impact neural
crest cell migration or proliferation.

92
Supplemental Figure 5. Mutant second heart field cells fail to migrate into the outflow tract and
remain within the cranial pharyngeal mesoderm.

93
Supplemental Figure 6. Wnt5aCreER lineage tracing of Wnt5a expressing cells and their
derivatives (shown in red). Neural crest cell lineages shown in GFP.

94
Supplemental Figure 7. (A, B) Lineage tracing of SHF progenitors demonstrates that SHF cells
within the splanchnic mesoderm fail to migrate into the outflow tract of Mef2C-Cre, Wnt5a
mutant embryos. (C, D) SHF conditional mutants also demonstrate a decrease in the cranio-
caudal extent of the splanchnic mesoderm.

95
Supplemental Figure 8. Loss of SHF-derived Wnt5a leads to altered polarized migration of
SHF cells into the outflow tract, including a reduction in phalloidin staining and disrupted
cellular polarity cytoarchitecture.

96
Supplemental Table 1. Primers used for genotyping mice based on extracted genomic DNA.
Gene name Forward primer Reverse primer
Wnt1-Cre CCTCTATCGAACAAGCATGCG GCCAATCTATCTGTGACGGC
Mef2c-Cre GAGCGTACGTGCTGCTTAGA AATCGCGAACATCTTCAGGT
Wnt5a F/F GGTGAGGGACTGGAAGTTGC GGAGCAGATGTTTATTGCCTTC
R26R-tdT CTCTGCTGCCTCCTGGCTTCT CGAGGCGGATCACAAGCAATA

97
Supplemental Table 2. Antibodies, probes, and chemical reagents used for expression and
experimental analyses.
Target gene/protein Catalog number (Company) Working concentration
Islet1 (Goat polyclonal) AF1837 (R&D Systems) 10 ug/mL
AP2a (Mouse monoclonal) NB100-74359 5 ug/mL
pHH3 (Rabbit polyclonal) 9701S (Cell signaling) 1 ug/mL
CD31 (Goat polyclonal) AF3628 (R&D Systems) 1 ug/mL
Alpha-SMA (Rabbit
polyclonal)
NBP1-30894 (Novus
Biologicals)
2 ug/mL
Semaphorin3c (Rabbit
polyclonal)
AB214309 (Abcam) 5 ug/mL
Phalloidin (488-conjugate) AB176753 (Abcam) 0.5 ug/mL
Laminin (Rabbit polyclonal) NB300-144 (Novus
Biologicals)
5 ug/mL
ZO-1 (Rabbit polyclonal) 61-7300 (Thermofisher) 1 ug/mL
N-cadherin 33-3900 (Thermofisher) 3 ug/mL
Mm-Wnt5a probe 316798 (Advanced Cell
Diagnostics)
Assay dependent
Recombinant Wnt5a protein 645-WN-010 (R&D Systems) 500 ng/mL

98
Supplemental Table 3. Primers used for gene expression analysis by RT-PCR.
Gene
name
Forward primer Reverse primer
GAPDH AGGTCGGTGTGAACGGATTTG TGTAGACCATGTAGTTGAGGTCA
WNT5A CAACTGGCAGGACTTTCTCAA CATCTCCGATGCCGGAACT

99
7.0 REFERENCES
1. Harvey RP. Patterning the vertebrate heart. Nat Rev Genet. 2002;3(7):544-56.
2. Dyer LA, Kirby ML. The role of secondary heart field in cardiac development. Dev Biol.
2009;336(2):137-144.
3. Zaffran S, Kelly RG, Meilhac SM, Buckingham ME, Brown NA. Right ventricular
myocardium derives from the anterior heart field. Circ Res. 2004;95(3):261-8.
4. Jiang X, Rowitch DH, Soriano P, McMahon AP, Sucov HM. Fate of the mammalian
cardiac neural crest. Development. 2000;127(8):1607-16.
5. Boot MJ, Gittenberger-De Groot AC, Van Iperen L, Hierck BP, Poelmann RE.
Spatiotemporally separated cardiac neural crest subpopulations that target the outflow
tract septum and pharyngeal arch arteries. Anat Rec A Discov Mol Cell Evol Biol.
2003;275(1):1009-18.
6. Virani SS, Alonso A, Aparicio HJ, Benjamin EJ, Bittencourt MS, Callaway CW, Carson
AP, Chamberlain AM, Cheng S, Delling FN, Elkind MSV, Evenson KR, Ferguson JF,
Gupta DK, Khan SS, Kissela BM, Knutson KL, Lee CD, Lewis TT, Liu J, Loop MS,
Lutsey PL, Ma J, Mackey J, Martin SS, Matchar DB, Mussolino ME, Navaneethan SD,
Perak AM, Roth GA, Samad Z, Satou GM, Schroeder EB, Shah SH, Shay CM, Stokes A,
VanWagner LB, Wang NY, Tsao CW; American Heart Association Council on
Epidemiology and Prevention Statistics Committee and Stroke Statistics Subcommittee.
Heart Disease and Stroke Statistics-2021 Update: A Report From the American Heart
Association. Circulation. 2021;143(8):e254-e743.
7. Niehrs C. The complex world of WNT receptor signalling. Nat Rev Mol Cell Biol.
2012;13(12):767-779.
8. Lin L, Cui L, Zhou W, Dufort D, Zhang X, Cai CL, Bu L, Yang L, Martin J, Kemler R,
Rosenfeld MG, Chen J, Evans SM. Beta-catenin directly regulates Islet1 expression in
100
cardiovascular progenitors and is required for multiple aspects of cardiogenesis. Proc
Natl Acad Sci U S A. 2007;104(22):9313-8.
9. Kwon C, Arnold J, Hsiao EC, Taketo MM, Conklin BR, Srivastava D. Canonical Wnt
signaling is a positive regulator of mammalian cardiac progenitors. Proc Natl Acad Sci U
S A. 2007;104(26):10894-9.
10. Sinha T, Wang B, Evans S, Wynshaw-Boris A, Wang J. Disheveled mediated planar cell
polarity signaling is required in the second heart field lineage for outflow tract
morphogenesis. Dev Biol. 2012;370(1):135-44.
11. Ramsbottom SA, Sharma V, Rhee HJ, Eley L, Phillips HM, Rigby HF, Dean C,
Chaudhry B, Henderson DJ. Vangl2-regulated polarisation of second heart field-derived
cells is required for outflow tract lengthening during cardiac development. PLoS Genet.
2014;10(12):e1004871.
12. Schleiffarth JR, Person AD, Martinsen BJ, Sukovich DJ, Neumann A, Baker CV, Lohr
JL, Cornfield DN, Ekker SC, Petryk A. Wnt5a is required for cardiac outflow tract
septation in mice. Pediatr Res. 2007;61(4):386-91.
13. Li D, Angermeier A, Wang J. Planar cell polarity signaling regulates polarized second
heart field morphogenesis to promote both arterial and venous pole septation.
Development. 2019;146(20):dev181719.
14. Bajolle F, Zaffran S, Meilhac SM, Dandonneau M, Chang T, Kelly RG, Buckingham
ME. Myocardium at the base of the aorta and pulmonary trunk is prefigured in the
outflow tract of the heart and in subdomains of the second heart field. Dev Biol.
2008;313(1):25-34.
15. Darrigrand JF, Valente M, Comai G, Martinez P, Petit M, Nishinakamura R, Osorio DS,
Renault G, Marchiol C, Ribes V, Cadot B. Dullard-mediated Smad1/5/8 inhibition
controls mouse cardiac neural crest cells condensation and outflow tract septation. Elife.
2020;9:e50325.
101
16. Ho HYH, Susman MW, Bikoff JB, et al. Wnt5a-Ror-Dishevelled signaling constitutes a
core developmental pathway that controls tissue morphogenesis. Proc Natl Acad Sci U S
A. 2012;109(11):4044-4051.
17. Čapek D, Smutny M, Tichy AM, Morri M, Janovjak H, Heisenberg CP. Light-activated
Frizzled7 reveals a permissive role of non-canonical wnt signaling in mesendoderm cell
migration. Elife. 2019;8:e42093.
18. Lutze G, Haarmann A, Demanou Toukam JA, Buttler K, Wilting J, Becker J. Non-
canonical WNT-signaling controls differentiation of lymphatics and extension
lymphangiogenesis via RAC and JNK signaling. Sci Rep. 2019;9(1):4739.
19. Weeraratna AT, Jiang Y, Hostetter G, et al. Wnt5a signaling directly affects cell motility
and invasion of metastatic melanoma. Cancer Cell. 2002;1(3):279-288.
20. Maung SM, Jenny A. Planar cell polarity in Drosophila. Organogenesis. 2011;7(3):165-
79.
21. Hashimoto M, Shinohara K, Wang J, Ikeuchi S, Yoshiba S, Meno C, Nonaka S, Takada
S, Hatta K, Wynshaw-Boris A, Hamada H. Planar polarization of node cells determines
the rotational axis of node cilia. Nat Cell Biol. 2010;12(2):170-6.
22. Wang J, Mark S, Zhang X, Qian D, Yoo SJ, Radde-Gallwitz K, Zhang Y, Lin X, Collazo
A, Wynshaw-Boris A, Chen P. Regulation of polarized extension and planar cell polarity
in the cochlea by the vertebrate PCP pathway. Nat Genet. 2005;37(9):980-5.
23. Devenport D, Fuchs E. Planar polarization in embryonic epidermis orchestrates global
asymmetric morphogenesis of hair follicles. Nat Cell Biol. 2008;10(11):1257-68.
24. Li D, Wang J. Planar Cell Polarity Signaling in Mammalian Cardiac Morphogenesis.
Pediatr Cardiol. 2018;39(5):1052-1062.
25. Sinha T, Li D, Théveniau-Ruissy M, Hutson MR, Kelly RG, Wang J. Loss of Wnt5a
disrupts second heart field cell deployment and may contribute to OFT malformations in
DiGeorge syndrome. Hum Mol Genet. 2015;24(6):1704-16.
102
26. Zhou W, Lin L, Majumdar A, Li X, Zhang X, Liu W, Etheridge L, Shi Y, Martin J, Van
de Ven W, Kaartinen V, Wynshaw-Boris A, McMahon AP, Rosenfeld MG, Evans SM.
Modulation of morphogenesis by noncanonical Wnt signaling requires ATF/CREB
family-mediated transcriptional activation of TGFbeta2. Nat Genet. 2007;39(10):1225-
34.
27. Yamaguchi TP, Bradley A, McMahon AP, Jones S. A Wnt5a pathway underlies
outgrowth of multiple structures in the vertebrate embryo. Development.
1999;126(6):1211-23.
28. Cohen ED, Miller MF, Wang Z, Moon RT, Morrisey EE. Wnt5a and Wnt11 are essential
for second heart field progenitor development. Development. 2012;139(11):1931-40.
29. van Vliet PP, Lin L, Boogerd CJ, Martin JF, Andelfinger G, Grossfeld PD, Evans SM.
Tissue specific requirements for WNT11 in developing outflow tract and dorsal
mesenchymal protrusion. Dev Biol. 2017;429(1):249-259.
30. Cai CL, Liang X, Shi Y, Chu PH, Pfaff SL, Chen J, Evans S. Isl1 identifies a cardiac
progenitor population that proliferates prior to differentiation and contributes a majority
of cells to the heart. Dev Cell. 2003;5(6):877-89.
31. Engleka KA, Manderfield LJ, Brust RD, Li L, Cohen A, Dymecki SM, Epstein JA. Islet1
derivatives in the heart are of both neural crest and second heart field origin. Circ Res.
2012;110(7):922-6.
32. Verzi MP, McCulley DJ, De Val S, Dodou E, Black BL. The right ventricle, outflow
tract, and ventricular septum comprise a restricted expression domain within the
secondary/anterior heart field. Dev Biol. 2005;287(1):134-45.
33. Ma M, Li P, Shen H, Estrada KD, Xu J, Kumar SR, Sucov HM. Dysregulated
endocardial TGFβ signaling and mesenchymal transformation result in heart outflow tract
septation failure. Dev Biol. 2016;409(1):272-276.
103
34. Wang Q, Symes AJ, Kane CA, Freeman A, Nariculam J, Munson P, Thrasivoulou C,
Masters JR, Ahmed A. A novel role for Wnt/Ca2+ signaling in actin cytoskeleton
remodeling and cell motility in prostate cancer. PLoS One. 2010;5(5):e10456.
35. Gibbs BC, Damerla RR, Vladar EK, et al. Prickle1 mutation causes planar cell polarity
and directional cell migration defects associated with cardiac outflow tract anomalies and
other structural birth defects. Biol Open. 2016;5(3):323-335.
36. Cui C, Chatterjee B, Lozito TP, Zhang Z, Francis RJ, Yagi H, Swanhart LM, Sanker S,
Francis D, Yu Q, San Agustin JT, Puligilla C, Chatterjee T, Tansey T, Liu X, Kelley
MW, Spiliotis ET, Kwiatkowski AV, Tuan R, Pazour GJ, Hukriede NA, Lo CW. Wdpcp,
a PCP protein required for ciliogenesis, regulates directional cell migration and cell
polarity by direct modulation of the actin cytoskeleton. PLoS Biol.
2013;11(11):e1001720.
37. Munabi NCO, Swanson J, Auslander A, Sanchez-Lara PA, Davidson Ward SL, Magee
WP 3rd. The Prevalence of Congenital Heart Disease in Nonsyndromic Cleft Lip and/or
Palate: A Systematic Review of the Literature. Ann Plast Surg. 2017;79(2):214-220.
38. Azadgoli B, Munabi NCO, Fahradyan A, Auslander A, McCullough M, Aflatooni N,
Davidson Ward SL, Kumar SR, Sanchez-Lara PA, Swanson J, Magee WP 3rd.
Congenital Heart Disease in Patients With Cleft Lip/Palate and Its Impact on Cleft
Management. Cleft Palate Craniofac J. 2020;57(8):957-966.
39. Toubat O, Mallios DN, Munabi NCO, Magee WP 3rd, Starnes VA, Kumar SR. Clinical
Importance of Concomitant Cleft Lip/Palate in the Surgical Management of Patients With
Congenital Heart Disease. World J Pediatr Congenit Heart Surg. 2021;12(1):35-42.
40. Tang W, Bronner ME. Neural crest lineage analysis: from past to future trajectory.
Development. 2020;147(20):dev193193.
41. Nguyen BH, Ishii M, Maxson RE, Wang J. Culturing and Manipulation of O9-1 Neural
Crest Cells. J Vis Exp. 2018;(140):58346.

104
C h a p t e r 5:
NEURAL CREST CELL-SPECIFIC LOSS OF HISTONE MODIFYING
ENZYME PROTEIN ARGININE METHYLTRANSFERASE-1
ESTABLISHES A CLINICALLY RELEVANT MODEL FOR
CONCOMITANT CONGENITAL CARDIAC AND CLEFT DEFECTS

1.0 ABSTRACT
Background: Our previous work implicates Wnt5a-mediated planar cell polarity (PCP) signaling
pathway derangements in the development of concomitant congenital heart disease and cleft lip
and/or palate (CHD+CLP). However, Wnt5a is known to be highly intolerant to loss-of-function
mutations in humans, and as such, cases of deleterious mutations in Wnt5a have rarely been
described in the literature. This suggests that understanding the factors that modify Wnt5a or
associated PCP signaling molecules may serve as a more clinically relevant mechanism to
explain the development of CHD+CLP. Protein arginine methyltransferase-1 (Prmt1) is an
enzyme that regulates gene transcription by catalyzing post-translational methylation of nuclear
histone proteins. Previous studies have shown that Prmt1 expression in cranial neural crest cells
(NCCs) is required for normal palatogenesis in the mouse and that loss of Prmt1 leads to a
downregulation of Wnt5a expression in this population. The objective of this study was to
determine if cardiac NCC Prmt1 expression is required for normal heart development.
Methods: Prmt1 expression was assessed by situ hybridization and immunostaining of wild-type
mice at relevant time points during cardiogenesis. Prmt1 was conditionally deleted in NCCs
using Wnt1-Cre recombinase mouse lines and cardiovascular phenotypes were evaluated by
standard paraffin processing protocols at embryonic day (E)14.5. To determine the effect that
loss of NCC-derived Wnt5a had on outflow tract length, India ink micropipette injections were
performed and outflow tract length was measured in control and mutant littermates at E10.5.
NCC and SHF cell migration, proliferation, and differentiation was assessed by
immunofluorescence staining at relevant time points. RNAseq was performed to evaluate the
global transcriptomic changes in NCCs following Prmt1 deletion, and Wnt5a expression in
105
NCCs was evaluated by RT-PCR and in situ hybridization. Using our previous transwell co-
culture system, the impact of Prmt1 knockdown in NCCs on SHF cell migratory capacity was
tested in vitro. All data were quantified using ImageJ software. Independent student t-tests or
one-factor analysis of variance (ANOVA) test for independent measures were used to
statistically compare differences between groups. All tests were two-sided and p<0.05 was
considered statistically significant.
Results: Prmt1 transcripts and protein are globally expressed in migratory and post-migratory
cardiac NCCs populations. Conditional deletion of Prmt1 from NCCs resulted in a fully
penetrant cleft palate and double outlet right ventricle (DORV) phenotype at E14.5. While NCC
migration and differentiation capacity was normal in Prmt1 mutants, proliferation and survival
was moderately reduced. Given the OFT malalignment defect observed in Prmt1 mutants, SHF
progenitor cells were evaluated. SHF cells demonstrated altered organization, PCP signaling, and
perturbed migration into the outflow tract, resulting in a 30% reduction in outflow tract length at
E10.5 in NCC-mutants. Comparative RNAseq analysis from isolated NCCs in control and
mutant embryos demonstrated a significant reduction in Wnt5a expression in mutants. This was
confirmed by RT-PCR and in situ hybridization. To test the genetic synergy of Prmt1 and Wnt5a
pathways in vivo, cardiovascular phenotypes were assessed in Wnt1-Cre, Prmt1 F/+, Wnt5a F/+
mice, and 75% of double heterozygotes had DORV phenotypes. Small interfering RNA
(siRNA)-mediated knockdown of Prmt1 in NCCs significantly reduced myoblast migratory
capacity and disrupted myoblast cytoplasmic polarization and cytoarchitecture in our co-culture
system, consistent with PCP abnormalities observed following Wnt5a knockdown in NCCs.
Exogenous supplementation with recombinant Wnt5a (rWnt5a) was found to rescue migratory
and morphologic defects in myoblasts following Prmt1 deletion in NCCs.
Conclusions: We show for the first time that Prmt1 is expressed in migratory and post-migratory
NCCs and that Prmt1 expressing NCCs are required for OFT alignment. Conditional deletion of
Prmt1 in the neural crest results in a shortened OFT due to the failure of SHF progenitor cell
migration. Consistent with previous studies in the cranial NCC domain, loss of Prmt1 led to a
downregulation of Wnt5a in cardiac NCCs. This suggests that Prmt1 may regulate Wnt5a in a
common manner in NCC derived palatal and cardiac tissues. The relationship between Prmt1 and
Wnt5a in cardiac NCCs was confirmed by genetic synergy and in vitro rescue experiments.
106
Taken together, our data are the first to define a role for Prmt1 in cardiac NCCs. With this
model, we reaffirm the importance of post-migratory NCCs on regulating PCP signaling and
alignment of the SHF-derived OFT and provide a clinically relevant model to study mechanisms
underlying concomitant CHD+CLP phenotypes observed in patients.

107
2.0 INTRODUCTION
Despite significant improvements in medical and surgical management, congenital heart
disease (CHD) remains the leading cause of birth defect-associated infant mortality in the United
States.
1,2
While most CHD patients are diagnosed with isolated cardiac lesions, it has been
estimated that 10-30% of CHD patients harbor concomitant extra-cardiac developmental
anomalies.
3-12
Our group previously reported that outflow tract CHD is among the most enriched
concomitant lesion sets encountered in patients with cleft malformations (cleft lip and/or palate,
CLP).
13-15
Given that neural crest cells (NCCs) are the only cell type that contributes to the
developing cardiac outflow tract (OFT) and palate, we inferred that concomitant CHD+CLP
lesions may arise as a result of common molecular defects in NCCs.
To better understand the molecular genetics of CHD+CLP, our group performed genetic
sequencing in CHD+CLP probands and their unaffected parents. We identified an enrichment of
rare de novo variants in molecules associated with the Wnt/planar cell polarity (PCP) signaling
pathway. These data suggest that genetic abnormalities in Wnt/PCP signaling may serve as one
potential mechanism to explain CHD+CLP disease pathogenesis. To test this hypothesis, we
developed genetic knockout mice in which Wnt/PCP ligand Wnt5a was conditionally deleted
from the neural crest. Our data demonstrated that NCC-derived Wnt5a is required for second
heart field (SHF) progenitor cell migration and normal cardiac OFT alignment, such that loss of
NCC-derived Wnt5a resulted in the most prevalent cardiac defects observed in CHD+CLP
patient cohorts - double outlet right ventricle (DORV). While our work in the Wnt5a mouse
model suggests that NCC-derived Wnt5a signals to SHF progenitors in a paracrine manner
during outflow tract morphogenesis, the mechanisms that regulate Wnt5a expression within the
neural crest remain unclear.
Protein arginine methyltransferase-1 (Prmt1) is a post-translational modifying enzyme
that catalyzes the asymmetric dimethylation of arginine residues on protein substrates.
16,17

Previous studies have identified several developmentally relevant substrates of Prmt1
methylation in mammalian systems, including proteins involved in BMP, TGF-beta, and Wnt
signal transduction pathways.
18-24
In addition to its activities in the cytosol, Prmt1 has also been
associated with epigenetic and transcriptional regulatory processes through methylation of
108
histone proteins.
25,26
Consistent with Prmt1’s involvement in a diverse network of cellular
signaling and gene regulatory pathways, it is unsurprising that global loss of Prmt1 has been
shown to be embryonically lethal in the mouse.
27
Tissue-specific deletion of Prmt1 in NCCs has
demonstrated that Prmt1 is critically required for palate development, with mutants exhibiting a
complete cleft palate phenotype.
28,29
In addition to this functional role for Prmt1 in cranial NCCs,
tissue transcriptomic analysis demonstrated that loss of Prmt1 resulted in a significant
downregulation of Wnt5a expression in NCC-derived palatal mesenchyme.
28
This suggests that
Prmt1-mediated arginine methylation may serve as a potential mechanism to regulate Wnt5a
expression in the neural crest.
In this study, we sought to test whether Prmt1 occupies a similar functional and
molecular role in the cardiac NCC domain. We conditionally deleted Prmt1 from NCCs using
Wnt1-Cre mice and demonstrated that mutants developed fully penetrant DORV phenotypes in
addition to cleft palate malformations. At the cellular level, loss of Prmt1 led to reduced second
heart field (SHF) progenitor cell migration into the OFT and a foreshortened OFT, consistent
with the malalignment DORV phenotype. Although NCCs were able to migrate and differentiate
appropriately in Prmt1 mutants, they demonstrated reduced survival over time. As was described
in the cranial NCC domain, Prmt1 deletion in cardiac NCCs led to a reduction in global histone 4
arginine 3 (H4R3) asymmetric dimethylation and a concomitant downregulation of Wnt5a
transcript expression. To confirm the genetic synergy between Prmt1 and Wnt5a pathways in
cardiac NCCs, double heterozygous mice were generated and 75% were found to harbor DORV
phenotypes. Moreover, supplementation with exogenous recombinant Wnt5a was sufficient to
rescue myoblast migratory and PCP defects following Prmt1 knockdown in a NCC-SHF cell co-
culture system, indicating functional synergy between these two pathways in vitro. Taken
together, our data suggest that Prmt1 epigenetically regulates paracrine Wnt5a-mediated PCP
signals to the SHF during outflow tract morphogenesis. Prmt1’s convergent molecular and
regulatory roles in cardiac and cranial NCC domains provides a common molecular mechanism
to explain the development of concomitant CHD+CL/P observed in patients.

109
3.0 RESULTS
Prmt1 is expressed in murine cardiac NCCs during outflow tract morphogenesis and loss of
NCC Prmt1 expression results in outflow tract and aortic arch malformations
To understand the spatiotemporal patterns of Prmt1 expressing cardiac NCCs during
heart development, we began by characterizing Prmt1 expression in pre- and post-migratory
cardiac NCCs by immunofluorescence. Cardiac NCCs and their progeny were lineage traced by
crossing the Rosa26-td-Tomato reporter mice with Wnt1-Cre mice. As expected, td-Tomato
labeled cardiac NCCs were seen migrating through the pharyngeal mesoderm at E10.5 and found
to reside within the subendocardial compartment of the outflow tract at this time point. At E12.5,
post-migratory cardiac NCCs were in sub-aortic mesenchyme, and tunica media of the great
vessels and aortic arch. We observed robust Prmt1 expression in cardiac NCCs residing in both
the outflow tract and pharyngeal mesoderm at embryonic day (E)10.5 (Figure 1A). As expected,
Prmt1 primarily displayed nuclear localization, with some cytoplasmic expression observed.
Prmt1 protein expression persisted in cardiac NCCs at E12.5, as Prmt1+ cardiac NCCs could be
observed within the smooth muscle layer of the aortic trunk, pulmonary trunk, and aortic arch as
well as the subaortic outflow tract mesenchyme in the heart (Figure 1A). This suggests that both
migratory and post-migratory cardiac NCCs robustly express Prmt1 during heart development. In
addition to cardiac NCCs, we also showed that Prmt1 transcripts and protein are uniformly
expressed in other cell types that contribute to the heart (Supplemental Figure 1, Supplemental
Figure 2). To assess Prmt1 expression in second heart field (SHF) derivatives, we surveyed
Prmt1 expression in the right ventricular and outflow tract endocardium as well as the right
ventricular myocardium. Prmt1 co-staining with CD31 (labeling endocardium) and myosin
heavy chain (MF-20) antibodies (labeling myocardium) showed that Prmt1 is expressed in each
of these SHF derivatives (Supplemental Figure 2). Prmt1’s global expression signature in various
cell-types and compartments of the embryonic cardiovascular system is consistent with the
potential for additional roles in cardiovascular development beyond the cardiac NCCs.
After establishing that Prmt1 is expressed in cardiac NCCs during outflow tract
morphogenesis, we sought to study the impact of loss of NCC Prmt1 expression on the
developing heart. We crossed Wnt1-Cre mice with those containing floxed Prmt1 alleles, kindly
110
provided by Dr. Jian Xu.
28
We confirmed efficient deletion of Prmt1 expression in the cardiac
neural crest by immunostaining at E10.5. In particular, Prmt1 protein expression was selectively
reduced within cardiac NCCs in the pharyngeal mesoderm and outflow tract, and not in other cell
types surrounding the neural crest (Figure 1B). Phenotypic analysis was performed in nineteen
E14.5 and post-natal day (P)0 Wnt1-Cre, Prmt1 mutants (Figure 1C-D, Supplemental Figure 3).
We found that 90% of conditional mutants develop the outflow tract malalignment defect double
outlet right ventricle (DORV). Of the two mutants that did not display DORV phenotypes, one
had pulmonary stenosis with ventricular septal defect and the other had a cervical aortic arch
malformation with no outflow tract abnormality. Of note, no Prmt1 mutants displayed common
arterial trunk (CAT) phenotypes, which suggests that loss of Prmt1 in NCCs does not adversely
impact the ability of NCCs to septate the outflow tract.
Outflow tract malalignment defects in NCC Prmt1 mutants are due to the failure second heart
field progenitor migration into the arterial pole of the heart
The enrichment of DORV phenotypes in Prmt1 mutants indicates that SHF cell biology is
being negatively affected in Prmt1 mutants. Previous studies have shown that outflow tract
malalignment is due to shortening of the SHF-derived outflow tract at the arterial pole. We
evaluated outflow tract length in two different ways in our model. First, we performed India ink
micropipette injections into the cardiac and outflow tract structures of Prmt1 control and mutant
embryos at E10.5. In addition to these whole mount experiments, we also performed serial
histologic analysis of sagittal sections of control and mutant embryos at this same time point.
Quantification of these data demonstrate a 36% reduction (p<0.0001) in the length of the outflow
tract in Prmt1 mutants relative to controls, consistent with the malalignment phenotype observed
at E14.5 (Figure 3A). Immunostaining of SHF progenitor cells using Islet-1 (Isl-1) showed that
Prmt1 mutants displayed inappropriate SHF migration into the outflow tract, with a 42%
reduction (p=0.002) of Isl-1 cells in the outflow tract at E9.5 and a 37% reduction (p<0.001) of
Isl-1 cells in the outflow tract at E10.5 (Figure 3B).
It is well established that Wnt/PCP signaling is required for SHF migration and outflow
tract alignment in the mouse. Mechanistically, Wnt/PCP defects result in inappropriate
polarization and organization of SHF progenitors such that they are unable to migrate into the
111
heart from adjacent pharyngeal mesoderm. To test if Wnt/PCP signaling derangements were
observed within SHF cells in our model, we performed co-staining with Isl-1 and multiple PCP
markers, including phalloidin, laminin, and ZO-1 (Figure 3C). Our data show that Isl-1
progenitors in Prmt1 mutants are highly disorganized in appearance, with reduced laminin and
zona occludens-1 (ZO-1) expression. In addition to this disorganized appearance, SHF
progenitors in Prmt1 mutants also displayed altered cytoarchitecture, with blunted phalloidin
expression and a lack of characteristic apicobasal polarity observed in control SHF. To confirm
that the lack of SHF cells within the outflow tract of Prmt1 mutants was not due to proliferative
abnormalities, we co-stained SHF cells with m-cycle marker phosphorylated histone H3 (pHH3)
and showed that proliferation was not significantly altered in SHF progenitors (Supplemental
Figure 4). As a consequence of altered PCP signaling in the SHF, differentiation of SHF
progenitors within the outflow tract was adversely impacted, leading to disrupted outflow tract
myocardialization by E12.5 and E13.5 (Figure 3D). Together, this staining pattern is consistent
with altered Wnt/PCP signaling in Prmt1 mutant SHF progenitors.
Prmt1 is necessary to maintain an adequate pool of post-migratory cardiac NCC progenitors in
the developing cardiac outflow tract
Because this study is the first to evaluate Prmt1 in cardiac NCCs, we wanted to determine
if Prmt1 maintains a cell-autonomous role within this population. Prmt1 has been shown to
occupy a conserved role in promoting the proliferative expansion of cells in various physiologic
and pathologic states. Moreover, previous studies in the cranial NCCs population demonstrated
that deletion of Prmt1 reduces proliferation in these cells and causes cleft palate malformations.
Thus, we wanted to determine if Prmt1 was similarly required to maintain cardiac NCC
proliferation in our model. However, in addition to proliferation, we also wanted to evaluate
whether Prmt1 has additional roles in cardiac NCC migration and differentiation. For migratory
analyses, we measured the population of lineage traced cardiac NCCs and their derivatives at
multiple time points in outflow tract development. At E10.5, Prmt1 deficient cardiac NCCs can
be observed within the proximal outflow tract at levels similar to control NCCs, indicating that
migratory capacity of Prmt1-null NCCs was preserved. However, at E13.5, we found that there
was a 54% reduction (p<0.001) in the number of td-Tomato labeled cardiac NCC and their
progeny within the outflow tract and aortic arch structures (Figure 3B). Co-staining with alpha-
112
smooth muscle actin (SMA) antibody demonstrated that cardiac NCCs retained the ability to
form smooth muscle cells in the tunica media of the aortic arch at this time point, establishing
that cardiac NCC differentiation was not altered in Prmt1 mutants (Supplemental Figure 5). The
reduction in the size of the cardiac NCC pool between E10.5 and E13.5 suggests that the
proliferative potential of cardiac NCCs was reduced following Prmt1 depletion. To confirm this,
we compared proliferation (using pHH3 co-staining) and apoptosis rates (using terminal
deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) assay) between Prmt1 control
and mutant cardiac NCCs. Our data showed that Prmt1 deficient NCCs had significantly reduced
proliferation beginning at day E9.5 and persisting through E10.5. Cellular apoptosis was mildly
increased in mutant cardiac NCCs at E10.5 (Figure 3B-C). These data collectively indicate that
Prmt1 is dispensable for cardiac NCC migration and differentiation. However, loss of Prmt1
reduces cardiac NCC survival, resulting in an inability to maintain the NCC progenitor pool
during outflow tract morphogenesis.
Prmt1 deficiency causes downregulation of Wnt5a in cardiac NCCs
Owing to Prmt1’s established role as a histone modifying enzyme, we evaluated global
levels of asymmetric histone 4 arginine 3 dimethylation (H4R3me2a) in control and mutant
tissues. Immunostaining demonstrated a marked reduction in global H4R3me2a expression
specifically within post-migratory cardiac NCCs of the outflow tract in Prmt1 mutants (Figure
4A). Global reduction of H4R3me2a signatures suggests a significant alteration of NCC gene
expression following Prmt1 depletion. Therefore, to study the transcriptomic changes in these
cells in vivo, we manually dissected thoracic tissues of E9.5 embryos, conducted single cell
suspension experiments, and isolated Wnt1-Cre, td-Tomato labeled cardiac NCCs using flow
cytometry (Figure 4B). As shown in Figure 4B, we were able to achieve distinct separation of td-
Tomato+ cell populations from td-Tomato- cells by flow cytometry. Total RNA was extracted
from sorted td-Tomato+ cardiac NCCs in Prmt1 control and mutants and bulk RNAseq was
performed.
Principal component analysis (PCA) and unsupervised hierarchical clustering was
performed to evaluate transcriptomic characteristics of the samples in an unbiased fashion. Prmt1
control and mutant cardiac NCCs demonstrated robust separation by PCA and hierarchical
113
clustering (Figure 4C-D). Differential gene expression analysis identified 1,777 transcripts that
were differentially expressed in Prmt1 control and mutant cells (656 upregulated in Prmt1
mutants; 1,121 downregulated in Prmt1 mutants), confirming global differences in gene
expression signatures between these conditions (Figure 4C-D). Gene ontology and pathway
enrichment analysis demonstrated that the most significantly differentially expressed genes
between Prmt1 control and mutant tissues were associated with the Wnt-signaling pathway.
Other implicated gene pathways are shown in Figure 4E. In accordance with what has been
previously described by Dr. Jian Xu and colleagues in the cranial neural crest, we observed a
statistically significant reduction in Wnt5a in cardiac NCCs deficient for Prmt1 (fold-change -
1.1, p=0.025). However, given the relatively small fold-changed predicted by bulk RNAseq, we
performed additional validation experiments to assess Wnt5a expression changes in mutant
neural crest. We first performed RT-PCR analysis on sorted cells and showed that Wnt5a
expression was downregulated in Prmt1 mutant NCCs (Figure 4F). We then confirmed RT-PCR
data by fluorescence in situ hybridization, which showed that cardiac NCCs (particularly those
residing within the outflow tract) demonstrate the most significant reduction in Wnt5a transcript
expression following Prmt1 deletion (Figure 4G). Together, these data not only affirm Prmt1’s
epigenetic role in the regulation of cardiac NCC gene expression signatures, but also indicate
that Wnt5a may serve as a potential target of Prmt1 in both cranial and cardiac NCC domains.
Prmt1 and Wnt5a signaling pathways demonstrate genetic and functional synergy in regulating
SHF progenitor biology
Our group previously showed that NCC-derived Wnt5a is critical for Wnt/PCP signaling
in SHF progenitor cells. In this study, we demonstrate that NCC-Prmt1 mutants phenocopy the
dominant cardiac lesion observed in conditional Wnt5a knockout mice and results in similar
mechanistic changes within the SHF, including dysregulated PCP signaling and a reduction in
Sema3c expression in the subpopulation SHF cells fated to become pulmonary trunk
(Supplemental Figure 6). In addition to this phenotypic convergence, the reduction of Wnt5a
gene expression in Prmt1-null NCCs suggests that Wnt5a may be downstream of Prmt1. To test
the genetic synergy between Prmt1 and Wnt5a pathways in the neural crest, we generated Wnt1-
Cre, Prmt1, Wnt5a double heterozygous mice and evaluated whether these double heterozygotes
develop outflow tract defects. Whereas Prmt1 or Wnt5a single heterozygotes do not display any
114
cardiac malformations, 75% of Wnt1-Cre, Prmt1 F/+, Wnt5a F/+

were found to develop DORV
or overriding aorta phenotypes at E14.5 (Figure 4A-B).
To demonstrate functional synergy between Prmt1 and Wnt5a pathways, we sought to
determine whether Wnt5a can rescue paracrine SHF defects caused by Prmt1 deficiency in the
neural crest. Using our NCC-myoblast co-culture platform, we found that siRNA-mediated
knockdown of Prmt1 in O9-1 NCCs significantly reduced migratory capacity of underlying
myoblasts, with a 26.5% difference in wound repopulated area compared to myoblasts assayed in
the presence of control NCCs (Figure 6A-C). In addition to this migratory deficit, myoblasts
assayed in the presence of Prmt1-null NCCs also displayed abnormal cytological morphology by
immunostaining, including a lack of polarization and protruding filapodia and lamellopodia.
These phenotypic changes are similar to those observed in SHF cells in vivo. Exogenous
supplementation with recombinant Wnt5a (rWnt5a) rescued myoblast migratory and
cytoarchitectural defects observed in Prmt1 knockdown conditions, indicating a functional
relationship between Prmt1 and Wnt5a molecules in the neural crest (Figure 6B-D). We are
currently pursuing an in vivo rescue experiment as outlined in Supplemental Figure 7A. This
experiment will include cardiovascular phenotypic assessments in genetically modified mice in
which Prmt1 will be deleted and Wnt5a will be concurrently overexpressed in NCCs. To date,
we have generated three founder mouse lines harboring a CAG-LSL-GFP-Wnt5a-V5 allele that
will be used for this experiment. A representative picture showing GFP reporter expression in
tail tips dissected from one founder line demonstrates robust expression following random
genomic insertion of this allele compared to a negative control littermate (Supplemental Figure
7B).

4.0 DISCUSSION
In this study, we investigated the function of Prmt1 in NCC-mediated cardiac outflow
tract biology. This analysis was completed through conditional genetic ablation of Prmt1 in
murine post-migratory cardiac NCCs. Our data demonstrate that Prmt1 is expressed in cardiac
NCCs throughout outflow tract morphogenesis and loss of Prmt1 expression results in near
complete double outlet right ventricle (DORV) phenotype. While Prmt1 has been studied in the
115
context of cranial NCC-mediated palatogenesis and post-natal cardiac physiology, to our
knowledge, this is the first study to examine the role of Prmt1 in cardiac NCC biology during
embryonic heart development.
28-32

As the primary type I arginine methyltransferase, Prmt1 is responsible for over 80% of
asymmetric arginine dimethylation in mammalian cells. Through these post-translational
modifications, Prmt1 has been shown to regulate the activity of a wide range of signal
transduction proteins from several signaling pathways, including BMP, TGFB, and Wnt.
However, in addition to influencing signal transduction cascades in the cytosol, Prmt1-mediated
arginine methylation has also been implicated in varying cellular processes within the nucleus.
These include DNA repair mechanisms, RNA nuclear export, and epigenetically-based gene
expression regulation through histone chromatin modifications.
33-38
Given the extensive array of
Prmt1 protein substrates and their diverse roles in mammalian systems, it is not surprising that
global genetic deletion of Prmt1 results in complete embryonic lethality by E8.5 in the mouse.
27

To circumvent this early global requirement of Prmt1 during embryogenesis, we pursued a NCC-
conditional deletion model and studied Prmt1’s role in the context of NCC-mediated outflow
tract morphogenesis.
We believe our findings highlight two important insights with respect to Prmt1’s role in
the cardiac neural crest. First, we found that Prmt1 expression is required for the proliferative
expansion of cardiac NCCs, yet is dispensable for migration and differentiation of NCCs. These
findings are in keeping with those of several other studies that have described Prmt1 as a
principle regulator of cellular proliferation in both developmental and disease contexts.
39-45
In
mouse cranial NCCs, loss of Prmt1 expression was shown to reduce NCC proliferation in the
palatal mesenchyme by 31%, potentially through direct repression of cell cycle genes.
28
While
the exact mechanism driving proliferative defects in cardiac NCCs were not evaluated here, our
bulk RNAseq pathway analysis demonstrated an enrichment of genes involved in cell cycle/p53
and apoptosis signaling, which suggests that a similar mechanism of action may be involved in
the cardiac NCC domain. In addition to Prmt1’s impact on cardiac NCC proliferation and
survival, our data also suggest that Prmt1 is involved in epigenetically regulating gene
expression signatures in these cells. This role is most strongly supported by the significant
reduction of global H4R3me2a expression and large-scale transcriptional changes identified in
116
Prmt1-null NCCs by RNAseq. Loss of Prmt1 was shown to cause a net downregulation of gene
expression (downregulated genes 64% vs upregulated genes 36%), which is consistent with its
role as a transcriptional activator in mammalian cells. These extensive transcriptomic changes
downstream of Prmt1 suggest that arginine methylation may be critical for the establishment of
post-migratory cardiac NCC gene programs relevant for other aspects of NCC biology. Such
findings warrant additional study.
Given that the DORV phenotype observed in NCC-Prmt1 mutants is traditionally
described as a SHF defect, we sought to evaluate SHF progenitor cells in our model. We showed
that SHF progenitors demonstrate poor cellular organization and limited migratory capacity
following Prmt1-depletion in the NCC. These SHF abnormalities resulted in Prmt1 mutants
having a shortened and malaligned outflow tract. It is well established that Wnt/PCP signaling is
required for SHF migration into the outflow tract during heart development. Evaluation of PCP
expression in SHF progenitor cells here showed a dysregulation of these markers, consistent with
a model whereby NCC-Prmt1 regulates PCP signaling in the SHF in a paracrine manner. Our
previous work identified NCC-derived Wnt5a as a potential mechanism to link paracrine PCP
signaling defects from the NCC to the SHF. Given recent findings by Guo and colleagues
showing that deletion of Prmt1 downregulates Wnt5a expression in cranial NCCs, we
hypothesized that Wnt5a may be acting downstream of Prmt1 in cardiac NCCs as well.
28
To test
this, we evaluated Wnt5a gene expression using multiple modalities, including RNAseq, targeted
expression analysis by RT-PCR, and fluorescence in situ hybridization. These experiments
collectively demonstrated a downregulation of Wnt5a in Prmt1 deficient cardiac NCCs, which is
mechanistically consistent with the phenotypic similarities observed in NCC Prmt1 and Wnt5a
mutant models. The genetic and functional synergy of the Prmt1-Wnt5a signaling axis in cardiac
NCCs was further corroborated by the observation that double heterozygous mice developed
DORV phenotypes and that recombinant Wnt5a treatment was sufficient to rescue PCP defects
in myoblasts in vitro. While it remains unclear how arginine methylation by Prmt1 regulates
Wnt5a expression in the neural crest, this mechanism is likely to involve epigenetic
modifications of histone chromatin architecture.
Taken together, our study provides the first characterization of Prmt1 in cardiac NCC
biology. We show that Prmt1 expression in cardiac NCCs is required for SHF accretion into the
117
outflow tract and appropriate outflow tract alignment through PCP signaling. Understanding this
paracrine relationship between NCCs and SHF cells not only offers insight into the
developmental principles governing outflow tract formation, but also provides a molecular
perspective to explain the enrichment of outflow tract alignment defects in patients with cleft
palate. Finally, given the established importance of histone modifying enzymes in the
developmental genetics of CHD, our work provides the first clinically relevant laboratory model
of molecular derangements that underlie concomitant CHD+CP.

5.0 MATERIALS AND METHODS
Mouse strains and genotyping
All animal experiments were carried out under protocols approved by the Institutional
Animal Care and Use Committee of the University of Southern California. Wnt1-Cre

mice used
in this study have been previously described.
46
During the breeding and experimental crosses,
the Cre gene was maintained on the paternal side to eliminate risk of germline transmission.
Prmt1 F/F mice were provided by Dr. Jian Xu’s lab and have been previously reported.
47
All
mice were genotyped using genomic DNA extracted from tail tip tissues collected at time of
weaning. A complete list of primers used for polymerase chain reaction (PCR) genotyping is
shown in Supplemental Table 1. To lineage trace the NCC during heart development, Wnt1-Cre
mice were crossed with Rosa26td-Tomato reporter mice to obtain Wnt1-Cre; Rosa26td-Tomato
embryos. These embryos were used for all experiments involving NCC immunostaining or
molecular characterizations. To identify SHF cells and their derivatives in conditional NCC
knockout mice, tissues were co-stained with Islet-1 (Isl-1) antibody, as this is known to be a
marker for SHF cells throughout outflow tract development.
Tissue histology and phenotypic analysis
Embryos were dissected in cold 1x PBS at appropriate time-points and genotypes were
confirmed using genomic DNA extracted from embryonic tail tips. For phenotypic analyses,
embryos underwent fixation with 10% formalin at 4°C overnight, followed by an ethanol/xylene
dehydration series and paraffin embedding. Paraffin embedded embryos were sectioned at 10µM
118
and underwent hematoxylin and eosin staining using standard protocols. For
immunofluorescence staining experiments, embryos were dissected in cold 1x PBS and
immediately placed in 4% paraformaldehyde and incubated at 4°C overnight. Embryos then
underwent cryopreservation through a sucrose dehydration sequence followed by OCT
embedding. Cryosections were made at 10µM. Antibodies used for immunofluorescence are
listed in Supplemental Table 2. Standard validation techniques included deletion of primary or
secondary antibody or use of blocking peptide to validate antibody specificity. Fluorescence in
situ hybridization for Wnt5a transcript expression in embryonic tissue sections was undertaken
using the commercially available RNAscope probe and manufacturer’s protocol (Advanced Cell
Diagnostics). Unless specifically mentioned, all phenotypic evaluations and immunofluorescence
stains performed in mutants were compared to Wnt1-Cre, Prmt1 F/+ littermate controls.
To assess progenitor cell migration, the integrated density of td-Tomato reporter (NCC)
or Islet1+ expression (SHF) was measured in the outflow tract of control and mutant littermates
at various time points using Image J software. Primary data were exported into SPSS and
analyzed. In all cases, experiments were repeated in multiple sections of multiple embryos from
different litters with littermate controls and all quantification was normalized to controls.
India ink injections and whole mount imaging
Pregnant dams were euthanized, and embryos were harvested at embryonic day (E)10.5.
Tail tips were dissected from embryos for genotyping. In each embryo, the thoracic cavity and
pericardium was dissected to expose the heart. Glass micropipettes were used to inject India ink
diluted in 1x PBS into the heart and pharyngeal arch arteries. Following injection, embryos were
fixed in 4% paraformaldehyde and incubated at 4°C overnight. After overnight fixation, embryos
underwent two 10-minute rinses with 1x PBS. Whole mount imaging was performed, and
sagittal pictures were taken to evaluate cardiac outflow tract length qualitatively. For quantitative
measurements of the outflow tract, serial paraffin sections of control and mutant embryos at
E10.5 were analyzed in Image J.
NCC isolation, flow cytometry sorting, and RNAseq analysis
119
Embryos were harvested at E9.5. Tail tips were removed to genotype as previously
described. During this time, embryos were left in 1x PBS at 4°C. Immediately following
genotyping, thoracic regions were carefully dissected from each embryo with the appropriate
genotype. For single cell suspension, we followed the manufacturer protocol outlined in Miltenyi
Biotec’s Multi-tissue Dissociation Kit #3 (Miltenyi Biotec, Germany). Briefly, dissected tissues
were placed in 1.5mL microcentrifuge tubes containing Buffer X and Enzyme T solution then
incubated in a rotating tube rack at 42°C for 10 minutes. After incubation, tissues were
transferred to a MACS-C tubes containing dissociation media comprised of Dulbecco’s Modified
Eagle’s Medium (DMEM), high glucose (4.5 g l−1), 10% Fetal bovine serum (FBS) (Fisher
Scientific, Cat# W3381E), and 1% penicillin-streptomycin (10,000 U ml−1 penicillin and 10,000
µg ml−1 streptomycin, Fisher Scientific, Cat# W3470H). Tissues then underwent additional
mechanical homogenization using the Miltenyi tissue dissociator (program Multi-D) followed by
centrifugation at 500xg for 10 minutes. Cell pellets were resuspended and filtered through a
100µM strainer with 15 mL of additional dissociation solution before a second round of
centrifugation. Following the second round of centrifugation, cell pellets were resuspended in
500µL 1x PBS with 1% bovine serum albumin (BSA) and transferred to a sterile 1.5mL
microcentrifuge tube kept on ice. Cells were then sorted by flow cytometry, which included
forward scatter, side scatter, pulse width, and RFP gates. Following sorting cells were kept on ice
and expeditiously placed in RNA lysis solution to begin the RNA extraction process.
Following RNA extraction, cDNA synthesis and library preparation was performed with
the SMARTer Stranded Total RNA-Seq Kit v2 - Pico Input Mammalian following manufacturer
protocols. Sequencing was conducted on the Illumina NextSeq Hi-Output platform (Illumina,
San Diego, California) at 150 cycles with 75 base-pair paired end reads. Reads were aligned to
human reference genome hg38 using the STAR (v2.4.1) aligner tool in Partek Flow. Counts were
assembled, filtered, and normalized by the upper quartile method. Differential expression
analysis, principal component analysis, and hierarchical clustering were performed according to
recommended programming settings in Partek Flow. Protein ANalysis THrough Evolutionary
Relationships (PANTHER) classification system (http://www.pantherdb.org/) and the Database
for Annotation, Visualization, and Integrated Discovery (DAVID) software
(https://david.ncifcrf.gov/home.jsp) were used to evaluate gene ontology and associated
120
pathways. Confirmatory RT-PCRs were performed for select genes using the primers outlined in
Supplemental Table 3.
O9-1 and C2C12 co-culture migratory assay
We utilized a transwell co-culture system to model the paracrine signaling relationship
between NCC and C2C12 cells, as previously described. O9-1 cells and C2C12 cells were
expanded and passaged according to published protocols.
48
To model the loss of NCC-derived
Prmt1 on myoblast migration, NCC inserts were incubated with 50nM of negative control
(scrambled) or Prmt1 siRNA prior to co-culture assembly. Functional rescue experiments were
performed by treating 50% of Prmt1 knockdown co-culture wells with exogenous recombinant
Wnt5a (rWnt5a, R&D Systems, Cat# 645-WN-010).
Statistical analyses
For all experiments requiring comparative statistics, cell counts and measurements were
performed in ImageJ using primary image files. Data were exported from ImageJ into SPSS and
descriptive statistics were calculated. To compare differences between control and mutant
datasets, two-tailed independent Student’s t-tests were performed in each experiment as
appropriate. Statistical significance was defined as p<0.05.

121
6.0 TABLES AND FIGURES
Table 1. Cardiovascular phenotypes in Prmt1 control and mutant embryos.

Genotype
No. (%)
Normal
Double outlet
right ventricle
Cervical arch
(+VSD)
Pulmonary
stenosis
(+VSD)
Wnt1-Cre; PRMT1
F/+
(n=10) 10 (100) 0 (0) 0 (0) 0 (0)
Wnt1-Cre; PRMT1
F/F
(n=19) 0 (0) 17 (90) 1 (5) 1 (5)
122
Figure 1. (A) Prmt1 is robustly expressed in neural crest cells and (B-C) deletion of neural crest
cell derived Prmt1 results in double outlet right ventricle phenotypes at embryonic day (E)14.5.

a b
Aortic Arch
DAPI PRMT1 tdT DAPI tdT DAPI PRMT1
DAPI PRMT1 tdT DAPI tdT DAPI PRMT1
OFT
Ao
PA
Ao
PA
Ao
PA
Ao Ao Ao
E12.5
E12.5
E12.5
E12.5
E12.5
E12.5
Aortic arch Proximal OFT Proximal OFT OFT Septum Arch arteries
DAPI PRMT1 tdT DAPI tdT DAPI PRMT1
DAPI PRMT1 tdT
DAPI PRMT1 tdT
DAPI tdT DAPI PRMT1
DAPI PRMT1 DAPI tdT
E10.5 E10.5 E10.5
E10.5 E10.5 E10.5
E10.5 E10.5 E10.5
c
Mutant Control
E14.5
E14.5
E14.5
E14.5
DAPI PRMT1 tdT
DAPI PRMT1 tdT
DAPI PRMT1 tdT
DAPI PRMT1 tdT
Mutant Control
E10.5
E10.5
E10.5
E10.5
E10.5
E10.5
E10.5
E10.5
Mutant Control
Outflow tract Arch arteries
E10.5
E10.5
E10.5
E10.5
E10.5
E10.5
E10.5
E10.5
123
Figure 2. (A) Loss of neural crest cell derived Prmt1 leads to outflow tract shortening due to a
(B-D) dysregulated planar cell polarity signaling and a failure of second heart field cellular
migration into the outflow tract.

a b
c d
Mutant Control
III
IV
VI
dAo
1mm
III
IV
VI
dAo
1mm
0.0
0.2
0.4
0.6
0.8
1.0
1.2
Control Mutant
Relative OFT length Average OFT length
(normalized to control)
P<0.0001
Control Mutant
E10.5
III
IV
VI
dAo
1mm
III
IV
VI
dAo
1mm
0.0
0.2
0.4
0.6
0.8
1.0
1.2
Control Mutant
Relative OFT length Average OFT length
(normalized to control)
P<0.0001
Average OFT length
(normalized to control)
Control Mutant
E10.5
P<0.0001
Mutant Control
DAPI Islet1
DAPI Islet1 DAPI Islet1
DAPI Islet1
E9.5
E9.5 E10.5
E10.5
0
0.2
0.4
0.6
0.8
1
1.2
1 2 3 4
Average Isl1 intensity
(normalized to control)
ns P<0.001
E9.5 E10.5 E9.5 E10.5
Pharyngeal
Mesoderm
Cardiac OFT
ns P=0.002
= Control
= Mutant
Mutant Control
DAPIMF20Islet1 E10.5
DAPIMF20Islet1
DAPIMF20
DAPIMF20
DAPIMF20tdT
DAPIMF20tdT E10.5
E12.5
E12.5
E13.5
E13.5
Islet1
Islet1
E10.5
E10.5
Phalloidin
Phalloidin DAPI Islet1 Laminin DAPI ZO-1 Islet1
DAPI Islet1 Laminin DAPI ZO-1 Islet1
E10.5
E10.5
E10.5
E10.5
E10.5
E10.5
Mutant Control
Mutant Control
DAPI Islet1
DAPI Islet1 DAPI Islet1
DAPI Islet1
E9.5
E9.5 E10.5
E10.5
0
0.2
0.4
0.6
0.8
1
1.2
1 2 3 4
Average Isl1 intensity
(normalized to control)
ns P<0.001
E9.5 E10.5 E9.5 E10.5
Pharyngeal
Mesoderm
Cardiac OFT
ns P=0.002
= Control
= Mutant
Mutant Control
DAPI Islet1
DAPI Islet1 DAPI Islet1
DAPI Islet1
E9.5
E9.5 E10.5
E10.5
0
0.2
0.4
0.6
0.8
1
1.2
1 2 3 4
Average Isl1 intensity
(normalized to control)
ns P<0.001
E9.5 E10.5 E9.5 E10.5
Pharyngeal
Mesoderm
Cardiac OFT
ns P=0.002
= Control
= Mutant
Mutant Control
DAPI Islet1
DAPI Islet1 DAPI Islet1
DAPI Islet1
E9.5
E9.5 E10.5
E10.5
0
0.2
0.4
0.6
0.8
1
1.2
1 2 3 4
Average Isl1 intensity
(normalized to control)
ns P<0.001
E9.5 E10.5 E9.5 E10.5
Pharyngeal
Mesoderm
Cardiac OFT
ns P=0.002
= Control
= Mutant
124
Figure 3. (A) Prmt1 expression is dispensable for cardiac neural crest cell migration into the
outflow tract. (B-C) However, Prmt1 is required to maintain the pool of post-migratory cardiac
neural crest cell progenitors by regulating proliferation and apoptosis.

a
0.0
0.2
0.4
0.6
0.8
1.0
1.2
1 2
Standardized average tdT intensity
Wnt1-Cre;
PRMT1
F/F
Wnt1-Cre;
PRMT1
F/+
P=0.5813
Average tdT intensity
(normalized to control)
Control Mutant
0.0
0.2
0.4
0.6
0.8
1.0
1.2
1 2
Standardized average tdT intensity
Wnt1-Cre;
PRMT1
F/F
Wnt1-Cre;
PRMT1
F/+
P<0.0001
Average tdT intensity
(normalized to control)
Control Mutant
E13.5 E10.5
0.0
0.2
0.4
0.6
0.8
1.0
1.2
1 2
Standardized average tdT intensity
Wnt1-Cre;
PRMT1
F/F
Wnt1-Cre;
PRMT1
F/+
P=0.5813
Average tdT intensity
(normalized to control)
Control Mutant
0.0
0.2
0.4
0.6
0.8
1.0
1.2
1 2
Standardized average tdT intensity
Wnt1-Cre;
PRMT1
F/F
Wnt1-Cre;
PRMT1
F/+
P<0.0001
Average tdT intensity
(normalized to control)
Control Mutant
E13.5 E10.5
Mutant Control
AoV
AoV
dAo
dAo
DAPI tdT
DAPI tdT tdT
tdT DAPI tdT
DAPI tdT
DAPI tdT
DAPI tdT
E10.5
E10.5
E10.5
E10.5
E13.5
E13.5
E13.5
E13.5
125

b
Mutant Control
Pharyngeal mesoderm Pharyngeal mesoderm Outflow tract Outflow tract
DAPI Phh3 tdT E9.5
DAPI Phh3 tdT E9.5
DAPI Phh3 tdT E9.5
DAPI Phh3 tdT E9.5
DAPI Phh3 tdT E10.5
DAPI Phh3 tdT E10.5
DAPI Phh3 tdT E10.5
DAPI Phh3 tdT E10.5
0
20
40
60
Control Mutant
Mean number of
pHH3+/tdT+ cells
Litter 1
P<0.001
0
10
20
30
40
50
Mean number of
pHH3+/tdT+ cells per HPF
0
10
20
30
40
50
Mean number of
pHH3+/tdT+ cells per HPF
Control Mutant
P=0.0041
c
Control Mutant
DAPI TUNEL tdT
DAPI TUNEL tdT
DAPI TUNEL tdT
DAPI TUNEL tdT
Outflow tract Pharyngeal mesoderm
E10.5
E10.5
E10.5
E10.5
0
15
30
45
60
75
90
Mean number of
TUNEL+/tdT+ cells per HPF
P=0.0372
Control Mutant
126
Figure 4. (A) Prmt1 depletion causes global reduction of asymmetric dimethylated histone H4
arginine 3 and (B-E) global transcriptomic changes in the neural crest. (F-G) RNAseq analysis
identified Wnt5a as a downregulated gene following Prmt1 deletion.

a
Mutant Control
DAPI H4R3me2a
DAPI H4R3me2a
DAPI tdT
DAPI tdT
DAPI H4R3me2a tdT
DAPI H4R3me2a tdT
E10.5
E10.5
E10.5
E10.5
E10.5
E10.5
b
c
DAPIWnt5a DAPItdT
Mutant Control
DAPIWnt5a DAPItdT
E10.5
E10.5
E10.5
E10.5
d
g f
e
0 5 10 15 20
Wnt signaling
Chemokine and cytokine signaling
CCKR signaling
Integrin signaling
GnRH receptor pathway
G-protein signaling (Gi-a, Gs-a)
Cadherin signaling
PDGF signaling
Angiogenesis
Endothelin signaling
TGF-beta signaling
Slit/Robo signaling
nACh receptor signaling
EGF receptor signaling
Alzheimer disease
T cell activation
PI3 kinase pathway
mACh receptor signaling
Glutamate receptor (group II)
Glutamate receptor (group III)
Number of genes
0 5 10 15 20
Wnt signaling
Ubiquitin proteasome
Huntington disease
Apoptosis signaling
p53 pathway
Parkinson disease
Cell cycle
CCKR signaling
Glycolysis
bZIP transcription factor
Integrin signaling
Chemokine and cytokine signaling
G-protein signaling (Gq-a, Go-a)
GnRH receptor pathway
G-protein signaling (Gi-a, Gs-a)
General transcription regulation
Alzheimer disease
De novo purine biosynthesis
p53 pathway feedback
FAS signaling
Number of genes
Pathway analysis of genes upregulated in
PRMT-1 mutants:
Pathway analysis of genes downregulated
in PRMT-1 mutants:
0 5 10 15 20
Wnt signaling
Chemokine and cytokine signaling
CCKR signaling
Integrin signaling
GnRH receptor pathway
G-protein signaling (Gi-a, Gs-a)
Cadherin signaling
PDGF signaling
Angiogenesis
Endothelin signaling
TGF-beta signaling
Slit/Robo signaling
nACh receptor signaling
EGF receptor signaling
Alzheimer disease
T cell activation
PI3 kinase pathway
mACh receptor signaling
Glutamate receptor (group II)
Glutamate receptor (group III)
Number of genes
0 5 10 15 20
Wnt signaling
Ubiquitin proteasome
Huntington disease
Apoptosis signaling
p53 pathway
Parkinson disease
Cell cycle
CCKR signaling
Glycolysis
bZIP transcription factor
Integrin signaling
Chemokine and cytokine signaling
G-protein signaling (Gq-a, Go-a)
GnRH receptor pathway
G-protein signaling (Gi-a, Gs-a)
General transcription regulation
Alzheimer disease
De novo purine biosynthesis
p53 pathway feedback
FAS signaling
Number of genes
Pathway analysis of genes upregulated in
PRMT-1 mutants:
Pathway analysis of genes downregulated
in PRMT-1 mutants:
Prmt1 Wnt5a
Relative mRNA expression
C-1 C-2 M-3 M-1 M-2 C-3
127
Figure 5. (A) Double heterozygous mice for Prmt1 and Wnt5a develop outflow tract alignment
defects, confirming the genetic synergy between these pathways in regulating second heart field
biology in vivo. (B) Table summarizing all double heterozygote phenotypes (n=8)

a
b
Wnt1-Cre, Prmt1
F/+
, Wnt5a
F/+
E14.5 E14.5 E14.5
E14.5 phenotypes
Wnt1-Cre, Prmt1
F/+
, Wnt5a
F/+
Total N=8
Cardiac defects
Normal 2 (25)
Double outlet right ventricle 6 (75)
Arch artery defects
Cervical aortic arch 3 (37.5)
128
Figure 6. (A) Design of in vitro rescue experiment. (B-D) Neural crest cell-derived Prmt1 is
necessary for myoblast migration and planar cell polarity signaling in vitro. Addition of
exogenous rWnt5a is sufficient to rescue migratory and morphologic deficits in myoblasts.

a b
c d
O9 insert NC siRNA O9 insert Prmt1 siRNA
O9 insert Prmt1 siRNA +
500ng/mL rWnt5a
0-hr post scratch 10-hr post scratch
0
20
40
60
80
100
0-hr 10-hrs
NC siRNA
Prmt1 siRNA
Prmt1 siRNA + rWnt5a
Time since scratch
Repopulated area (%)
P=0.5483
P<0.0001
0
20
40
60
80
100
0-hr 10-hrs
NC siRNA
Prmt1 siRNA
Prmt1 siRNA + rWnt5a
O9 insert NC siRNA O9 insert Prmt1 siRNA
O9 insert Prmt1 siRNA +
500ng/mL rWnt5a
0-hr post scratch 10-hr post scratch
-24hrs Time 0 24hrs 48hrs 72hrs
Cells
plated
siRNA added
Scratch
performed
Scratch assay ended,
cells imaged and
stained
96hrs
NC
siRNA
Prmt1
siRNA
Prmt1 siRNA
+ rWnt5a
129
Supplemental Figure 1. Fluorescence in situ hybridization confirms Prmt1 transcript expression
in the developing heart.

Anti-sense probe Anti-sense probe
DAPI Prmt1 E10.5
DAPI Prmt1 E10.5
DAPI Prmt1 E10.5
DAPI Prmt1 E10.5
DAPI Prmt1 E10.5
Right ventricle Pharyngeal mesoderm Outflow tract
130
Supplemental Figure 2. (A) Immunostaining confirms robust and uniform Prmt1 expression at
relevant periods throughout heart development, including the (B) ventricular and outflow tract
endocardium and (C) myocardium.

a
b
DAPI PRMT1
DAPI PRMT1 DAPI PRMT1 DAPI PRMT1
DAPI PRMT1 DAPI PRMT1 DAPI PRMT1
E10.5 E9.5 E12.5
c
E10.5
DAPI PRMT1 CD31 DAPI PRMT1 CD31 DAPI PRMT1 CD31 DAPI PRMT1 CD31
20x 20x
DAPI PRMT1 CD31 DAPI PRMT1 CD31
20x
E12.5
DAPI MF20 PRMT1 DAPI MF20 PRMT1
DAPI MF20 PRMT1 DAPI MF20 PRMT1 DAPI MF20 PRMT1
E10.5 E12.5
131
Supplemental Figure 3. (A) Whole mount imaging and (B) India ink injections confirm double
outlet right ventricle phenotype in Prmt1 mutants at post-natal day 0.

a
P0 Control P0 Wnt1-Cre; PRMT1
F/F
Wnt1-Cre, PRMT1
F/+
Wnt1-Cre, PRMT1
F/F
b
Wnt1-Cre, PRMT1
F/+
Wnt1-Cre, PRMT1
F/F
132
Supplemental Figure 4. Second heart field cells display similar levels of proliferation in Prmt1
control and mutant embryos.

a
Mutant Control
DAPI Islet1 pHH3 E9.5
DAPI Islet1 pHH3 E9.5
DAPI Islet1 pHH3 E10.5
DAPI Islet1 pHH3 E10.5
133
Supplemental Figure 5. Neural crest cells maintain the capacity to differentiate into smooth
muscle cells of the aortic arch in Prmt1 mutants.

a
Mutant Control
DAPI Sm22a
E13.5
DAPI tdT
E13.5
DAPI Sm22a tdT
E13.5
DAPI Sm22a
E13.5
DAPI tdT
E13.5
DAPI Sm22a tdT
E13.5
134
Supplemental Figure 6. (A) Semaphorin 3c expression is initially expressed normally within
the second heart field cells of the outflow tract at embryonic day (E)10.5. (B) However, its
expression is reduced in second heart field cells fated to become pulmonary trunk myocardium at
E12.0.

a
Mutant Control
DAPI Sema3c Islet1 E10.5
DAPI Sema3c Islet1 E10.5
DAPI PlexinA2 tdT E10.5
DAPI PlexinA2 tdT E10.5
b
DAPI Sema3c
PA
Ao
DAPI Sema3c
PA
Ao
Control Mutant
E12.0
E12.0
135
Supplemental Figure 7. (A) Breeding strategy for planned in vivo rescue experiments aimed at
overexpressing Wnt5a in neural crest cells following Prmt1 depletion. (B) Fluorescence whole
mount and histologic analysis confirms genomic integration of transgenic Wnt5a-v5 fragment in
founder mice.

a
Prmt1
LoxP LoxP
Wnt1-Cre
Prmt1
LoxP LoxP
Prmt1
-/-
Wnt1-Cre
Wnt5a-v5
LoxP
Wnt5a-v5
CAG
Rescue of DORV DORV
Wnt5a-v5
sGFP
LoxP LoxP
CAG
b
DAPIGFPCD31
DAPIGFPCD31
GFP
GFP
Littermate Founder #2
136
Supplemental Table 1. Primers used for genotyping mice based on extracted genomic DNA.
Gene name Forward primer Reverse primer
Wnt1-Cre CCTCTATCGAACAAGCATGCG GCCAATCTATCTGTGACGGC
Prmt1 F/F GTCAAAGCCAACAAGTTAGACC
ATG
CTGAGGGATGGGAAACCCTCGC
AC
Wnt5a F/F GGTGAGGGACTGGAAGTTGC GGAGCAGATGTTTATTGCCTTC
R26R-tdT CTCTGCTGCCTCCTGGCTTCT CGAGGCGGATCACAAGCAATA

137
Supplemental Table 2. Antibodies, probes, and chemical reagents used for expression and
experimental analyses
Target gene/protein Catalog number (Company) Working
concentration
Prmt1 (Rabbit polyclonal) 2449S (Cell signaling) 1 ug/mL
Islet1 (Goat polyclonal) AF1837 (R&D Systems) 10 ug/mL
pHH3 (Rabbit polyclonal) 9701S (Cell signaling) 1 ug/mL
CD31 (Goat polyclonal) AF3628 (R&D Systems) 1 ug/mL
MHC II (Mouse monoclonal) 14-6503-82 (Thermofisher) 1 ug/mL
Alpha-SMA (Rabbit
polyclonal)
NBP1-30894 (Novus Biologicals) 1 ug/mL
Semaphorin3c (Rabbit
polyclonal)
AB214309 (Abcam) 5 ug/mL
Phalloidin (488-conjugate) AB176753 (Abcam) 0.5 ug/mL
Laminin (Rabbit polyclonal) NB300-144 (Novus Biologicals) 5 ug/mL
ZO-1 (Rabbit polyclonal) 61-7300 (Thermofisher) 1 ug/mL
H4R3me2a (Rabbit
polyclonal)
39705 (Active Motif) 1 ug/mL
Mm-Wnt5a probe 316798 (Advanced Cell
Diagnostics)
Assay dependent
Recombinant Wnt5a protein 645-WN-010 (R&D Systems) 500 ng/mL

138
Supplemental Table 3. Primers used for gene expression analysis by RT-PCR.
Gene
name
Forward primer Reverse primer
GAPDH AGGTCGGTGTGAACGGATTTG TGTAGACCATGTAGTTGAGGTCA
PRMT1 TACTACTTTGACTCCTATGCCCA ATGCCGATTGTGAAACATGGA
WNT5A CAACTGGCAGGACTTTCTCAA CATCTCCGATGCCGGAACT

139
7.0 REFERENCES
1. Oster ME, Lee KA, Honein MA, Riehle-Colarusso T, Shin M, Correa A. Temporal trends
in survival among infants with critical congenital heart defects. Pediatrics.
2013;131(5):e1502-8.
2. Best KE, Rankin J. Long-Term Survival of Individuals Born With Congenital Heart
Disease: A Systematic Review and Meta-Analysis. J Am Heart Assoc.
2016;5(6):e002846.
3. Tennstedt C, Chaoui R, Korner H, Dietel M. Spectrum of congenital heart defects and
extracardiac malformations associated with chromosomal abnormalities: Results of a
seven year necropsy study. Heart. 1999;82:34-9
4. Hoffman JI, Christianson R. Congenital heart disease in a cohort of 19,502 births with
long-term follow-up. Am J Cardiol. 1978;42:641-7
5. Ferencz C, Rubin JD, McCarter RJ, Boughman JA, Wilson PD, Brenner JI, et al. Cardiac
and noncardiac malformations: Observations in a population-based study. Teratology.
1987;35:367-78
6. Greenwood RD. Cardiovascular malformations associated with extracardiac anomalies
and malformation syndromes. Patterns for diagnosis. Clin Pediatr. 1984;23:145-51
7. Ferencz C, Boughman JA, Neill CA, Brenner JI, Perry LW. Congenital cardiovascular
malformations: Questions on inheritance. Baltimore-Washington Infant Study Group. J
Am Coll Cardiol.1989;14:756-63.
8. Egbe A, Lee S, Ho D, Uppu S, Srivastava S. Prevalence of congenital anomalies in
newborns with congenital heart disease diagnosis. Ann Pediatr Cardiol. 2014;7(2):86-91.
9. Meberg A, Hals J, Thaulow E. Congenital heart defects--chromosomal anomalies,
syndromes and extracardiac malformations. Acta Paediatr. 2007;96(8):1142-5.
140
10. Rosa RC, Rosa RF, Zen PR, Paskulin GA. Congenital heart defects and extracardiac
malformations. Rev Paul Pediatr. 2013;31(2):243-51.
11. Eskedal L, Hagemo P, Eskild A, Aamodt G, Seiler KS, Thaulow E. A population-based
study of extra-cardiac anomalies in children with congenital cardiac malformations.
Cardiol Young. 2004;14(6):600-7.
12. Patel A, Costello JM, Backer CL, Pasquali SK, Hill KD, Wallace AS, Jacobs JP, Jacobs
ML. Prevalence of Noncardiac and Genetic Abnormalities in Neonates Undergoing
Cardiac Operations: Analysis of The Society of Thoracic Surgeons Congenital Heart
Surgery Database. Ann Thorac Surg. 2016;102(5):1607-1614.
13. Munabi NCO, Swanson J, Auslander A, Sanchez-Lara PA, Davidson Ward SL, Magee
WP 3rd. The Prevalence of Congenital Heart Disease in Nonsyndromic Cleft Lip and/or
Palate: A Systematic Review of the Literature. Ann Plast Surg. 2017;79(2):214-220.
14. Azadgoli B, Munabi NCO, Fahradyan A, Auslander A, McCullough M, Aflatooni N,
Davidson Ward SL, Kumar SR, Sanchez-Lara PA, Swanson J, Magee WP 3rd.
Congenital Heart Disease in Patients With Cleft Lip/Palate and Its Impact on Cleft
Management. Cleft Palate Craniofac J. 2020;57(8):957-966.
15. Toubat O, Mallios DN, Munabi NCO, Magee WP 3rd, Starnes VA, Kumar SR. Clinical
Importance of Concomitant Cleft Lip/Palate in the Surgical Management of Patients With
Congenital Heart Disease. World J Pediatr Congenit Heart Surg. 2021;12(1):35-42.
16. Blanc RS, Richard S. Arginine Methylation: The Coming of Age. Mol Cell.
2017;65(1):8-24.
17. Tang J, Frankel A, Cook RJ, Kim S, Paik WK, Williams KR, Clarke S, Herschman HR.
PRMT1 is the predominant type I protein arginine methyltransferase in mammalian cells.
J Biol Chem. 2000;275(11):7723-30.
18. Xu J, Wang AH, Oses-Prieto J, Makhijani K, Katsuno Y, Pei M, Yan L, Zheng YG,
Burlingame A, Brückner K, Derynck R. Arginine Methylation Initiates BMP-Induced
Smad Signaling. Mol Cell. 2013;51(1):5-19.
141
19. Wu J, Chen X, Sehgal P, Zhang T, Jackson-Weaver O, Gou Y, Bautch V, Frenkel B, Sun
H, Xu J. Arginine methylation of R81 in Smad6 confines BMP-induced Smad1 signaling.
J Biol Chem. 2021;296:100496.
20. Katsuno Y, Qin J, Oses-Prieto J, Wang H, Jackson-Weaver O, Zhang T, Lamouille S, Wu
J, Burlingame A, Xu J, Derynck R. Arginine methylation of SMAD7 by PRMT1 in TGF-
β-induced epithelial-mesenchymal transition and epithelial stem-cell generation. J Biol
Chem. 2018;293(34):13059-13072.
21. Cha B, Park Y, Hwang BN, Kim SY, Jho EH. Protein Arginine Methyltransferase 1
Methylates Smurf2. Mol Cells. 2015;38(8):723-8.
22. Albrecht LV, Ploper D, Tejeda-Muñoz N, De Robertis EM. Arginine methylation is
required for canonical Wnt signaling and endolysosomal trafficking. Proc Natl Acad Sci
U S A. 2018;115(23):E5317-E5325.
23. Bikkavilli RK, Avasarala S, Vanscoyk M, Sechler M, Kelley N, Malbon CC, Winn RA.
Dishevelled3 is a novel arginine methyl transferase substrate. Sci Rep. 2012;2:805.
24. Bikkavilli RK, Malbon CC. Arginine methylation of G3BP1 in response to Wnt3a
regulates β-catenin mRNA. J Cell Sci. 2011;124(Pt 13):2310-20.
25. Wang H, Huang ZQ, Xia L, Feng Q, Erdjument-Bromage H, Strahl BD, Briggs SD, Allis
CD, Wong J, Tempst P, Zhang Y. Methylation of histone H4 at arginine 3 facilitating
transcriptional activation by nuclear hormone receptor. Science. 2001;293(5531):853-7.
26. Wesche J, Kühn S, Kessler BM, Salton M, Wolf A. Protein arginine methylation: a
prominent modification and its demethylation. Cell Mol Life Sci. 2017;74(18):3305-3315.
27. Pawlak MR, Scherer CA, Chen J, Roshon MJ, Ruley HE. Arginine N-methyltransferase 1
is required for early postimplantation mouse development, but cells deficient in the
enzyme are viable. Mol Cell Biol. 2000;20(13):4859-69.
142
28. Gou Y, Li J, Jackson-Weaver O, Wu J, Zhang T, Gupta R, Cho I, Ho TV, Chen Y, Li M,
Richard S, Wang J, Chai Y, Xu J. Protein Arginine Methyltransferase PRMT1 Is
Essential for Palatogenesis. J Dent Res. 2018;97(13):1510-1518.
29. Gou Y, Li J, Wu J, Gupta R, Cho I, Ho TV, Chai Y, Merrill A, Wang J, Xu J. Prmt1
regulates craniofacial bone formation upstream of Msx1. Mech Dev. 2018;152:13-20.
30. Pyun JH, Kim HJ, Jeong MH, Ahn BY, Vuong TA, Lee DI, Choi S, Koo SH, Cho H,
Kang JS. Cardiac specific PRMT1 ablation causes heart failure through CaMKII
dysregulation. Nat Commun. 2018;9(1):5107.
31. Jackson-Weaver O, Ungvijanpunya N, Yuan Y, Qian J, Gou Y, Wu J, Shen H, Chen Y,
Li M, Richard S, Chai Y, Sucov HM, Xu J. PRMT1-p53 Pathway Controls Epicardial
EMT and Invasion. Cell Rep. 2020;31(10):107739.
32. Murata K, Lu W, Hashimoto M, Ono N, Muratani M, Nishikata K, Kim JD, Ebihara S,
Ishida J, Fukamizu A. PRMT1 Deficiency in Mouse Juvenile Heart Induces Dilated
Cardiomyopathy and Reveals Cryptic Alternative Splicing Products. iScience.
2018;8:200-213.
33. Vadnais C, Chen R, Fraszczak J, Yu Z, Boulais J, Pinder J, Frank D, Khandanpour C,
Hébert J, Dellaire G, Côté JF, Richard S, Orthwein A, Drobetsky E, Möröy T. GFI1
facilitates efficient DNA repair by regulating PRMT1 dependent methylation of MRE11
and 53BP1. Nat Commun. 2018;9(1):1418.
34. Izumikawa K, Ishikawa H, Simpson RJ, Takahashi N. Modulating the expression of
Chtop, a versatile regulator of gene-specific transcription and mRNA export. RNA Biol.
2018;15(7):849-855.
35. Chang CT, Hautbergue GM, Walsh MJ, Viphakone N, van Dijk TB, Philipsen S, Wilson
SA. Chtop is a component of the dynamic TREX mRNA export complex. EMBO J.
2013;32(3):473-86.
143
36. Li X, Hu X, Patel B, Zhou Z, Liang S, Ybarra R, Qiu Y, Felsenfeld G, Bungert J, Huang
S. H4R3 methylation facilitates beta-globin transcription by regulating histone
acetyltransferase binding and H3 acetylation. Blood. 2010;115(10):2028-37.
37. Huang S, Litt M, Felsenfeld G. Methylation of histone H4 by arginine methyltransferase
PRMT1 is essential in vivo for many subsequent histone modifications. Genes Dev.
2005;19(16):1885-93.
38. Rezai-Zadeh N, Zhang X, Namour F, Fejer G, Wen YD, Yao YL, Gyory I, Wright K,
Seto E. Targeted recruitment of a histone H4-specific methyltransferase by the
transcription factor YY1. Genes Dev. 2003;17(8):1019-29.
39. Shibata Y, Okada M, Miller TC, Shi YB. Knocking out histone methyltransferase
PRMT1 leads to stalled tadpole development and lethality in Xenopus tropicalis. Biochim
Biophys Acta Gen Subj. 2020;1864(3):129482.
40. Yu Z, Chen T, Hébert J, Li E, Richard S. A mouse PRMT1 null allele defines an essential
role for arginine methylation in genome maintenance and cell proliferation. Mol Cell
Biol. 2009;29(11):2982-96.
41. Hua ZY, Hansen JN, He M, Dai SK, Choi Y, Fulton MD, Lloyd SM, Szemes M, Sen J,
Ding HF, Angelastro JM, Fei X, Li HP, Wu CR, Yang SY, Malik K, Bao X, George
Zheng Y, Liu CM, Schor NF, Li ZJ, Li XG. PRMT1 promotes neuroblastoma cell
survival through ATF5. Oncogenesis. 2020;9(5):50.
42. Liao HW, Hsu JM, Xia W, Wang HL, Wang YN, Chang WC, Arold ST, Chou CK, Tsou
PH, Yamaguchi H, Fang YF, Lee HJ, Lee HH, Tai SK, Yang MH, Morelli MP, Sen M,
Ladbury JE, Chen CH, Grandis JR, Kopetz S, Hung MC. PRMT1-mediated methylation
of the EGF receptor regulates signaling and cetuximab response. J Clin Invest.
2015;125(12):4529-43.
43. Yao B, Gui T, Zeng X, Deng Y, Wang Z, Wang Y, Yang D, Li Q, Xu P, Hu R, Li X,
Chen B, Wang J, Zen K, Li H, Davis MJ, Herold MJ, Pan HF, Jiang ZW, Huang DCS,
Liu M, Ju J, Zhao Q. PRMT1-mediated H4R3me2a recruits SMARCA4 to promote
144
colorectal cancer progression by enhancing EGFR signaling. Genome Med.
2021;13(1):58.
44. Plotnikov A, Kozer N, Cohen G, Carvalho S, Duberstein S, Almog O, Solmesky LJ,
Shurrush KA, Babaev I, Benjamin S, Gilad S, Kupervaser M, Levin Y, Gershovits M,
Ben-Avraham D, Barr HM. PRMT1 inhibition induces differentiation of colon cancer
cells. Sci Rep. 2020;10(1):20030.
45. Choucair A, Pham TH, Omarjee S, Jacquemetton J, Kassem L, Trédan O, Rambaud J,
Marangoni E, Corbo L, Treilleux I, Le Romancer M. The arginine methyltransferase
PRMT1 regulates IGF-1 signaling in breast cancer. Oncogene. 2019;38(21):4015-4027.
46. Jiang X, Rowitch DH, Soriano P, McMahon AP, Sucov HM. Fate of the mammalian
cardiac neural crest. Development. 2000;127(8):1607-16.
47. Yu Z, Chen T, Hébert J, Li E, Richard S. A mouse PRMT1 null allele defines an essential
role for arginine methylation in genome maintenance and cell proliferation. Mol Cell
Biol. 2009;29(11):2982-96.
48. Nguyen BH, Ishii M, Maxson RE, Wang J. Culturing and Manipulation of O9-1 Neural
Crest Cells. J Vis Exp. 2018;(140):58346.

145
C h a p t e r 6:
CONCLUSION AND FUTURE DIRECTIONS

1.0 CONCLUSION
The overall objective established at the outset of this work was to understand the role of
post-migratory neural crest cells (NCCs) in cardiac outflow tract alignment. Our laboratory’s
focus on outflow tract biology stems from a collective interest in conducting scientific research
with the translational potential to meaningfully impact the lives of children born with complex
congenital heart disease (CHD). That abnormalities of the outflow tract are responsible for nearly
30% of CHD suggested to us that scientific inquiry into the mechanisms governing outflow tract
formation would naturally intersect clinically relevant areas of study. To this end, we began this
work by investigating phenotypic patterns of CHD frequently encountered in the clinic. This led
us to identify concomitant double outlet right ventricle/tetralogy of Fallot and cleft palate as a
clinically relevant yet scientifically understudied disease entity. Together, with a
multidisciplinary team of practicing congenital heart surgeons, craniofacial surgeons, clinical
geneticists, developmental biologists, and human geneticists/bioinformaticians, we were able to
recruit and perform high-throughput genetic sequencing in patients with these coexisting lesions.
Our work shed novel insights into the underlying genetic architecture of DORV+CP and
implicated Wnt/planar cell polarity signaling defects in the mechanistic basis of disease. We took
a reverse translational approach to these findings, leveraging these insights to develop unique
genetic and phenotypic models of disease for further study.
To summarize, our mouse model work led to several novel findings, including: (1) post-
migratory cardiac neural crest cells are required for second heart field accretion and outflow tract
alignment independent of their role in septation; (2) cardiac neural crest cells are a novel source
of Wnt5a during heart development; (3) cardiac neural crest cell derived Wnt5a directly
regulates second heart field migration into the outflow tract; (4) protein arginine
methyltransferase-1 (Prmt1) is a novel post-translational modifying enzyme required to maintain
the population of post-migratory cardiac neural crest cells in the embryo; (5) through its role as a
histone modifying enzyme, Prmt1 may potentially regulate Wnt5a expression in both the cranial
146
and cardiac neural crest and thus provide a common molecular mechanism to explain
concomitant palate and heart defects in the embryo. Taken together, these findings not only
advance current perspectives on the role of post-migratory cardiac NCCs in outflow tract
morphogenesis, but also provide important insights into the molecular basis of concomitant CHD
and cleft malformations observed in the clinic.

2.0 FUTURE DIRECTIONS
As with all meaningful scientific endeavors, the projects pursued in this dissertation leave
us with more questions than answers. To pose some of the unaddressed questions that stem from
this work: Does Prmt1 regulate Wnt5a expression through direct or indirect epigenetic
mechanisms in the neural crest? Does Prmt1 regulate Wnt5a expression in a common fashion in
the cranial and cardiac neural crest domains? What receptors and downstream core effector
molecules within the second heart field transduce Wnt5a signals from the neural crest? Are all
cardiac neural crest cells uniformly capable of providing paracrine Wnt5a signals to the second
heart field, or are there unique subpopulations that engage in other intercellular signaling events?
To what extent do spatiotemporal restrictions play a role in defining which second heart field
cells are responsive to paracrine signals from the neural crest? Are there specific molecular
profiles unique to the subpopulation of second heart field cells responsive to neural crest cell
signals? Do second heart field cells provide reciprocal signals that modify neural crest cell
behavior during septation? What role, if any, does Prmt1 occupy in other cardiogenic progenitor
populations, such as second heart field cells? Future studies aimed at providing answers to some
of these questions are ongoing in the laboratory. Their answers will most certainly spark new
lines of investigation that will continue the iterative process toward scientific progress in outflow
tract biology.
In addition to project-specific experimental future directions, I believe that the work
contained in this dissertation provides an important framework for future studies aimed at
translating principles of developmental biology into the clinical understanding and management
of congenital heart disease more broadly. Over the past several decades, improvements in
medical and surgical therapies have drastically reduced early mortality for children born with
147
many different types of congenital heart disease. However, one consequence of these early
therapeutic improvements is the rapidly emerging adult congenital heart disease population. This
cohort presents new clinical challenges in the form of heterogeneous concomitant disease
profiles and long-term sequela of surgically repaired or palliated congenital heart disease lesions
not previously seen. This clinical situation is further exacerbated by the burden of cardiovascular
pathologies or related risk factors traditionally experienced with age, such as atherosclerotic
coronary or aortic disease, degenerative valve disease, diabetes mellitus, and metabolic
syndrome, to name a few. Given the depth and complexity of this clinical scenario, a new level
of innovation and creativity will be required from the next generation of congenital heart
surgeon-scientists tasked with managing this population. Current trends in the field indicate that
the next wave of improvements in life expectancy for those with congenital heart disease will
likely emerge from the integration of multiple scientific disciplines aimed at creating novel
molecular-based therapeutic approaches. Scientific principles in basic developmental biology
will serve as an integral component of this endeavor. As outlined in this dissertation, such
concepts can be applied to not only identify common etiologies for clinically relevant
concomitant disease phenotypes in practice, but also to develop personalized genetic or
phenotypic models of disease to study in the laboratory. Looking to the future, I believe that
approaches similar to those pursued in this dissertation can be applied to understand the
mechanistic basis of other concomitant disease lesions of interest, explore underlying biologic or
genetic susceptibilities to poor clinical outcomes, optimize therapeutic decision-making by
tailoring therapies toward individual molecular or genetic derangements, and finally, to identify
novel and clinically actionable therapeutic targets in the congenital heart disease population.

148
REFERENCES
Chapter 1:
1. Olson EN. Gene regulatory networks in the evolution and development of the heart.
Science. 2006;313(5795):1922-7.
2. Cripps RM, Olson EN. Control of cardiac development by an evolutionarily conserved
transcriptional network. Dev Biol. 2002;246(1):14-28.
3. Icardo JM, Manasek FJ. An indirect immunofluorescence study of the distribution of
fibronectin during the formation of the cushion tissue mesenchyme in the embryonic
heart. Dev Biol. 1984;101(2):336-45.
4. Lu J, Kaestle K, Huang J, Liu Q, Zhang P, Gao L, Gardiner J, Thissen H, Yang HT.
Interactions of human embryonic stem cell-derived cardiovascular progenitor cells with
immobilized extracellular matrix proteins. J Biomed Mater Res A. 2017;105(4):1094-
1104.
5. Jackson TR, Kim HY, Balakrishnan UL, Stuckenholz C, Davidson LA. Spatiotemporally
Controlled Mechanical Cues Drive Progenitor Mesenchymal-to-Epithelial Transition
Enabling Proper Heart Formation and Function. Curr Biol. 2017;27(9):1326-1335.
6. Yuan X, Qi H, Li X, Wu F, Fang J, Bober E, Dobreva G, Zhou Y, Braun T. Disruption of
spatiotemporal hypoxic signaling causes congenital heart disease in mice. J Clin Invest.
2017;127(6):2235-2248.
7. Virani SS, Alonso A, Aparicio HJ, Benjamin EJ, Bittencourt MS, Callaway CW, Carson
AP, Chamberlain AM, Cheng S, Delling FN, Elkind MSV, Evenson KR, Ferguson JF,
Gupta DK, Khan SS, Kissela BM, Knutson KL, Lee CD, Lewis TT, Liu J, Loop MS,
Lutsey PL, Ma J, Mackey J, Martin SS, Matchar DB, Mussolino ME, Navaneethan SD,
Perak AM, Roth GA, Samad Z, Satou GM, Schroeder EB, Shah SH, Shay CM, Stokes A,
VanWagner LB, Wang NY, Tsao CW; American Heart Association Council on
Epidemiology and Prevention Statistics Committee and Stroke Statistics Subcommittee.
149
Heart Disease and Stroke Statistics-2021 Update: A Report From the American Heart
Association. Circulation. 2021;143(8):e254-e743.
8. Zaffran S, Frasch M. Early signals in cardiac development. Circ Res. 2002;91(6):457-69.
9. Herrmann F, Groß A, Zhou D, Kestler HA, Kühl M. A boolean model of the cardiac gene
regulatory network determining first and second heart field identity. PLoS One.
2012;7(10):e46798.
10. Tam PP, Parameswaran M, Kinder SJ, Weinberger RP. The allocation of epiblast cells to
the embryonic heart and other mesodermal lineages: the role of ingression and tissue
movement during gastrulation. Development. 1997;124(9):1631-42.
11. Abu-Issa R, Kirby ML. Heart field: from mesoderm to heart tube. Annu Rev Cell Dev
Biol. 2007;23:45-68.
12. Buckingham M, Meilhac S, Zaffran S. Building the mammalian heart from two sources
of myocardial cells. Nat Rev Genet. 2005;6(11):826-35.
13. Black BL. Transcriptional pathways in second heart field development. Semin Cell Dev
Biol. 2007;18(1):67-76.
14. Dyer LA, Kirby ML. The role of secondary heart field in cardiac development. Dev Biol.
2009;336(2):137-44.
15. Zaffran S, Kelly RG. New developments in the second heart field. Differentiation.
2012;84(1):17-24.
16. Cai CL, Liang X, Shi Y, Chu PH, Pfaff SL, Chen J, Evans S. Isl1 identifies a cardiac
progenitor population that proliferates prior to differentiation and contributes a majority
of cells to the heart. Dev Cell. 2003;5(6):877-89.
17. Kelly RG, Brown NA, Buckingham ME. The arterial pole of the mouse heart forms from
Fgf10-expressing cells in pharyngeal mesoderm. Dev Cell. 2001;1(3):435-40.
150
18. Watanabe Y, Miyagawa-Tomita S, Vincent SD, Kelly RG, Moon AM, Buckingham ME.
Role of mesodermal FGF8 and FGF10 overlaps in the development of the arterial pole of
the heart and pharyngeal arch arteries. Circ Res. 2010;106(3):495-503.
19. Waldo KL, Kumiski DH, Wallis KT, Stadt HA, Hutson MR, Platt DH, Kirby ML.
Conotruncal myocardium arises from a secondary heart field. Development.
2001;128(16):3179-88.
20. De Zoysa P, Liu J, Toubat O, Choi J, Moon A, Gill PS, Duarte A, Sucov HM, Kumar SR.
Delta-like ligand 4-mediated Notch signaling controls proliferation of second heart field
progenitor cells by regulating Fgf8 expression. Development. 2020;147(17):dev185249.
21. Xie L, Hoffmann AD, Burnicka-Turek O, Friedland-Little JM, Zhang K, Moskowitz IP.
Tbx5-hedgehog molecular networks are essential in the second heart field for atrial
septation. Dev Cell. 2012;23(2):280-91.
22. Zhang KK, Xiang M, Zhou L, Liu J, Curry N, Heine Suñer D, Garcia-Pavia P, Zhang X,
Wang Q, Xie L. Gene network and familial analyses uncover a gene network involving
Tbx5/Osr1/Pcsk6 interaction in the second heart field for atrial septation. Hum Mol
Genet. 2016;25(6):1140-51.
23. Lin CJ, Lin CY, Chen CH, Zhou B, Chang CP. Partitioning the heart: mechanisms of
cardiac septation and valve development. Development. 2012;139(18):3277-99.
24. Sinha T, Wang B, Evans S, Wynshaw-Boris A, Wang J. Disheveled mediated planar cell
polarity signaling is required in the second heart field lineage for outflow tract
morphogenesis. Dev Biol. 2012;370(1):135-44.
25. Li D, Angermeier A, Wang J. Planar cell polarity signaling regulates polarized second
heart field morphogenesis to promote both arterial and venous pole septation.
Development. 2019;146(20):dev181719.
26. Rochais F, Dandonneau M, Mesbah K, Jarry T, Mattei MG, Kelly RG. Hes1 is expressed
in the second heart field and is required for outflow tract development. PLoS One.
2009;4(7):e6267.
151
27. Ramsbottom SA, Sharma V, Rhee HJ, Eley L, Phillips HM, Rigby HF, Dean C,
Chaudhry B, Henderson DJ. Vangl2-regulated polarisation of second heart field-derived
cells is required for outflow tract lengthening during cardiac development. PLoS Genet.
2014;10(12):e1004871.
28. Sauka-Spengler T, Bronner-Fraser M. A gene regulatory network orchestrates neural
crest formation. Nat Rev Mol Cell Biol. 2008;9(7):557-68.
29. Scholl AM, Kirby ML. Signals controlling neural crest contributions to the heart. Wiley
Interdiscip Rev Syst Biol Med. 2009;1(2):220-7.
30. Bronner ME, Simões-Costa M. The Neural Crest Migrating into the Twenty-First
Century. Curr Top Dev Biol. 2016;116:115-34.
31. Kirby ML, Waldo KL. Neural crest and cardiovascular patterning. Circ Res.
1995;77(2):211-5.
32. Jiang X, Rowitch DH, Soriano P, McMahon AP, Sucov HM. Fate of the mammalian
cardiac neural crest. Development. 2000;127(8):1607-16.
33. Hutson MR, Kirby ML. Neural crest and cardiovascular development: a 20-year
perspective. Birth Defects Res C Embryo Today. 2003;69(1):2-13.
34. Wang J, Nagy A, Larsson J, Dudas M, Sucov HM, Kaartinen V. Defective ALK5
signaling in the neural crest leads to increased postmigratory neural crest cell apoptosis
and severe outflow tract defects. BMC Dev Biol. 2006;6:51.
35. Kaartinen V, Dudas M, Nagy A, Sridurongrit S, Lu MM, Epstein JA. Cardiac outflow
tract defects in mice lacking ALK2 in neural crest cells. Development.
2004;131(14):3481-90.
36. Todorovic V, Frendewey D, Gutstein DE, Chen Y, Freyer L, Finnegan E, Liu F, Murphy
A, Valenzuela D, Yancopoulos G, Rifkin DB. Long form of latent TGF-beta binding
protein 1 (Ltbp1L) is essential for cardiac outflow tract septation and remodeling.
Development. 2007;134(20):3723-32.
152
37. Rentschler S, Jain R, Epstein JA. Tissue-tissue interactions during morphogenesis of the
outflow tract. Pediatr Cardiol. 2010;31(3):408-13.
38. Kodo K, Shibata S, Miyagawa-Tomita S, Ong SG, Takahashi H, Kume T, Okano H,
Matsuoka R, Yamagishi H. Regulation of Sema3c and the Interaction between Cardiac
Neural Crest and Second Heart Field during Outflow Tract Development. Sci Rep.
2017;7(1):6771.
39. Yelbuz TM, Waldo KL, Kumiski DH, Stadt HA, Wolfe RR, Leatherbury L, Kirby ML.
Shortened outflow tract leads to altered cardiac looping after neural crest
ablation. Circulation. 2002;106:504–510.
40. Yelbuz TM, Waldo KL, Zhang X, Zdanowicz M, Parker J, Creazzo TL, Johnson GA,
Kirby ML. Myocardial volume and organization are changed by failure of addition of
secondary heart field myocardium to the cardiac outflow tract. Dev Dyn. 2003;228: 152–
160
41. Xiong H, Luo Y, Yue Y, Zhang J, Ai S, Li X, Wang X, Zhang YL, Wei Y, Li HH, Hu X,
Li C, He A. Single-Cell Transcriptomics Reveals Chemotaxis-Mediated Intraorgan
Crosstalk During Cardiogenesis. Circ Res. 2019;125(4):398-410.

Chapter 2:
1. Hoffman JIE, Kaplan S. The incidence of congenital heart disease. J Am Coll Cardiol.
2002. doi:10.1016/S0735-1097(02)01886-7
2. Gilboa SM, Devine OJ, Kucik JE, et al. Congenital Heart Defects in the United States:
Estimating the Magnitude of the Affected Population in 2010. Circulation.
2016;134(2):101-109. doi:10.1161/CIRCULATIONAHA.115.019307
3. Ferencz C, Rubin JD, McCarter RJ, et al. Cardiac and noncardiac malformations:
Observations in a population-based study. Teratology. 1987.
doi:10.1002/tera.1420350311
153
4. Greenwood RD. Cardiovascular Malformations Associated with Extracardiac Anomalies
and Malformation Syndromes: Patterns for Diagnosis. Clin Pediatr (Phila). 1984.
doi:10.1177/000992288402300303
5. Egbe A, Lee S, Ho D, Uppu S, Srivastava S. Prevalence of congenital anomalies in
newborns with congenital heart disease diagnosis. Ann Pediatr Cardiol. 2014.
doi:10.4103/0974-2069.132474
6. Geis N, Seto B, Bartoshesky L, Lewis MB, Pashayan HM. The prevalence of congenital
heart disease among the population of a metropolitan cleft lip and palate clinic. Cleft
Palate J. 1981.
7. Milerad J1, Larson O, PhD D, Hagberg C IM. Associated Malformations in Infants With
Cleft Lip and Palate A Prospective, Population-based Study. Pediactrics. 1997.
doi:10.1542/peds.100.2.180
8. Barbosa MM, Rocha CMG, Katina T, Caldas M, Codorniz A, Medeiros C. Prevalence of
congenital heart diseases in oral cleft patients. Pediatr Cardiol. 2003.
doi:10.1007/s00246-002-0335-9
9. Kasatwar A, Borle R, Bhola N, K R, Prasad GSV, Jadhav A. Prevalence of congenital
cardiac anomalies in patients with cleft lip and palate – Its implications in surgical
management. J Oral Biol Craniofacial Res. 2018;8(3):241-244.
doi:10.1016/j.jobcr.2017.09.009
10. Munabi NCO, Swanson J, Auslander A, Sanchez-Lara PA, Davidson Ward SL, Magee
WP. The Prevalence of Congenital Heart Disease in Nonsyndromic Cleft Lip and/or
Palate. Ann Plast Surg. 2017;79(2):214-220. doi:10.1097/SAP.0000000000001069
11. Azadgoli B, Munabi NCO, Fahradyan A, et al. Congenital Heart Disease in Patients with
Cleft Lip/Palate and its Impact on Cleft Management. The Cleft Palate-Craniofacial
Journal. 2020;57:957-66. doi:10.1177/1055665620924915.
154
12. Jacobs ML, O'Brien SM, Jacobs JP, et al. An empirically based tool for analyzing
morbidity associated with operations for congenital heart disease. J Thorac Cardiovasc
Surg. 2013;145:1046-57. doi:10.1016/j.jtcvs.2012.06.029.
13. Alsoufi B, McCracken C, Oster M, Shashidharan S, Kanter K. Genetic and Extracardiac
Anomalies are Associated with Inferior Single Ventricle Palliation Outcomes. Ann
Thorac Surg. 2018;106(4):1204-12. doi:10.1016/j.athoracsur.2018.04.043.
14. Patel A, Costello JM, Backer CL, et al. Prevalence of Noncardiac and Genetic
Abnormalities in Neonates Undergoing Cardiac Operations: Analysis of The Society of
Thoracic Surgeons Congenital Heart Surgery Database. Ann Thorac Surg.
2016;102(5):1607-14. doi:10.1016/j.athoracsur.2016.04.008.
15. Vincent S D, Buckingham ME. How to make a heart: the origin and regulation of cardiac
progenitor cells. Curr Top Dev Biol. 2010; 90:1-41. doi:10.1016/S0070-2153(10)90001-
X.
16. O'Brien SM, Jacobs JP, Pasquali SK, et al. The Society of Thoracic Surgeons Congenital
Heart Surgery Database Mortality Risk Model: Part 1-Statistical Methodology. Ann
Thorac Surg. 2015;100(3):1054-62. doi:10.1016/j.athoracsur.2015.07.014.
17. Jacobs JP, O'Brien SM, Hill KD, et al. Refining The Society of Thoracic Surgeons
Congenital Heart Surgery Database Mortality Risk Model With Enhanced Risk
Adjustment for Chromosomal Abnormalities, Syndromes, and Noncardiac Congenital
Anatomic Abnormalities. Ann Thorac Surg. 2019;108:558-66.
doi:10.1016/j.athoracsur.2019.01.069.
18. Pasquali SK, Shahian DM, O'Brien SM, et al. Development of a Congenital Heart
Surgery Composite Quality Metric: Part 1-Conceptual Framework. Ann Thorac Surg.
2019;107:583-9. doi:10.1016/j.athoracsur.2018.07.037.

155
Chapter 3:
1. Dixon MJ, Marazita ML, Beaty TH, Murray JC. Cleft lip and palate: understanding
genetic and environmental influences. Nat Rev Genet. 2011;12(3):167-78.
2. Mossey PA, Modell B. Epidemiology of oral clefts 2012: an international perspective.
Front Oral Biol. 2012;16:1-18.
3. Mossey, P. A. and Catilla, E. E. Global registry and database on craniofacial anomalies:
Report of a WHO Registry Meeting on Craniofacial Anomalies. 2003.
4. Kohli SS, Kohli VS. A comprehensive review of the genetic basis of cleft lip and palate.
J Oral Maxillofac Pathol. 2012;16(1):64-72.
5. Murthy J, Bhaskar L. Current concepts in genetics of nonsyndromic clefts. Indian J Plast
Surg. 2009;42(1):68-81.
6. Hoffman J. The global burden of congenital heart disease. Cardiovasc J Afr.
2013;24(4):141-5.
7. Munabi NCO, Swanson J, Auslander A, Sanchez-Lara PA, Davidson Ward SL, Magee
WP, 3rd. The Prevalence of Congenital Heart Disease in Nonsyndromic Cleft Lip and/or
Palate: A Systematic Review of the Literature. Ann Plast Surg. 2017;79(2):214-20.
8. Köhler S, Gargano M, Matentzoglu N, Carmody LC, Lewis-Smith D, Vasilevsky NA,
Danis D, Balagura G, Baynam G, Brower AM, Callahan TJ, Chute CG, Est JL, Galer PD,
Ganesan S, Griese M, Haimel M, Pazmandi J, Hanauer M, Harris NL, Hartnett MJ,
Hastreiter M, Hauck F, He Y, Jeske T, Kearney H, Kindle G, Klein C, Knoflach K,
Krause R, Lagorce D, McMurry JA, Miller JA, Munoz-Torres MC, Peters RL, Rapp CK,
Rath AM, Rind SA, Rosenberg AZ, Segal MM, Seidel MG, Smedley D, Talmy T,
Thomas Y, Wiafe SA, Xian J, Yüksel Z, Helbig I, Mungall CJ, Haendel MA, Robinson
PN. The Human Phenotype Ontology in 2021. Nucleic Acids Res. 2021;49(D1):D1207-
D1217.
156
9. Azadgoli B, Munabi NCO, Fahradyan A, Auslander A, McCullough M, Aflatooni N,
Davidson Ward SL, Kumar SR, Sanchez-Lara PA, Swanson J, Magee WP 3rd.
Congenital Heart Disease in Patients With Cleft Lip/Palate and Its Impact on Cleft
Management. Cleft Palate Craniofac J. 2020;57(8):957-966.
10. Toubat O, Mallios DN, Munabi NCO, Magee WP 3rd, Starnes VA, Kumar SR. Clinical
Importance of Concomitant Cleft Lip/Palate in the Surgical Management of Patients With
Congenital Heart Disease. World J Pediatr Congenit Heart Surg. 2021;12(1):35-42.
11. Zaidi S, Choi M, Wakimoto H, Ma L, Jiang J, Overton JD, Romano-Adesman A,
Bjornson RD, Breitbart RE, Brown KK, Carriero NJ, Cheung YH, Deanfield J, DePalma
S, Fakhro KA, Glessner J, Hakonarson H, Italia MJ, Kaltman JR, Kaski J, Kim R, Kline
JK, Lee T, Leipzig J, Lopez A, Mane SM, Mitchell LE, Newburger JW, Parfenov M,
Pe'er I, Porter G, Roberts AE, Sachidanandam R, Sanders SJ, Seiden HS, State MW,
Subramanian S, Tikhonova IR, Wang W, Warburton D, White PS, Williams IA, Zhao H,
Seidman JG, Brueckner M, Chung WK, Gelb BD, Goldmuntz E, Seidman CE, Lifton RP.
De novo mutations in histone-modifying genes in congenital heart disease. Nature.
2013;498(7453):220-3.
12. Jin SC, Homsy J, Zaidi S, Lu Q, Morton S, DePalma SR, Zeng X, Qi H, Chang W,
Sierant MC, Hung WC, Haider S, Zhang J, Knight J, Bjornson RD, Castaldi C, Tikhonoa
IR, Bilguvar K, Mane SM, Sanders SJ, Mital S, Russell MW, Gaynor JW, Deanfield J,
Giardini A, Porter GA Jr, Srivastava D, Lo CW, Shen Y, Watkins WS, Yandell M, Yost
HJ, Tristani-Firouzi M, Newburger JW, Roberts AE, Kim R, Zhao H, Kaltman JR,
Goldmuntz E, Chung WK, Seidman JG, Gelb BD, Seidman CE, Lifton RP, Brueckner M.
Contribution of rare inherited and de novo variants in 2,871 congenital heart disease
probands. Nat Genet. 2017;49(11):1593-1601.
13. Watkins WS, Hernandez EJ, Wesolowski S, Bisgrove BW, Sunderland RT, Lin E,
Lemmon G, Demarest BL, Miller TA, Bernstein D, Brueckner M, Chung WK, Gelb BD,
Goldmuntz E, Newburger JW, Seidman CE, Shen Y, Yost HJ, Yandell M, Tristani-
Firouzi M. De novo and recessive forms of congenital heart disease have distinct genetic
and phenotypic landscapes. Nat Commun. 2019;10(1):4722.
157
14. Glessner JT, Bick AG, Ito K, Homsy J, Rodriguez-Murillo L, Fromer M, Mazaika E,
Vardarajan B, Italia M, Leipzig J, DePalma SR, Golhar R, Sanders SJ, Yamrom B,
Ronemus M, Iossifov I, Willsey AJ, State MW, Kaltman JR, White PS, Shen Y,
Warburton D, Brueckner M, Seidman C, Goldmuntz E, Gelb BD, Lifton R, Seidman J,
Hakonarson H, Chung WK. Increased frequency of de novo copy number variants in
congenital heart disease by integrative analysis of single nucleotide polymorphism array
and exome sequence data. Circ Res. 2014;115(10):884-896.
15. Sevim Bayrak C, Zhang P, Tristani-Firouzi M, Gelb BD, Itan Y. De novo variants in
exomes of congenital heart disease patients identify risk genes and pathways. Genome
Med. 2020;12(1):9.
16. Veltman JA, Brunner HG. De novo mutations in human genetic disease. Nat Rev Genet.
2012;13(8):565-75.
17. Fuller ZL, Berg JJ, Mostafavi H, Sella G, Przeworski M. Measuring intolerance to
mutation in human genetics. Nat Genet. 2019;51(5):772-776.
18. Glinianaia SV, Morris JK, Best KE, et al. Long-term survival of children born with
congenital anomalies: A systematic review and meta-analysis of population-based
studies. PLoS Med. 2020;17(9):e1003356.
19. Homsy J, Zaidi S, Shen Y, Ware JS, Samocha KE, Karczewski KJ, DePalma SR,
McKean D, Wakimoto H, Gorham J, Jin SC, Deanfield J, Giardini A, Porter GA Jr, Kim
R, Bilguvar K, López-Giráldez F, Tikhonova I, Mane S, Romano-Adesman A, Qi H,
Vardarajan B, Ma L, Daly M, Roberts AE, Russell MW, Mital S, Newburger JW, Gaynor
JW, Breitbart RE, Iossifov I, Ronemus M, Sanders SJ, Kaltman JR, Seidman JG,
Brueckner M, Gelb BD, Goldmuntz E, Lifton RP, Seidman CE, Chung WK. De novo
mutations in congenital heart disease with neurodevelopmental and other congenital
anomalies. Science. 2015;350(6265):1262-6.
20. Zentner GE, Layman WS, Martin DM, Scacheri PC. Molecular and phenotypic aspects of
CHD7 mutation in CHARGE syndrome. Am J Med Genet A. 2010;152A(3):674-686.
158
21. Vissers LE, van Ravenswaaij CM, Admiraal R, Hurst JA, de Vries BB, Janssen IM, van
der Vliet WA, Huys EH, de Jong PJ, Hamel BC, Schoenmakers EF, Brunner HG,
Veltman JA, van Kessel AG. Mutations in a new member of the chromodomain gene
family cause CHARGE syndrome. Nat Genet. 2004;36(9):955-7.
22. Lalani SR, Safiullah AM, Fernbach SD, et al. Spectrum of CHD7 mutations in 110
individuals with CHARGE syndrome and genotype-phenotype correlation. Am J Hum
Genet. 2006;78(2):303-314.
23. Aramaki M, Udaka T, Kosaki R, Makita Y, Okamoto N, Yoshihashi H, Oki H, Nanao K,
Moriyama N, Oku S, Hasegawa T, Takahashi T, Fukushima Y, Kawame H, Kosaki K.
Phenotypic spectrum of CHARGE syndrome with CHD7 mutations. J Pediatr.
2006;148(3):410-4.
24. Van Nostrand JL, Brady CA, Jung H, Fuentes DR, Kozak MM, Johnson TM, Lin CY,
Lin CJ, Swiderski DL, Vogel H, Bernstein JA, Attié-Bitach T, Chang CP, Wysocka J,
Martin DM, Attardi LD. Inappropriate p53 activation during development induces
features of CHARGE syndrome. Nature. 2014;514(7521):228-32.
25. Bosman EA, Penn AC, Ambrose JC, Kettleborough R, Stemple DL, Steel KP. Multiple
mutations in mouse Chd7 provide models for CHARGE syndrome. Hum Mol Genet.
2005;14(22):3463-76.
26. Hurd EA, Capers PL, Blauwkamp MN, Adams ME, Raphael Y, Poucher HK, Martin
DM. Loss of Chd7 function in gene-trapped reporter mice is embryonic lethal and
associated with severe defects in multiple developing tissues. Mamm Genome.
2007;18(2):94-104.
27. Randall V, McCue K, Roberts C, et al. Great vessel development requires biallelic
expression of Chd7 and Tbx1 in pharyngeal ectoderm in mice. J Clin Invest.
2009;119(11):3301-3310.
159
28. Payne S, Burney MJ, McCue K, Popal N, Davidson SM, Anderson RH, Scambler PJ. A
critical role for the chromatin remodeller CHD7 in anterior mesoderm during
cardiovascular development. Dev Biol. 2015;405(1):82-95.
29. Yan S, Thienthanasit R, Chen D, Engelen E, Brühl J, Crossman DK, Kesterson R, Wang
Q, Bouazoune K, Jiao K. CHD7 regulates cardiovascular development through ATP-
dependent and -independent activities. Proc Natl Acad Sci U S A. 2020;117(46):28847-
28858.
30. Hughes SS, Welsh HI, Safina NP, Bejaoui K, Ardinger HH. Family history and clefting
as major criteria for CHARGE syndrome. Am J Med Genet A. 2014;164A(1):48-53.
31. Sperry ED, Hurd EA, Durham MA, Reamer EN, Stein AB, Martin DM. The chromatin
remodeling protein CHD7, mutated in CHARGE syndrome, is necessary for proper
craniofacial and tracheal development. Dev Dyn. 2014;243(9):1055-66.
32. Jiang J, Tang S, Xia J, Wen J, Chen S, Shu X, Huen MSY, Deng Y. C9orf140, a novel
Axin1-interacting protein, mediates the negative feedback loop of Wnt/β-catenin
signaling. Oncogene. 2018;37(22):2992-3005.
33. Goffinet AM, Tissir F. Seven pass Cadherins CELSR1-3. Semin Cell Dev Biol.
2017;69:102-110.
34. Aznar N, Sun N, Dunkel Y, Ear J, Buschman MD, Ghosh P. A Daple-Akt feed-forward
loop enhances noncanonical Wnt signals by compartmentalizing β-catenin. Mol Biol Cell.
2017;28(25):3709-3723.
35. Ishida-Takagishi M, Enomoto A, Asai N, Ushida K, Watanabe T, Hashimoto T, Kato T,
Weng L, Matsumoto S, Asai M, Murakumo Y, Kaibuchi K, Kikuchi A, Takahashi M.
The Dishevelled-associating protein Daple controls the non-canonical Wnt/Rac pathway
and cell motility. Nat Commun. 2012;3:859.
36. Vacik T, Stubbs JL, Lemke G. A novel mechanism for the transcriptional regulation of
Wnt signaling in development. Genes Dev. 2011;25(17):1783-95.
160
37. Liu W, Komiya Y, Mezzacappa C, Khadka DK, Runnels L, Habas R. MIM regulates
vertebrate neural tube closure. Development. 2011;138(10):2035-47.
38. Katoh M. GIPC gene family (Review). Int J Mol Med. 2002;9(6):585-9.
39. Griffin CT, Curtis CD, Davis RB, Muthukumar V, Magnuson T. The chromatin-
remodeling enzyme BRG1 modulates vascular Wnt signaling at two levels. Proc Natl
Acad Sci U S A. 2011;108(6):2282-7.
40. Scholz B, Korn C, Wojtarowicz J, Mogler C, Augustin I, Boutros M, Niehrs C, Augustin
HG. Endothelial RSPO3 Controls Vascular Stability and Pruning through Non-canonical
WNT/Ca(2+)/NFAT Signaling. Dev Cell. 2016;36(1):79-93.
41. Ho HYH, Susman MW, Bikoff JB, et al. Wnt5a-Ror-Dishevelled signaling constitutes a
core developmental pathway that controls tissue morphogenesis. Proc Natl Acad Sci U S
A. 2012;109(11):4044-4051.
42. Li D, Angermeier A, Wang J. Planar cell polarity signaling regulates polarized second
heart field morphogenesis to promote both arterial and venous pole septation. Dev.
2019;146(20).
43. Grigoryan T, Wend P, Klaus A, Birchmeier W. Deciphering the function of canonical
Wnt signals in development and disease: conditional loss- and gain-of-function mutations
of beta-catenin in mice. Genes Dev. 2008;22(17):2308-41.
44. Carvalho JR, Fortunato IC, Fonseca CG, et al. Non-canonical Wnt signaling regulates
junctional mechanocoupling during angiogenic collective cell migration. Elife.
2019;8:e45853.
45. Lutze G, Haarmann A, Demanou Toukam JA, Buttler K, Wilting J, Becker J. Non-
canonical WNT-signaling controls differentiation of lymphatics and extension
lymphangiogenesis via RAC and JNK signaling. Sci Rep. 2019;9(1):4739.

161
Chapter 4:
1. Harvey RP. Patterning the vertebrate heart. Nat Rev Genet. 2002;3(7):544-56.
2. Dyer LA, Kirby ML. The role of secondary heart field in cardiac development. Dev Biol.
2009;336(2):137-144.
3. Zaffran S, Kelly RG, Meilhac SM, Buckingham ME, Brown NA. Right ventricular
myocardium derives from the anterior heart field. Circ Res. 2004;95(3):261-8.
4. Jiang X, Rowitch DH, Soriano P, McMahon AP, Sucov HM. Fate of the mammalian
cardiac neural crest. Development. 2000;127(8):1607-16.
5. Boot MJ, Gittenberger-De Groot AC, Van Iperen L, Hierck BP, Poelmann RE.
Spatiotemporally separated cardiac neural crest subpopulations that target the outflow
tract septum and pharyngeal arch arteries. Anat Rec A Discov Mol Cell Evol Biol.
2003;275(1):1009-18.
6. Virani SS, Alonso A, Aparicio HJ, Benjamin EJ, Bittencourt MS, Callaway CW, Carson
AP, Chamberlain AM, Cheng S, Delling FN, Elkind MSV, Evenson KR, Ferguson JF,
Gupta DK, Khan SS, Kissela BM, Knutson KL, Lee CD, Lewis TT, Liu J, Loop MS,
Lutsey PL, Ma J, Mackey J, Martin SS, Matchar DB, Mussolino ME, Navaneethan SD,
Perak AM, Roth GA, Samad Z, Satou GM, Schroeder EB, Shah SH, Shay CM, Stokes A,
VanWagner LB, Wang NY, Tsao CW; American Heart Association Council on
Epidemiology and Prevention Statistics Committee and Stroke Statistics Subcommittee.
Heart Disease and Stroke Statistics-2021 Update: A Report From the American Heart
Association. Circulation. 2021;143(8):e254-e743.
7. Niehrs C. The complex world of WNT receptor signalling. Nat Rev Mol Cell Biol.
2012;13(12):767-779.
8. Lin L, Cui L, Zhou W, Dufort D, Zhang X, Cai CL, Bu L, Yang L, Martin J, Kemler R,
Rosenfeld MG, Chen J, Evans SM. Beta-catenin directly regulates Islet1 expression in
cardiovascular progenitors and is required for multiple aspects of cardiogenesis. Proc
Natl Acad Sci U S A. 2007;104(22):9313-8.
162
9. Kwon C, Arnold J, Hsiao EC, Taketo MM, Conklin BR, Srivastava D. Canonical Wnt
signaling is a positive regulator of mammalian cardiac progenitors. Proc Natl Acad Sci U
S A. 2007;104(26):10894-9.
10. Sinha T, Wang B, Evans S, Wynshaw-Boris A, Wang J. Disheveled mediated planar cell
polarity signaling is required in the second heart field lineage for outflow tract
morphogenesis. Dev Biol. 2012;370(1):135-44.
11. Ramsbottom SA, Sharma V, Rhee HJ, Eley L, Phillips HM, Rigby HF, Dean C,
Chaudhry B, Henderson DJ. Vangl2-regulated polarisation of second heart field-derived
cells is required for outflow tract lengthening during cardiac development. PLoS Genet.
2014;10(12):e1004871.
12. Schleiffarth JR, Person AD, Martinsen BJ, Sukovich DJ, Neumann A, Baker CV, Lohr
JL, Cornfield DN, Ekker SC, Petryk A. Wnt5a is required for cardiac outflow tract
septation in mice. Pediatr Res. 2007;61(4):386-91.
13. Li D, Angermeier A, Wang J. Planar cell polarity signaling regulates polarized second
heart field morphogenesis to promote both arterial and venous pole septation.
Development. 2019;146(20):dev181719.
14. Bajolle F, Zaffran S, Meilhac SM, Dandonneau M, Chang T, Kelly RG, Buckingham
ME. Myocardium at the base of the aorta and pulmonary trunk is prefigured in the
outflow tract of the heart and in subdomains of the second heart field. Dev Biol.
2008;313(1):25-34.
15. Darrigrand JF, Valente M, Comai G, Martinez P, Petit M, Nishinakamura R, Osorio DS,
Renault G, Marchiol C, Ribes V, Cadot B. Dullard-mediated Smad1/5/8 inhibition
controls mouse cardiac neural crest cells condensation and outflow tract septation. Elife.
2020;9:e50325.
16. Ho HYH, Susman MW, Bikoff JB, et al. Wnt5a-Ror-Dishevelled signaling constitutes a
core developmental pathway that controls tissue morphogenesis. Proc Natl Acad Sci U S
A. 2012;109(11):4044-4051.
163
17. Čapek D, Smutny M, Tichy AM, Morri M, Janovjak H, Heisenberg CP. Light-activated
Frizzled7 reveals a permissive role of non-canonical wnt signaling in mesendoderm cell
migration. Elife. 2019;8:e42093.
18. Lutze G, Haarmann A, Demanou Toukam JA, Buttler K, Wilting J, Becker J. Non-
canonical WNT-signaling controls differentiation of lymphatics and extension
lymphangiogenesis via RAC and JNK signaling. Sci Rep. 2019;9(1):4739.
19. Weeraratna AT, Jiang Y, Hostetter G, et al. Wnt5a signaling directly affects cell motility
and invasion of metastatic melanoma. Cancer Cell. 2002;1(3):279-288.
20. Maung SM, Jenny A. Planar cell polarity in Drosophila. Organogenesis. 2011;7(3):165-
79.
21. Hashimoto M, Shinohara K, Wang J, Ikeuchi S, Yoshiba S, Meno C, Nonaka S, Takada
S, Hatta K, Wynshaw-Boris A, Hamada H. Planar polarization of node cells determines
the rotational axis of node cilia. Nat Cell Biol. 2010;12(2):170-6.
22. Wang J, Mark S, Zhang X, Qian D, Yoo SJ, Radde-Gallwitz K, Zhang Y, Lin X, Collazo
A, Wynshaw-Boris A, Chen P. Regulation of polarized extension and planar cell polarity
in the cochlea by the vertebrate PCP pathway. Nat Genet. 2005;37(9):980-5.
23. Devenport D, Fuchs E. Planar polarization in embryonic epidermis orchestrates global
asymmetric morphogenesis of hair follicles. Nat Cell Biol. 2008;10(11):1257-68.
24. Li D, Wang J. Planar Cell Polarity Signaling in Mammalian Cardiac Morphogenesis.
Pediatr Cardiol. 2018;39(5):1052-1062.
25. Sinha T, Li D, Théveniau-Ruissy M, Hutson MR, Kelly RG, Wang J. Loss of Wnt5a
disrupts second heart field cell deployment and may contribute to OFT malformations in
DiGeorge syndrome. Hum Mol Genet. 2015;24(6):1704-16.
26. Zhou W, Lin L, Majumdar A, Li X, Zhang X, Liu W, Etheridge L, Shi Y, Martin J, Van
de Ven W, Kaartinen V, Wynshaw-Boris A, McMahon AP, Rosenfeld MG, Evans SM.
Modulation of morphogenesis by noncanonical Wnt signaling requires ATF/CREB
164
family-mediated transcriptional activation of TGFbeta2. Nat Genet. 2007;39(10):1225-
34.
27. Yamaguchi TP, Bradley A, McMahon AP, Jones S. A Wnt5a pathway underlies
outgrowth of multiple structures in the vertebrate embryo. Development.
1999;126(6):1211-23.
28. Cohen ED, Miller MF, Wang Z, Moon RT, Morrisey EE. Wnt5a and Wnt11 are essential
for second heart field progenitor development. Development. 2012;139(11):1931-40.
29. van Vliet PP, Lin L, Boogerd CJ, Martin JF, Andelfinger G, Grossfeld PD, Evans SM.
Tissue specific requirements for WNT11 in developing outflow tract and dorsal
mesenchymal protrusion. Dev Biol. 2017;429(1):249-259.
30. Cai CL, Liang X, Shi Y, Chu PH, Pfaff SL, Chen J, Evans S. Isl1 identifies a cardiac
progenitor population that proliferates prior to differentiation and contributes a majority
of cells to the heart. Dev Cell. 2003;5(6):877-89.
31. Engleka KA, Manderfield LJ, Brust RD, Li L, Cohen A, Dymecki SM, Epstein JA. Islet1
derivatives in the heart are of both neural crest and second heart field origin. Circ Res.
2012;110(7):922-6.
32. Verzi MP, McCulley DJ, De Val S, Dodou E, Black BL. The right ventricle, outflow
tract, and ventricular septum comprise a restricted expression domain within the
secondary/anterior heart field. Dev Biol. 2005;287(1):134-45.
33. Ma M, Li P, Shen H, Estrada KD, Xu J, Kumar SR, Sucov HM. Dysregulated
endocardial TGFβ signaling and mesenchymal transformation result in heart outflow tract
septation failure. Dev Biol. 2016;409(1):272-276.
34. Wang Q, Symes AJ, Kane CA, Freeman A, Nariculam J, Munson P, Thrasivoulou C,
Masters JR, Ahmed A. A novel role for Wnt/Ca2+ signaling in actin cytoskeleton
remodeling and cell motility in prostate cancer. PLoS One. 2010;5(5):e10456.
165
35. Gibbs BC, Damerla RR, Vladar EK, et al. Prickle1 mutation causes planar cell polarity
and directional cell migration defects associated with cardiac outflow tract anomalies and
other structural birth defects. Biol Open. 2016;5(3):323-335.
36. Cui C, Chatterjee B, Lozito TP, Zhang Z, Francis RJ, Yagi H, Swanhart LM, Sanker S,
Francis D, Yu Q, San Agustin JT, Puligilla C, Chatterjee T, Tansey T, Liu X, Kelley
MW, Spiliotis ET, Kwiatkowski AV, Tuan R, Pazour GJ, Hukriede NA, Lo CW. Wdpcp,
a PCP protein required for ciliogenesis, regulates directional cell migration and cell
polarity by direct modulation of the actin cytoskeleton. PLoS Biol.
2013;11(11):e1001720.
37. Munabi NCO, Swanson J, Auslander A, Sanchez-Lara PA, Davidson Ward SL, Magee
WP 3rd. The Prevalence of Congenital Heart Disease in Nonsyndromic Cleft Lip and/or
Palate: A Systematic Review of the Literature. Ann Plast Surg. 2017;79(2):214-220.
38. Azadgoli B, Munabi NCO, Fahradyan A, Auslander A, McCullough M, Aflatooni N,
Davidson Ward SL, Kumar SR, Sanchez-Lara PA, Swanson J, Magee WP 3rd.
Congenital Heart Disease in Patients With Cleft Lip/Palate and Its Impact on Cleft
Management. Cleft Palate Craniofac J. 2020;57(8):957-966.
39. Toubat O, Mallios DN, Munabi NCO, Magee WP 3rd, Starnes VA, Kumar SR. Clinical
Importance of Concomitant Cleft Lip/Palate in the Surgical Management of Patients With
Congenital Heart Disease. World J Pediatr Congenit Heart Surg. 2021;12(1):35-42.
40. Tang W, Bronner ME. Neural crest lineage analysis: from past to future trajectory.
Development. 2020;147(20):dev193193.
41. Nguyen BH, Ishii M, Maxson RE, Wang J. Culturing and Manipulation of O9-1 Neural
Crest Cells. J Vis Exp. 2018;(140):58346.

166
Chapter 5:
1. Oster ME, Lee KA, Honein MA, Riehle-Colarusso T, Shin M, Correa A. Temporal trends
in survival among infants with critical congenital heart defects. Pediatrics.
2013;131(5):e1502-8.
2. Best KE, Rankin J. Long-Term Survival of Individuals Born With Congenital Heart
Disease: A Systematic Review and Meta-Analysis. J Am Heart Assoc.
2016;5(6):e002846.
3. Tennstedt C, Chaoui R, Korner H, Dietel M. Spectrum of congenital heart defects and
extracardiac malformations associated with chromosomal abnormalities: Results of a
seven year necropsy study. Heart. 1999;82:34-9
4. Hoffman JI, Christianson R. Congenital heart disease in a cohort of 19,502 births with
long-term follow-up. Am J Cardiol. 1978;42:641-7
5. Ferencz C, Rubin JD, McCarter RJ, Boughman JA, Wilson PD, Brenner JI, et al. Cardiac
and noncardiac malformations: Observations in a population-based study. Teratology.
1987;35:367-78
6. Greenwood RD. Cardiovascular malformations associated with extracardiac anomalies
and malformation syndromes. Patterns for diagnosis. Clin Pediatr. 1984;23:145-51
7. Ferencz C, Boughman JA, Neill CA, Brenner JI, Perry LW. Congenital cardiovascular
malformations: Questions on inheritance. Baltimore-Washington Infant Study Group. J
Am Coll Cardiol.1989;14:756-63.
8. Egbe A, Lee S, Ho D, Uppu S, Srivastava S. Prevalence of congenital anomalies in
newborns with congenital heart disease diagnosis. Ann Pediatr Cardiol. 2014;7(2):86-91.
9. Meberg A, Hals J, Thaulow E. Congenital heart defects--chromosomal anomalies,
syndromes and extracardiac malformations. Acta Paediatr. 2007;96(8):1142-5.
167
10. Rosa RC, Rosa RF, Zen PR, Paskulin GA. Congenital heart defects and extracardiac
malformations. Rev Paul Pediatr. 2013;31(2):243-51.
11. Eskedal L, Hagemo P, Eskild A, Aamodt G, Seiler KS, Thaulow E. A population-based
study of extra-cardiac anomalies in children with congenital cardiac malformations.
Cardiol Young. 2004;14(6):600-7.
12. Patel A, Costello JM, Backer CL, Pasquali SK, Hill KD, Wallace AS, Jacobs JP, Jacobs
ML. Prevalence of Noncardiac and Genetic Abnormalities in Neonates Undergoing
Cardiac Operations: Analysis of The Society of Thoracic Surgeons Congenital Heart
Surgery Database. Ann Thorac Surg. 2016;102(5):1607-1614.
13. Munabi NCO, Swanson J, Auslander A, Sanchez-Lara PA, Davidson Ward SL, Magee
WP 3rd. The Prevalence of Congenital Heart Disease in Nonsyndromic Cleft Lip and/or
Palate: A Systematic Review of the Literature. Ann Plast Surg. 2017;79(2):214-220.
14. Azadgoli B, Munabi NCO, Fahradyan A, Auslander A, McCullough M, Aflatooni N,
Davidson Ward SL, Kumar SR, Sanchez-Lara PA, Swanson J, Magee WP 3rd.
Congenital Heart Disease in Patients With Cleft Lip/Palate and Its Impact on Cleft
Management. Cleft Palate Craniofac J. 2020;57(8):957-966.
15. Toubat O, Mallios DN, Munabi NCO, Magee WP 3rd, Starnes VA, Kumar SR. Clinical
Importance of Concomitant Cleft Lip/Palate in the Surgical Management of Patients With
Congenital Heart Disease. World J Pediatr Congenit Heart Surg. 2021;12(1):35-42.
16. Blanc RS, Richard S. Arginine Methylation: The Coming of Age. Mol Cell.
2017;65(1):8-24.
17. Tang J, Frankel A, Cook RJ, Kim S, Paik WK, Williams KR, Clarke S, Herschman HR.
PRMT1 is the predominant type I protein arginine methyltransferase in mammalian cells.
J Biol Chem. 2000;275(11):7723-30.
18. Xu J, Wang AH, Oses-Prieto J, Makhijani K, Katsuno Y, Pei M, Yan L, Zheng YG,
Burlingame A, Brückner K, Derynck R. Arginine Methylation Initiates BMP-Induced
Smad Signaling. Mol Cell. 2013;51(1):5-19.
168
19. Wu J, Chen X, Sehgal P, Zhang T, Jackson-Weaver O, Gou Y, Bautch V, Frenkel B, Sun
H, Xu J. Arginine methylation of R81 in Smad6 confines BMP-induced Smad1 signaling.
J Biol Chem. 2021;296:100496.
20. Katsuno Y, Qin J, Oses-Prieto J, Wang H, Jackson-Weaver O, Zhang T, Lamouille S, Wu
J, Burlingame A, Xu J, Derynck R. Arginine methylation of SMAD7 by PRMT1 in TGF-
β-induced epithelial-mesenchymal transition and epithelial stem-cell generation. J Biol
Chem. 2018;293(34):13059-13072.
21. Cha B, Park Y, Hwang BN, Kim SY, Jho EH. Protein Arginine Methyltransferase 1
Methylates Smurf2. Mol Cells. 2015;38(8):723-8.
22. Albrecht LV, Ploper D, Tejeda-Muñoz N, De Robertis EM. Arginine methylation is
required for canonical Wnt signaling and endolysosomal trafficking. Proc Natl Acad Sci
U S A. 2018;115(23):E5317-E5325.
23. Bikkavilli RK, Avasarala S, Vanscoyk M, Sechler M, Kelley N, Malbon CC, Winn RA.
Dishevelled3 is a novel arginine methyl transferase substrate. Sci Rep. 2012;2:805.
24. Bikkavilli RK, Malbon CC. Arginine methylation of G3BP1 in response to Wnt3a
regulates β-catenin mRNA. J Cell Sci. 2011;124(Pt 13):2310-20.
25. Wang H, Huang ZQ, Xia L, Feng Q, Erdjument-Bromage H, Strahl BD, Briggs SD, Allis
CD, Wong J, Tempst P, Zhang Y. Methylation of histone H4 at arginine 3 facilitating
transcriptional activation by nuclear hormone receptor. Science. 2001;293(5531):853-7.
26. Wesche J, Kühn S, Kessler BM, Salton M, Wolf A. Protein arginine methylation: a
prominent modification and its demethylation. Cell Mol Life Sci. 2017;74(18):3305-3315.
27. Pawlak MR, Scherer CA, Chen J, Roshon MJ, Ruley HE. Arginine N-methyltransferase 1
is required for early postimplantation mouse development, but cells deficient in the
enzyme are viable. Mol Cell Biol. 2000;20(13):4859-69.
169
28. Gou Y, Li J, Jackson-Weaver O, Wu J, Zhang T, Gupta R, Cho I, Ho TV, Chen Y, Li M,
Richard S, Wang J, Chai Y, Xu J. Protein Arginine Methyltransferase PRMT1 Is
Essential for Palatogenesis. J Dent Res. 2018;97(13):1510-1518.
29. Gou Y, Li J, Wu J, Gupta R, Cho I, Ho TV, Chai Y, Merrill A, Wang J, Xu J. Prmt1
regulates craniofacial bone formation upstream of Msx1. Mech Dev. 2018;152:13-20.
30. Pyun JH, Kim HJ, Jeong MH, Ahn BY, Vuong TA, Lee DI, Choi S, Koo SH, Cho H,
Kang JS. Cardiac specific PRMT1 ablation causes heart failure through CaMKII
dysregulation. Nat Commun. 2018;9(1):5107.
31. Jackson-Weaver O, Ungvijanpunya N, Yuan Y, Qian J, Gou Y, Wu J, Shen H, Chen Y,
Li M, Richard S, Chai Y, Sucov HM, Xu J. PRMT1-p53 Pathway Controls Epicardial
EMT and Invasion. Cell Rep. 2020;31(10):107739.
32. Murata K, Lu W, Hashimoto M, Ono N, Muratani M, Nishikata K, Kim JD, Ebihara S,
Ishida J, Fukamizu A. PRMT1 Deficiency in Mouse Juvenile Heart Induces Dilated
Cardiomyopathy and Reveals Cryptic Alternative Splicing Products. iScience.
2018;8:200-213.
33. Vadnais C, Chen R, Fraszczak J, Yu Z, Boulais J, Pinder J, Frank D, Khandanpour C,
Hébert J, Dellaire G, Côté JF, Richard S, Orthwein A, Drobetsky E, Möröy T. GFI1
facilitates efficient DNA repair by regulating PRMT1 dependent methylation of MRE11
and 53BP1. Nat Commun. 2018;9(1):1418.
34. Izumikawa K, Ishikawa H, Simpson RJ, Takahashi N. Modulating the expression of
Chtop, a versatile regulator of gene-specific transcription and mRNA export. RNA Biol.
2018;15(7):849-855.
35. Chang CT, Hautbergue GM, Walsh MJ, Viphakone N, van Dijk TB, Philipsen S, Wilson
SA. Chtop is a component of the dynamic TREX mRNA export complex. EMBO J.
2013;32(3):473-86.
170
36. Li X, Hu X, Patel B, Zhou Z, Liang S, Ybarra R, Qiu Y, Felsenfeld G, Bungert J, Huang
S. H4R3 methylation facilitates beta-globin transcription by regulating histone
acetyltransferase binding and H3 acetylation. Blood. 2010;115(10):2028-37.
37. Huang S, Litt M, Felsenfeld G. Methylation of histone H4 by arginine methyltransferase
PRMT1 is essential in vivo for many subsequent histone modifications. Genes Dev.
2005;19(16):1885-93.
38. Rezai-Zadeh N, Zhang X, Namour F, Fejer G, Wen YD, Yao YL, Gyory I, Wright K,
Seto E. Targeted recruitment of a histone H4-specific methyltransferase by the
transcription factor YY1. Genes Dev. 2003;17(8):1019-29.
39. Shibata Y, Okada M, Miller TC, Shi YB. Knocking out histone methyltransferase
PRMT1 leads to stalled tadpole development and lethality in Xenopus tropicalis. Biochim
Biophys Acta Gen Subj. 2020;1864(3):129482.
40. Yu Z, Chen T, Hébert J, Li E, Richard S. A mouse PRMT1 null allele defines an essential
role for arginine methylation in genome maintenance and cell proliferation. Mol Cell
Biol. 2009;29(11):2982-96.
41. Hua ZY, Hansen JN, He M, Dai SK, Choi Y, Fulton MD, Lloyd SM, Szemes M, Sen J,
Ding HF, Angelastro JM, Fei X, Li HP, Wu CR, Yang SY, Malik K, Bao X, George
Zheng Y, Liu CM, Schor NF, Li ZJ, Li XG. PRMT1 promotes neuroblastoma cell
survival through ATF5. Oncogenesis. 2020;9(5):50.
42. Liao HW, Hsu JM, Xia W, Wang HL, Wang YN, Chang WC, Arold ST, Chou CK, Tsou
PH, Yamaguchi H, Fang YF, Lee HJ, Lee HH, Tai SK, Yang MH, Morelli MP, Sen M,
Ladbury JE, Chen CH, Grandis JR, Kopetz S, Hung MC. PRMT1-mediated methylation
of the EGF receptor regulates signaling and cetuximab response. J Clin Invest.
2015;125(12):4529-43.
43. Yao B, Gui T, Zeng X, Deng Y, Wang Z, Wang Y, Yang D, Li Q, Xu P, Hu R, Li X,
Chen B, Wang J, Zen K, Li H, Davis MJ, Herold MJ, Pan HF, Jiang ZW, Huang DCS,
Liu M, Ju J, Zhao Q. PRMT1-mediated H4R3me2a recruits SMARCA4 to promote
171
colorectal cancer progression by enhancing EGFR signaling. Genome Med.
2021;13(1):58.
44. Plotnikov A, Kozer N, Cohen G, Carvalho S, Duberstein S, Almog O, Solmesky LJ,
Shurrush KA, Babaev I, Benjamin S, Gilad S, Kupervaser M, Levin Y, Gershovits M,
Ben-Avraham D, Barr HM. PRMT1 inhibition induces differentiation of colon cancer
cells. Sci Rep. 2020;10(1):20030.
45. Choucair A, Pham TH, Omarjee S, Jacquemetton J, Kassem L, Trédan O, Rambaud J,
Marangoni E, Corbo L, Treilleux I, Le Romancer M. The arginine methyltransferase
PRMT1 regulates IGF-1 signaling in breast cancer. Oncogene. 2019;38(21):4015-4027.
46. Jiang X, Rowitch DH, Soriano P, McMahon AP, Sucov HM. Fate of the mammalian
cardiac neural crest. Development. 2000;127(8):1607-16.
47. Yu Z, Chen T, Hébert J, Li E, Richard S. A mouse PRMT1 null allele defines an essential
role for arginine methylation in genome maintenance and cell proliferation. Mol Cell
Biol. 2009;29(11):2982-96.
48. Nguyen BH, Ishii M, Maxson RE, Wang J. Culturing and Manipulation of O9-1 Neural
Crest Cells. J Vis Exp. 2018;(140):58346.

Abstract (if available)

Linked assets

University of Southern California Dissertations and Theses

Conceptually similar

PDF

Proliferation and maturation events in second heart field cells during cardiovascular development activated by the Delta like ligand-4 mediated notch signaling

PDF

The roles of Tnni3k in heart regeneration, cardiac conduction system defects and cardiomyopathy

PDF

Elucidating the functional role of CHD7 associated nuclear PDH complex and other associated proteins on neural crest development

PDF

Retinoic acid and TGFβ signaling regulate cardiovascular development

PDF

The role of LGR5 in the pathogenesis of Ewing sarcoma: a marker of aggressive disease and a contributor to the malignant phenotype

Asset Metadata

Creator Toubat, Omar (author)

Core Title A novel role for post-migratory neural crest cells in cardiac outflow tract alignment: insights into the molecular basis of concomitant congenital cardiac and cleft malformations

School Keck School of Medicine

Degree Doctor of Philosophy

Degree Program Development, Stem Cells and Regenerative Medicine

Degree Conferral Date 2021-08

Publication Date 07/29/2021

Defense Date 05/03/2021

Publisher University of Southern California (original), University of Southern California. Libraries (digital)

Tag cleft palate,congenital heart disease,heart development,neural crest cells,OAI-PMH Harvest,second heart field cells

Format application/pdf (imt)

Language English

Contributor Electronically uploaded by the author (provenance)

Advisor Lien, Ching-Ling (committee chair), Hong, Young-Kwon (committee member), Subramanyan, Ram Kumar (committee member), Xu, Jian (committee member)

Creator Email otoubat@gmail.com,toubat@usc.edu

Permanent Link (DOI) https://doi.org/10.25549/usctheses-oUC15659703

Unique identifier UC15659703

Legacy Identifier etd-ToubatOmar-9928

Document Type Dissertation

Format application/pdf (imt)

Rights Toubat, Omar

Type texts

Source University of Southern California (contributing entity), University of Southern California Dissertations and Theses (collection)

Access Conditions The author retains rights to his/her dissertation, thesis or other graduate work according to U.S. copyright law. Electronic access is being provided by the USC Libraries in agreement with the author, as the original true and official version of the work, but does not grant the reader permission to use the work if the desired use is covered by copyright. It is the author, as rights holder, who must provide use permission if such use is covered by copyright. The original signature page accompanying the original submission of the work to the USC Libraries is retained by the USC Libraries and a copy of it may be obtained by authorized requesters contacting the repository e-mail address given.

Repository Name University of Southern California Digital Library

Repository Location USC Digital Library, University of Southern California, University Park Campus MC 2810, 3434 South Grand Avenue, 2nd Floor, Los Angeles, California 90089-2810, USA

Repository Email cisadmin@lib.usc.edu